Label free and reagentless electrochemical detection of micro rn-as using a conducting polymer nanostructured by carbon nanotubes- application to prostate cancer biomarker mir-141
This document describes a label-free and reagentless electrochemical biosensor for detecting microRNAs (miRNAs). The sensor uses a conducting polymer nanostructured with carbon nanotubes that is electroactive in neutral aqueous solutions. Addition of the target miRNA miR-141, a prostate cancer biomarker, causes a "signal-on" response by increasing the current through the polymer. Non-complementary miRNAs do not change the current. The sensor achieves very low detection of about 8 femtomolar (fM) of miR-141. The conducting polymer-carbon nanotube composite provides a reagentless platform for immobilizing and detecting miRNA sequences with high sensitivity and specificity.
A seminar report on the chemical frontiers of living matter seminar series - ...Glen Carter
This seminar report highlights a select few presentations of cutting-edge research being done in various labs across the Paris Science et Lettre (PSL) network.
Porous Covalent Triazine Polymer as a Potential Nanocargo for Cancer Therapy ...Arun kumar
A microporous covalent triazine polymer (CTP) network with a high surface area was synthesized via the Friedel-Crafts reaction for anticancer drug delivery and controlled release. The CTP is transformed to the nanoscale region by intense ultasonication followed by filtration to yield nanoscale CTP (NCTP) with excellent dispersibility in physiological solution while maintaining its chemical structure and the porosity of the material. An anti-cancer drug, doxorubicin (DOX), is loaded onto the NCTP through simple physisorption by hydrophobic and π–π interactions, and its release can be controlled at acidic and neutral pH. The NCTP did not show practical toxicity to cancer and normal cells, but the NCTP-DOX complex showed high efficacy at killing both types of cells in-vitro. The prolonged drug release (over 50h) from the NCTP-DOX at neutral and acidic pH values was demonstrated. The in-vitro cell imaging results indicate that NCTP has good potential for bio-imaging. The cellular senescence and potency of NCTP was confirmed by the expression of senescence associated marker proteins p53 and p21. These results suggest that NCTP can be used as a new platform for imaging and drug delivery, which may find potential applications in diagnosis and therapy.
This document reviews the use of quantum dots for bioimaging applications. It discusses:
1) The synthesis of quantum dots, particularly CdSe/ZnS core/shell structures, and methods to tune their optical properties.
2) Modification of quantum dot surfaces with ligands to make them water soluble and biocompatible while maintaining fluorescence. Common surface modifications include adding carboxylic acids, silica shells, and encapsulation in micelles.
3) Applications of quantum dots in biology, including labeling of proteins and targeting of specific cell surface receptors due to their photostability and ability to detect multiple signals simultaneously.
The document discusses the use of quantum dots (QDs) for biomedical applications such as bioimaging and therapy. It provides an overview of the photophysical properties of QDs that make them advantageous over organic dyes for imaging. Various biomedical applications of QDs are described, including in vitro and in vivo imaging, biosensing, photodynamic therapy, drug delivery, and gene delivery. Finally, the document outlines a research proposal to develop MoS2@polyaniline nanohybrids for dual-model imaging and synergistic photothermal/radiation therapy of tumors.
Application of nanomaterials in lifescienceArun kumar
The document discusses the application of nanomaterials in life sciences. It begins with an introduction to nanomaterials, their properties, synthesis, and classification. It then discusses two key applications: drug delivery and biosensors. For drug delivery, it provides examples of using metal-organic frameworks for controlled drug release. For biosensors, it details the development of a graphene-nickel oxide nanocomposite for cholesterol detection with high sensitivity and selectivity. In conclusion, the document outlines the potential of nanotechnology to advance areas like targeted drug delivery and disease diagnostics.
Design and development of nanomaterials for biomolecular detection and cancer...Arun kumar
This document discusses the design and development of nanomaterials for biomolecular detection and cancer therapy. It describes using graphene-protamine conjugates for sensing heparin and graphene/NiO composites for cholesterol sensing. For cancer therapy, it outlines using NMOF/PEG conjugates for drug delivery and ROS therapy, NCTP conjugates for drug delivery and cancer senescence, and PAMAM/5-FU conjugates for targeting oncoproteins. The document examines nanomaterials for improved biomolecular detection and drug delivery for cancer treatment.
Current and future techniques for cancer diagnosisNitin Talreja
This document discusses various nanotechnology approaches for cancer diagnosis, including the use of gold nanoparticles, quantum dots, carbon nanotubes, and nanoflares. Gold nanoparticles can be used for detection through techniques like dynamic light scattering and surface plasmon coupling. Quantum dots and carbon nanotubes can also be functionalized for ultrasensitive detection of cancer biomarkers. Emerging tools like nanoflares allow for detection of genetic targets associated with cancer within living cells. Overall, nanotechnology enables low detection limits and early cancer diagnosis.
A seminar report on the chemical frontiers of living matter seminar series - ...Glen Carter
This seminar report highlights a select few presentations of cutting-edge research being done in various labs across the Paris Science et Lettre (PSL) network.
Porous Covalent Triazine Polymer as a Potential Nanocargo for Cancer Therapy ...Arun kumar
A microporous covalent triazine polymer (CTP) network with a high surface area was synthesized via the Friedel-Crafts reaction for anticancer drug delivery and controlled release. The CTP is transformed to the nanoscale region by intense ultasonication followed by filtration to yield nanoscale CTP (NCTP) with excellent dispersibility in physiological solution while maintaining its chemical structure and the porosity of the material. An anti-cancer drug, doxorubicin (DOX), is loaded onto the NCTP through simple physisorption by hydrophobic and π–π interactions, and its release can be controlled at acidic and neutral pH. The NCTP did not show practical toxicity to cancer and normal cells, but the NCTP-DOX complex showed high efficacy at killing both types of cells in-vitro. The prolonged drug release (over 50h) from the NCTP-DOX at neutral and acidic pH values was demonstrated. The in-vitro cell imaging results indicate that NCTP has good potential for bio-imaging. The cellular senescence and potency of NCTP was confirmed by the expression of senescence associated marker proteins p53 and p21. These results suggest that NCTP can be used as a new platform for imaging and drug delivery, which may find potential applications in diagnosis and therapy.
This document reviews the use of quantum dots for bioimaging applications. It discusses:
1) The synthesis of quantum dots, particularly CdSe/ZnS core/shell structures, and methods to tune their optical properties.
2) Modification of quantum dot surfaces with ligands to make them water soluble and biocompatible while maintaining fluorescence. Common surface modifications include adding carboxylic acids, silica shells, and encapsulation in micelles.
3) Applications of quantum dots in biology, including labeling of proteins and targeting of specific cell surface receptors due to their photostability and ability to detect multiple signals simultaneously.
The document discusses the use of quantum dots (QDs) for biomedical applications such as bioimaging and therapy. It provides an overview of the photophysical properties of QDs that make them advantageous over organic dyes for imaging. Various biomedical applications of QDs are described, including in vitro and in vivo imaging, biosensing, photodynamic therapy, drug delivery, and gene delivery. Finally, the document outlines a research proposal to develop MoS2@polyaniline nanohybrids for dual-model imaging and synergistic photothermal/radiation therapy of tumors.
Application of nanomaterials in lifescienceArun kumar
The document discusses the application of nanomaterials in life sciences. It begins with an introduction to nanomaterials, their properties, synthesis, and classification. It then discusses two key applications: drug delivery and biosensors. For drug delivery, it provides examples of using metal-organic frameworks for controlled drug release. For biosensors, it details the development of a graphene-nickel oxide nanocomposite for cholesterol detection with high sensitivity and selectivity. In conclusion, the document outlines the potential of nanotechnology to advance areas like targeted drug delivery and disease diagnostics.
Design and development of nanomaterials for biomolecular detection and cancer...Arun kumar
This document discusses the design and development of nanomaterials for biomolecular detection and cancer therapy. It describes using graphene-protamine conjugates for sensing heparin and graphene/NiO composites for cholesterol sensing. For cancer therapy, it outlines using NMOF/PEG conjugates for drug delivery and ROS therapy, NCTP conjugates for drug delivery and cancer senescence, and PAMAM/5-FU conjugates for targeting oncoproteins. The document examines nanomaterials for improved biomolecular detection and drug delivery for cancer treatment.
Current and future techniques for cancer diagnosisNitin Talreja
This document discusses various nanotechnology approaches for cancer diagnosis, including the use of gold nanoparticles, quantum dots, carbon nanotubes, and nanoflares. Gold nanoparticles can be used for detection through techniques like dynamic light scattering and surface plasmon coupling. Quantum dots and carbon nanotubes can also be functionalized for ultrasensitive detection of cancer biomarkers. Emerging tools like nanoflares allow for detection of genetic targets associated with cancer within living cells. Overall, nanotechnology enables low detection limits and early cancer diagnosis.
Quantum dots and application in medical sciencekeyhan *
applications of quantum dots in medicine
Pharmacy and pharmacology
Bioimaiging (in vitro labelling , in vivo imaging)
Tumor & cancer target
Pathogen and toxin detection
Photothermal therapy (PTT)
photodynamic therapy (PDT)
Targeted surgery
Immunoassay
DNA analysis
biological monitoring
drug discovery
Universal and rapid salt extraction of high quality genomic dna for pcr-based...CAS0609
This document describes a simple and universal method for extracting high-quality genomic DNA from a variety of organisms including plants, fungi, insects, and shrimp. The method uses a salt-based homogenizing buffer and SDS to extract DNA from as little as 50mg of fresh tissue. The extracted DNA is of sufficient quality and quantity to be used in PCR, restriction digestion, and other molecular techniques. The method is fast, inexpensive, and does not require expensive equipment, making it suitable for laboratories with limited resources. Test results demonstrated the method successfully extracted high molecular weight DNA from many diverse organisms without modification, indicating its universal applicability.
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...Thermo Fisher Scientific
The introduction of defined Ion AmpliSeq™ panels for detection and characterization of actionable mutations occurring in tumor tissue has the potential to revolutionize translational oncology research. The Ion Ampliseq™ cancer hot spot panel version 2 (CHP v2) by Ion Torrent includes 207 actionable sequences from a single target and mutation targets present in 50 genes and the more comprehensive Ion Oncomine™ cancer panel (OCP) developed by Life Technologies Compendia Bioscience™ contains over 2000 mutations. A hallmark of these Ion Torrent Ampliseq cancer panels is the low amount of input DNA needed which is critical when the clinical specimen material is limited such as with fine needle biopsy or FFPE samples. Typically, 10 ng of DNA obtained from these sources is sufficient to produce informative sequencing data. Often, cancer-causing or promoting mutations are detected at relatively low allele frequencies like 10-20 % compared to the major normal allele. Many researchers wish to verify these findings of low frequency mutations by an orthologous method such as traditional dye-fluorescent Sanger sequencing on a capillary electrophoresis (CE) instrument such as the Applied Biosystems 3500 genetic analyzer. To that end, we have developed a workflow that enables the amplification and traditional Sanger sequencing of individual Ion AmpliSeq targets directly from the AmpliSeq library starting material.
The method requires a retainer of 1 μl (~ 5%) of the original AmpliSeq preamplification material. A dilution of this aliquot is used as template source for individualized PCR/sequencing reactions. We show that a random selection of 48 targets from the CHPv2 panel could be successfully amplified and Sanger-sequenced from an Ion Torrent Ampliseq library originally prepared from 10 ng of FFPE
DNA. Furthermore, we show the successful Sanger-re-sequencing of all individual 24 targets covering the TP53 exons from the same sample processed and pre-amplified with the OncoMine AmpliSeq panel.
Taken together, this method will enable researchers to reflex-test potential mutations of interest from very material-limited specimen using Sanger CE sequencing
The document provides the final program for the International Symposium on Technetium and Other Radiometals in Chemistry and Medicine (TERACHEM-2010) held in Bressanone, Italy from September 8-11, 2010. The symposium included sessions on the chemistry of technetium and other metals, other radiometals in radiodiagnosis and radiotherapy, and radiopharmaceuticals labeled with technetium-99m and other radiometals. It featured invited lectures, oral presentations, and poster presentations covering topics such as new radiolabeled complexes, metal coordination chemistry, stability of metal complexes in vivo, and applications of various radiometals including technetium
This study evaluated the effectiveness of a 3-carboranyl thymidine analogue (3CTA), designated N5–2OH, as a boron delivery agent for boron neutron capture therapy (BNCT) of brain tumors. Target validation studies using wild-type and mutant thymidine kinase 1 (TK1) L929 cell lines implanted in mice found higher boron levels and tumor cell kill in TK1-expressing tumors after BNCT with N5–2OH. Subsequent studies in rats with intracerebral RG2 gliomas found significantly increased survival times when tumors were treated with either N5–2OH alone or combined with boronophenylalanine compared to boronophenyl
Sima Lev: MEETING OF THE BIOCHEMICAL SOCIETYSima Lev
The Biochemical Society had a great meeting on the 21-24 of October in Turin, Italy.
The subject of the meeting this year was:
Cell Signaling and Intracellular Trafficking in Cancer Biology: Interplay, Targeting, and Therapy.
Treating cancer effectively requires an understanding of the molecular alterations driving each patient’s tumor. Targeted sequencing efforts that characterize prevalent somatic alterations and require limited sample input may provide an effective diagnostic approach. Herein, we describe the design and characterization of the Oncomine™ Cancer Research Panel (OCP) that includes recurrent somatic alterations in solid tumors derived from the Oncomine™ cancer database. Using Ion AmpliSeq™ technology, we designed a DNA panel that includes assays for 73 oncogenes with 1,826 recurrent hotspot mutations, 26 tumor suppressor genes enriched for deleterious mutations, as well as 75 genes subject to recurrent focal copy gain or loss. A complementary RNA panel includes 183 assays for relevant gene fusions involving 22 fusion driver genes. Recommended sample inputs were 10 ng of nucleic acid per pool. Sequencing libraries were analyzed on an Ion Torrent™ Personal Genome Machine™. Initial testing revealed an average read depth of > 1,500X with > 95% uniformity and on target frequency. The panel was shown to reliably detect known hotspots, insertions/deletions, gene copy changes, and gene fusions in molecular standards, cell lines and formalin-fixed paraffin embedded samples. Retrospective analysis of large sample cohorts has been completed and the results of analysis of 100 lung cancer and 100 prostate cancer cases will be summarized. In addition, a prospective cohort of 100 samples from the University of Michigan Molecular Diagnostics laboratory was profiled with OCP. Overall, we achieved >95% sensitivity and specificity for detection of KRAS, EGFR and BRAF mutations and ALK gene fusions.
This document describes a study that used PCR and DNA sequencing to identify four fungal species - Aspergillus flavus, A. fumigatus, Alternaria alternata, and A. terreus - found in vermicompost produced from floral waste. Genomic DNA was isolated from fungal mycelium and the internal transcribed spacer region of ribosomal DNA was amplified by PCR using universal primers. The PCR products were sequenced and compared to identify the fungal species based on their ITS sequences. The molecular identification method was able to reliably distinguish between the four fungal species and provides insights into the role of microbes in the vermicomposting process.
Reproductive toxicity induced by nanoparticlesANJUNITHIKURUP
This document summarizes research on the potential impacts of nanoparticles on the reproductive system. It discusses various routes of nanoparticle exposure and the possibility that nanoparticles may translocate to the placenta and fetus. Animal studies show nanoparticles can cross the placental barrier and induce trophoblast apoptosis. The document also outlines gaps in understanding the developmental and reproductive toxicity of nanoparticles and calls for further research using guidelines for reproductive and developmental toxicity studies.
124I & 89Zr Radiopharmaceuticals as an Alternative to F-18 Tracers – a Compar...Soppata
This document discusses molecular imaging techniques using positron emission tomography (PET). It describes several radionuclides used for PET imaging, including fluorine-18, iodine-124, and zirconium-89. Iodine-124 has a longer half-life of 4.2 days, making it suitable for long-term PET studies compared to other radionuclides like fluorine-18 with a half-life of 109.8 minutes. The document also discusses labeling monoclonal antibodies with iodine-124 and zirconium-89 for immuno-PET imaging to study molecular and cellular processes in vivo.
Global run-on sequencing (GRO-Seq) is a method to map the binding sites of transcriptionally active RNA polymerase II. It involves allowing RNA polymerase II to actively transcribe in the presence of labeled nucleotides, followed by purification and sequencing of the newly synthesized RNA. This provides sequences of RNAs that are currently being transcribed, without prior knowledge of transcription sites. While it directly determines relative transcriptional activity, GRO-Seq is limited to cell cultures and may introduce artifacts during nuclear preparation or transcription run-on.
Single strand conformation polymorphism (SSCP) is a technique that detects differences in the secondary structure of single-stranded DNA fragments caused by variations in their nucleotide sequence. SSCP analysis involves digesting DNA, separating the strands, running electrophoresis on a gel, and comparing the mobility of single strands - strands with different sequences will have different conformations and mobilities. SSCP is useful for detecting genetic variations and mutations, and has applications in genotyping, viral strain identification, and medical diagnosis.
Toxicogenomics uses gene expression profiling to study how organisms respond to toxic compounds on a global scale. This new approach promises to greatly advance toxicology research. It may help identify toxic mechanisms earlier and assist in predicting compound toxicity. Challenges include interpreting large gene expression datasets and linking changes to specific toxic effects. Progress has been made using toxicogenomics to predict compound mode of action and toxicity pathways. Integrating gene expression data with traditional toxicology can help realize the full potential of this new approach.
This document discusses potential applications of carbon nanotubes in nanomedicine. Carbon nanotubes have desirable properties such as a high aspect ratio and strong photoluminescence. They can be functionalized through various methods like covalent and non-covalent bonding. Functionalized carbon nanotubes show promise for applications such as drug delivery, gene delivery, cancer treatment, neural interaction, and medical imaging. Further research is still needed to improve carbon nanotube biocompatibility and targeting for safe use in nanomedicine.
This document provides an agenda for a lecture on copy number variations (CNV) and their role in cancer development and pharmacogenetics. It begins with an introduction to CNVs, including definitions and mechanisms for their creation. It then discusses how CNVs can contribute to disease susceptibility and notes their role in directly influencing cancer cell genomes. The document outlines how common and rare CNVs may serve as "first hits" to the tumor genome or influence cancer risk. It provides some examples of specific cancers associated with CNVs and discusses how pharmacogenetics focuses on CNV effects in cancer treatment for drugs like tamoxifen and irinotecan. The document concludes by noting the promising potential for further discovery regarding C
Microarray analysis allows scientists to determine which genes are active or inactive in a cell. It involves isolating genetic material from a cell and identifying which genes have messenger RNA present, indicating they are turned on. DNA microarrays contain thousands of unique DNA sequences spotted onto a solid surface that fluorescently-labeled genetic material from a sample can bind to. This allows scientists to measure gene expression levels across the entire genome simultaneously and understand molecular mechanisms of toxicity. Protein microarrays similarly contain arrays of capture proteins that can be used to analyze protein-protein interactions and activities on a large scale.
This document summarizes recent research on peanut allergy. It discusses the rising prevalence of peanut allergy in western countries. It also examines factors that may be associated with the development of peanut allergy such as delayed introduction of peanuts in infancy, maternal diet during pregnancy/lactation, and environmental peanut exposure. The document also reviews research on diagnosing peanut allergy and the natural history of peanut allergy. It briefly discusses a new immunotherapy treatment approach called oral immunotherapy.
This document discusses various materials and therapies for peripheral nerve regeneration. It covers guidance therapies using nerve conduits made from natural and synthetic biomaterials. Biomolecular therapies involve delivering growth factors to promote regeneration. Cellular therapies utilize Schwann cells, stem cells, and genetically modified cells. Advanced techniques include nerve conduits fabricated using 3D printing, injection molding and aligned polymer fibers. Future areas of focus are multi-chamber conduits and stem cell therapies to further enhance regeneration.
This document discusses the development of artificial vision systems to cure blindness. It describes how artificial silicon retinas work to restore some vision by bypassing damaged retinal cells. The artificial silicon retina is a tiny microchip implanted in the eye that contains solar cells to convert light into electrical pulses, similar to the function of retinal rods and cones. It receives power from light entering the eye without needing external batteries or wires. Researchers are also developing other implantable microchips like the artificial retina component chip to restore partial vision for the blind.
Quantum dots and application in medical sciencekeyhan *
applications of quantum dots in medicine
Pharmacy and pharmacology
Bioimaiging (in vitro labelling , in vivo imaging)
Tumor & cancer target
Pathogen and toxin detection
Photothermal therapy (PTT)
photodynamic therapy (PDT)
Targeted surgery
Immunoassay
DNA analysis
biological monitoring
drug discovery
Universal and rapid salt extraction of high quality genomic dna for pcr-based...CAS0609
This document describes a simple and universal method for extracting high-quality genomic DNA from a variety of organisms including plants, fungi, insects, and shrimp. The method uses a salt-based homogenizing buffer and SDS to extract DNA from as little as 50mg of fresh tissue. The extracted DNA is of sufficient quality and quantity to be used in PCR, restriction digestion, and other molecular techniques. The method is fast, inexpensive, and does not require expensive equipment, making it suitable for laboratories with limited resources. Test results demonstrated the method successfully extracted high molecular weight DNA from many diverse organisms without modification, indicating its universal applicability.
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...Thermo Fisher Scientific
The introduction of defined Ion AmpliSeq™ panels for detection and characterization of actionable mutations occurring in tumor tissue has the potential to revolutionize translational oncology research. The Ion Ampliseq™ cancer hot spot panel version 2 (CHP v2) by Ion Torrent includes 207 actionable sequences from a single target and mutation targets present in 50 genes and the more comprehensive Ion Oncomine™ cancer panel (OCP) developed by Life Technologies Compendia Bioscience™ contains over 2000 mutations. A hallmark of these Ion Torrent Ampliseq cancer panels is the low amount of input DNA needed which is critical when the clinical specimen material is limited such as with fine needle biopsy or FFPE samples. Typically, 10 ng of DNA obtained from these sources is sufficient to produce informative sequencing data. Often, cancer-causing or promoting mutations are detected at relatively low allele frequencies like 10-20 % compared to the major normal allele. Many researchers wish to verify these findings of low frequency mutations by an orthologous method such as traditional dye-fluorescent Sanger sequencing on a capillary electrophoresis (CE) instrument such as the Applied Biosystems 3500 genetic analyzer. To that end, we have developed a workflow that enables the amplification and traditional Sanger sequencing of individual Ion AmpliSeq targets directly from the AmpliSeq library starting material.
The method requires a retainer of 1 μl (~ 5%) of the original AmpliSeq preamplification material. A dilution of this aliquot is used as template source for individualized PCR/sequencing reactions. We show that a random selection of 48 targets from the CHPv2 panel could be successfully amplified and Sanger-sequenced from an Ion Torrent Ampliseq library originally prepared from 10 ng of FFPE
DNA. Furthermore, we show the successful Sanger-re-sequencing of all individual 24 targets covering the TP53 exons from the same sample processed and pre-amplified with the OncoMine AmpliSeq panel.
Taken together, this method will enable researchers to reflex-test potential mutations of interest from very material-limited specimen using Sanger CE sequencing
The document provides the final program for the International Symposium on Technetium and Other Radiometals in Chemistry and Medicine (TERACHEM-2010) held in Bressanone, Italy from September 8-11, 2010. The symposium included sessions on the chemistry of technetium and other metals, other radiometals in radiodiagnosis and radiotherapy, and radiopharmaceuticals labeled with technetium-99m and other radiometals. It featured invited lectures, oral presentations, and poster presentations covering topics such as new radiolabeled complexes, metal coordination chemistry, stability of metal complexes in vivo, and applications of various radiometals including technetium
This study evaluated the effectiveness of a 3-carboranyl thymidine analogue (3CTA), designated N5–2OH, as a boron delivery agent for boron neutron capture therapy (BNCT) of brain tumors. Target validation studies using wild-type and mutant thymidine kinase 1 (TK1) L929 cell lines implanted in mice found higher boron levels and tumor cell kill in TK1-expressing tumors after BNCT with N5–2OH. Subsequent studies in rats with intracerebral RG2 gliomas found significantly increased survival times when tumors were treated with either N5–2OH alone or combined with boronophenylalanine compared to boronophenyl
Sima Lev: MEETING OF THE BIOCHEMICAL SOCIETYSima Lev
The Biochemical Society had a great meeting on the 21-24 of October in Turin, Italy.
The subject of the meeting this year was:
Cell Signaling and Intracellular Trafficking in Cancer Biology: Interplay, Targeting, and Therapy.
Treating cancer effectively requires an understanding of the molecular alterations driving each patient’s tumor. Targeted sequencing efforts that characterize prevalent somatic alterations and require limited sample input may provide an effective diagnostic approach. Herein, we describe the design and characterization of the Oncomine™ Cancer Research Panel (OCP) that includes recurrent somatic alterations in solid tumors derived from the Oncomine™ cancer database. Using Ion AmpliSeq™ technology, we designed a DNA panel that includes assays for 73 oncogenes with 1,826 recurrent hotspot mutations, 26 tumor suppressor genes enriched for deleterious mutations, as well as 75 genes subject to recurrent focal copy gain or loss. A complementary RNA panel includes 183 assays for relevant gene fusions involving 22 fusion driver genes. Recommended sample inputs were 10 ng of nucleic acid per pool. Sequencing libraries were analyzed on an Ion Torrent™ Personal Genome Machine™. Initial testing revealed an average read depth of > 1,500X with > 95% uniformity and on target frequency. The panel was shown to reliably detect known hotspots, insertions/deletions, gene copy changes, and gene fusions in molecular standards, cell lines and formalin-fixed paraffin embedded samples. Retrospective analysis of large sample cohorts has been completed and the results of analysis of 100 lung cancer and 100 prostate cancer cases will be summarized. In addition, a prospective cohort of 100 samples from the University of Michigan Molecular Diagnostics laboratory was profiled with OCP. Overall, we achieved >95% sensitivity and specificity for detection of KRAS, EGFR and BRAF mutations and ALK gene fusions.
This document describes a study that used PCR and DNA sequencing to identify four fungal species - Aspergillus flavus, A. fumigatus, Alternaria alternata, and A. terreus - found in vermicompost produced from floral waste. Genomic DNA was isolated from fungal mycelium and the internal transcribed spacer region of ribosomal DNA was amplified by PCR using universal primers. The PCR products were sequenced and compared to identify the fungal species based on their ITS sequences. The molecular identification method was able to reliably distinguish between the four fungal species and provides insights into the role of microbes in the vermicomposting process.
Reproductive toxicity induced by nanoparticlesANJUNITHIKURUP
This document summarizes research on the potential impacts of nanoparticles on the reproductive system. It discusses various routes of nanoparticle exposure and the possibility that nanoparticles may translocate to the placenta and fetus. Animal studies show nanoparticles can cross the placental barrier and induce trophoblast apoptosis. The document also outlines gaps in understanding the developmental and reproductive toxicity of nanoparticles and calls for further research using guidelines for reproductive and developmental toxicity studies.
124I & 89Zr Radiopharmaceuticals as an Alternative to F-18 Tracers – a Compar...Soppata
This document discusses molecular imaging techniques using positron emission tomography (PET). It describes several radionuclides used for PET imaging, including fluorine-18, iodine-124, and zirconium-89. Iodine-124 has a longer half-life of 4.2 days, making it suitable for long-term PET studies compared to other radionuclides like fluorine-18 with a half-life of 109.8 minutes. The document also discusses labeling monoclonal antibodies with iodine-124 and zirconium-89 for immuno-PET imaging to study molecular and cellular processes in vivo.
Global run-on sequencing (GRO-Seq) is a method to map the binding sites of transcriptionally active RNA polymerase II. It involves allowing RNA polymerase II to actively transcribe in the presence of labeled nucleotides, followed by purification and sequencing of the newly synthesized RNA. This provides sequences of RNAs that are currently being transcribed, without prior knowledge of transcription sites. While it directly determines relative transcriptional activity, GRO-Seq is limited to cell cultures and may introduce artifacts during nuclear preparation or transcription run-on.
Single strand conformation polymorphism (SSCP) is a technique that detects differences in the secondary structure of single-stranded DNA fragments caused by variations in their nucleotide sequence. SSCP analysis involves digesting DNA, separating the strands, running electrophoresis on a gel, and comparing the mobility of single strands - strands with different sequences will have different conformations and mobilities. SSCP is useful for detecting genetic variations and mutations, and has applications in genotyping, viral strain identification, and medical diagnosis.
Toxicogenomics uses gene expression profiling to study how organisms respond to toxic compounds on a global scale. This new approach promises to greatly advance toxicology research. It may help identify toxic mechanisms earlier and assist in predicting compound toxicity. Challenges include interpreting large gene expression datasets and linking changes to specific toxic effects. Progress has been made using toxicogenomics to predict compound mode of action and toxicity pathways. Integrating gene expression data with traditional toxicology can help realize the full potential of this new approach.
This document discusses potential applications of carbon nanotubes in nanomedicine. Carbon nanotubes have desirable properties such as a high aspect ratio and strong photoluminescence. They can be functionalized through various methods like covalent and non-covalent bonding. Functionalized carbon nanotubes show promise for applications such as drug delivery, gene delivery, cancer treatment, neural interaction, and medical imaging. Further research is still needed to improve carbon nanotube biocompatibility and targeting for safe use in nanomedicine.
This document provides an agenda for a lecture on copy number variations (CNV) and their role in cancer development and pharmacogenetics. It begins with an introduction to CNVs, including definitions and mechanisms for their creation. It then discusses how CNVs can contribute to disease susceptibility and notes their role in directly influencing cancer cell genomes. The document outlines how common and rare CNVs may serve as "first hits" to the tumor genome or influence cancer risk. It provides some examples of specific cancers associated with CNVs and discusses how pharmacogenetics focuses on CNV effects in cancer treatment for drugs like tamoxifen and irinotecan. The document concludes by noting the promising potential for further discovery regarding C
Microarray analysis allows scientists to determine which genes are active or inactive in a cell. It involves isolating genetic material from a cell and identifying which genes have messenger RNA present, indicating they are turned on. DNA microarrays contain thousands of unique DNA sequences spotted onto a solid surface that fluorescently-labeled genetic material from a sample can bind to. This allows scientists to measure gene expression levels across the entire genome simultaneously and understand molecular mechanisms of toxicity. Protein microarrays similarly contain arrays of capture proteins that can be used to analyze protein-protein interactions and activities on a large scale.
This document summarizes recent research on peanut allergy. It discusses the rising prevalence of peanut allergy in western countries. It also examines factors that may be associated with the development of peanut allergy such as delayed introduction of peanuts in infancy, maternal diet during pregnancy/lactation, and environmental peanut exposure. The document also reviews research on diagnosing peanut allergy and the natural history of peanut allergy. It briefly discusses a new immunotherapy treatment approach called oral immunotherapy.
This document discusses various materials and therapies for peripheral nerve regeneration. It covers guidance therapies using nerve conduits made from natural and synthetic biomaterials. Biomolecular therapies involve delivering growth factors to promote regeneration. Cellular therapies utilize Schwann cells, stem cells, and genetically modified cells. Advanced techniques include nerve conduits fabricated using 3D printing, injection molding and aligned polymer fibers. Future areas of focus are multi-chamber conduits and stem cell therapies to further enhance regeneration.
This document discusses the development of artificial vision systems to cure blindness. It describes how artificial silicon retinas work to restore some vision by bypassing damaged retinal cells. The artificial silicon retina is a tiny microchip implanted in the eye that contains solar cells to convert light into electrical pulses, similar to the function of retinal rods and cones. It receives power from light entering the eye without needing external batteries or wires. Researchers are also developing other implantable microchips like the artificial retina component chip to restore partial vision for the blind.
They are not tattoos.they don't contain any ink nor involve piercing through skin.they can stick to the skin as band aid and consists of sensors.in addition to sensors wireless networking capability provided with which contrlolling can be done from remote computer or smartphone.
The document describes the Tongue Drive System (TDS), an assistive technology that allows people with severe disabilities to control their environment using only their tongue. [1] TDS uses a small magnet pierced on the tongue and magnetic sensors to detect tongue movements and send wireless signals to control devices like powered wheelchairs. [2] It provides an alternative to existing assistive technologies that have limitations. The document outlines the components, working, advantages and limitations of the TDS.
This document summarizes an artificial retina system (ARS) that aims to restore vision to blind individuals. It discusses the history of ARS development led by Dr. Mark Humayun beginning in 2002. The first ARS model, Argus I, contained 16 electrodes and allowed patients to distinguish light and dark and locate objects. Later models like Argus II contained more electrodes and were smaller and less invasive. The ARS works by implanting a chip containing electrodes that stimulate the retina. Technological challenges remain around biocompatibility, resolution, and cost, but advances are being made to improve the design. The overall goal is for ARS to help millions of blind individuals see well enough to navigate, read, and recognize faces
This document discusses electronic skin (e-skin), which aims to mimic human skin. It provides a brief history of e-skin development from 2010-2013. E-skin features are described, including its ability to sense pressure, temperature, and stretch. The document explains how e-skin achieves a visual response through the use of OLED and AMOLED displays. Pixels contain nanotube thin film transistors, pressure sensors, and OLED arrays. Applications include use in robotics, health monitoring, and smart wallpapers. Future improvements could allow e-skin to monitor vital signs and control devices.
Electronic skin is a material that mimics human skin and can measure vital signs like heart rate and brain waves. It is made of flexible silicon sensors laminated onto skin like a temporary tattoo. The sensors form a spider web-like circuit that detects pressure, temperature and other bodily functions and transmits the signals to monitoring devices. Electronic skin has applications in healthcare for wound monitoring and in robotics for making machines more human-like. While promising, challenges remain in reducing the cost and enabling reuse of electronic skin technologies.
What is sensitive skin?
It is a large area flexible array of sensors, with data processing capabilities, with the ability to sense the surroundings.
It make possible the use of unsupervised machine in our midst.
Machines in unstructured environments
Societal needs and concerns
a) Health industry
b) Eco friendly
c) Difficulties of acceptance
Electronic' skin monitors heart, brain functioncmr cet
The document discusses electronic skin, a new ultra-thin electronic device that can attach to the skin like a temporary tattoo. It can measure vital signs like electrical heart activity and brain waves. Researchers developed it to reduce wires and make medical monitoring more compact. Electronic skin uses tiny sensors and a "spider web" circuitry design made of silicon filaments. It transmits the recorded body signals to a receiver. Researchers believe it could one day control virtual screens to monitor health and even stimulate skin for smart bandages.
Similar to Label free and reagentless electrochemical detection of micro rn-as using a conducting polymer nanostructured by carbon nanotubes- application to prostate cancer biomarker mir-141
3 Rapid and selective detection of dopamine in human serum using an.pdfVictorHugo214270
This document describes the development of an electrochemical sensor for the detection of dopamine (DA) using a composite material based on carbon nanotubes (CNT), zinc oxide nanoparticles (ZnONPs), and nickel phthalocyanine (NiTsPc) immobilized on a pyrolytic graphite electrode (PGE). Characterization of the PGE/NiTsPc-ZnONPs-CNT electrode showed well-defined redox behavior of the composite materials. Differential pulse voltammetry and chronoamperometry were used to detect DA, achieving detection limits of 7.0 nM and 24 nM, respectively. Interferents like ascorbic acid, uric acid, and serotonin did not significantly affect
Leveraging nanotechnology and biology for medical diagnostics. Including novel techniques such as immuno-PCR and using phages as reporters, as well as using Izon's qNano to detect DNA hybridization and potential uses in point-of-care applications.
biotechnology of aminophenol PhD defenseppt.pptmisgana18
This document outlines the development of an electrochemical sensor using reduced graphene oxide for the detection of acetaminophen. Graphene oxide was deposited on a glassy carbon electrode through electrochemical reduction. The sensor showed good sensitivity and selectivity for acetaminophen detection with a low limit of detection of 2.013 nM. Real drug samples and human blood serum were analyzed with recoveries ranging from 96-103%, demonstrating the potential of this sensor for pharmaceutical and clinical analysis of acetaminophen.
This paper presents a microfluidic approach for analyzing exosomal RNA from pancreatic cancer cell lines. It uses surface acoustic waves on a microchip to lyse exosomes and releases RNA. It then detects target miRNA using an ion-exchange nanomembrane sensor on a separate microchip. The approach reduces total analysis time to about 1.5 hours compared to over 13 hours for conventional methods. It also requires a smaller sample volume of about 100 microliters compared to milliliters typically needed. The microfluidic method lysed 38% of exosomes and the nanomembrane sensor detected a target miRNA with a limit of 2 picomolar concentration and linear range over two decades. This integrated microfluidic platform shows
The Karolinska Institute (KI) is the largest centre for medical education and research in Sweden and the home of the Nobel Prize in Physiology or Medicine.
KI consists of 22 departments and 600 research groups dedicated to improving human health through research and higher education.
The role of the Kohonen/Grafström team has been to guide the application, analysis, interpretation and storage of so called “omics” technology-derived data within the service-oriented subproject “ToxBank”.
The document discusses several applications of biosensors and nanomaterials in biosensors. It describes how researchers at the Institute of Bioengineering and Nanotechnology developed a simple method to organize cells and their microenvironments in hydrogel fibers, providing a template for assembling complex tissues. It also discusses how researchers at NYU-Poly used a nano-enhanced biosensor to detect a single cancer marker protein smaller than any known virus or molecule, setting a new limit of detection.
This document is a dissertation presented by Jukka Sund at the University of Helsinki on April 4th 2014. The dissertation investigates the health effects of engineered nanomaterials (ENMs) using proteomic methods. It first evaluates how ENMs interact with plasma and cellular proteins and then analyzes the effects of ENM exposure on the intracellular proteome and secretome of human macrophages. The results provide new insights into how ENM properties govern interactions with proteins and influence cellular responses. This work contributes to understanding the biological effects of ENMs.
Piperazine derivatives as iron chelators a potentialSteve Huvelle
This document summarizes a study that synthesized new piperazine derivatives designed as iron chelators and assessed their potential to prevent iron-induced neurotoxicity. The compounds were able to provide sustained neuroprotection to dopaminergic neurons vulnerable in Parkinson's disease. Spectrophotometric titration showed the compounds have high affinity for iron and can chelate iron, while an in vitro cellular model demonstrated their neuroprotective effects. The document then details the experimental methods used for synthesizing the piperazine derivatives and assessing their iron-chelating properties and neuroprotective abilities.
Neuro identification of some commonly used volatile organic compounds using e...Alexander Decker
This document describes a study that used an electronic nose system with three gas sensors and an artificial neural network to identify three volatile organic compounds (formaldehyde, acetone, and chloroform). Sensor responses were analyzed and 60% of data was used to train the neural network, which successfully identified the compounds. The system has potential for applications in environmental monitoring and industrial process control.
Applications of gold nanoparticles in medicine and therapyAl Baha University
The stability and dispersity of AuNMs in solution play a key role for the many applications. Most inorganic nanomaterials are not well dispersed in physiological buffers and require function-alization by thiols or surfactants to offer the stabilization forces. Furthermore, sufficient blood circulation time is critical for both imaging and in vivo drug delivery. Localized surface Plasmon resonance (LSPR) is one of the most significant features of AuNMs. The AuNMs as reporters have been broadly applied into lateral flow immunechromatographicalassay (LFICA) and enzyme-linked immunosorbent assay (ELISA), which is a well-established technology for analysis of the target analytes in food safety, clinical diagnosis, environmental monitoring, and medical science and so on. Au based nanomaterials (AuNMs) are known to possess many attractive features such as unique electrical, optical and catalytic properties as well as excellent biocompatibility. In this review, we summarize the current advancement on application of AuNMs in analytical sciences based on their local surface plasmon resonance, fluorescence and electrochemistry properties. AuNMs based imaging and therapy in biomolecules is explained. As one of the most reliable imaging modes, computed tomography (CT), X-ray and SERS imaging has been widely used owing to its high spatial and density resolution. We end the review by a discussion of the conjugation between gold nanoparticles with other kinds of nanoparticles such as other metals and carbon nano structures. Finally, future development in this research area is also prospected.
This document summarizes applications of gold nanoparticles (AuNPs) in analytical sciences and medicine. It discusses how AuNPs can be used in colorimetric sensors, imaging, and therapy due to their localized surface plasmon resonance, fluorescence, and electrochemical properties. It also reviews several methods for synthesizing AuNPs with controlled size and shape, and how DNA can be used as a programmable tool to precisely tune AuNP size and shape.
This document discusses electrochemical sensors for detecting antibiotic residues in food. It begins with an introduction on the increasing global use of antibiotics and development of antibiotic resistance. It then discusses the working principles of electrochemical sensors and how they can be used to detect antibiotics. Specifically, it describes how electrochemical sensors use recognition elements like enzymes, antibodies, aptamers, and molecularly imprinted polymers to detect antibiotics. It also discusses using different electrode systems and materials like carbon nanotubes, nanoparticles, and graphene to improve detection. The document aims to provide an overview of developing electrochemical sensor techniques for antibiotic residue detection in food.
The transformational role of polymerase chain reaction (pcr) in environmental...Alexander Decker
This document discusses the transformational role of polymerase chain reaction (PCR) in environmental health research. PCR allows for exponential amplification of target DNA sequences, which has enabled rapid and sensitive detection of pathogens in environmental samples as an alternative to traditional culture methods. While PCR is widely used in developed countries, its benefits have yet to be fully realized in developing countries like Nigeria. The document provides background on DNA replication and the basics of how PCR works to exponentially amplify DNA. It argues that PCR could greatly aid environmental health monitoring and disease diagnosis in Nigeria.
Chemical sensors definitions and classificationVenkey Tagore
This document provides definitions and classifications for chemical sensors. It defines a chemical sensor as a device that transforms chemical information into an analytically useful signal, with the chemical information originating from either a chemical reaction or physical property of the system. The document then classifies chemical sensors based on the operating principle of the transducer, with categories including optical, electrochemical, electrical, mass sensitive, magnetic, and thermometric devices. It notes that sensors can be further classified in various ways and that this classification provides one possible approach.
MALDI-TOF: Pricinple and Its Application in Biochemistry and BiotechnologyDevakumar Jain
The document discusses MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. It provides a history of the development of mass spectrometry techniques. MALDI-TOF allows for the analysis of intact biomolecules like proteins and is a soft ionization method. It provides high sensitivity and mass accuracy for analyzing proteins, peptides, and other large biomolecules. The document also discusses applications of MALDI-TOF like protein identification and characterization.
ST8 micellar/niosomal vesicular nanoformulation for delivery of naproxen in c...Vahid Erfani-Moghadam
This document describes a study that developed a micellar/niosomal vesicular nanoformulation using squalene and Tween 80 (ST8MNV) to deliver the drug naproxen (NPX) for potential anti-inflammatory and anticancer applications. The ST8MNV exhibited high encapsulation efficiency of 99.5% for NPX. In vitro tests showed the ST8MNV nanoformulation significantly reduced the half maximal inhibitory concentration of NPX in four cancer cell lines, suggesting it is a promising drug delivery system to improve the cytotoxic effects of NPX for future studies.
Preparation and characterization of poly (2 hydroxyethyl methacrylate) (phema...Alexander Decker
This document discusses the preparation and characterization of poly(2-hydroxyethyl methacrylate) (PHEMA) nanoparticles for potential use in controlled drug delivery. PHEMA nanoparticles were prepared using a modified suspension polymerization technique. The nanoparticles were characterized using infrared spectroscopy, scanning electron microscopy, and particle size analysis. The nanoparticles were found to be less than 100 nm in size and spherical or elliptical in shape, making them suitable for biomedical applications such as controlled drug delivery.
This document discusses various applications of nanotechnology in urology, including imaging and treatment of genitourinary cancers, prostate cancer screening, tissue engineering, and more. It describes how nanoparticles can improve detection of cancer through imaging modalities like MRI. Nanoparticles are also explored as drug delivery vehicles to selectively target cancer cells and overcome issues like drug resistance. The document outlines several preclinical and early clinical studies investigating nanoparticle formulations to treat cancers of the prostate, bladder, and kidneys with reduced toxicity compared to conventional therapies.
Mass spectrometry is an analytical technique that measures the molecular mass of samples. It provides accurate molecular weight measurements and can generate structural information by fragmenting samples. Mass spectrometers are used in various fields including biotechnology, pharmaceuticals, clinical analysis, environmental analysis, and geology. They work by ionizing samples, separating the ions by mass-to-charge ratio using an analyzer, and detecting the ions. Common ionization methods for biochemical analysis include electrospray ionization and matrix-assisted laser desorption ionization.
Similar to Label free and reagentless electrochemical detection of micro rn-as using a conducting polymer nanostructured by carbon nanotubes- application to prostate cancer biomarker mir-141 (20)
Evidence of Jet Activity from the Secondary Black Hole in the OJ 287 Binary S...Sérgio Sacani
Wereport the study of a huge optical intraday flare on 2021 November 12 at 2 a.m. UT in the blazar OJ287. In the binary black hole model, it is associated with an impact of the secondary black hole on the accretion disk of the primary. Our multifrequency observing campaign was set up to search for such a signature of the impact based on a prediction made 8 yr earlier. The first I-band results of the flare have already been reported by Kishore et al. (2024). Here we combine these data with our monitoring in the R-band. There is a big change in the R–I spectral index by 1.0 ±0.1 between the normal background and the flare, suggesting a new component of radiation. The polarization variation during the rise of the flare suggests the same. The limits on the source size place it most reasonably in the jet of the secondary BH. We then ask why we have not seen this phenomenon before. We show that OJ287 was never before observed with sufficient sensitivity on the night when the flare should have happened according to the binary model. We also study the probability that this flare is just an oversized example of intraday variability using the Krakow data set of intense monitoring between 2015 and 2023. We find that the occurrence of a flare of this size and rapidity is unlikely. In machine-readable Tables 1 and 2, we give the full orbit-linked historical light curve of OJ287 as well as the dense monitoring sample of Krakow.
Travis Hills of MN is Making Clean Water Accessible to All Through High Flux ...Travis Hills MN
By harnessing the power of High Flux Vacuum Membrane Distillation, Travis Hills from MN envisions a future where clean and safe drinking water is accessible to all, regardless of geographical location or economic status.
Describing and Interpreting an Immersive Learning Case with the Immersion Cub...Leonel Morgado
Current descriptions of immersive learning cases are often difficult or impossible to compare. This is due to a myriad of different options on what details to include, which aspects are relevant, and on the descriptive approaches employed. Also, these aspects often combine very specific details with more general guidelines or indicate intents and rationales without clarifying their implementation. In this paper we provide a method to describe immersive learning cases that is structured to enable comparisons, yet flexible enough to allow researchers and practitioners to decide which aspects to include. This method leverages a taxonomy that classifies educational aspects at three levels (uses, practices, and strategies) and then utilizes two frameworks, the Immersive Learning Brain and the Immersion Cube, to enable a structured description and interpretation of immersive learning cases. The method is then demonstrated on a published immersive learning case on training for wind turbine maintenance using virtual reality. Applying the method results in a structured artifact, the Immersive Learning Case Sheet, that tags the case with its proximal uses, practices, and strategies, and refines the free text case description to ensure that matching details are included. This contribution is thus a case description method in support of future comparative research of immersive learning cases. We then discuss how the resulting description and interpretation can be leveraged to change immersion learning cases, by enriching them (considering low-effort changes or additions) or innovating (exploring more challenging avenues of transformation). The method holds significant promise to support better-grounded research in immersive learning.
Anti-Universe And Emergent Gravity and the Dark UniverseSérgio Sacani
Recent theoretical progress indicates that spacetime and gravity emerge together from the entanglement structure of an underlying microscopic theory. These ideas are best understood in Anti-de Sitter space, where they rely on the area law for entanglement entropy. The extension to de Sitter space requires taking into account the entropy and temperature associated with the cosmological horizon. Using insights from string theory, black hole physics and quantum information theory we argue that the positive dark energy leads to a thermal volume law contribution to the entropy that overtakes the area law precisely at the cosmological horizon. Due to the competition between area and volume law entanglement the microscopic de Sitter states do not thermalise at sub-Hubble scales: they exhibit memory effects in the form of an entropy displacement caused by matter. The emergent laws of gravity contain an additional ‘dark’ gravitational force describing the ‘elastic’ response due to the entropy displacement. We derive an estimate of the strength of this extra force in terms of the baryonic mass, Newton’s constant and the Hubble acceleration scale a0 = cH0, and provide evidence for the fact that this additional ‘dark gravity force’ explains the observed phenomena in galaxies and clusters currently attributed to dark matter.
Mending Clothing to Support Sustainable Fashion_CIMaR 2024.pdfSelcen Ozturkcan
Ozturkcan, S., Berndt, A., & Angelakis, A. (2024). Mending clothing to support sustainable fashion. Presented at the 31st Annual Conference by the Consortium for International Marketing Research (CIMaR), 10-13 Jun 2024, University of Gävle, Sweden.
EWOCS-I: The catalog of X-ray sources in Westerlund 1 from the Extended Weste...Sérgio Sacani
Context. With a mass exceeding several 104 M⊙ and a rich and dense population of massive stars, supermassive young star clusters
represent the most massive star-forming environment that is dominated by the feedback from massive stars and gravitational interactions
among stars.
Aims. In this paper we present the Extended Westerlund 1 and 2 Open Clusters Survey (EWOCS) project, which aims to investigate
the influence of the starburst environment on the formation of stars and planets, and on the evolution of both low and high mass stars.
The primary targets of this project are Westerlund 1 and 2, the closest supermassive star clusters to the Sun.
Methods. The project is based primarily on recent observations conducted with the Chandra and JWST observatories. Specifically,
the Chandra survey of Westerlund 1 consists of 36 new ACIS-I observations, nearly co-pointed, for a total exposure time of 1 Msec.
Additionally, we included 8 archival Chandra/ACIS-S observations. This paper presents the resulting catalog of X-ray sources within
and around Westerlund 1. Sources were detected by combining various existing methods, and photon extraction and source validation
were carried out using the ACIS-Extract software.
Results. The EWOCS X-ray catalog comprises 5963 validated sources out of the 9420 initially provided to ACIS-Extract, reaching a
photon flux threshold of approximately 2 × 10−8 photons cm−2
s
−1
. The X-ray sources exhibit a highly concentrated spatial distribution,
with 1075 sources located within the central 1 arcmin. We have successfully detected X-ray emissions from 126 out of the 166 known
massive stars of the cluster, and we have collected over 71 000 photons from the magnetar CXO J164710.20-455217.
ESA/ACT Science Coffee: Diego Blas - Gravitational wave detection with orbita...Advanced-Concepts-Team
Presentation in the Science Coffee of the Advanced Concepts Team of the European Space Agency on the 07.06.2024.
Speaker: Diego Blas (IFAE/ICREA)
Title: Gravitational wave detection with orbital motion of Moon and artificial
Abstract:
In this talk I will describe some recent ideas to find gravitational waves from supermassive black holes or of primordial origin by studying their secular effect on the orbital motion of the Moon or satellites that are laser ranged.
Discovery of An Apparent Red, High-Velocity Type Ia Supernova at 𝐳 = 2.9 wi...Sérgio Sacani
We present the JWST discovery of SN 2023adsy, a transient object located in a host galaxy JADES-GS
+
53.13485
−
27.82088
with a host spectroscopic redshift of
2.903
±
0.007
. The transient was identified in deep James Webb Space Telescope (JWST)/NIRCam imaging from the JWST Advanced Deep Extragalactic Survey (JADES) program. Photometric and spectroscopic followup with NIRCam and NIRSpec, respectively, confirm the redshift and yield UV-NIR light-curve, NIR color, and spectroscopic information all consistent with a Type Ia classification. Despite its classification as a likely SN Ia, SN 2023adsy is both fairly red (
�
(
�
−
�
)
∼
0.9
) despite a host galaxy with low-extinction and has a high Ca II velocity (
19
,
000
±
2
,
000
km/s) compared to the general population of SNe Ia. While these characteristics are consistent with some Ca-rich SNe Ia, particularly SN 2016hnk, SN 2023adsy is intrinsically brighter than the low-
�
Ca-rich population. Although such an object is too red for any low-
�
cosmological sample, we apply a fiducial standardization approach to SN 2023adsy and find that the SN 2023adsy luminosity distance measurement is in excellent agreement (
≲
1
�
) with
Λ
CDM. Therefore unlike low-
�
Ca-rich SNe Ia, SN 2023adsy is standardizable and gives no indication that SN Ia standardized luminosities change significantly with redshift. A larger sample of distant SNe Ia is required to determine if SN Ia population characteristics at high-
�
truly diverge from their low-
�
counterparts, and to confirm that standardized luminosities nevertheless remain constant with redshift.
Immersive Learning That Works: Research Grounding and Paths ForwardLeonel Morgado
We will metaverse into the essence of immersive learning, into its three dimensions and conceptual models. This approach encompasses elements from teaching methodologies to social involvement, through organizational concerns and technologies. Challenging the perception of learning as knowledge transfer, we introduce a 'Uses, Practices & Strategies' model operationalized by the 'Immersive Learning Brain' and ‘Immersion Cube’ frameworks. This approach offers a comprehensive guide through the intricacies of immersive educational experiences and spotlighting research frontiers, along the immersion dimensions of system, narrative, and agency. Our discourse extends to stakeholders beyond the academic sphere, addressing the interests of technologists, instructional designers, and policymakers. We span various contexts, from formal education to organizational transformation to the new horizon of an AI-pervasive society. This keynote aims to unite the iLRN community in a collaborative journey towards a future where immersive learning research and practice coalesce, paving the way for innovative educational research and practice landscapes.
Immersive Learning That Works: Research Grounding and Paths Forward
Label free and reagentless electrochemical detection of micro rn-as using a conducting polymer nanostructured by carbon nanotubes- application to prostate cancer biomarker mir-141
1. Label-free and reagentless electrochemical detection of microRNAs
using a conducting polymer nanostructured by carbon nanotubes:
Application to prostate cancer biomarker miR-141
H.V. Tran a,b
, B. Piro a
, S. Reisberg a
, L.D. Tran c
, H.T. Duc d
, M.C. Pham a,n
a
Université Paris Diderot, Sorbonne Paris Cité, ITODYS, UMR 7086 CNRS, 15 rue J-A de Baïf, 75205 Paris Cedex 13, France
b
USTH, University of Science and Technology of Hanoi, 18 Hoang Quoc Viet, Hanoi, Viet Nam
c
Institute of Material Sciences (IMS), Vietnamese Academy of Science and Technology, 18 Hoang Quoc Viet, Hanoi, Viet Nam
d
Université Paris XI, INSERM U-1014, Groupe Hospitalier Paul Brousse, 94800 Villejuif, France
a r t i c l e i n f o
Article history:
Received 4 February 2013
Received in revised form
12 April 2013
Accepted 2 May 2013
Available online 14 May 2013
Keywords:
Conducting polymer
Square wave voltammetry
Oligonucleotides
Electrochemical biosensor
Label-free detection
MicroRNA
a b s t r a c t
In this paper, a label-free and reagentless microRNA sensor based on an interpenetrated network of
carbon nanotubes and electroactive polymer is described. The nanostructured polymer film presents
very well-defined electroactivity in neutral aqueous medium in the cathodic potential domain from the
quinone group embedded in the polymer backbone. Addition of microRNA miR-141 target (prostate
cancer biomarker) gives a “signal-on” response, i.e. a current increase due to enhancement of the polymer
electroactivity. On the contrary, non-complementary miRNAs such as miR-103 and miR-29b-1 do not
lead to any significant current change. A very low detection limit of ca. 8 fM is achieved with this sensor.
& 2013 Elsevier B.V. All rights reserved.
1. Introduction
The biology of the late 20th century was marked by the
discovery in 1993 of a new class of small non-coding ribonucleic
acids (RNAs) which play major roles in regulating the translation
and degradation of messenger RNAs (Lee et al., 1993; Wightman
et al., 1993). These small RNAs (18–25 nucleotides), called micro-
RNAs (miRNAs), are implied in several biological processes such as
differentiation, metabolic homeostasis, cellular apoptosis and
proliferation (Iorio and Croce, 2009; Brase et al., 2010).
The discovery in 2008 that the presence of miRNAs in body
fluid is in correlation with cancer (prostate, breast, colon, lung,
etc.) or other diseases (diabetes, heart diseases, etc.) has made
them new key players as biomarkers (Lawrie et al., 2008;
Catuogno et al., 2011; Chen et al., 2008). Actually, more than
1200 miRNAs have been identified (Liu et al., 2012), among which
miR-141 is detected at elevated level in blood of patients having
metastatic prostate cancer (Mitchell et al., 2008).
Current standard methods for identification and quantification
of miRNAs are based on traditional molecular biology techniques
(Northern blot, microarray, qRT-PCR). These approaches although
very sensitive and reliable are often expensive, time consuming,
and need highly trained technicians (Hunt et al., 2009; Planell-
Saguer and Rodicio, 2011). That is why a real challenge is to
develop devices able to detect and quantify easily and simulta-
neously different miRNA sequences at sub-picomolar levels (Wang
et al., 2012). Ideally, these new bioanalytical tools should be easy
to manufacture, need low power, and allow reagentless and label-
free detection. Few work deal with such strategy, and particularly
very few when electrochemical transduction is involved. Electro-
chemical biosensors offer the advantages of mass fabrication, low
cost and potential decentralized analysis (Paleček and Bartošík,
2012).
Lusi et al. (2009) reported amperometric detection based on
oxidation of RNA nucleobases. This system allows detection at sub-
picomolar level (0.1 pM), but the current depends on the number
of guanine and needs high oxidation potentials, which may
generate side-oxidations. Using enzyme-labeled detection probes,
Kilic et al. (2012) reported detection for miR-21 with a detection
limit of 1 μM. Gao and Peng (2011) achieved a detection limit of
10 fM. Allosteric molecular beacons able to bind HRP enzyme were
used by Cai et al. (2003), with a detection limit of 44 amol in a
volume of 4 μL, i.e. 11 pM. Yin et al. (2012) have shown a detection
limit of 60 fM for miR-21 with gold NPs bearing HRP. Using a
Contents lists available at SciVerse ScienceDirect
journal homepage: www.elsevier.com/locate/bios
Biosensors and Bioelectronics
0956-5663/$ - see front matter & 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.bios.2013.05.007
n
Corresponding author. Tel.: +33 1 57277223.
E-mail address: mcpham@univ-paris-diderot.fr (M.C. Pham).
Biosensors and Bioelectronics 49 (2013) 164–169
2. polymerase-labeled DNA probe and impedance measurements,
Shen et al. (2013) reported a LOD of 2 fM for a S/N of 3. Very high
sensitivity (0.1 fM) was obtained using peptide nucleic acid (PNA)
probes (Zhang et al., 2009). Qavi et al. (2010) proposed an
excellent review on miRNA analysis.
Conducting polymers constitute a powerful platform to immo-
bilize short DNA or RNA sequences while maintaining their
stability, accessibility and activity (Gerard et al., 2002; Cosnier,
2003, 1999). Unfortunately, label-free electrochemical biosensors
based on polymer-modified electrodes are known to suffer from
lack of sensitivity (Cosnier and Holzinger, 2011). To enhance
sensitivity, carbon nanotubes (CNTs) were frequently reported
(Wohlstadter et al., 2003; Wang, 2005) to increase the electro-
active area and decrease the electrical resistance of the working
electrodes, leading to 3D conductive materials (Peigney et al.,
2001; Kulesza et al., 2006; Acevedo et al., 2008). Qi et al. (2007)
fabricated an electrochemical DNA biosensor based on electro-
polymerised polypyrrole and carbon nanotubes, using ethidium
bromide as redox indicator with high sensitivity, ca. 85 pM. Very
few works were related to label-free and reagentless biosensors.
Okuno et al. (2007) described a label-free and reagentless
immunosensor for prostate-specific antigen based on single-
walled CNT-modified microelectrodes with low detection limit
(0.25 ng mL−1
). The current being derived from oxidation of amino
acid residues (tyrosine and tryptophan), it is then dependent on
the presence of these residues in the target sequence. Zhang et al.
(2011) described a strategy for label-free and reagentless electro-
chemical DNA sensing based on SWNTs and an immobilized redox
probe. This system allows very specific detection of DNA but the
limit of detection is only 0.1 mM. 3D structures obtained using
CNTs may induce high capacitance which may introduce distortion
on cyclic voltammograms (Peng et al., 2007). In order to minimize
this effect, pulsed methods such as differential pulse voltammetry
(DPV) or square wave voltammetry (SWV) are currently used.
Impedance methods combining polymer and carbon nanotubes
have also been widely used in reagentless formats (Xu et al., 2004,
2006; Cai et al., 2003). In this paper, we describe a label-free and
reagentless miRNA sensor based on an interpenetrated network of
carbon nanotubes and electroactive polymer. The nanostructured
polymer film presents very well-defined electroactivity in neutral
aqueous medium from the quinone group embedded in the
polymer backbone. When the miRNA-141 target is added (miR-
141, a prostate biomarker) a “signal-on” response, i.e. a current
increase, is observed while no current change occurs with non-
complementary miRNAs such as miR-103 (a colorectal cancer
biomarker; Chen et al., 2012) or miR-29b-1 (a lung cancer
biomarker; Fabbri et al., 2007). The biosensor presents a very
low detection limit of ca. 8 fM.
2. Experimental
2.1. Chemicals
Phosphate buffer saline (PBS, 0.137 M NaCl; 0.0027 M KCl;
0.0081 M Na2HPO4; 0.00147 M KH2PO4, pH 7.4) was provided by
Sigma. Aqueous solutions were made with ultrapure (18 MΩ cm)
water. Glassy carbon (GC) working electrodes (3 mm diameter,
S¼0.07 cm2
) were purchased from BASInc. 3-(5-Hydroxy-1,
4-dioxo-1,4-dihydronaphthalen-2(3)-yl) propanoic acid (JUGA)
was synthesized from 5-hydroxy-1,4-naphthoquinone (JUG) and
succinic acid (Piro et al., 2011). All oligonucleotides were provided
by Eurogentec (Belgium). All sequences are detailed in Table 1.
DNA strands were used as capture probes for the corresponding
miRNAs. Human sera were provided by Paul Brousse Hospital (H.T.
Duc). Multi-walled carbon nanotubes (MWCNTs, purity 90%;
diameter of 110–170 nm and length of 5–9 mm), lithium perchlo-
rate (purity≥95%) and 5-hydroxy-1,4-naphthoquinone (JUG, purity
97%) were purchased from Sigma Aldrich. 1-(3-Dimethylamino-
propyl)-3-ethylcarbodiimide hydrochloride (EDC, purity 98%) and
N-hydroxysuccinimide (NHS, purity 98%) were from Alfa Aesar
(Ward Hill, MA). Alumina slurry is from ESCIL, Chassieu, France. All
other reagents used (H2SO4, HNO3) and solvents, acetonitrile
(ACN), ethanol (EtOH), were PA grade.
2.2. CNTs preparation
MWCNTs were purified and oxidized in a 1:1 mixture of HNO3
and H2SO4 at 90 1C for 1 h, then washed with distilled water until
pH 7 and separated by centrifugation. The solid residue was then
dried at 80 1C for 12 h before use. These oxidized MWCNTs are
referred as o-MWCNTs in the following.
2.3. Electrochemical procedures
The three-electrodes cell consists of a GC working electrode
(3 mm in diameter), a platinum (Pt) grid counter electrode and a
commercial calomel electrode (SCE, supplied from Radiometer
Analytical). Cyclic voltammetry was used for polymer electro-
synthesis, using an Autolab PGSTAT30. Electrochemical Impedance
Spectroscopy (EIS) was used for characterization of the modified
electrodes. Impedance spectra were recorded using the FRA
module associated with the PGSTAT30 for frequencies between
100 kHz and 100 mHz and a perturbation amplitude of 10 mV.
Solutions were systematically deaerated with argon before and
during experiments. Field Emission Scanning Electron Microscopy
(FESEM) photographs were taken on a Hitachi S4800 system.
2.4. Electrode preparation
GC electrodes were polished by 1 μm alumina slurry on
polishing cloth then washed with water, ethanol and ACN in
ultrasonic bath for 2 min. 1 mg o-MWCNTs was dispersed in
1 mL H2O then 5 mL of this solution was dropped onto a freshly
polished GC electrode and let to dry. This procedure gives CNT-
modified electrodes (noted o-MWCNT/GCE) for which the CNT
density is controlled by the quantity initially contained in the
droplet. GC or o-MWCNT/GCE electrodes were modified by co-
electrooxidation of the two monomers JUG and JUGA in ACN
solution containing 5 Â 10−2
M JUG, 3.75 Â 10−3
M JUGA, 0.1 M
LiClO4 and 10−3
M 1-naphthol (the JUGA:JUG ratio is 0.075). This
procedure leads to poly(JUG-co-JUGA)-modified electrodes or poly
(JUG-co-JUGA)/o-MWCNT-modified electrodes.
Table 1
ODN probes and miRNA target sequences.
ODN name Function (type) Bases Tm (1C) Sequences
ODN-141-P Probe (DNA) 22 46.0 5′ NH2–CCATCTTTACCAGACAGTGTTA 3′
miR-141 Target (RNA) 22 46 3′ GGUAGAAAUGGUCUGUCACAAU 5′
miR-29b-1 Target (RNA) 23 44.8 3′ UUGUGACUAAAGUUUACCACGAU 5′
miR-103 Target (RNA) 23 50.2 3′AGUAUC GGGACAUGUUACGACGA 5′
H.V. Tran et al. / Biosensors and Bioelectronics 49 (2013) 164–169 165
3. 2.5. Grafting ODN capture probes
Poly(JUG-co-JUGA)-modified electrodes or poly(JUG-co-JUGA)/
o-MWCNT-modified electrodes were immersed into 500 μL of a
solution containing 150 mM EDC+300 mM NHS at 37 1C for 2 h to
activate the carboxyl group. Then, electrodes were washed with
distilled water and immersed into 500 μL of an aqueous solution
containing 0.1 μM ODN probe for 2 h at 37 1C. Electrodes were
then washed with MilliQ water and PBS at room temperature and
immersed into PBS at 37 1C under stirring for 2 h to remove
physisorbed ODN. After that, the electroactivity of poly(JUG-co-
JUGA)/ODN- or poly(JUG-co-JUGA)/o-MWCNT/ODN-modified elec-
trodes was investigated by SWV curves.
2.6. Hybridization assays
Hybridization solutions containing various concentrations of
miRNA target (from 10−15
M to 10−8
M) were prepared and heated
for 5 min above the melting temperature of the corresponding
duplex to avoid cross hybridization (Gortner et al., 1996; Válóczi
et al., 2004). Probe-modified electrodes were then dipped into this
solution at 45 1C for 1 h. After hybridization, electrodes were
washed with 1 Â SSC (saline sodium citrate) buffer for 1 min at
45 1C then dipped into 1 Â PBS at 37 1C for 30 min in order to wash
out physisorbed targets. SWVs were then recorded in 1 Â PBS, at
25 1C, several times consecutively until the signal is perfectly
stable. The main peak (situated between −0.5 and −0.4 V vs. SCE)
was used to calculate the relative current change (%ΔI/I) before and
after hybridization, using the following equation:
%
ΔI
I
¼
IHyb−IProbe
IProbe
 100
where IProbe and IHyb are currents corresponding to the main SWV
peak before and after hybridization, respectively.
The sample standard deviation was calculated as follows:
S ¼
ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
1
ðN−1Þ
∑
N
i ¼ 1
ΔI
I
i
−
ΔI
I
#2
v
u
u
t ð1Þ
with ðΔI=IÞi corresponding to the observed value of the relative
current change for each measurement i and ðΔI=IÞ the mean value
for N measurements.
The relative limit of detection ðΔI=IÞLOD was derived from the
relative current change obtained with blank samples
ΔI
I
LOD
¼
ΔI
I
Blank
þ 3SBlank ð2Þ
with ðΔI=IÞBlank corresponding to the mean value of the relative
current change observed for blank samples and SBlank the sample
standard deviation for blank samples.
To obtain a calibration curve, at least three independent measure-
ments were performed for each concentration. The limit of detection
(LOD) was obtained from five independent blank samples.
3. Results and discussion
3.1. Electrode modifications and characterizations
The first step consists of the physisorption of a well-defined
quantity of o-MWCNTs on the GC electrode surface. The procedure is
detailed in Section 2. Several surface densities of o-MWCNT were
investigated: 0, 7, 14.3, 28.6, 36.7 and 142 μg cm−2
(see Fig. SI5). After
that, poly(JUG-co-JUGA) was deposited by potential scans (20 scans)
from 0.4 to 1.1 V (vs. SCE) at a scan rate of 0.05 V s−1
. The redox peaks
situated at +0.91/+0.85 V vs. SCE develop continuously under
scanning, which indicates formation of conducting poly(JUG-co-
JUGA) film on the electrode surface. Fig. 1 shows CVs for a bare GC
electrode (a) and for a o-MWCNT-modified electrode using
14.3 μg cm−2
(b). As expected, the currents measured on the o-
MWCNT-modified electrode are higher than that on the bare GC one.
Fig. 2 shows FESEM pictures of (a) bare GC; (b) o-MWCNT/GC at
low magnification; (c) o-MWCNT/GC at high magnification and
(d) poly(JUG-co-JUGA)/o-MWCNT/GC. As shown, o-MWCNT-
modified electrodes present much higher specific area than bare
GC and, as expected, poly(JUG-co-JUGA) is deposited preferentially
on the o-MWCNTs.
3.2. Electroactivity of the poly(JUG-co-JUGA)/o-MWCNT-modified
electrodes
CVs of different polymer/o-MWCNT-modified electrodes are
presented in Supplementary information, Fig. SI1A. The higher the
o-MWCNT density, the higher the current intensity, with a quasi-
reversible signal observed in the cathodic potential domain
between −1 and 0.1 V vs. SCE, attributed to quinone electroactivity.
0.4 0.6 0.8 1.0 1.2
0
20
40
60
80
100
I/μA
0.4 0.6 0.8 1.0 1.2
-20
0
20
40
60
80
100
120
I/μA
E/ V vs. SCE
E / V vs. SCE
Fig. 1. Cyclic voltammograms during film growth. Medium: 5.10−2
M JUG+5.10−3
M
JUGA+10−3
M naphthol in ACN, a—on bare GC electrode; b—on o-MWCNT/GC
using 14.3 μg cm−2
o-MWCNT.
H.V. Tran et al. / Biosensors and Bioelectronics 49 (2013) 164–169166
4. Two typical redox couples for quinone in PBS can be identified: a
main couple is situated at −0.50/−0.65 V and a secondary one at
−0.8/−0.85 V. Electrochemical impedance spectroscopy has been
performed as well; results are given in Fig. SI1B.
Square wave voltammograms (SWVs), which evidence the
faradic peaks more clearly than CVs, are given in Fig. SI2. The o-
MWCNT-modified electrode shows one small peak at −0.2 V vs.
SCE, whereas the poly(JUG-co-JUGA)-modified electrode shows
two well-defined peaks at −0.56 V vs. SCE (peak ♯1) and −082 V vs.
SCE (peak ♯2) which correspond to the two quinone redox couples
observed on the CVs. For the poly(JUG-co-JUGA)/o-MWCNT-mod-
ified electrode, peak ♯2 remains weak whereas peak ♯1 becomes
predominant, along with a new shoulder (♯3) at −0.32 V. Peak ♯3
increases with the o-MWCNT density (data not shown).
3.3. Detection of miRNA
ODN probes (ODN-141-P) were immobilized on poly(JUG-co-
JUGA)/o-MWCNT-modified electrodes as described in Section 2. The
surface concentration ΓODN of ODN probe has been estimated around
1075 pmol cm−2
via fluorescence experiments after hybridization
with fluorescent complementary target. Details are given in Supple-
mentary information. The maximum density Γmax can be derived
from the gyration radius RG (RG¼1.8 nm2
for a single-stranded ODN
of 22 bases) (Piro et al., 2007) which gives Γmax¼17 pmol cm−2
. If
ODN probe strands are closely packed on the electrode surface, this
leads to a significant steric hindrance which decreases the apparent
diffusion coefficient of counter-ions, therefore decreases the current
intensity of SWV. Conversely, hybridization leads to conformational
reorganization of the double strands which creates free space on the
electrode surface and induces a significant current increase (Reisberg
et al., 2006; Piro et al., 2007).
miRNA of about the same length than the probes were used as
targets (conditions are detailed in Section 2 and sequences are given
in Table 1). Fig. 3a shows SWVs after hybridization with increasing
concentrations of complementary miR-141 (10 fM, 1 pM, 100 pM).
More curves are given in Fig. SI6. A complete calibration curve is
given in Fig. 3b, where the relative current increase upon hybridiza-
tion (%ΔI/I) is plotted vs. the target concentration, in the range 10−15
–
10−8
M. Saturation occurs beyond a concentration of 10−10
M; the
limit of detection (LOD) is estimated around 8 fM (see Section 2). The
linear part of the calibration curve corresponds to an extremely high
sensitivity of +7.5% per decade, which gives ΔI/I¼30% for 10 pM miR-
141. This is one of the lowest LOD reported for a reagentless and
label-free electrochemical miRNA biosensor.
3.4. Selectivity of the sensor
To check the selectivity of the sensor, hybridization experiments
were performed with two other non-complementary miRNAs: miR-
103 and miR-29b-1 (see Table 1). Two concentrations were inves-
tigated, 1 pM and 10 pM (within the linear range determined from
Fig. 3). As shown in Fig. SI3, the complementary target miR-141
leads to a current increase which is approximately three times
higher than that for the two non-complementary targets miR-103
and miR-29b-1. These results indicate that the biosensor is suffi-
ciently selective to discriminate non-complementary miRNAs from
the complementary one.
3.5. Detection of miRNA in diluted serum
The last set of experiments was conducted using human sera. A
human normal serum (which does not contain miRNA in detect-
able quantity) was diluted 50 times and used as a blank; it is
referred as 2% serum (−). From this solution samples were
prepared in which known quantities of miR-141 were added,
giving 2% serum (+) samples. A calibration curve is given in
Fig. 4. Corresponding SWVs are given in Fig. SI4.
SWV performed on a 2% serum (−) solution led to a negative
current change (decrease of the peak intensity) of about 10%,
Fig. 2. FESEM photographs on: (a) bare GC electrode; (b) o-MWCNT/GC at low magnification; (c) o-MWCNT/GC at high magnification (o-MWCNT density is 14.3 mg cm−2
);
(d) poly(JUG-co-JUGA)/o-MWCNT/GC. Conditions: poly(JUG-co-JUGA) was deposited by 20 scans; CNT's density is 14.3 mg cm−2
.
H.V. Tran et al. / Biosensors and Bioelectronics 49 (2013) 164–169 167
5. which can probably be attributed to unspecific physisorption of
serum proteins on the electrode surface (such solution contains
around 1.5 mg mL−1
of various proteins). The current change is still
negative for 10 fM (but yet significantly different from negative
serum), which probably means that unspecific physisorption of
proteins is predominant over the specific miRNA hybridization. For
higher concentrations, the current change becomes positive, the
LOD being significantly higher and the sensitivity lower than for
experiments conducted in PBS instead of diluted serum.
4. Conclusion
A nanostructured poly(JUG-co-JUGA)/o-MWCNT composite was
designed onto which oligonucleotide probes were grafted. The
system was applied for direct electrochemical detection of miR-
141, a miRNA biomarker. It is shown that the copolymer electro-
activity is enhanced by the presence of o-MWCNTs, which prob-
ably participate to the low detection limit and high sensitivity. The
sensor can work in complex samples such as diluted human
serum. It is noteworthy to point out the interest to use signal-on
transduction, which makes the sensor much less sensitive to
unspecific adsorption of proteins or nucleic acids than in case of
signal-off transduction.
Work is now in progress to extent this detection system to use
as probes peptide nucleic acids (PNA) or locked nucleic acids
(LNA). These probes, having a higher affinity for RNA than DNA, are
expected to attain even lower LOD and higher sensitivity.
Acknowledgments
H.V. Tran thanks the University of Sciences and Technology of
Hanoi (USTH) for a Ph.D. grant. The authors thank University Paris
Diderot for financial support through an interdisciplinary grant
between Chemistry and Odontology Departments.
Appendix A. Supporting information
Supplementary data associated with this article can be found in
the online version at http://dx.doi.org/10.1016/j.bios.2013.05.007.
References
Acevedo, D.F., Reisberg, S., Piro, B., Peralta, D.O., Miras, M.C., Pham, M.C., Barbero, C.A.,
2008. Electrochimica Acta 53, 4001–4006.
Brase, J.C., Wuttig, D., Kuner, R., Sültmann, H., 2010. Molecular Cancer 9, 306–313.
Cai, H., Xu, Y., He, P.G., Fang, Y.Z., 2003. Electroanalysis 15, 1864–1870.
Catuogno, S., Esposito, C.L., Quintavalle, C., Cerchia, L., Condorelli, G., De Franciscis,
V., 2011. Cancers 3, 1877–1898.
Chen, H.Y., Lin, Y.M., Chung, H.C., Lang, Y.D., Lin, C.J., Huang, J., Wang, W.C., Lin, F.M.,
Chen, Z., Huang, H.D., Shyy, J.Y., Liang, J.T., Chen, R.H., 2012. Cancer Research 72,
3631–3641.
Chen, X., Ba, Y., Ma, L., Cai, X., Yin, Y., Wang, K., Guo, J., Zhang, Y., Chen, J., Guo, X., Li,
Q., Li, X., Wang, W., Zhang, Y., Wang, J., Jiang, X., Xiang, Y., Xu, C., Zheng, P.,
Zhang, J., Li, R., Zhang, H., Shang, X., Gong, T., Ning, G., Wang, J., Zen, K., Zhang, J.,
Zhang, C.Y., 2008. Cell Research 18, 997–1006.
Cosnier, S., 1999. Biosensors and Bioelectronics 14, 443–456.
Cosnier, S., 2003. Analytical and Bioanalytical Chemistry 377, 507–520.
Cosnier, S., Holzinger, M., 2011. Chemical Society Reviews 40, 2146–2156.
Fabbri, M., Garzon, R., Cimmino, A., Liu, Z., Zanesi, N, Callegari, E., Liu, S., Alder, H.,
Costinean, S., Fernandez-Cymering, C., Volinia, S., Guler, G., Morrison, C.D.,
Chan, K.K., Marcucci, G., Calin, G.A., Huebner, K., Croce, C.M., 2007. Proceedings
of National Academy of Sciences 104, 15805–15810.
Gao, Z., Peng, Y., 2011. Biosensors and Bioelectronics 26, 3768–3773.
Gerard, M., Chaubey, A., Malhotra, B.D., 2002. Biosensors and Bioelectronics 17,
345–359.
-1.0 -0.8 -0.6 -0.4 -0.2 0.0
30
40
50
60
I/μA
E/ V vs. SCE
After ODN grafting
1 fM
10 fM
1 pM
100 pM
1E-14
Concentration / mol L
1E-12 1E-10 1E-8
0
10
20
30
40
50
ΔI/I(%)
-1
Fig. 3. a—SWVs recorded before adding miRNA-141 (lower green curve) then after
hybridization (upper red curves) with increasing concentrations of complementary
miRNA-141: 1 fM, 10 fM, 1 pM and 100 pM. b—Calibration curve giving relative
current increase (%ΔI/I) upon hybridization with concentrations of miRNA-141 in
the range 10−15
–10−8
M. (For interpretation of the references to color in this figure
legend, the reader is referred to the web version of this article.)
1E-3 0.01 0.1 1 10 100 1000
-10
0
10
20
30
ΔI/I(%)
Concentration of miR-141 in diluted serum / pM
Fig. 4. Calibration curve obtained from SWVs in 2% serum (−) and 2% serum (+), for
10 fM, 1 pM, 20 pM and 800 pM miR-141. Error bars were obtained by three
independent experiments.
H.V. Tran et al. / Biosensors and Bioelectronics 49 (2013) 164–169168
6. Gortner, G., Pfenninger, M., Kahl, G., Weising, K., 1996. Electrophoresis 17,
1183–1189.
Hunt, A., Goulding, A.M., Deo, S.K., 2009. Analytical Biochemistry 387, 1–12.
Iorio, M.V., Croce, C.M., 2009. Journal of Clinical Oncology 27, 5848–5856.
Kilic, T., Topkaya, S.N., Ariksoysal, D.O., Ozsoz, M., Ballar, P., Erac, Y., Gozen, O., 2012.
Biosensors and Bioelectronics 38, 195–201.
Kulesza, P.J., Skunik, M., Baranowska, B., Miecznikowski, K., Chojak, M., Karnicka, K.,
Frackowiak, E., B´eguin, F., Kuhn, A., Delville, M.H., Starobrzynska, B., Ernst, A.,
2006. Electrochimica Acta 51, 2373–2379.
Lawrie, C.H., Gal, S., Dunlop, H.M., Pushkaran, B., Liggins, A.P., Pulford, K., Banham,
A.H., Pezzella, F., Boultwood, J., Wainscoat, J.S., Hatton, C.S.R., Harris, A.L., 2008.
British Journal of Haematology 141, 672–675.
Lee, R.C., Feinbaum, R.L., Ambros, V., 1993. Cell 75, 843–854.
Liu, X., He, S., Skogerbø, G., Gong, F., Chen, R., 2012. PLoS ONE 7, e32797.
Lusi, E.A., Passamano, M., Guarascio, P., Scarpa, A., Schiavo, L., 2009. Analytical
Chemistry 81, 2819–2822.
Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan,
E.L., Peterson, A., Noteboom, J., O'Briant, K.C., Allen, A., Lin, D.W., Urban, N.,
Drescher, C.W., Knudsen, B.S., Stirewalt, D.L., Gentleman, R., Vessella, R.L.,
Nelson, P.S., Martin, D.B., Tewari, M., 2008. Proceedings of National Academy
of Sciences 105, 10513–10518.
Okuno, J., Maehashi, K., Kerman, K., Takamura, Y., Matsumoto, K., Tamiya, E., 2007.
Biosens. Bioelectron. 22, 2377–2381.
Paleček, E., Bartošík, M., 2012. Chemical Reviews 112, 3427–3481.
Peigney, A., Laurent, C., Flahaut, E., Bacsa, R.R., Rousset, A., 2001. Carbon 39,
507–514.
Peng, C., Jin, J., Chen, G.Z., 2007. Electrochimica Acta 53, 525–537.
Piro, B., Kapella, A., Hai, L.V., Anquetin, G., Zhang, Q.D., Reisberg, S., Noel, V., Tran, L.
D., Duc, H.T., Pham, M.C., 2011. Electrochimica Acta 55, 6136–6146.
Piro, B., Reisberg, S., Noel, V., Pham, M.C., 2007. Biosensors and Bioelectronics 22,
3126–3131.
Planell-Saguer, M., Rodicio, M.C., 2011. Analytica Chimica Acta 699, 134–152.
Qavi, A.J., Kindt, J.T., Bailey, R.C., 2010. Analytical and Bioanalytical Chemistry 398,
2535–2549.
Qi, H., Li, X., Chen, P., Zhang, C., 2007. Talanta 72, 1030–1035.
Reisberg, S., Piro, B., Noel, V., Pham, M.C., 2006. Bioelectrochemistry 69, 172–179.
Shen, W., Deng, H., Ren, Y., Gao, Z., 2013. Biosensors and Bioelectronics, 171–176.
Válóczi, A., Hornyik, C., Varga, N., Burgyán, J., Kauppinen, S., Havelda, Z., 2004.
Nucleic Acids Research 32, e175.
Wang, J., 2005. Electroanalysis 17, 7–14.
Wang, J., Yi, X., Tang, H., Han, H., Wu, M., Zhou, F., 2012. Analytical Chemistry 84,
6400–6406.
Wightman, B., Ha, I., Ruvkun, G., 1993. Cell 75, 855–862.
Wohlstadter, J.N., Wilbur, J.L., Sigal, G.B., Biebuyck, H.A., Billadeau, M.A., Dong, L.,
Fischer, A.B., Gudibande, S.R., Jameison, S.H., Kenten, J.H., Leginus, J., Leland, J.K.,
Massey, R.J., Wohlstadter, S.J., 2003. Advanced Materials 15, 1184–1187.
Xu, Y., Jiang, Y., Cai, H., He, P.G., Fang, Y.Z., 2004. Analytica Chimica Acta 516, 19–27.
Xu, Y., Ye, X.Y., Yang, L., He, P.A., Fang, Y.Z., 2006. Electroanalysis 18, 1471–1478.
Yin, H., Zhou, Y., Zhang, H., Meng, X., Ai, S., 2012. Biosensors and Bioelectronics 33,
247–253.
Zhang, G.J., Chua, J.H., Chee, R.E., Agarwal, A., Wong, S.M., 2009. Biosensors and
Bioelectronics 24, 2504–2508.
Zhang, Q.D., Piro, B., Noel, V., Reisberg, S., Pham, M.C., 2011. Analyst 136, 1023–1028.
H.V. Tran et al. / Biosensors and Bioelectronics 49 (2013) 164–169 169