International Winter Wheat Improvement Program: breeding strategies and meth...ICARDA
A. Morgunov (CIMMYT-Turkey)
B. Akin (CIMMYT-Turkey),
Y. Kaya (B. Dagdas International Agric. Research Institute, Turkey)
M. Keser (ICARDA-Turkey)
K. Nazari (ICARDA-Syria)
Z. Mert (Central Field Crop Research Institute, Turkey),
R. Sharma (ICARDA-Uzbekistan)
T. Wuletaw (ICARDA-Syria)
Effective genes for resistance to wheat yellow rust and virulence of Puccinia...Atef Shahin
The objective of the study was to evaluate reaction of the differential set, isogenic line and Egyptian genotypes to identify the virulence of strpe rust pathogen and determine the effectiveness of resistance genes. Title: "Effective genes for resistance to wheat yellow rust and virulence of Puccinia striiformis f. sp. tritici in Egypt" Egypt. Acad. J. Biolog. Sci., 8(2):1-10 (2017).
Variation in the virulence of Magnaporthe grisea isolates adapted to finger m...ICRISAT
Finger millet is the fourth most important millet covering 10 % of the global millet area in over 25 countries in Asia and Africa. Though India is the leading producer of the crop with an area of 1.4 million ha and 2.0 million tons grain production. Its production is severely hampered by blast fungus Magnaporthe grisea which affects leaves, fingers, neck and discolors the seed; thus, significantly reducing the grain yield and quality. The average loss due to blast has been reported to be around 20-30% and could be as high as 80-90% in endemic areas. Recognizing the importance of finger millet and constraints posed by blast disease, present study was planned to characterize populations of M. grisea adapted to finger millet from diverse geographical locations with reference to pathogenicity of the isolates.
International Winter Wheat Improvement Program: breeding strategies and meth...ICARDA
A. Morgunov (CIMMYT-Turkey)
B. Akin (CIMMYT-Turkey),
Y. Kaya (B. Dagdas International Agric. Research Institute, Turkey)
M. Keser (ICARDA-Turkey)
K. Nazari (ICARDA-Syria)
Z. Mert (Central Field Crop Research Institute, Turkey),
R. Sharma (ICARDA-Uzbekistan)
T. Wuletaw (ICARDA-Syria)
Effective genes for resistance to wheat yellow rust and virulence of Puccinia...Atef Shahin
The objective of the study was to evaluate reaction of the differential set, isogenic line and Egyptian genotypes to identify the virulence of strpe rust pathogen and determine the effectiveness of resistance genes. Title: "Effective genes for resistance to wheat yellow rust and virulence of Puccinia striiformis f. sp. tritici in Egypt" Egypt. Acad. J. Biolog. Sci., 8(2):1-10 (2017).
Variation in the virulence of Magnaporthe grisea isolates adapted to finger m...ICRISAT
Finger millet is the fourth most important millet covering 10 % of the global millet area in over 25 countries in Asia and Africa. Though India is the leading producer of the crop with an area of 1.4 million ha and 2.0 million tons grain production. Its production is severely hampered by blast fungus Magnaporthe grisea which affects leaves, fingers, neck and discolors the seed; thus, significantly reducing the grain yield and quality. The average loss due to blast has been reported to be around 20-30% and could be as high as 80-90% in endemic areas. Recognizing the importance of finger millet and constraints posed by blast disease, present study was planned to characterize populations of M. grisea adapted to finger millet from diverse geographical locations with reference to pathogenicity of the isolates.
Inheritance of stem rust (Puccinia graminis Pers. F. Sp. Tritici ericks and E...Innspub Net
Stem rust disease caused by Puccinia graminis f.sp. tritici (Pgt) is currently one of the major biotic constraints in wheat (Triticum aestivum) production worldwide. Therefore, objectives of this study were (i) to identify resistant wheat lines with both adult plant resistance (APR) and seedling plant resistance (SPR), and (ii) to determine the kind of resistance to stem rust in KSL18, PCB52, PCB62 and PCB76 wheat lines. A collection of 100 wheat lines was evaluated in the field and greenhouse for stem rust resistance. The following four lines- KSL18, PCB52, PCB62 and PCB76 were identified as resistant and were crossed with known susceptible cultivars Kwale and
Duma. The resulting F1 hybrids and F2 populations alongside the parents were then tested in the greenhouse for response to the stem rust race TTKST. The selected wheat lines exhibited infection types ‘;’ to ‘2’ depicting resistance while Kwale and Duma depicted infection type ‘3+’ to TTKST. In the F2 populations evaluations that derived from Kwale × PCB52 indicated that the resistance is conferred by a single dominant gene. However, all other F2 populations showed that the resistance was conferred by two genes complementing each other (duplicate recessive epistasis) thus the ratios 9R: 7S. These identified resistant lines could be evaluated for other qualities and passed as potential varieties or used as sources of valuable stem rust resistance. Get more articles at: http://www.innspub.net/volume-7-number-4-october-2015-ijaar/
Genetics of Yellow Rust Resistance in WheatAnu Naruka
Wheat is a major staple food of world population and occupies about 21.8 % of total cultivated area accounting for 35.5 % of total food grain production at global level. Wheat is the second most important cereal of India. India is a major producer of wheat, accounting for about 13.2 percent of the world tonnage. India’s share in global exports during the year 2014-15 was 1.8 percent (Anonymous, 2016)
ABSTRACT- A field trial comprising eight sorghum varieties (as treatments) arranged in a randomized complete block design with four replicates was conducted in a Striga infested plot for two consecutive seasons (2006/07 and 2007/08) at Damazin (Lat. 11º 47' N, Long. 34º 21' E); Agricultural Research Station farm in the Sudan. Objectives of the trial were to determine resistance, tolerance and susceptibility of five sorghum genotypes on basis of the population of Striga plants and grain yield of the crops. The five sorghum genotypes namely Wad Ahmed, Arfa Gadamak, Sham sham, Korokolo, and Moheireiba were compared in Striga population and sorghum grain yield with those of SRN 39, Um Bineine 7 and Tabat. Sorghum cultivars: SRN 39, Um Bineine 7 and Tabat were the Striga resistant, tolerant and susceptible checks respectively. Soil type of the trial was predominantly vertisol with decreasing nitrogen and organic matter contents corresponding to the consecutive seasons 2006/07 and 2007/08 during which the trial was conducted. Results obtained from correlating the population of Striga plants with sorghum grain yield of the various tested sorghum genotypes (Wad Ahmed, Arfa Gadamak, Sham sham, Korokolo and Moheireiba) with the checks showed that Wad Ahmed, Korokolo and Moheireiba were resistant while Arfa Gadamak was tolerant to the parasite [Striga hermonthica (Del.) Benth].
Key-words- Sorghum (Sorghum bicolor); Cultivars; Resistance; Susceptibility; Tolerance; Witch weed (Striga sp)
Detection of ug99_in_egypt_bgri2015_austrilia_atef_shahinAtef Shahin
Wheat stem rust caused by Puccinia graminis f. sp. tritici = Pgt play an important role in wheat production throughout the world with rusts disease of wheat (Triticum aestivum L.).
Identification of Resistance Gene Analogs (RGAs) linked to Powdery Mildew Res...AM Publications
Powdery Mildew caused by Erysiphe pisi, is one of the most common fungal disease in garden peas
worldwide. As studied, few pea plants are resistance for powdery mildew and few pea plants are susceptible for
powdery mildew disease. All the resistance variety plants contains resistance genes (R-genes), which are the genes in
plant genomes that conveys plant disease resistance against pathogens by producing R-proteins. Most of resistance
genes encode highly conserved nucleotide binding site and leucine rich repeat structure (NBS-LRR) which helps to
isolate specific gene linked to powdery mildew. Degenerative primers based on NBS conserved motif of NBS-LRR
resistance protein can be used as molecular RGA markers in PCR amplification for cloning of resistance genes. Later
on the screening of genotype with degenerative primers can be done for both resistance genotype and susceptible
genotype in order to identifying resistance gene in resistance genotype. Based on resistance gene sequence RGAs
were identified, these RGAs would help in identifying marker linked to Powdery mildew resistance and improvise in
further Peas Marker Assisted Selection.
Richard's entangled aventures in wonderlandRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
Inheritance of stem rust (Puccinia graminis Pers. F. Sp. Tritici ericks and E...Innspub Net
Stem rust disease caused by Puccinia graminis f.sp. tritici (Pgt) is currently one of the major biotic constraints in wheat (Triticum aestivum) production worldwide. Therefore, objectives of this study were (i) to identify resistant wheat lines with both adult plant resistance (APR) and seedling plant resistance (SPR), and (ii) to determine the kind of resistance to stem rust in KSL18, PCB52, PCB62 and PCB76 wheat lines. A collection of 100 wheat lines was evaluated in the field and greenhouse for stem rust resistance. The following four lines- KSL18, PCB52, PCB62 and PCB76 were identified as resistant and were crossed with known susceptible cultivars Kwale and
Duma. The resulting F1 hybrids and F2 populations alongside the parents were then tested in the greenhouse for response to the stem rust race TTKST. The selected wheat lines exhibited infection types ‘;’ to ‘2’ depicting resistance while Kwale and Duma depicted infection type ‘3+’ to TTKST. In the F2 populations evaluations that derived from Kwale × PCB52 indicated that the resistance is conferred by a single dominant gene. However, all other F2 populations showed that the resistance was conferred by two genes complementing each other (duplicate recessive epistasis) thus the ratios 9R: 7S. These identified resistant lines could be evaluated for other qualities and passed as potential varieties or used as sources of valuable stem rust resistance. Get more articles at: http://www.innspub.net/volume-7-number-4-october-2015-ijaar/
Genetics of Yellow Rust Resistance in WheatAnu Naruka
Wheat is a major staple food of world population and occupies about 21.8 % of total cultivated area accounting for 35.5 % of total food grain production at global level. Wheat is the second most important cereal of India. India is a major producer of wheat, accounting for about 13.2 percent of the world tonnage. India’s share in global exports during the year 2014-15 was 1.8 percent (Anonymous, 2016)
ABSTRACT- A field trial comprising eight sorghum varieties (as treatments) arranged in a randomized complete block design with four replicates was conducted in a Striga infested plot for two consecutive seasons (2006/07 and 2007/08) at Damazin (Lat. 11º 47' N, Long. 34º 21' E); Agricultural Research Station farm in the Sudan. Objectives of the trial were to determine resistance, tolerance and susceptibility of five sorghum genotypes on basis of the population of Striga plants and grain yield of the crops. The five sorghum genotypes namely Wad Ahmed, Arfa Gadamak, Sham sham, Korokolo, and Moheireiba were compared in Striga population and sorghum grain yield with those of SRN 39, Um Bineine 7 and Tabat. Sorghum cultivars: SRN 39, Um Bineine 7 and Tabat were the Striga resistant, tolerant and susceptible checks respectively. Soil type of the trial was predominantly vertisol with decreasing nitrogen and organic matter contents corresponding to the consecutive seasons 2006/07 and 2007/08 during which the trial was conducted. Results obtained from correlating the population of Striga plants with sorghum grain yield of the various tested sorghum genotypes (Wad Ahmed, Arfa Gadamak, Sham sham, Korokolo and Moheireiba) with the checks showed that Wad Ahmed, Korokolo and Moheireiba were resistant while Arfa Gadamak was tolerant to the parasite [Striga hermonthica (Del.) Benth].
Key-words- Sorghum (Sorghum bicolor); Cultivars; Resistance; Susceptibility; Tolerance; Witch weed (Striga sp)
Detection of ug99_in_egypt_bgri2015_austrilia_atef_shahinAtef Shahin
Wheat stem rust caused by Puccinia graminis f. sp. tritici = Pgt play an important role in wheat production throughout the world with rusts disease of wheat (Triticum aestivum L.).
Identification of Resistance Gene Analogs (RGAs) linked to Powdery Mildew Res...AM Publications
Powdery Mildew caused by Erysiphe pisi, is one of the most common fungal disease in garden peas
worldwide. As studied, few pea plants are resistance for powdery mildew and few pea plants are susceptible for
powdery mildew disease. All the resistance variety plants contains resistance genes (R-genes), which are the genes in
plant genomes that conveys plant disease resistance against pathogens by producing R-proteins. Most of resistance
genes encode highly conserved nucleotide binding site and leucine rich repeat structure (NBS-LRR) which helps to
isolate specific gene linked to powdery mildew. Degenerative primers based on NBS conserved motif of NBS-LRR
resistance protein can be used as molecular RGA markers in PCR amplification for cloning of resistance genes. Later
on the screening of genotype with degenerative primers can be done for both resistance genotype and susceptible
genotype in order to identifying resistance gene in resistance genotype. Based on resistance gene sequence RGAs
were identified, these RGAs would help in identifying marker linked to Powdery mildew resistance and improvise in
further Peas Marker Assisted Selection.
Richard's entangled aventures in wonderlandRichard Gill
Since the loophole-free Bell experiments of 2020 and the Nobel prizes in physics of 2022, critics of Bell's work have retreated to the fortress of super-determinism. Now, super-determinism is a derogatory word - it just means "determinism". Palmer, Hance and Hossenfelder argue that quantum mechanics and determinism are not incompatible, using a sophisticated mathematical construction based on a subtle thinning of allowed states and measurements in quantum mechanics, such that what is left appears to make Bell's argument fail, without altering the empirical predictions of quantum mechanics. I think however that it is a smoke screen, and the slogan "lost in math" comes to my mind. I will discuss some other recent disproofs of Bell's theorem using the language of causality based on causal graphs. Causal thinking is also central to law and justice. I will mention surprising connections to my work on serial killer nurse cases, in particular the Dutch case of Lucia de Berk and the current UK case of Lucy Letby.
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
A brief information about the SCOP protein database used in bioinformatics.
The Structural Classification of Proteins (SCOP) database is a comprehensive and authoritative resource for the structural and evolutionary relationships of proteins. It provides a detailed and curated classification of protein structures, grouping them into families, superfamilies, and folds based on their structural and sequence similarities.
Slide 1: Title Slide
Extrachromosomal Inheritance
Slide 2: Introduction to Extrachromosomal Inheritance
Definition: Extrachromosomal inheritance refers to the transmission of genetic material that is not found within the nucleus.
Key Components: Involves genes located in mitochondria, chloroplasts, and plasmids.
Slide 3: Mitochondrial Inheritance
Mitochondria: Organelles responsible for energy production.
Mitochondrial DNA (mtDNA): Circular DNA molecule found in mitochondria.
Inheritance Pattern: Maternally inherited, meaning it is passed from mothers to all their offspring.
Diseases: Examples include Leber’s hereditary optic neuropathy (LHON) and mitochondrial myopathy.
Slide 4: Chloroplast Inheritance
Chloroplasts: Organelles responsible for photosynthesis in plants.
Chloroplast DNA (cpDNA): Circular DNA molecule found in chloroplasts.
Inheritance Pattern: Often maternally inherited in most plants, but can vary in some species.
Examples: Variegation in plants, where leaf color patterns are determined by chloroplast DNA.
Slide 5: Plasmid Inheritance
Plasmids: Small, circular DNA molecules found in bacteria and some eukaryotes.
Features: Can carry antibiotic resistance genes and can be transferred between cells through processes like conjugation.
Significance: Important in biotechnology for gene cloning and genetic engineering.
Slide 6: Mechanisms of Extrachromosomal Inheritance
Non-Mendelian Patterns: Do not follow Mendel’s laws of inheritance.
Cytoplasmic Segregation: During cell division, organelles like mitochondria and chloroplasts are randomly distributed to daughter cells.
Heteroplasmy: Presence of more than one type of organellar genome within a cell, leading to variation in expression.
Slide 7: Examples of Extrachromosomal Inheritance
Four O’clock Plant (Mirabilis jalapa): Shows variegated leaves due to different cpDNA in leaf cells.
Petite Mutants in Yeast: Result from mutations in mitochondrial DNA affecting respiration.
Slide 8: Importance of Extrachromosomal Inheritance
Evolution: Provides insight into the evolution of eukaryotic cells.
Medicine: Understanding mitochondrial inheritance helps in diagnosing and treating mitochondrial diseases.
Agriculture: Chloroplast inheritance can be used in plant breeding and genetic modification.
Slide 9: Recent Research and Advances
Gene Editing: Techniques like CRISPR-Cas9 are being used to edit mitochondrial and chloroplast DNA.
Therapies: Development of mitochondrial replacement therapy (MRT) for preventing mitochondrial diseases.
Slide 10: Conclusion
Summary: Extrachromosomal inheritance involves the transmission of genetic material outside the nucleus and plays a crucial role in genetics, medicine, and biotechnology.
Future Directions: Continued research and technological advancements hold promise for new treatments and applications.
Slide 11: Questions and Discussion
Invite Audience: Open the floor for any questions or further discussion on the topic.
What is greenhouse gasses and how many gasses are there to affect the Earth.moosaasad1975
What are greenhouse gasses how they affect the earth and its environment what is the future of the environment and earth how the weather and the climate effects.
Cancer cell metabolism: special Reference to Lactate PathwayAADYARAJPANDEY1
Normal Cell Metabolism:
Cellular respiration describes the series of steps that cells use to break down sugar and other chemicals to get the energy we need to function.
Energy is stored in the bonds of glucose and when glucose is broken down, much of that energy is released.
Cell utilize energy in the form of ATP.
The first step of respiration is called glycolysis. In a series of steps, glycolysis breaks glucose into two smaller molecules - a chemical called pyruvate. A small amount of ATP is formed during this process.
Most healthy cells continue the breakdown in a second process, called the Kreb's cycle. The Kreb's cycle allows cells to “burn” the pyruvates made in glycolysis to get more ATP.
The last step in the breakdown of glucose is called oxidative phosphorylation (Ox-Phos).
It takes place in specialized cell structures called mitochondria. This process produces a large amount of ATP. Importantly, cells need oxygen to complete oxidative phosphorylation.
If a cell completes only glycolysis, only 2 molecules of ATP are made per glucose. However, if the cell completes the entire respiration process (glycolysis - Kreb's - oxidative phosphorylation), about 36 molecules of ATP are created, giving it much more energy to use.
IN CANCER CELL:
Unlike healthy cells that "burn" the entire molecule of sugar to capture a large amount of energy as ATP, cancer cells are wasteful.
Cancer cells only partially break down sugar molecules. They overuse the first step of respiration, glycolysis. They frequently do not complete the second step, oxidative phosphorylation.
This results in only 2 molecules of ATP per each glucose molecule instead of the 36 or so ATPs healthy cells gain. As a result, cancer cells need to use a lot more sugar molecules to get enough energy to survive.
Unlike healthy cells that "burn" the entire molecule of sugar to capture a large amount of energy as ATP, cancer cells are wasteful.
Cancer cells only partially break down sugar molecules. They overuse the first step of respiration, glycolysis. They frequently do not complete the second step, oxidative phosphorylation.
This results in only 2 molecules of ATP per each glucose molecule instead of the 36 or so ATPs healthy cells gain. As a result, cancer cells need to use a lot more sugar molecules to get enough energy to survive.
introduction to WARBERG PHENOMENA:
WARBURG EFFECT Usually, cancer cells are highly glycolytic (glucose addiction) and take up more glucose than do normal cells from outside.
Otto Heinrich Warburg (; 8 October 1883 – 1 August 1970) In 1931 was awarded the Nobel Prize in Physiology for his "discovery of the nature and mode of action of the respiratory enzyme.
WARNBURG EFFECT : cancer cells under aerobic (well-oxygenated) conditions to metabolize glucose to lactate (aerobic glycolysis) is known as the Warburg effect. Warburg made the observation that tumor slices consume glucose and secrete lactate at a higher rate than normal tissues.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
1. Genetics and Breeding for Stripe Rust Resistance in Bread Wheat
Cultivars in Egypt
2nd International and 3rd National Conference on Recent Advances in Drug Discovery and Development, 15-16 NOVEMBER 2023, The
University of Lahore, Pakistan.
By
Prof. Dr. Atef A. Shahin
Head of Wheat Diseases Dept.,
Department of Wheat Diseases Research,
Plant Pathology Research Institute (PPRI),
ARC, Egypt
E-mail: a.a.shahin@hotmail.com, a.shahin@arc.sci.eg
CAUTION:- Increasing risk of stripe (yellow) rust outbreaks North Africa to South Asia
2.
3. The production of bread wheat is threatened by many biotic (diseases, insect pests, and
weeds) and abiotic (moisture stress, low soil fertility, repeated drought, and others)
problems, the most significant that is yellow or stripe rust caused by Puccinia striiformis f.
sp. tritici.
Wheat is one of
approximately 300,000
potentially edible plant
species, of which just
over 100 are commonly
cultivated (Fig. 1.1). Of
these just three – maize,
rice, and wheat – provide
nearly 60% of all human
calories and wheat alone
provides approximately
20% of all calories and
protein.
Wheat is a staple for both rich and poor
4. Typical stripe rust symptoms on the seedling and adult-plant leaves stage , spike 4
seedling leaves stage
5. Country /Year Crop losses Millions $
USA 2000-07
2010
6.5 million tones
2.2 millions tones $US 30 Washington State
Australia 2003-2006 AU$ 30-90
Australia 2009 AU$ 127
China 1950
64, 90,02
14.4 million tones
More than 20 million
Turkey 1992
1996
2000
2009-10
26.5% (Gereck > 1 m ha)
1.2 million tones
3% Gerek 79
568
53
10
Iran 1992-94
2007 and 09
2010
2.5 milliom tones
2 million ha
650.000 ha spray
258
?
?
Syria 2010 Cham 8 (80% yield loss) 80% of Area
Ethiopia 2010 $US 3.2 in fungicide application in
Ethiopia
Pakistan 2005 $100 million USD**
During the last decades, several yellow rust epidemics in most of the
wheat-growing areas
The last dramatic epidemic took place in 1997 in which stripe rust and national average loss in grain yield ranged from 14 % -
20 % in Delta region (El-Daoudi et al., 1998), Recently in 2020, Losses in grain yield per plot was 37.72% and 69.33% during
2018 and 2019 growing seasons, respectively at the Delta region in Egypt. The highest grain yield losses were recorded with
wheat cvs.; Gemmeiza 11 (Shahin et al., 2020).
* DOI: https://doi.org/10.3329/bjb.v51i4.63481 5
6. • Stripe (Yellow) rust and Virulence trends;
Yr9 (1990)
Yr27 aggressive race since 2010
Yr32 race 2014
Warrior race since 2015
A unique race of the wheat stripe rust
pathogen (2019)
Yr10 race 2022
Pathogenic variabilities: race analysis
• Yellow : Yr27 race and Warrior (Avirulence/ Virulence formula)
• 2+, 5,10,15 / 1, 2, 3, 4, 6, 7, 8, 9, 17, 25, 27, 32, Sp, Su
6
Aggressive yellow rusts
• The Warrior-type race of yellow rust was first found back in 2011 and it is
virulent against a wider range of resistance genes.
Warrior-type race
The Wheat Disease Research Department , at the Sakha Agriculture Research Station, Plant Pathology Research Institute (PPRI), Agricultural
Research Center (ARC), Egypt discovered the novel P. striiformis race. , 2019
7. SCIENCE AND TECHNOLOGY
AARHUS UNIVERSITY
Report for Puccinia striiformis race analyses 2013, Global Rust Reference Center
(GRRC), Denmark. January 31, 2014.
Race identification by GRRC (Denmark)
GRRC race analyses of Puccinia striiformis in 2012 and 2013
-,-,-,-,-,6,7,-,-,-,-,-,-,-,-,-,AVS,-
-,2,-,-,-,6,7,-,-,-,-,-,-,-,-,-,AVS,-
-,(2),-,-,-,6,7,9,-,-,-,-,25,27,-,-,AVS,-
×
Yr 27 virulent strain of yellow rust has caused significant losses in some countries in
North Africa, Near East and Central and South Asia during the serious epidemics in
2009, 2010 and 2013
7
8.
9. Adult plant infection type
Resistant
Susceptible Intermediate
Stripe Rust Reaction
9
0
10
20
30
40
50
60
70
80
90
Old race Yr27 race Warrior race
Stripe rust severity of selected wheat
genotypes inoculated with old races, Yr27
race and warrior races at adult stage.
11. Yellow rust reaction during 2018/2019
growing season for the two inbred line
(IL) populations Gemmeiza11/Avocet S
and Sids12/Avocet S developed by
wheat research section at Sakha
Agricultural Research Station.
inbred line (IL) populations stripe rust field
reaction
The adult plant field response to stripe rust under field condition for the two Egyptian bread wheat
cultivars Sids12 and Gemmeiza11, four monogenic lines and their eight F1 crosses.
Cross name
Adult plant field response to stripe rust‡
P1 P2 F1
Sids12//Yr5/6* Avocet S S R R
Sids12//Yr10/6* Avocet S S R R
Sids12//lYr15/6* Avocet S S R R
Sids12//YrSp/6* Avocet S S MRMS R
Gemmeiza11//Yr5/6* Avocet S S R R
Gemmeiza11//Yr10/6* Avocet S S R R
Gemmeiza11//Yr15/6* Avocet S S R R
Gemmeiza11//YrSp/6* Avocet S S MRMS MR
‡ R= resistance, MR= moderately resistance, MS= moderately susceptible and S = susceptible .
12. Adult plant response for stripe rust, observed hypothetical ratios, chi-square and probability
values for nine wheat F2 populations inoculated with Pst under field conditions.
Cross
No. of plants
Ratio 2 P. value
Number of
genes and
mode of
inheritance†
Resistant Susceptible Total
Sids12//Yr5/6* Avocet S 214 19 233 15 : 1 1.44 0.23 2D
Sids12//Yr10/6* Avocet S 170 93 263 11 : 5 2.07 0.15 1R, 1D
Sids12//Yr15/6* Avocet S 266 30 296 57 : 7 0.20 0.66 3D
Sids12//YrSp/6* Avocet S 226 92 318 11 : 5 0.80 0.37 1R, 1D
Gemmeiza11//Yr5/6* Avocet S 218 28 246 57 : 7 0.02 0.89 3D
Gemmeiza11//Yr10/6* Avocet S 172 54 226 3 : 1 0.15 0.70 1D
Gemmeiza11//Yr15/6* Avocet S 178 35 213 13 : 3 0.75 0.39 1R, 1D
Gemmeiza11//YrSp/6* Avocet S 110 122 232 7 : 9 1.27 0.30 2R
†D = dominant and R = recessive. Interpretation for some ratios can be found in Fasoulas (1980).
13. Cross name
No. of
planted F3
families++
Total no.
of plants
No. of
selected
zero type
plants*
No. of
nun-
segregati
ng zero
type
families
Percentage
of zero
type
plants/cros
s
Percentage
of zero type
plants/
cultivar
Sids12//Yr5/6* Avocet S 10 141 57 1 40
29
Sids12//Yr10/6* Avocet S 3 47 10 0 21
Sids12//lYr15/6* Avocet S 5 78 20 0 26
Sids12//YrSp/6* Avocet S 10 115 24 0 21
Gemmeiza11//Yr5/6* Avocet S 10 99 35 1 35
27
Gemmeiza11//Yr10/6* Avocet S 5 71 24 0 34
Gemmeiza11//Yr15/6* Avocet S 10 136 29 0 21
Gemmeiza11//YrSp/6* Avocet S 10 128 28 0 22
Total 63 815 227 2 -
Number of resistant plants selected from F3 families during the wheat growing season 2019/2020.
++ Selected F2 plants are resistance and phenotypically similar to the commercial cultivar.
*The selected plants have the same reaction like the monogenic line (zero type).
15. Molecular characterization of wheat germplasm for strip
resistance genes (Yr5 , Yr10 and Yr15)
A yellow rust resistance genes, Yr5 , Yr10, Yr15 shows immunity or high resistance to all
races . Establishment of DNA Markers for Yr5,Yr10,Yr15 genes facilitated marker assisted
selection and gene pyramiding in breeding programs.
Molecular characterization and identification of candidate lines for stripe rust
resistance genes Yr5 , Yr10 , Yr15 depicted that genes Yr5 was found in 640 entries ,
Yr10 in 272 entries , Yr15 in 306 entries including the reference lines , while the
susceptible control didn’t amplify any of the resistance genes used in the study . single
gene-based resistance was detected in 347 entries , two genes in 132 entries .
16. No.
Stripe
rust
resistan
ce gene
Details of primer
sequences
Type of
primer
Allele
size
(bp)
References
1 Yr5
Sequence(5’-3’)
Sequence(5’-3’)
GTACAATTCACCTAGAGT
GCAAGTTTTCTCCCTATT
STS-7
STS-8
490 Chen et al
2 Yr10
Forward sequence
(5’-3’)
Reverse sequence
(5’-3’)
GCAGACCTGTGTCATTGGTC
GATATAGTGGCAGCAGGATA
Xpsp3000 230 Wang et al
3 Yr15
Forward sequence
(5’-3’)
Reverse sequence
(5’-3’)
GCGGGAATCATGCATAGGAA
AGAA
GCGGGGGCGAAACATACACA
AAAACA
Xbarc8 230 Yaniv et al
Sequences (F/R) of SSR marker used for 3 yellow rust
resistance genes.
17. The gene Yr5 was detected in 260 including 91 cultivar carrying Yr5 in heterozygous
condition. The stripe rust resistance gene by investigating two codominant STS
primers YrSTS7/8 and YrSTS9/10 in 640 entries , it has been concluded that these
markers are completely linked to Yr5. Based on epidemiological studies, Yr5 was
found effective against all rust virulent races.
STS primers marker, YrSTS7/8 and YrSTS9/10 analyses revealed that, out of
the tested genotypes 91 cultivar carrying Yr5 showed an indicative band
for Y5
18. The stripe rust resistance gene Yr10 was molecularly validated in 199 entries
. of which 11 cultivars were heterozygous , From 640 entries . the Xpsp3000
marker is suitable for identifying resistant genotypes at different plant growth
stages. designed two primer pairs (Yr10 F/R & Yr10 F1/R1) based on the
Yr10 sequence and produced markers completely linked to Yr10 .the findings
reported that varieties with gene Yr10 amplify a 230-bps fragment and those
lacking this gene amplify only 190 bps band fragment, which is confirmed in
the present investigation.
19. The stripe rust resistance gene Yr15 was detected in 152 entries , depicting
heterozygous condition of this gene in 32 genotypes producing both resistance and
susceptibility specific fragments as heterozygotes .Xbarc8 was used which showed
the presence of Yr15 gene in 306 entries. So, this gene was present in maximum
cultivars showing its effectiveness against the predominant and virulent pathogen.
PCR amplification of Yr15 gene by using Xbarc8, which produces two fragments, viz., 230 bp
as resistant and 200 bp as susceptible.
21. Conclusion
• Close cooperation between (the wheat pathologists, wheat breeders) in Egypt and International research
center and labs, e.g. ICARDA, CIMMYT, GRRC, and USDA,. Such cooperation includes exchange and improved
crop genotypes, sharing of good practices, and joint training.
• Close cooperation between the wheat pathologists in Egypt and International research center and labs, e.g.
Global rust reference center (GRRC), led to confirm observe of a new novel race of wheat stripe rust- in
Egypt, 2019.
• Race analysis results indicated the presence the Yr27 virulence (2010), the Warrior-races was detected in
Egypt (2015), in addition to and YrSp virulence race. Recently, detection of Yr10 virulence race (2022) in
Egypt.
• Despite of presence of Warrior-races and new aggressive race in Egypt, high level of stripe rust resistance is
observed on most of the Egyptian wheat promising lines.
• The strip rust resistant genes Yr5, Yr10, Yr15, Yr51, Yr57 and Yrkk were effective against the dominating Pst
races in Egypt.
• Close cooperation has been established in Egypt between wheat breeders and wheat pathologist from long
time ago, generated a good system for rust diseases breeding. Recently, breeders and pathologists now use
the effective genes to develop wheat varieties to enhance resistance for the dominating stripe rust races in
Egypt.
27. You need to do is hard work to achieve your dream
That's my constructive advice to you today
Egyptian chemist Noble prize-winner The world's most famous football player
28. Acknowledgements
• Agricultural Research Center, ARC, Egypt.
• Department of Wheat Diseases Research,
• Plant Pathology Research Institute (PPRI)
• The University of Lahore
• Prof. Dr. Mohammad Ashraf, H.I.SI. POP, Rector University of Lahore, Pakistan
• Prof. Dr. Ahsan Sheikh, Director Immb/CRiMM, University of Lahore, Pakistan
Dr. Asma Ahmed, and Dr. Anam Naz, Lahore University, Pakistan
Rehana Badar, Lahore University, Pakistan
Prof. Dr. Adel Hagras, ARC, Egypt
Dr. Khaled E. Ragab, ARC, Egypt
Dr. Sedahom A. Abdelkhalik, ARC, Egypt
Thanks to all the people who have contributed to organizing this
great event
2nd International and 3rd National Conference on Recent Advances in Drug Discovery and Development, 15-16 NOVEMBER 2023, The
University of Lahore, Pakistan.
Thanks for your attention