HMSV 346 Diversity Issues in Human Services / Spring 2021
1/2
(George Floyd) Advocacy Project
Objective: Students will understand the importance of advocacy and develop the attitude, knowledge, and
skills needed to effectively advocate on behalf of oppressed or marginalized groups.
Background: A few months ago, George Floyd died when four Minneapolis police officers were trying to
subdue and arrest him. His death, which was caught on video, raised the now common concerns about
police brutality towards African Americans, and ignited protests, unrest, and debate throughout the country.
Personal and Professional Relevance: Such incidents (the death of Floyd and others) and subsequent
chain of events impact you in two distinct ways:
• As an individual bound by your personal identities, thoughts, values, etc.,
• As a soon-to-be human service professional bound by a professional code of ethics.
While your reactions to these events as an individual are quite likely to be emotional and subjective, it is
essential that as a human service professional you maintain objectivity in understanding and addressing
these events. The primary objective of this project is to develop fundamental skills necessary to advocate
on behalf of an oppressed or marginalized group. Successful completion of this project/assignment requires
you to answer the following questions and complete the following parts:
Part I
1. What is your personal reaction, thoughts, feelings, etc. about such incidents?
2. There are various perspectives about who is responsible for such incidents:
a. Some claim that incidents such as these are caused by those (some African Americans) who violate
the law or disobey the lawful orders of cops.
b. Others claim that such situations are caused by those racists (some cops) who are ready to inflict
violence on African Americans at the slightest pretext or for no reason whatsoever.
c. Some believe that such incidents happen because of a combination of both (a) and (b).
d. A few believe that it is neither a, b, nor c, but there are other or more reasons for why such
incidents happen.
What is your personal opinion about the reason(s) for such incidents? Choose only one of the above (a, b, c,
or d) and elaborate.
Part II
3. Are such incidents relevant to human services practice with clients? In other words, are incidents such
as these likely to impact certain groups of clients?
• If yes, then elaborate upon these impacts/consequences.
• If no, then provide a strong justification for your answer.
4. Human service professionals are required to consider the National Organization of Human Services’
ethical standards in professional decision making. Identify which ethical standards may apply to
understanding and addressing such incidents (Hint: Check out the standards pertaining to
Responsibi ...
Civic Engagement Letter CHDV 3210Due Dates Draft due Mon.docxrichardnorman90310
Civic Engagement Letter
CHDV 3210
Due Dates
Draft due Monday, 11/7 by 11:59pm
Final Submission due Monday, 12/5 by 11:59pm
Letter must be mailed or emailed to representative by Tuesday, 12/13
Instructions: Students will write a one-page advocacy letter to an elected official about an important community issue. Students must use the template provided or receive approval in advance for another format.
Your letter should:
a) Identity an important issue that affects families within a chosen community. What issue are you addressing?
b) Identify an appropriate elected official at the county, state, or national level; appropriate meaning someone in a position that can address your issue. In your letter, note the official’s correct title and their full name.
c) Describe how the issue affects children and families. Be specific!
d) Provide at least ONE key statistic AND empirical research to support your argument. Must include APA citation within your paragraph and include the reference at the bottom of the letter.
e) Describe specific actions you would like the elected official to take to address this family centered issue. What solution(s) are you proposing they take?
f) Date should be included at top of letter; at bottom of letter sign and print your name
g) Letter must meet appropriate length requirement of one page with 4 paragraphs, following the provided template.
h) Letter must be spell-checked and make grammatical sense.
i) Letter should be typed, single-spaced, use appropriate font (Times/Times New Roman, 12 point). Note that the appropriate spacing for each paragraph should follow the template: do not indent the start of each paragraph and use one line spacing in between paragraphs.
*The formatting guidelines for a letter are different from what I usually require for a paper.
**Use the template on the following page.
_________________________(Your full name)
_________________________(Your mailing address)
_________________________
Month day, year
Dear _________________ ___________________,
(Person’s Title) (Person’s Full Name)
Paragraph 1 – The Introduction: Briefly describe the problem and what action(s) you want your political representative to take to address it. (Three to four sentences). ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ Paragraph 2 – The Issue: Describe in detail how the problem affects children and families. Be specific by giving a(n) example(s)! Include one statistic AND empirical research to support your argument. Use APA format. (Four to five sentences). ______________________________________________________________________________ __________________________________________________________________.
Assignment 3 Single Line Diagram Systemmellies4kxl
Assignment 3
Single Line Diagram
System Data
MVAbase=100 KVbase=230
P1== Slack Bus PG2=50MW PG3=60 MW
PLoad 4=70 MW and QLoad4=70MW
PLoad 5=70 MW and QLoad5=70MW
PLoad 6=70 MW and QLoad6=70MW
V1=1.05+0i V2mag=1.05 V3mag=1.07
Line data
The Assignment:
Use 10 iterations to find the load flow solution, and show results on the single line diagram.
From To R X Bcap (Half)
1 2 0.1 0.2 0.02
1 4 0.05 0.2 0.02
1 5 0.08 0.3 0.03
2 3 0.05 0.25 0.03
2 4 0.05 0.1 0.01
2 5 0.1 0.3 0.02
2 6 0.07 0.2 0.025
3 5 0.12 0.26 0.025
3 6 0.02 0.1 0.01
4 5 0.2 0.4 0.04
5 6 0.1 0.3 0.03
ENG 315
Due Week 2 and worth 100 points
Choose one of the professional scenarios provided in Blackboard under the Course Info tab, or click here to view them in a new window.
Write a Professional Email Message (in the form of Figure 5.1 on page 84 of BCOM9) from the perspective of a character in the scenario. The email should discuss the communication issue provided in the scenario and should be addressed to another character from the scenario.
The message should take the form of an email; however, you will submit your assignment to the online course shell.
The professional email message must adhere to the following requirements:
1. Content:
Address the communication issue from the scenario.
Request a face-to-face meeting to discuss the issue (at a specific time).
Concentrate on the facts of the situation and avoid using overly emotional language.
Assume your recipient is learning about the situation for the first time through your communication.
2. Format:
Use a descriptive subject line or heading.
Include an appropriate and professional greeting / salutation.
Use email form including: To:, From:, Subject:, and Signature.
3. Clarity / Mechanics:
Focus on clarity, writing mechanics, and professional language/style requirements.
Run spell/grammar check before submitting.
4. Your assignment must:
This course requires use of Strayer Writing Standards (SWS). The format is different than other Strayer University courses. Please take a moment to review the SWS documentation for details.
5. Submitting your assignment:
Submit your assignment through the online course shell only.
6. The specific course learning outcomes associated with this assignment are:
Plan, create, and evaluate professional documents.
Deliver professional information to various audiences using appropriate tone, style, and format.
Analyze professional communication examples to assist in revision.
To download the assignment instructions provided above and assignment rubric, click here.
By submitting this paper, you agree: (1) that you are submitting your paper to be used and stored as part of the SafeAssign™ services in accordance with the Blackboard Privacy Policy; (2) that your institution may use your paper in accordance with your institution's policies; and (3) that your use of SafeAssign will be without recourse against Blackboa ...
What Is Animal Cruelty and How Can We Stop It? Free Essay Example. Reasons of animal cruelty - Free Essay Example PapersOwl.com. Cruelty To Animals Essay / Animal Right Essay Essay On Animal Right For .... 015 Are Zoos Cruel To Wild Animals Essay Istock 140450813 Wide .... The definition of animal cruelty - Free Essay Example PapersOwl.com. Animal Cruelty Speech Essay Example. Types of Animal Cruelty Free Essay Sample on Samploon.com. Tips to Write Animal Cruelty Essay - FreeEducator.com. Animal Cruelty Essay Outline Inspirational 58 Essays Animal Rights .... Essay on Cruelty to Animals 1839: Buy Essay on Cruelty to Animals .... Buy Essay Papers Here - essay on society for prevention of cruelty to .... Cruelty to Animals Essay Essay on Cruelty to Animals Essay for .... Legislation for animal cruelty Free Essay Example. 001 Cruelty To Animals Essay Example Page 1 Thatsnotus. Frightening Essay On Cruelty Animals Thatsnotus. Animal cruelty argumentative essay. Cruelty to Animals Essay. 2022-10-28. Cruelty To Animals Essay usomakoni9. Essay of cruelty to the animals - facebookthesis.web.fc2.com. Animal Cruelty and Testing in the United States - Free Essay Example .... Cruelty to Animals Essay for Students in English Easy Words. Animal cruelty research paper. Animal Cruelty Essay: Most Exciting .... Expository essay: Cruelty towards animals essay. 005 Cruelty To Animals Essay Example Animal Rodeo Png Rights Persuasive .... 012 Cruelty To Animals Essay Example On Animal Abuse Of Farm Novel .... Animal Cruelty Essay Outline Elegant the Most Awesome Animals Speech .... Speech on Animal Cruelty Year 11 HSC - English as a Second Language .... Essay websites: Animal cruelty essay conclusion. Animal Cruelty - GCSE English - Marked by Teachers.com Cruelty To Animals Essay Cruelty To Animals Essay
1. Define the term rape culture. Identify three examples of rape c.docxjeremylockett77
1. Define the term rape culture. Identify three examples of rape culture that you’ve observed in your life. What was the impact of these examples on your own life, or what do you think their impact is on young women? What messages are these examples saying about the value of girls and women in our society? Describe actions you can take as an individual to challenge rape culture. Finally, describe what we (as a society) need to do to eradicate rape culture. How would your life be different if rape culture didn’t exist?
2. Explain the term reproductive justice. Where did this term develop from? Name 4 issues that are part of the reproductive justice movement. Describe how the reproductive justice movement uses intersectionality to expand and challenge the “choice” narrative.
3. Identify a tv show, movie, or short film that you think adopts a feminist stance (i.e. a feminist perspective, way of looking at the world). Describe the characters and highlight what the show is doing right. Then, describe examples of stereotypes, myths, or misperceptions that might be problematic in the show. Who is the target audience of the show? Do you think that this show can have a positive impact on social change? Support your answer with specific examples. Did your own perceptions of this show change after participating in this class? If yes, how?
4. Identify 3 distinct types of privilege that are social constructed in our society today. Give examples that you’ve observed or are aware of that demonstrated each type of privilege you’ve identified. Then, describe steps you’d take to use that privilege for social change, using the principles of feminist praxis as described in our textbook.
ANTH DISCUSSION3
1. The following is the assignment criteria that was missed:
Note: Criteria in Black were correct, in Blue were partially incorrect, in Red were completely incorrect:
· Introduces/uses the concept of Filter Bubble
· Analysis of results using course concepts (Filter Bubble, Function Creep, Data Exhaust)
· Clear introduction and rationale of search criteria
· Shows understanding of/implications of a Filter Bubble
· Reasoning behind the selection of specific participants
· Personal observations on results
· Expectations/Reasoning around search criteria
· Conclusion supported by analysis and discussion
· Complete discussion of search results
· Well written with information presented logically and easy to follow
· Presents their participants’ demographic data
· Follows general expectation around layout/length
· Discusses the impact of their demographic data on their search results
· Follows Executive Summary parameters
· Table contains demographic data
· Thoughts on other things that might have influenced their search results (bonus)
· Table included within the document
· Big picture context on findings (bonus)
· Table referenced and used in discussion/analysis/conclusion
· Uses external resources for support (bonus)
- (C+ and below) Does not ...
Case StudyIn March 1994, Randal Schwartz was indicted on three f.docxwendolynhalbert
Case Study
In March 1994, Randal Schwartz was indicted on three felony counts under the Oregon State Computer Crime Law and sentenced to 5 years of probation. 480 hours of community service, 90 days of deferred jail time, $68,000 of restitution to Intel, and disclosure of full details surrounding conviction to any future employer. The complaint against Randal Schwartz was brought by Intel Corporation, a multinational microchip manufacturer. The charges related to altering two computer systems without authorization and accessing a computer with intent to commit theft. Randal Schwartz is a perfect example of someone who does not fit into the stereotype of hackers. Anyone familiar with Perl will know Schwartz as the author of the definitive Perl instruction guide, Learning Perl. Schwartz is a frequent columnist for such technical magazines as Unix Review and Web Techniques. Randal Schwartz was a consultant for Intel in Oregon for three years before the indictment. Schwartz’s crimes are a result of what he says were “good intentions.” Although Schwartz is well respected in the community, he has been criticized for his unprofessional and irresponsible conduct as a consultant, thus being subjected to a lot of controversy. Schwartz claimed that because of jos travels and invitations to lecture on Perl, he needed an easy way to access his e-mail at Intel. Without seeking requisite permissions, Schwartz modified the systems so as to access his account outside of the organization. He also installed the Crack software on the systems, which enabled him to capture nearly 50 passwords.
In his defense, Schwartz argued that he was merely helping the company by checking the security of systems. This could have been an excellent explanation except for the fact that in police reports. Randal told the officers that thought he could be criminally prosecuted for these incidents. “When asked why he stole 40 or 50 passwords. Schwartz told detectives. “I needed them in case they caught me doing it and I knew they would shut me down, so the more passwords I had, the longer I could continue doing what I wanted to do.” Schwartz also admitted that this wasn’t the first time he had done things against Intel’s policy. He had been previously caught accessing the systems from outside the company and had been warned on several occasions.
Schwartz Case Study
Organizations need to be concerned with breaches of security from internal sources as much (if not more) as from outside sources. Employees and consultants in an organization often need sensitive information. How can the organization provide access, but still protect against improper usage of this information?
Read the Case Study at the end of Chapter 10. With your group, act as hired consultants and write a 1- to 2-page group report that determines what steps you would recommend for the company to ensure that their security policies are not violated. One of the CEO's goals is to keep from burdening the employees with ...
1. Define the term rape culture. Identify three examples of rape c.docxstilliegeorgiana
1. Define the term rape culture. Identify three examples of rape culture that you’ve observed in your life. What was the impact of these examples on your own life, or what do you think their impact is on young women? What messages are these examples saying about the value of girls and women in our society? Describe actions you can take as an individual to challenge rape culture. Finally, describe what we (as a society) need to do to eradicate rape culture. How would your life be different if rape culture didn’t exist?
2. Explain the term reproductive justice. Where did this term develop from? Name 4 issues that are part of the reproductive justice movement. Describe how the reproductive justice movement uses intersectionality to expand and challenge the “choice” narrative.
3. Identify a tv show, movie, or short film that you think adopts a feminist stance (i.e. a feminist perspective, way of looking at the world). Describe the characters and highlight what the show is doing right. Then, describe examples of stereotypes, myths, or misperceptions that might be problematic in the show. Who is the target audience of the show? Do you think that this show can have a positive impact on social change? Support your answer with specific examples. Did your own perceptions of this show change after participating in this class? If yes, how?
4. Identify 3 distinct types of privilege that are social constructed in our society today. Give examples that you’ve observed or are aware of that demonstrated each type of privilege you’ve identified. Then, describe steps you’d take to use that privilege for social change, using the principles of feminist praxis as described in our textbook.
ANTH DISCUSSION 3
1. The following is the assignment criteria that was missed:
Note: Criteria in Black were correct, in Blue were partially incorrect, in Red were completely incorrect:
· Introduces/uses the concept of Filter Bubble
· Analysis of results using course concepts (Filter Bubble, Function Creep, Data Exhaust)
· Clear introduction and rationale of search criteria
· Shows understanding of/implications of a Filter Bubble
· Reasoning behind the selection of specific participants
· Personal observations on results
· Expectations/Reasoning around search criteria
· Conclusion supported by analysis and discussion
· Complete discussion of search results
· Well written with information presented logically and easy to follow
· Presents their participants’ demographic data
· Follows general expectation around layout/length
· Discusses the impact of their demographic data on their search results
· Follows Executive Summary parameters
· Table contains demographic data
· Thoughts on other things that might have influenced their search results (bonus)
· Table included within the document
· Big picture context on findings (bonus)
· Table referenced and used in discussion/analysis/conclusion
· Uses external resources for support (bonus)
- (C+ and below) Does no.
Civic Engagement Letter CHDV 3210Due Dates Draft due Mon.docxrichardnorman90310
Civic Engagement Letter
CHDV 3210
Due Dates
Draft due Monday, 11/7 by 11:59pm
Final Submission due Monday, 12/5 by 11:59pm
Letter must be mailed or emailed to representative by Tuesday, 12/13
Instructions: Students will write a one-page advocacy letter to an elected official about an important community issue. Students must use the template provided or receive approval in advance for another format.
Your letter should:
a) Identity an important issue that affects families within a chosen community. What issue are you addressing?
b) Identify an appropriate elected official at the county, state, or national level; appropriate meaning someone in a position that can address your issue. In your letter, note the official’s correct title and their full name.
c) Describe how the issue affects children and families. Be specific!
d) Provide at least ONE key statistic AND empirical research to support your argument. Must include APA citation within your paragraph and include the reference at the bottom of the letter.
e) Describe specific actions you would like the elected official to take to address this family centered issue. What solution(s) are you proposing they take?
f) Date should be included at top of letter; at bottom of letter sign and print your name
g) Letter must meet appropriate length requirement of one page with 4 paragraphs, following the provided template.
h) Letter must be spell-checked and make grammatical sense.
i) Letter should be typed, single-spaced, use appropriate font (Times/Times New Roman, 12 point). Note that the appropriate spacing for each paragraph should follow the template: do not indent the start of each paragraph and use one line spacing in between paragraphs.
*The formatting guidelines for a letter are different from what I usually require for a paper.
**Use the template on the following page.
_________________________(Your full name)
_________________________(Your mailing address)
_________________________
Month day, year
Dear _________________ ___________________,
(Person’s Title) (Person’s Full Name)
Paragraph 1 – The Introduction: Briefly describe the problem and what action(s) you want your political representative to take to address it. (Three to four sentences). ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ Paragraph 2 – The Issue: Describe in detail how the problem affects children and families. Be specific by giving a(n) example(s)! Include one statistic AND empirical research to support your argument. Use APA format. (Four to five sentences). ______________________________________________________________________________ __________________________________________________________________.
Assignment 3 Single Line Diagram Systemmellies4kxl
Assignment 3
Single Line Diagram
System Data
MVAbase=100 KVbase=230
P1== Slack Bus PG2=50MW PG3=60 MW
PLoad 4=70 MW and QLoad4=70MW
PLoad 5=70 MW and QLoad5=70MW
PLoad 6=70 MW and QLoad6=70MW
V1=1.05+0i V2mag=1.05 V3mag=1.07
Line data
The Assignment:
Use 10 iterations to find the load flow solution, and show results on the single line diagram.
From To R X Bcap (Half)
1 2 0.1 0.2 0.02
1 4 0.05 0.2 0.02
1 5 0.08 0.3 0.03
2 3 0.05 0.25 0.03
2 4 0.05 0.1 0.01
2 5 0.1 0.3 0.02
2 6 0.07 0.2 0.025
3 5 0.12 0.26 0.025
3 6 0.02 0.1 0.01
4 5 0.2 0.4 0.04
5 6 0.1 0.3 0.03
ENG 315
Due Week 2 and worth 100 points
Choose one of the professional scenarios provided in Blackboard under the Course Info tab, or click here to view them in a new window.
Write a Professional Email Message (in the form of Figure 5.1 on page 84 of BCOM9) from the perspective of a character in the scenario. The email should discuss the communication issue provided in the scenario and should be addressed to another character from the scenario.
The message should take the form of an email; however, you will submit your assignment to the online course shell.
The professional email message must adhere to the following requirements:
1. Content:
Address the communication issue from the scenario.
Request a face-to-face meeting to discuss the issue (at a specific time).
Concentrate on the facts of the situation and avoid using overly emotional language.
Assume your recipient is learning about the situation for the first time through your communication.
2. Format:
Use a descriptive subject line or heading.
Include an appropriate and professional greeting / salutation.
Use email form including: To:, From:, Subject:, and Signature.
3. Clarity / Mechanics:
Focus on clarity, writing mechanics, and professional language/style requirements.
Run spell/grammar check before submitting.
4. Your assignment must:
This course requires use of Strayer Writing Standards (SWS). The format is different than other Strayer University courses. Please take a moment to review the SWS documentation for details.
5. Submitting your assignment:
Submit your assignment through the online course shell only.
6. The specific course learning outcomes associated with this assignment are:
Plan, create, and evaluate professional documents.
Deliver professional information to various audiences using appropriate tone, style, and format.
Analyze professional communication examples to assist in revision.
To download the assignment instructions provided above and assignment rubric, click here.
By submitting this paper, you agree: (1) that you are submitting your paper to be used and stored as part of the SafeAssign™ services in accordance with the Blackboard Privacy Policy; (2) that your institution may use your paper in accordance with your institution's policies; and (3) that your use of SafeAssign will be without recourse against Blackboa ...
What Is Animal Cruelty and How Can We Stop It? Free Essay Example. Reasons of animal cruelty - Free Essay Example PapersOwl.com. Cruelty To Animals Essay / Animal Right Essay Essay On Animal Right For .... 015 Are Zoos Cruel To Wild Animals Essay Istock 140450813 Wide .... The definition of animal cruelty - Free Essay Example PapersOwl.com. Animal Cruelty Speech Essay Example. Types of Animal Cruelty Free Essay Sample on Samploon.com. Tips to Write Animal Cruelty Essay - FreeEducator.com. Animal Cruelty Essay Outline Inspirational 58 Essays Animal Rights .... Essay on Cruelty to Animals 1839: Buy Essay on Cruelty to Animals .... Buy Essay Papers Here - essay on society for prevention of cruelty to .... Cruelty to Animals Essay Essay on Cruelty to Animals Essay for .... Legislation for animal cruelty Free Essay Example. 001 Cruelty To Animals Essay Example Page 1 Thatsnotus. Frightening Essay On Cruelty Animals Thatsnotus. Animal cruelty argumentative essay. Cruelty to Animals Essay. 2022-10-28. Cruelty To Animals Essay usomakoni9. Essay of cruelty to the animals - facebookthesis.web.fc2.com. Animal Cruelty and Testing in the United States - Free Essay Example .... Cruelty to Animals Essay for Students in English Easy Words. Animal cruelty research paper. Animal Cruelty Essay: Most Exciting .... Expository essay: Cruelty towards animals essay. 005 Cruelty To Animals Essay Example Animal Rodeo Png Rights Persuasive .... 012 Cruelty To Animals Essay Example On Animal Abuse Of Farm Novel .... Animal Cruelty Essay Outline Elegant the Most Awesome Animals Speech .... Speech on Animal Cruelty Year 11 HSC - English as a Second Language .... Essay websites: Animal cruelty essay conclusion. Animal Cruelty - GCSE English - Marked by Teachers.com Cruelty To Animals Essay Cruelty To Animals Essay
1. Define the term rape culture. Identify three examples of rape c.docxjeremylockett77
1. Define the term rape culture. Identify three examples of rape culture that you’ve observed in your life. What was the impact of these examples on your own life, or what do you think their impact is on young women? What messages are these examples saying about the value of girls and women in our society? Describe actions you can take as an individual to challenge rape culture. Finally, describe what we (as a society) need to do to eradicate rape culture. How would your life be different if rape culture didn’t exist?
2. Explain the term reproductive justice. Where did this term develop from? Name 4 issues that are part of the reproductive justice movement. Describe how the reproductive justice movement uses intersectionality to expand and challenge the “choice” narrative.
3. Identify a tv show, movie, or short film that you think adopts a feminist stance (i.e. a feminist perspective, way of looking at the world). Describe the characters and highlight what the show is doing right. Then, describe examples of stereotypes, myths, or misperceptions that might be problematic in the show. Who is the target audience of the show? Do you think that this show can have a positive impact on social change? Support your answer with specific examples. Did your own perceptions of this show change after participating in this class? If yes, how?
4. Identify 3 distinct types of privilege that are social constructed in our society today. Give examples that you’ve observed or are aware of that demonstrated each type of privilege you’ve identified. Then, describe steps you’d take to use that privilege for social change, using the principles of feminist praxis as described in our textbook.
ANTH DISCUSSION3
1. The following is the assignment criteria that was missed:
Note: Criteria in Black were correct, in Blue were partially incorrect, in Red were completely incorrect:
· Introduces/uses the concept of Filter Bubble
· Analysis of results using course concepts (Filter Bubble, Function Creep, Data Exhaust)
· Clear introduction and rationale of search criteria
· Shows understanding of/implications of a Filter Bubble
· Reasoning behind the selection of specific participants
· Personal observations on results
· Expectations/Reasoning around search criteria
· Conclusion supported by analysis and discussion
· Complete discussion of search results
· Well written with information presented logically and easy to follow
· Presents their participants’ demographic data
· Follows general expectation around layout/length
· Discusses the impact of their demographic data on their search results
· Follows Executive Summary parameters
· Table contains demographic data
· Thoughts on other things that might have influenced their search results (bonus)
· Table included within the document
· Big picture context on findings (bonus)
· Table referenced and used in discussion/analysis/conclusion
· Uses external resources for support (bonus)
- (C+ and below) Does not ...
Case StudyIn March 1994, Randal Schwartz was indicted on three f.docxwendolynhalbert
Case Study
In March 1994, Randal Schwartz was indicted on three felony counts under the Oregon State Computer Crime Law and sentenced to 5 years of probation. 480 hours of community service, 90 days of deferred jail time, $68,000 of restitution to Intel, and disclosure of full details surrounding conviction to any future employer. The complaint against Randal Schwartz was brought by Intel Corporation, a multinational microchip manufacturer. The charges related to altering two computer systems without authorization and accessing a computer with intent to commit theft. Randal Schwartz is a perfect example of someone who does not fit into the stereotype of hackers. Anyone familiar with Perl will know Schwartz as the author of the definitive Perl instruction guide, Learning Perl. Schwartz is a frequent columnist for such technical magazines as Unix Review and Web Techniques. Randal Schwartz was a consultant for Intel in Oregon for three years before the indictment. Schwartz’s crimes are a result of what he says were “good intentions.” Although Schwartz is well respected in the community, he has been criticized for his unprofessional and irresponsible conduct as a consultant, thus being subjected to a lot of controversy. Schwartz claimed that because of jos travels and invitations to lecture on Perl, he needed an easy way to access his e-mail at Intel. Without seeking requisite permissions, Schwartz modified the systems so as to access his account outside of the organization. He also installed the Crack software on the systems, which enabled him to capture nearly 50 passwords.
In his defense, Schwartz argued that he was merely helping the company by checking the security of systems. This could have been an excellent explanation except for the fact that in police reports. Randal told the officers that thought he could be criminally prosecuted for these incidents. “When asked why he stole 40 or 50 passwords. Schwartz told detectives. “I needed them in case they caught me doing it and I knew they would shut me down, so the more passwords I had, the longer I could continue doing what I wanted to do.” Schwartz also admitted that this wasn’t the first time he had done things against Intel’s policy. He had been previously caught accessing the systems from outside the company and had been warned on several occasions.
Schwartz Case Study
Organizations need to be concerned with breaches of security from internal sources as much (if not more) as from outside sources. Employees and consultants in an organization often need sensitive information. How can the organization provide access, but still protect against improper usage of this information?
Read the Case Study at the end of Chapter 10. With your group, act as hired consultants and write a 1- to 2-page group report that determines what steps you would recommend for the company to ensure that their security policies are not violated. One of the CEO's goals is to keep from burdening the employees with ...
1. Define the term rape culture. Identify three examples of rape c.docxstilliegeorgiana
1. Define the term rape culture. Identify three examples of rape culture that you’ve observed in your life. What was the impact of these examples on your own life, or what do you think their impact is on young women? What messages are these examples saying about the value of girls and women in our society? Describe actions you can take as an individual to challenge rape culture. Finally, describe what we (as a society) need to do to eradicate rape culture. How would your life be different if rape culture didn’t exist?
2. Explain the term reproductive justice. Where did this term develop from? Name 4 issues that are part of the reproductive justice movement. Describe how the reproductive justice movement uses intersectionality to expand and challenge the “choice” narrative.
3. Identify a tv show, movie, or short film that you think adopts a feminist stance (i.e. a feminist perspective, way of looking at the world). Describe the characters and highlight what the show is doing right. Then, describe examples of stereotypes, myths, or misperceptions that might be problematic in the show. Who is the target audience of the show? Do you think that this show can have a positive impact on social change? Support your answer with specific examples. Did your own perceptions of this show change after participating in this class? If yes, how?
4. Identify 3 distinct types of privilege that are social constructed in our society today. Give examples that you’ve observed or are aware of that demonstrated each type of privilege you’ve identified. Then, describe steps you’d take to use that privilege for social change, using the principles of feminist praxis as described in our textbook.
ANTH DISCUSSION 3
1. The following is the assignment criteria that was missed:
Note: Criteria in Black were correct, in Blue were partially incorrect, in Red were completely incorrect:
· Introduces/uses the concept of Filter Bubble
· Analysis of results using course concepts (Filter Bubble, Function Creep, Data Exhaust)
· Clear introduction and rationale of search criteria
· Shows understanding of/implications of a Filter Bubble
· Reasoning behind the selection of specific participants
· Personal observations on results
· Expectations/Reasoning around search criteria
· Conclusion supported by analysis and discussion
· Complete discussion of search results
· Well written with information presented logically and easy to follow
· Presents their participants’ demographic data
· Follows general expectation around layout/length
· Discusses the impact of their demographic data on their search results
· Follows Executive Summary parameters
· Table contains demographic data
· Thoughts on other things that might have influenced their search results (bonus)
· Table included within the document
· Big picture context on findings (bonus)
· Table referenced and used in discussion/analysis/conclusion
· Uses external resources for support (bonus)
- (C+ and below) Does no.
There are two Discussion Boards and a Reflection Discussion for a .docxrandymartin91030
There are two Discussion Boards and a Reflection Discussion for a total of three things to complete, must be answered thoroughly. Must be APA format, answer thoroughly, must have at least 1-2 verifiable legitimate sources per discussion post and reflection discussion.250+ words needed per discussion and reflection post answering thoroughly. Due Thursday November 7, 2019. By8 AM EST. 36 hours. Plagiarism Free.
Discussion #1
Describe how you believe a "problem-solving culture" is established in a public safety organization.
Discussion #2
Read:
http://patimes.org/considerations-public-administrators-rainbow/
Blessett states "Whatever your reason is for being drawn to this profession, please consider that the work you do does not just affect you, but informs the interactions, impressions and expectations of public servants overall."
How do we reflect this goal in the day-to-day administration of a public safety organization?
#3
Program Outcome Two Reflection Discussion
Discussion Topic
The Program Outcome Reflections project requires you to reflect on each of the five Public Safety Administration Program Outcomes demonstrating a comprehension of the concept(s), and indicating how the PSAD curriculum provided you the knowledge and skills (process or application of knowledge) to master the outcome.
You will address each outcome individually in a 250-word reflection posted as a discussion topic. You should respond to the postings of at least two fellow students. Reflections on the individual program outcomes will include:
· Your understanding of the concept;
· How you feel the curriculum provided you with the knowledge and skills to meet the outcome;
· What courses and activities in the curriculum addressed the concepts of the outcome.
The outcome for this assignment is:
· Use informed decision making, goal orientation, teamwork, ethical behavior, enhanced technology, and communications to ensure effective leadership in public safety administration.
Class Material
"Problem Solving and Decision Making" http://www.studygs.net/problem/
· "Defining the Problem/Gathering Information" http://www.studygs.net/problem/problemsolvingv1.htm
· "Identifying and Structuring Problems" http://www.skillsyouneed.com/ips/problem-solving2.html
Module 2: Identify Issues or Challenges
Each public safety administrator needs to evaluate his or her environment to determine the major issues. Once identified, each issue must be analyzed, recommendations determined, and solutions implemented and reviewed. Your comprehensive case study capstone project will focus on each area.
Your first paper is an individual project where you will identify an issue or challenge. We have looked at issues facing public safety leaders. The most important point is to identify an issue or problem before it becomes an even bigger problem.
Many problems can be solved on an individual basis. For example, let's say the fire station doors are leaking. Possible solutions include patching the lea.
An explanation of the Doing Ethics Technique Graham R Seach .docxnettletondevon
An explanation of the Doing Ethics Technique
Graham R Seach
Simpson, C. R., Nevile, L., & Burmeister, O. K. (2003). Doing ethics: A universal technique in an
accessibility context. Australian Journal of Information Systems, 10(2), 127-133.
The 'Doing Ethics' technique (DET) is a process for analysing ethical issues in any scenario. It doesn't
guarantee that what you come up with will be the best solution, but it does help you to think
ethically. That said, I understand that the technique may seem a little vague and perhaps lacking
guidance. To that end, the following might help you to understand how to apply the technique in
order to better understand ethical analysis.
To gain the most from the technique, you must explore and answer all eight questions in the order
in which they are posed. Each question stands alone and you cannot take the view that because you
have given information in response to one question that you can omit the same information from
subsequent questions.
Q1. What's going on?
This is a synopsis of what the case is all about. It is written in your own words, and can be taken from
a variety of perspectives, for example, from the perspective of a person raising a complaint, in which
case, it is a synopsis of the complaint. It can be taken from the perspective of an uninvolved
observer, in which case, it is an outline of what was observed, without going into too much detail.
Where you see multiple perspectives, you should describe them here. This question should target a
reader who has no knowledge of the case at hand, and is a brief outline of the case.
Q2. What are the facts?
This is a descriptive list of all the facts of the case. It doesn't just describe the case, but lists all the
facts as they are known (from all sources and perspectives), and also what one might reasonably
consider to be possibilities. For example, if a person was raising a complaint, Question 1 would
outline their complaint, and Question 2 would provide the detailed facts and the evidence to both
support and refute the claims (facts). All facts listed here must be supported by credible evidence, of
which the case itself is one source. If you choose, you may optionally assign a credibility weighting to
each fact, to help with later analysis.
Q3. What are the ethical and non-ethical issues?
This is a list of ALL the issues that are involved in the case, whether they be ethical, legal, social or
otherwise. In Question 5 we extract only the ethical issues for further analysis, but for now, simply
list and describe every relevant issue you can think of. This is probably the most difficult and
important question to get right, because Question 5 can only include the ethical that you have raised
here in Question 3. Therefore, this question must be a complete and comprehensive list of ALL the
issues.
Q4. Who is affected?
This is a list of all the stakeholders (people and entities) invo.
Deliverable 6 - Making Contacts for the FutureTop of FormBotto.docxalisondakintxt
Deliverable 6 - Making Contacts for the Future
Top of Form
Bottom of Form
Assignment Content Nursing Home Admin future job
1.
Top of Form
Competency
Design a personal plan to use social media to benefit the student both personally and professionally as well as minimize online mistakes and their impact.
Student Success Criteria
View the grading rubric for this deliverable by selecting the “This item is graded with a rubric” link, which is located in the
Details & Information pane.
Instructions
Regardless of the career that you pursue or are currently pursuing, it is likely that the action of securing the resource of friends and professional acquaintances will be as valuable as any other action you could take.
Part 1:
First, take some time to reflect on your career and/or future career. If this includes more than one career path, then focus on the one that you are most concerned with in the long term. This might include working in a specific field, starting a business, or any other pursuit you are currently working on or plan to work on in the future. The choice behind the pursuit you will focus on is a personal choice.
Write two pages on why this particular career and/or pursuit is your choice. Reflecting on the why behind your wish to achieve a goal will help to make it feel more tangible to you. This exercise of reflection should serve to remind you of your motivation and will be a good thing to refer back to if your motivation ever gets low. The "why" behind a pursuit is oftentimes more important than the "how" of a pursuit. If you have a strong enough "why," you will find the "how."
Part 2:
For the second part of this assignment, make a list of the types of people that could help you in your career and why those people would be good contacts to have. This list should be general in nature, meaning you should list professions or names of positions within companies rather than specific names.
You should list general fields or positions like accountants, attorneys, marketing managers, CEOs, etc., rather than any specific names. Be sure to list at least five professions or types of people.
Part 3:
Next, consider which social media platforms you could use to make personal contacts that could help you in your pursuit along with why and how you could use each. Ensure that the platform and your use of it line up with the specifics behind your chosen future goal.
Describe at least three different platforms you could use, along with why you would use it, and how you would use it for each of the three.
· Platform #
· Why?
· How?
· Platform #
· Why?
· How?
· Platform #
· Why?
· How?
Part 4:
Finally, put all of this together and take action. The next part of this assignment is where you can make a big difference in your grade as well as in your real life pursuit of a goal!
Reach out through the avenue of social media and make contact with three people that you do not currently know. Describe who you contacted and why .
etting StartedRevised Final Proposal - Internal and ExternalBetseyCalderon89
etting Started
Revised Final Proposal - Internal and External Marketing Environments
The process of peer review strengthens a presentation by having another qualified person analyze the same data and then review your work. You have written and revised a product differentiation and positioning section (submitted in 3.4), and a product development and market demand section (submitted in 4.4). You will now strengthen your initial report on internal and external marketing environments by integrating the alternative from your peer (received in 4.2) into your revised final draft that will be submitted to the client.
Upon successful completion of this assignment, you will be able to:
· Assess the market structure and internal and external marketing environments to determine the crucial factors influencing the marketing strategy.
Resources
· Textbook: The 30 Day MBA in Marketing: Your Fast Track Guide to Business Success, Ch. 9, pp. 175-192
· Textbook: Developing Successful Marketing Strategies, Ch. 6
· Textbook: Value-based Marketing Strategy: Pricing and Costs for Relationship, Ch. 1; Ch. 3, Section 3
· File: Market Analysis Report Template
Instructions
1. Review the rubric to make sure you understand the criteria for earning your grade.
2. This is your revised final draft of the internal and external marketing environments section of your consultant’s report. It is based on what you posted in 3.3 and on your peer’s comments and response posted in 4.2.
3. Your revised final report must integrate your peer’s alternative analysis or recommendation as an alternative perspective as part of your final report. You must either accept your peer’s perspective as a replacement to your initial proposal based on adequate credible theory and current marketing practice to accept it or you must provide adequate credible theory and current marketing practice to reject it. If you accept it as the correct analysis or recommendation, then the peer alternative will become the primary focus of your final paper, and your original analysis and/or recommendation will be noted as an alternative perspective that you have rebutted through cited research. If you do not accept the alternative, then you only need to discuss it as an alternative and provide objective and qualified reasons to reject it.
4. Use the titles from the Market Analysis Report Template to create four sections for this part of the consultant’s report:
a. Porter’s five forces model
b. Other macroenvironmental external factors
c. Required Internal Resources and Competencies to Compete in the Market
d. Required Licenses, Patents, and Rulings or Legal Requirements to Compete in the Market
5. The body of your paper (i.e. excluding title page, graphics, appendices, and references page) must be 1300 words (+/- 50 words). In the event that your peer did not provide feedback, your length must be 1000 words (+/- 0 words) and you will not be penalized for not including the missing feedback.
6. You must use, cit ...
Charles Hackner, Felicia Anderson 6212-ECON-2302-Principles of MicJinElias52
Charles Hackner, Felicia Anderson 6212-ECON-2302-Principles of Microeconomics-SS-20242
March 3, 2021 at 11:17am
· Reply to conversation Here are the instructions for submitting exams. If you do not follow those instructions, I will take points off your overall score! 1. Put all your answers to the questions for the exam into a Word doc. 2. Put your name and course code at the top of your word doc. 3. Use the following file naming format – a. Your file name should be your first name space your last name space 5 digit course code. 4. Use your HCC Outlook email to send the document to me as an attachment. Do not use your canvas email account! CH
· Message actions for Here are the instructions for submitting exams. If you do not follow those instructions, I will take points off your overall score! 1. Put all your answers to the questions for the exam into a Word doc. 2. Put your name and course code at the top of your word doc. 3. Use the following file naming format – a. Your file name should be your first name space your last name space 5 digit course code. 4. Use your HCC Outlook email to send the document to me as an attachment. Do not use your canvas email account! CH
Here are the instructions for submitting exams.
If you do not follow those instructions, I will take points off your overall score!
1. Put all your answers to the questions for the exam into a Word doc.
2. Put your name and course code at the top of your word doc.
3. Use the following file naming format –
a. Your file name should be your first name space your last name space 5 digit course code.
4. Use your HCC Outlook email to send the document to me as an attachment. Do not use your canvas
email account!
•Make sure that you are using an open outline like format in the construction of your answers.
1.The objective of this question is to help you understand how the critical ecosystem services are impacted byeconomic activityand some things we can do to solve those problems. To agreat extent, Economics is about connecting the dots (finding relationshipsbetween seemingly unrelated things). For now,Earth is the only place we can live. Our ability to live on this planet is supported by the many Ecosystems active on the planet. Our behavior disrupts thoseEcosystemsand allthe Ecosystem Services. Those disruptedEcosystem Services in turn have impacts on the people and economies of the global north and global south. It is very important that youdevelopagood understanding of the interaction of ourbehavior and the environmental and economic consequences of that behavior.This question is part of the topic called Intro to some keyconcepts of Economics.
•Pick 5 Ecosystem Servicesfrom the list in slide13of the topic called Intro to some key concepts of Economics.
•For each of your 5 ecosystem services, please explain how each is supposed to work.This iskey to answering the entire question, so please focus on this.Google canhelp with this!
•For each of your 5 ecosystem services ...
Notifications My CommunityHome BSL 4060-14F-6A19-S1, Team .docxvannagoforth
Notifications My CommunityHome
BSL 4060-14F-6A19-S1, Team Building and Leadership
Unit VIII
Unit 8 Introduction--Your
Final Week!!
Unit 8 Learning Objectives and Leaving With A
Competitive Advantage
Congrats!
You’ve made it! Well done! I applaud
everyone of you for your effort and
determination. You met the challenges of
this course, and are ready to move forward
to the next course, graduation, next
academic level or your next set of goals
that you set for yourself. Before you leave
I want to remind you about being
competitive.
You always want to seek a Competitive
Advantage. Look at the picture. What
does it communicate?
Ask yourself this: “Am I the figure in gold
or gray?” If you’re gold…what did it take
to get there? If you’re gray, why are you
there? Competitive advantage is doing
things better than the other person. Think
about athletes, how do they get better?
Well, they train harder, they lift weights,
do plyometrics, yoga, strength training,
and more. Think about how you can gain
a competitive advantage in your job, and
what it takes to be out in front.
Having been a CEO I can tell you this the
people that were promoted, advanced with
responsibility, received awards, and pay
increases contributed more to the
organization. They didn’t complain or
look for handouts. They developed more
skill sets then others, and they
volunteered. Bosses love it when you
volunteer for extra work and projects.
Yes, trust me. Those I promoted gave
more to the organization than others, and
they left their competition in the dust.
Good luck in your future classes, it was a
pleasure having you in class.
Dr Anderson
This final week you want to reflect on
your previous 7 weeks of material.
What are your takeaways?
What was the biggest influence to you
over the course?
What can you apply to your daily life,
work, etc to be more productive,
competitive and a better team player by
communicating better.
Review the second picture. What do you
see? What you see in an abstract concept
is this weeks objectives: Describe team-
building activities leaders can incorporate
for better managing internal teams and
interorganizational alliances. Predict
major challenges teams will face in the
future, and the need for teamwork will
remain high in the future. Finally the
work activities that will require a team for
task completion.
Unit 8 Learning Objectives
Upon completion of this unit, students
should be able to:
5. Describe team-building activities
leaders can incorporate for better
managing internal teams and
interorganizational alliances.
8. Predict major challenges teams will
face in the future.
8.1 Explain why the need for teamwork
will remain high in the future.
8.2 Describe work activities that will
require a team for task completion.
3.1 Describe advances in organizational
diversity developed from legislation.
3.2 Explain paradigm shifts in
organizational environments from
increased diversity legislation
Un ...
Assignment 1 Reviewing Research and Making Connections (Student.docxdeanmtaylor1545
Assignment 1: Reviewing Research and Making Connections
(Student name)
Dr. Goldstein
Introduction to Sociology
(Date)
Ask (Write a paragraph of at least 5 7 sentences answering the following questions in your own words.)
· What was the topic of the research?
· Who was studied in the research?
· What was the research question that was answered by the information in the article?
Research (Write a paragraph of at least 5-7 sentences answering the following questions in your own words.)
· What research methods were used?
· Summarize the process researchers used to collect data.
Learn (Write a paragraph of at least 5-7 sentences answering the following questions in your own words.)
· What were the key findings of the research?
· What conclusion was drawn from the research?
Do (Write a paragraph of at least 5-7 sentences answering the following questions in your own words.)
· What are two additional follow-up questions that you have based on this research?
· Why did you choose these follow up questions?
The topic of research is chose was the main difference of the people from different part of the world especially when it comes to their looks. During the research some 4000 people from 40 different countries were used as the sample for the study. The research question answered in the article was what are some of the difference witnessed in people from different countries? Through studying the samples the researchers were able to determine that people from different parts of the world prefer different space especially when communicating with others.
Survey was the method which was used in collecting information for this particular study. Geographical locations are the one which determine personal space boundaries and thus conducting the survey, the world should be divided into contact and non-conduct cultures. For instance, conduct cultures will comprise of countries such as Middle East, South America and South Europe. On the other hand, non-conduct countries are such as Asia, Northern Europe and North America. All the participants were issued with sheet with two options and with at the end they should explain the amount of space they keep when dealing with others. The participants will be given three categories; personal distance, social distance and social distance.
From the research, it was found that people from Saudi Arabia keep a large distance to their friend as compared to their counterparts from Argentina. On the other hand Hungarians keep a close distance to all the people they meet even if they are strangers. When it comes to gender, women have a more personal space when they are dealing with strangers as compared to men. On the other hand old people keep less distance to other as compared to young people. When it comes to climate, people living in warmer areas keep close distance as compared to those living in cold areas in the world.
Because babies are not usually born with the understanding of perso.
Unit 12 assignment 1 – job market researchBluecare
Support can either be nothing more than a means to an end, or it can be a dynamic aspect of your entire business. Engaging customers and helping them get the most out of your product will give them a reason to tell others why they love your company. Cultivate these traits, and I guarantee you’ll be on your way to world-class support.
As a backlash, the professional model, which reflects a "we are the experts and you are not" attitude, alienated the police from the public. Problems and crime kept growing, and people wanted to be more involved in their communities. Therefore, community members started to work closely with the police. The police saw their resources diminish and decided it was critical to engage the communities to more effectively combat rising crime.
Please read the description of the Religion ethnography carefully an.docxSusanaFurman449
Please read the description of the Religion ethnography carefully and then ask me in class to explain anything that isn't clear. You can also email me with questions.
At the end there is a short list of possible sites for the ethnography: Sikh, Islamic, Jewish, Catholic, Hindu, Buddhist. Shumei. There are other religions and many other sites. Bahai is an interesting religion but you have to be invited to attend by a member.
Mormon the same.
If you have access to a Santeria or similar ceremony, great!
To make the project worthwhile choose a site as different from your own background as you can.
If you have a Christian or Catholic background do not do your paper on any kind of Christian or Catholic service.
You are welcome to attend a non-English language service as long as you understand the language being used.
Be sure to okay your choice with me. Some places that don’t work for this project are Scientology, the Self Realization Fellowship, the Kabbalah Center, SGI Buddhist, Hare Krishna.
INSTRUCTIONS:
Attend a religious activity that you’re curious about and would like to explore.
You must attend a service, not simply visit a religious site.
Examples: a mosque, temple, synagogue, gurdwara.
You can probably find an interesting place of worship near where you live or work.
It’s always a good idea to phone or email the place of worship before you attend.
Research methods must include participant/observation and informal conversation. One slightly more formal interview is desirable.
Be absolutely sure to allow time to stay after the service for food, lunch, other refreshment, or informal gathering. This may well be the most important part of your experience and will enable you to answer the question, “What meaning does this place and this service have for the participants?
You must go some place you’ve never been to before. Do NOT choose your own tradition or somewhere you’re even a bit familiar with. Choose somewhere entirely new and different.
The important thing is to come to the service as an outsider, with the eyes and ears of an anthropologist and take note of everything. Use the skills you’ve learned in this class.
You can attend alone or with a co-researcher or two from the class. Best, you can be the guest(s) of a classmate or someone else you know and discuss the event with them. Invite a classmate or two to attend a service from your tradition.
Do not write about an event you attended in the past. But you can use past experiences for comparison and reflection.
It is almost never appropriate to jot down notes during a religious service. Better, write everything you remember immediately after the event. Get sufficient detail to write what anthropologist Clifford Geertz called “thick”, or rich description.
In writing your paper use terms we've discussed in class and think about connections to the reading we’ve done and films we’ve seen.
OUTLINE
: Include each of these sections.
Title Page,
or top of page: .
PLEASE read the question carefully. The creation of teen ido.docxSusanaFurman449
PLEASE read the question carefully.
The creation of “teen idols” is a tradition that stems back to Tin Pan Alley and the “old guard” way of making music. What were some of the factors that led to this point in the early 60’s? Is it still prevalent? If so, why? Name some examples.
.
Please reflect on the relationship between faith, personal disciplin.docxSusanaFurman449
Please reflect on the relationship between faith, personal discipline, and political integrity. Explain how the Progressive movement and the New Deal Court transformed constitutional interpretation. Briefly give 2 illustrations of how government regulations and/or subsidies (legal plunder, perhaps?) channels behavior and/or distorts markets. 400 WORDS
.
Please read the following questions and answer the questions.docxSusanaFurman449
Please read the following questions and answer the questions
This unit's chapter discussed concerns about quality programming in the media. Different models for assessing culture were discussed:
1) Culture as a Skyscraper Model and 2) Culture as a Map.
Come up with several television shows that serve as examples of “quality” programs and “trashy” programs. What characteristics determine their quality (plots, subject matter, themes, characters…)?
Is there anything you can think of that is “universally trashy”? Or universally in good taste?
On the whole, are Americans seen as having good taste? Why or why not? Is there a country/culture that always seems tasteful in its cultural products?
Which model (Culture as Skyscraper or Culture as Map) makes more sense to you and why?
i need 400 words
.
PRAISE FOR CRUCIAL CONVERSATIONS Relationships ar.docxSusanaFurman449
PRAISE FOR CRUCIAL CONVERSATIONS
"Relationships are the priority of life, and conversations are the
crucial element in profound caring of relationships. This book
helps us to think about what we really want to say. If you want
to succeed in both talking and listening, read this book."
-Dr. Lloyd J. Ogilvie, chaplain, United States Senate
"Important, lucid, and practical, Crucial Conversations is a
book that will make a difference in your life. Learn how to flour
ish in every difficult situation."
-Robert E. Quinn, ME Tracy Collegiate Professor of
OBHRM, University of Michigan Business School
"I was personally and professionally inspired by this book-and
I'm not easily impressed. In the fast-paced world of IT, the success
of our systems, and our business, depends on crucial conversations
we have every day. Unfortunately, because our environment is so
technical, far too often we forget about the 'human systems' that
make or break us. These skills are the missing foundation piece."
-Maureen Burke, manager of training,
Coca-Cola Enterprises, Inc.
"The book is compelling. Yes, I found myself in too many of their
examples of what not to do when caught in these worst-of-all
worlds situations! GET THIS BOOK, WHIP OUT A PEN AND
GET READY TO SCRIBBLE MARGIN NOTES FURIOUSLY,
AND PRACTICE, PRACTICE, PRACTICE THE INVALUABLE
TOOLS THESE AUTHORS PRESENT. I know I did-and it
helped me salvage several difficult situations and repair my
damaged self-esteem in others. I will need another copy pretty
soon. as I'm wearing out the pages in this one!"
-James Belasco. best-selling author of Flight of the Buffalo,
l!l1trl!prl!l1eur. professor. und l!xl!cutive director of the Financial
Tilllrs Knowkdgc Diuloguc
"Crucial Conversations is the most useful self-help book I have
ever read. I'm awed by how insightful, readable, well organized,
and focused it is. I keep thinking: 'If only I had been exposed to
these dialogue skills 30 years ago ... '"
-John Hatch, founder, FINCA International
"One of the greatest tragedies is seeing someone with incredible
talent get derailed because he or she lacks some basic skills.
Crucial Conversations addresses the number one reason execu
tives derail, and it provides extremely helpful tools to operate in
a fast-paced, results-oriented environment."
-Karie A. Willyerd, chief talent officer, Solectron
"The book prescribes, with structure and wit, a way to improve on
the most fundamental element of organizational learning and
growth-honest, unencumbered dialogue between individuals.
There are one or two of the many leadership/management
'thought' books on my shelf that are frayed and dog-eared from
use. Crucial Conversations will no doubt end up in the same con
dition."
-John Gill, VP of Human Resources, Rolls Royce USA
Crucial
Conversations
Crucial
Conversations
Tools for Talking
When Stakes Are High
by
Kerry Patterson, .
Must Be a
hip-hop concert!!!!
attend a
hip-hop concert (in-person or virtual/recorded live concert on DVD or streaming platform) of your choice
THIS month.
After the concert, write an
objective review (1000 - 1500 words) of the concert detailing your experience.
Write A Review and include those questions!!!
The review should include:
1. The names of the performing groups/artists; the date and location of the performance.
2. Describe the setting. Is it a large hall or an intimate theater? What type of audience demographic is there? Young or old? How do they respond to the music?
3. The different styles/genres of songs the artist(s) perform.
4. Use your notes and experience to describe the different musical elements (i.e. melody, harmony, timbre, technology, form, volume, etc.) you recognize in most (if not all) the songs/pieces.
5. Be sure to arrive on time to hear the
entire concert.
6. Attach a photo of the flyer, ticket, or webpage (or social media event) when you submit this assignment.
7. Describe your personal reaction to the concert. List reasons why you think it was successful or not. However, do not make this the center of your paper. It should be
one or two paragraphs at the end. Further, use
data to support your arguments about why it was successful or not successful. (e.g., How did people respond verbally and non-verbally? Was this based on your perception or was there a general consensus? If it is a consensus, then what facts do you have to support this?)
8. Try to do some background research on the genre or artist before and after you attend the concert. This is not a research paper, but if you use any information from any source (including the artist's website), you
must cite it both in-text and on a works-cited page.
.
Mini-Paper #3 Johnson & Johnson and a Tale of Two Crises - An Eth.docxSusanaFurman449
Mini-Paper #3: Johnson & Johnson and a Tale of Two Crises - An Ethics Story Revised Submission
Read the following two PDF documents located at this link: click hereLinks to an external site.
·
Johnson & Johnson’s Tylenol Crisis
·
JNJ’s Baby Powder Crisis: Does Baby Powder Cause Cancer?
·
You are not expected to conduct any outside research
Based on your reading please write a short paper answering the following questions (do not answer with bullets, write a paper):
· JNJ’s response to the Tylenol Crisis is often cited as one of the best historical crisis management leadership examples. Given this perspective:
·
Compare JNJ’s response to the Tylenol Crisis to their response in the Baby Powder Crisis.
·
What actions by JNJ were highly effective in the Tylenol Crisis and why? Explain your examples and why you believe they are best practices
·
What could JNJ improve upon in the Tylenol Crisis?
· After reading JNJ's handling of the Baby Powder Class Action Lawsuit elaborate upon the following:
·
How did JNJs response differ from the Tylenol Crisis in the Baby Powder Lawsuit?
·
Given what you've learned from the Tylenol Crisis what are three potential recommendations/improvements JNJ could have made in the Baby Powder Lawsuit?
·
Ethics Analysis - consider your decision from the perspective of a senior advisor to senior leadership at JNJ (
there is NO right answer here, YOU MAY GIVE OPINION IN FIRST PERSON IN THIS SECTION ONLY (this is a special exception)):
·
· With what ethical actions do you agree or disagree regarding how JNJ handled the Tylenol Crisis?
· With what ethical actions do you agree or disagree regarding how JNJ handled the Baby Powder Crisis?
·
Be sure to reference at least 3 concepts from Chapters 9 and/or 12 in the textbook in answering this mini-paper. Please mark your references with "(textbook)" to make clear the references from the book.
Johnson & Johnson’s Tylenol Crisis
Background
“The killer’s motives remain unknown, but his — or her, or their — technical
savvy is as chilling today as it was 30 years ago.
On Sept. 29, 1982, three people died in the Chicago area after taking
cyanide-laced Tylenol at the outset of a poisoning spree that would claim seven
lives by Oct. 1. The case has never been solved, and so the lingering question —
why? — still haunts investigators.
Food and Drug Administration officials hypothesized that the killer bought
Extra-Strength Tylenol capsules over the counter, injected cyanide into the red
half of the capsules, resealed the bottles, and sneaked them back onto the shelves
of drug and grocery stores. The Illinois attorney general, on the other hand,
suspected a disgruntled employee on Tylenol’s factory line. In either case, it was a
sophisticated and ambitious undertaking with the seemingly pathological go.
Please write these 2 assignments in first person.docxSusanaFurman449
Please write these 2 assignments in
first person view. No need for citation. Please give me two files, the first one is a
Short Paper(600-700 words); the second one is
Long Discussion(450-500 words).
They are all about Art and Politics in Renaissance Florence Period
1. Short Paper
Street corners, guild halls, government offices, and confraternity centers contained works of art that made the city of Florence a visual jewel at precisely the time of its emergence as a European cultural leader. In shared religious and secular spaces, people from the city of Florence commissioned altarpieces, chapels, buildings, textiles, all manner of objects – at home, interior spaces were animated with smaller-scale works, such as family portraits, birth trays, decorated pieces of furniture, all of which relied on patrons, artists, and audiences working with the beauty and power of sensory experience. Like people all over Europe, viewers believed in the power of images, and they shared an understanding of the persuasiveness of art and architecture. Florentines accepted the utterly vital role that art could play as a propagator of civic, corporate, religious, political and individual identity.
Select one or two of the test case studies [that is, talk about Cosimo or Lorenzo the Magnificent or Savonarola's impact on Florence or the new Republic under Soderini] from this Module on Art and Politics in Renaissance Florence, and explore your understanding of people in Florence, who was so alive to the power and communication possibilities in works of art, objects, and spaces throughout the city and beyond.
Word count:
600-700 words
No need for citations.
2. Long Discussion
In this longer discussion forum, create an initial post of
450-500 words that explores these key concepts;
In this discussion post, talk about the political and social messages that you can see in the various works of art commissioned by the Medici, all the while being aware of the debate that was circulating about power and religion. If the content of the work of art is religious, how does the work convey political messages?
a video that may help
https://www.youtube.com/watch?v=UAqE21zjQH4
.
Personal Leadership Training plan AttributesColumbia South.docxSusanaFurman449
Personal Leadership Training plan : Attributes
Columbia Southern University
Dr. Mark Friske
Current Issues in Leadership
LDR 6302-22.01.00
10/14/2022
Introduction
Personal leadership style
personal leadership style attributes
Characteristics of a democratic leader
Charismatic leadership style
Charismatic leader
Transformational leadership style
Transformational leader
Charismatic vs. transformational
Impacts of transformational leadership
Reflection
Personal leadership style
Democratic leadership style
Embraces diversity and open dialogue as core values.
The leader's role is to provide direction and exercise authority.
Commands respect and admiration from those who follow you.
Moral principles and personal beliefs underpin all choices.
Seek out a wide range of perspectives (Cherry, 2020).
Behaviorist theory is the one that fits my style of leadership the best.
Being the change you wish to see in the world is crucial, in my opinion. According to Johann Wolfgang von Goethe, "Behavior is the mirror in which everyone exhibits their picture." My main priorities are the well-being of the team members and developing effective solutions via cooperative effort.
personal leadership style attributes
Active participant
Each person is given a fair chance to speak their mind, and there is no pressure to conform to any one viewpoint.
Values other standpoints
I find it fascinating to hear the perspectives of others. To me, it's crucial that everyone in the team pitches in to find the most effective answer. To me, it's important to give everyone a voice on the team since they all have something unique to offer.
Characteristics of democratic leader
Attribute:
Talk About It
Subcontract Work
Get Other People's Opinions
Friendly
Approachable
Trustworthy
Participative
Motivate Originality
Regard for Others
Build Confidence
Life example
Working as a Management Analyst in the realm of government spending, I am frequently required to communicate with the Program Management Team of a third party firm. No collimated staff members prevent me from personally performing some of the work necessary to maintain an accurate external organization ledger. As a result, I need to be approachable, polite, and nice to my coworkers so that they would feel comfortable confiding in me and trusting me with their ideas. By consistently soliciting feedback from staff and management, I want to foster a culture of collaboration. This fosters innovation on the team and opens minds to new points of view.
Charismatic leadership style
They have excellent communication skills.
Passionate in furthering Their Cause.
Professionals have a lot of experience in their field.
Act with a level head (Siangchokyoo, et al. 2020).
Leadership traits and behavior are under scrutiny.
Win Over Huge Crowds.
Possible drawbacks
Frustratingly Diminished Clarity
Not Enough People to Make It Happen
Charismatic leader
Charismatic leader example:
pr.
More Related Content
Similar to HMSV 346 Diversity Issues in Human Services Spring 2021
There are two Discussion Boards and a Reflection Discussion for a .docxrandymartin91030
There are two Discussion Boards and a Reflection Discussion for a total of three things to complete, must be answered thoroughly. Must be APA format, answer thoroughly, must have at least 1-2 verifiable legitimate sources per discussion post and reflection discussion.250+ words needed per discussion and reflection post answering thoroughly. Due Thursday November 7, 2019. By8 AM EST. 36 hours. Plagiarism Free.
Discussion #1
Describe how you believe a "problem-solving culture" is established in a public safety organization.
Discussion #2
Read:
http://patimes.org/considerations-public-administrators-rainbow/
Blessett states "Whatever your reason is for being drawn to this profession, please consider that the work you do does not just affect you, but informs the interactions, impressions and expectations of public servants overall."
How do we reflect this goal in the day-to-day administration of a public safety organization?
#3
Program Outcome Two Reflection Discussion
Discussion Topic
The Program Outcome Reflections project requires you to reflect on each of the five Public Safety Administration Program Outcomes demonstrating a comprehension of the concept(s), and indicating how the PSAD curriculum provided you the knowledge and skills (process or application of knowledge) to master the outcome.
You will address each outcome individually in a 250-word reflection posted as a discussion topic. You should respond to the postings of at least two fellow students. Reflections on the individual program outcomes will include:
· Your understanding of the concept;
· How you feel the curriculum provided you with the knowledge and skills to meet the outcome;
· What courses and activities in the curriculum addressed the concepts of the outcome.
The outcome for this assignment is:
· Use informed decision making, goal orientation, teamwork, ethical behavior, enhanced technology, and communications to ensure effective leadership in public safety administration.
Class Material
"Problem Solving and Decision Making" http://www.studygs.net/problem/
· "Defining the Problem/Gathering Information" http://www.studygs.net/problem/problemsolvingv1.htm
· "Identifying and Structuring Problems" http://www.skillsyouneed.com/ips/problem-solving2.html
Module 2: Identify Issues or Challenges
Each public safety administrator needs to evaluate his or her environment to determine the major issues. Once identified, each issue must be analyzed, recommendations determined, and solutions implemented and reviewed. Your comprehensive case study capstone project will focus on each area.
Your first paper is an individual project where you will identify an issue or challenge. We have looked at issues facing public safety leaders. The most important point is to identify an issue or problem before it becomes an even bigger problem.
Many problems can be solved on an individual basis. For example, let's say the fire station doors are leaking. Possible solutions include patching the lea.
An explanation of the Doing Ethics Technique Graham R Seach .docxnettletondevon
An explanation of the Doing Ethics Technique
Graham R Seach
Simpson, C. R., Nevile, L., & Burmeister, O. K. (2003). Doing ethics: A universal technique in an
accessibility context. Australian Journal of Information Systems, 10(2), 127-133.
The 'Doing Ethics' technique (DET) is a process for analysing ethical issues in any scenario. It doesn't
guarantee that what you come up with will be the best solution, but it does help you to think
ethically. That said, I understand that the technique may seem a little vague and perhaps lacking
guidance. To that end, the following might help you to understand how to apply the technique in
order to better understand ethical analysis.
To gain the most from the technique, you must explore and answer all eight questions in the order
in which they are posed. Each question stands alone and you cannot take the view that because you
have given information in response to one question that you can omit the same information from
subsequent questions.
Q1. What's going on?
This is a synopsis of what the case is all about. It is written in your own words, and can be taken from
a variety of perspectives, for example, from the perspective of a person raising a complaint, in which
case, it is a synopsis of the complaint. It can be taken from the perspective of an uninvolved
observer, in which case, it is an outline of what was observed, without going into too much detail.
Where you see multiple perspectives, you should describe them here. This question should target a
reader who has no knowledge of the case at hand, and is a brief outline of the case.
Q2. What are the facts?
This is a descriptive list of all the facts of the case. It doesn't just describe the case, but lists all the
facts as they are known (from all sources and perspectives), and also what one might reasonably
consider to be possibilities. For example, if a person was raising a complaint, Question 1 would
outline their complaint, and Question 2 would provide the detailed facts and the evidence to both
support and refute the claims (facts). All facts listed here must be supported by credible evidence, of
which the case itself is one source. If you choose, you may optionally assign a credibility weighting to
each fact, to help with later analysis.
Q3. What are the ethical and non-ethical issues?
This is a list of ALL the issues that are involved in the case, whether they be ethical, legal, social or
otherwise. In Question 5 we extract only the ethical issues for further analysis, but for now, simply
list and describe every relevant issue you can think of. This is probably the most difficult and
important question to get right, because Question 5 can only include the ethical that you have raised
here in Question 3. Therefore, this question must be a complete and comprehensive list of ALL the
issues.
Q4. Who is affected?
This is a list of all the stakeholders (people and entities) invo.
Deliverable 6 - Making Contacts for the FutureTop of FormBotto.docxalisondakintxt
Deliverable 6 - Making Contacts for the Future
Top of Form
Bottom of Form
Assignment Content Nursing Home Admin future job
1.
Top of Form
Competency
Design a personal plan to use social media to benefit the student both personally and professionally as well as minimize online mistakes and their impact.
Student Success Criteria
View the grading rubric for this deliverable by selecting the “This item is graded with a rubric” link, which is located in the
Details & Information pane.
Instructions
Regardless of the career that you pursue or are currently pursuing, it is likely that the action of securing the resource of friends and professional acquaintances will be as valuable as any other action you could take.
Part 1:
First, take some time to reflect on your career and/or future career. If this includes more than one career path, then focus on the one that you are most concerned with in the long term. This might include working in a specific field, starting a business, or any other pursuit you are currently working on or plan to work on in the future. The choice behind the pursuit you will focus on is a personal choice.
Write two pages on why this particular career and/or pursuit is your choice. Reflecting on the why behind your wish to achieve a goal will help to make it feel more tangible to you. This exercise of reflection should serve to remind you of your motivation and will be a good thing to refer back to if your motivation ever gets low. The "why" behind a pursuit is oftentimes more important than the "how" of a pursuit. If you have a strong enough "why," you will find the "how."
Part 2:
For the second part of this assignment, make a list of the types of people that could help you in your career and why those people would be good contacts to have. This list should be general in nature, meaning you should list professions or names of positions within companies rather than specific names.
You should list general fields or positions like accountants, attorneys, marketing managers, CEOs, etc., rather than any specific names. Be sure to list at least five professions or types of people.
Part 3:
Next, consider which social media platforms you could use to make personal contacts that could help you in your pursuit along with why and how you could use each. Ensure that the platform and your use of it line up with the specifics behind your chosen future goal.
Describe at least three different platforms you could use, along with why you would use it, and how you would use it for each of the three.
· Platform #
· Why?
· How?
· Platform #
· Why?
· How?
· Platform #
· Why?
· How?
Part 4:
Finally, put all of this together and take action. The next part of this assignment is where you can make a big difference in your grade as well as in your real life pursuit of a goal!
Reach out through the avenue of social media and make contact with three people that you do not currently know. Describe who you contacted and why .
etting StartedRevised Final Proposal - Internal and ExternalBetseyCalderon89
etting Started
Revised Final Proposal - Internal and External Marketing Environments
The process of peer review strengthens a presentation by having another qualified person analyze the same data and then review your work. You have written and revised a product differentiation and positioning section (submitted in 3.4), and a product development and market demand section (submitted in 4.4). You will now strengthen your initial report on internal and external marketing environments by integrating the alternative from your peer (received in 4.2) into your revised final draft that will be submitted to the client.
Upon successful completion of this assignment, you will be able to:
· Assess the market structure and internal and external marketing environments to determine the crucial factors influencing the marketing strategy.
Resources
· Textbook: The 30 Day MBA in Marketing: Your Fast Track Guide to Business Success, Ch. 9, pp. 175-192
· Textbook: Developing Successful Marketing Strategies, Ch. 6
· Textbook: Value-based Marketing Strategy: Pricing and Costs for Relationship, Ch. 1; Ch. 3, Section 3
· File: Market Analysis Report Template
Instructions
1. Review the rubric to make sure you understand the criteria for earning your grade.
2. This is your revised final draft of the internal and external marketing environments section of your consultant’s report. It is based on what you posted in 3.3 and on your peer’s comments and response posted in 4.2.
3. Your revised final report must integrate your peer’s alternative analysis or recommendation as an alternative perspective as part of your final report. You must either accept your peer’s perspective as a replacement to your initial proposal based on adequate credible theory and current marketing practice to accept it or you must provide adequate credible theory and current marketing practice to reject it. If you accept it as the correct analysis or recommendation, then the peer alternative will become the primary focus of your final paper, and your original analysis and/or recommendation will be noted as an alternative perspective that you have rebutted through cited research. If you do not accept the alternative, then you only need to discuss it as an alternative and provide objective and qualified reasons to reject it.
4. Use the titles from the Market Analysis Report Template to create four sections for this part of the consultant’s report:
a. Porter’s five forces model
b. Other macroenvironmental external factors
c. Required Internal Resources and Competencies to Compete in the Market
d. Required Licenses, Patents, and Rulings or Legal Requirements to Compete in the Market
5. The body of your paper (i.e. excluding title page, graphics, appendices, and references page) must be 1300 words (+/- 50 words). In the event that your peer did not provide feedback, your length must be 1000 words (+/- 0 words) and you will not be penalized for not including the missing feedback.
6. You must use, cit ...
Charles Hackner, Felicia Anderson 6212-ECON-2302-Principles of MicJinElias52
Charles Hackner, Felicia Anderson 6212-ECON-2302-Principles of Microeconomics-SS-20242
March 3, 2021 at 11:17am
· Reply to conversation Here are the instructions for submitting exams. If you do not follow those instructions, I will take points off your overall score! 1. Put all your answers to the questions for the exam into a Word doc. 2. Put your name and course code at the top of your word doc. 3. Use the following file naming format – a. Your file name should be your first name space your last name space 5 digit course code. 4. Use your HCC Outlook email to send the document to me as an attachment. Do not use your canvas email account! CH
· Message actions for Here are the instructions for submitting exams. If you do not follow those instructions, I will take points off your overall score! 1. Put all your answers to the questions for the exam into a Word doc. 2. Put your name and course code at the top of your word doc. 3. Use the following file naming format – a. Your file name should be your first name space your last name space 5 digit course code. 4. Use your HCC Outlook email to send the document to me as an attachment. Do not use your canvas email account! CH
Here are the instructions for submitting exams.
If you do not follow those instructions, I will take points off your overall score!
1. Put all your answers to the questions for the exam into a Word doc.
2. Put your name and course code at the top of your word doc.
3. Use the following file naming format –
a. Your file name should be your first name space your last name space 5 digit course code.
4. Use your HCC Outlook email to send the document to me as an attachment. Do not use your canvas
email account!
•Make sure that you are using an open outline like format in the construction of your answers.
1.The objective of this question is to help you understand how the critical ecosystem services are impacted byeconomic activityand some things we can do to solve those problems. To agreat extent, Economics is about connecting the dots (finding relationshipsbetween seemingly unrelated things). For now,Earth is the only place we can live. Our ability to live on this planet is supported by the many Ecosystems active on the planet. Our behavior disrupts thoseEcosystemsand allthe Ecosystem Services. Those disruptedEcosystem Services in turn have impacts on the people and economies of the global north and global south. It is very important that youdevelopagood understanding of the interaction of ourbehavior and the environmental and economic consequences of that behavior.This question is part of the topic called Intro to some keyconcepts of Economics.
•Pick 5 Ecosystem Servicesfrom the list in slide13of the topic called Intro to some key concepts of Economics.
•For each of your 5 ecosystem services, please explain how each is supposed to work.This iskey to answering the entire question, so please focus on this.Google canhelp with this!
•For each of your 5 ecosystem services ...
Notifications My CommunityHome BSL 4060-14F-6A19-S1, Team .docxvannagoforth
Notifications My CommunityHome
BSL 4060-14F-6A19-S1, Team Building and Leadership
Unit VIII
Unit 8 Introduction--Your
Final Week!!
Unit 8 Learning Objectives and Leaving With A
Competitive Advantage
Congrats!
You’ve made it! Well done! I applaud
everyone of you for your effort and
determination. You met the challenges of
this course, and are ready to move forward
to the next course, graduation, next
academic level or your next set of goals
that you set for yourself. Before you leave
I want to remind you about being
competitive.
You always want to seek a Competitive
Advantage. Look at the picture. What
does it communicate?
Ask yourself this: “Am I the figure in gold
or gray?” If you’re gold…what did it take
to get there? If you’re gray, why are you
there? Competitive advantage is doing
things better than the other person. Think
about athletes, how do they get better?
Well, they train harder, they lift weights,
do plyometrics, yoga, strength training,
and more. Think about how you can gain
a competitive advantage in your job, and
what it takes to be out in front.
Having been a CEO I can tell you this the
people that were promoted, advanced with
responsibility, received awards, and pay
increases contributed more to the
organization. They didn’t complain or
look for handouts. They developed more
skill sets then others, and they
volunteered. Bosses love it when you
volunteer for extra work and projects.
Yes, trust me. Those I promoted gave
more to the organization than others, and
they left their competition in the dust.
Good luck in your future classes, it was a
pleasure having you in class.
Dr Anderson
This final week you want to reflect on
your previous 7 weeks of material.
What are your takeaways?
What was the biggest influence to you
over the course?
What can you apply to your daily life,
work, etc to be more productive,
competitive and a better team player by
communicating better.
Review the second picture. What do you
see? What you see in an abstract concept
is this weeks objectives: Describe team-
building activities leaders can incorporate
for better managing internal teams and
interorganizational alliances. Predict
major challenges teams will face in the
future, and the need for teamwork will
remain high in the future. Finally the
work activities that will require a team for
task completion.
Unit 8 Learning Objectives
Upon completion of this unit, students
should be able to:
5. Describe team-building activities
leaders can incorporate for better
managing internal teams and
interorganizational alliances.
8. Predict major challenges teams will
face in the future.
8.1 Explain why the need for teamwork
will remain high in the future.
8.2 Describe work activities that will
require a team for task completion.
3.1 Describe advances in organizational
diversity developed from legislation.
3.2 Explain paradigm shifts in
organizational environments from
increased diversity legislation
Un ...
Assignment 1 Reviewing Research and Making Connections (Student.docxdeanmtaylor1545
Assignment 1: Reviewing Research and Making Connections
(Student name)
Dr. Goldstein
Introduction to Sociology
(Date)
Ask (Write a paragraph of at least 5 7 sentences answering the following questions in your own words.)
· What was the topic of the research?
· Who was studied in the research?
· What was the research question that was answered by the information in the article?
Research (Write a paragraph of at least 5-7 sentences answering the following questions in your own words.)
· What research methods were used?
· Summarize the process researchers used to collect data.
Learn (Write a paragraph of at least 5-7 sentences answering the following questions in your own words.)
· What were the key findings of the research?
· What conclusion was drawn from the research?
Do (Write a paragraph of at least 5-7 sentences answering the following questions in your own words.)
· What are two additional follow-up questions that you have based on this research?
· Why did you choose these follow up questions?
The topic of research is chose was the main difference of the people from different part of the world especially when it comes to their looks. During the research some 4000 people from 40 different countries were used as the sample for the study. The research question answered in the article was what are some of the difference witnessed in people from different countries? Through studying the samples the researchers were able to determine that people from different parts of the world prefer different space especially when communicating with others.
Survey was the method which was used in collecting information for this particular study. Geographical locations are the one which determine personal space boundaries and thus conducting the survey, the world should be divided into contact and non-conduct cultures. For instance, conduct cultures will comprise of countries such as Middle East, South America and South Europe. On the other hand, non-conduct countries are such as Asia, Northern Europe and North America. All the participants were issued with sheet with two options and with at the end they should explain the amount of space they keep when dealing with others. The participants will be given three categories; personal distance, social distance and social distance.
From the research, it was found that people from Saudi Arabia keep a large distance to their friend as compared to their counterparts from Argentina. On the other hand Hungarians keep a close distance to all the people they meet even if they are strangers. When it comes to gender, women have a more personal space when they are dealing with strangers as compared to men. On the other hand old people keep less distance to other as compared to young people. When it comes to climate, people living in warmer areas keep close distance as compared to those living in cold areas in the world.
Because babies are not usually born with the understanding of perso.
Unit 12 assignment 1 – job market researchBluecare
Support can either be nothing more than a means to an end, or it can be a dynamic aspect of your entire business. Engaging customers and helping them get the most out of your product will give them a reason to tell others why they love your company. Cultivate these traits, and I guarantee you’ll be on your way to world-class support.
As a backlash, the professional model, which reflects a "we are the experts and you are not" attitude, alienated the police from the public. Problems and crime kept growing, and people wanted to be more involved in their communities. Therefore, community members started to work closely with the police. The police saw their resources diminish and decided it was critical to engage the communities to more effectively combat rising crime.
Please read the description of the Religion ethnography carefully an.docxSusanaFurman449
Please read the description of the Religion ethnography carefully and then ask me in class to explain anything that isn't clear. You can also email me with questions.
At the end there is a short list of possible sites for the ethnography: Sikh, Islamic, Jewish, Catholic, Hindu, Buddhist. Shumei. There are other religions and many other sites. Bahai is an interesting religion but you have to be invited to attend by a member.
Mormon the same.
If you have access to a Santeria or similar ceremony, great!
To make the project worthwhile choose a site as different from your own background as you can.
If you have a Christian or Catholic background do not do your paper on any kind of Christian or Catholic service.
You are welcome to attend a non-English language service as long as you understand the language being used.
Be sure to okay your choice with me. Some places that don’t work for this project are Scientology, the Self Realization Fellowship, the Kabbalah Center, SGI Buddhist, Hare Krishna.
INSTRUCTIONS:
Attend a religious activity that you’re curious about and would like to explore.
You must attend a service, not simply visit a religious site.
Examples: a mosque, temple, synagogue, gurdwara.
You can probably find an interesting place of worship near where you live or work.
It’s always a good idea to phone or email the place of worship before you attend.
Research methods must include participant/observation and informal conversation. One slightly more formal interview is desirable.
Be absolutely sure to allow time to stay after the service for food, lunch, other refreshment, or informal gathering. This may well be the most important part of your experience and will enable you to answer the question, “What meaning does this place and this service have for the participants?
You must go some place you’ve never been to before. Do NOT choose your own tradition or somewhere you’re even a bit familiar with. Choose somewhere entirely new and different.
The important thing is to come to the service as an outsider, with the eyes and ears of an anthropologist and take note of everything. Use the skills you’ve learned in this class.
You can attend alone or with a co-researcher or two from the class. Best, you can be the guest(s) of a classmate or someone else you know and discuss the event with them. Invite a classmate or two to attend a service from your tradition.
Do not write about an event you attended in the past. But you can use past experiences for comparison and reflection.
It is almost never appropriate to jot down notes during a religious service. Better, write everything you remember immediately after the event. Get sufficient detail to write what anthropologist Clifford Geertz called “thick”, or rich description.
In writing your paper use terms we've discussed in class and think about connections to the reading we’ve done and films we’ve seen.
OUTLINE
: Include each of these sections.
Title Page,
or top of page: .
PLEASE read the question carefully. The creation of teen ido.docxSusanaFurman449
PLEASE read the question carefully.
The creation of “teen idols” is a tradition that stems back to Tin Pan Alley and the “old guard” way of making music. What were some of the factors that led to this point in the early 60’s? Is it still prevalent? If so, why? Name some examples.
.
Please reflect on the relationship between faith, personal disciplin.docxSusanaFurman449
Please reflect on the relationship between faith, personal discipline, and political integrity. Explain how the Progressive movement and the New Deal Court transformed constitutional interpretation. Briefly give 2 illustrations of how government regulations and/or subsidies (legal plunder, perhaps?) channels behavior and/or distorts markets. 400 WORDS
.
Please read the following questions and answer the questions.docxSusanaFurman449
Please read the following questions and answer the questions
This unit's chapter discussed concerns about quality programming in the media. Different models for assessing culture were discussed:
1) Culture as a Skyscraper Model and 2) Culture as a Map.
Come up with several television shows that serve as examples of “quality” programs and “trashy” programs. What characteristics determine their quality (plots, subject matter, themes, characters…)?
Is there anything you can think of that is “universally trashy”? Or universally in good taste?
On the whole, are Americans seen as having good taste? Why or why not? Is there a country/culture that always seems tasteful in its cultural products?
Which model (Culture as Skyscraper or Culture as Map) makes more sense to you and why?
i need 400 words
.
PRAISE FOR CRUCIAL CONVERSATIONS Relationships ar.docxSusanaFurman449
PRAISE FOR CRUCIAL CONVERSATIONS
"Relationships are the priority of life, and conversations are the
crucial element in profound caring of relationships. This book
helps us to think about what we really want to say. If you want
to succeed in both talking and listening, read this book."
-Dr. Lloyd J. Ogilvie, chaplain, United States Senate
"Important, lucid, and practical, Crucial Conversations is a
book that will make a difference in your life. Learn how to flour
ish in every difficult situation."
-Robert E. Quinn, ME Tracy Collegiate Professor of
OBHRM, University of Michigan Business School
"I was personally and professionally inspired by this book-and
I'm not easily impressed. In the fast-paced world of IT, the success
of our systems, and our business, depends on crucial conversations
we have every day. Unfortunately, because our environment is so
technical, far too often we forget about the 'human systems' that
make or break us. These skills are the missing foundation piece."
-Maureen Burke, manager of training,
Coca-Cola Enterprises, Inc.
"The book is compelling. Yes, I found myself in too many of their
examples of what not to do when caught in these worst-of-all
worlds situations! GET THIS BOOK, WHIP OUT A PEN AND
GET READY TO SCRIBBLE MARGIN NOTES FURIOUSLY,
AND PRACTICE, PRACTICE, PRACTICE THE INVALUABLE
TOOLS THESE AUTHORS PRESENT. I know I did-and it
helped me salvage several difficult situations and repair my
damaged self-esteem in others. I will need another copy pretty
soon. as I'm wearing out the pages in this one!"
-James Belasco. best-selling author of Flight of the Buffalo,
l!l1trl!prl!l1eur. professor. und l!xl!cutive director of the Financial
Tilllrs Knowkdgc Diuloguc
"Crucial Conversations is the most useful self-help book I have
ever read. I'm awed by how insightful, readable, well organized,
and focused it is. I keep thinking: 'If only I had been exposed to
these dialogue skills 30 years ago ... '"
-John Hatch, founder, FINCA International
"One of the greatest tragedies is seeing someone with incredible
talent get derailed because he or she lacks some basic skills.
Crucial Conversations addresses the number one reason execu
tives derail, and it provides extremely helpful tools to operate in
a fast-paced, results-oriented environment."
-Karie A. Willyerd, chief talent officer, Solectron
"The book prescribes, with structure and wit, a way to improve on
the most fundamental element of organizational learning and
growth-honest, unencumbered dialogue between individuals.
There are one or two of the many leadership/management
'thought' books on my shelf that are frayed and dog-eared from
use. Crucial Conversations will no doubt end up in the same con
dition."
-John Gill, VP of Human Resources, Rolls Royce USA
Crucial
Conversations
Crucial
Conversations
Tools for Talking
When Stakes Are High
by
Kerry Patterson, .
Must Be a
hip-hop concert!!!!
attend a
hip-hop concert (in-person or virtual/recorded live concert on DVD or streaming platform) of your choice
THIS month.
After the concert, write an
objective review (1000 - 1500 words) of the concert detailing your experience.
Write A Review and include those questions!!!
The review should include:
1. The names of the performing groups/artists; the date and location of the performance.
2. Describe the setting. Is it a large hall or an intimate theater? What type of audience demographic is there? Young or old? How do they respond to the music?
3. The different styles/genres of songs the artist(s) perform.
4. Use your notes and experience to describe the different musical elements (i.e. melody, harmony, timbre, technology, form, volume, etc.) you recognize in most (if not all) the songs/pieces.
5. Be sure to arrive on time to hear the
entire concert.
6. Attach a photo of the flyer, ticket, or webpage (or social media event) when you submit this assignment.
7. Describe your personal reaction to the concert. List reasons why you think it was successful or not. However, do not make this the center of your paper. It should be
one or two paragraphs at the end. Further, use
data to support your arguments about why it was successful or not successful. (e.g., How did people respond verbally and non-verbally? Was this based on your perception or was there a general consensus? If it is a consensus, then what facts do you have to support this?)
8. Try to do some background research on the genre or artist before and after you attend the concert. This is not a research paper, but if you use any information from any source (including the artist's website), you
must cite it both in-text and on a works-cited page.
.
Mini-Paper #3 Johnson & Johnson and a Tale of Two Crises - An Eth.docxSusanaFurman449
Mini-Paper #3: Johnson & Johnson and a Tale of Two Crises - An Ethics Story Revised Submission
Read the following two PDF documents located at this link: click hereLinks to an external site.
·
Johnson & Johnson’s Tylenol Crisis
·
JNJ’s Baby Powder Crisis: Does Baby Powder Cause Cancer?
·
You are not expected to conduct any outside research
Based on your reading please write a short paper answering the following questions (do not answer with bullets, write a paper):
· JNJ’s response to the Tylenol Crisis is often cited as one of the best historical crisis management leadership examples. Given this perspective:
·
Compare JNJ’s response to the Tylenol Crisis to their response in the Baby Powder Crisis.
·
What actions by JNJ were highly effective in the Tylenol Crisis and why? Explain your examples and why you believe they are best practices
·
What could JNJ improve upon in the Tylenol Crisis?
· After reading JNJ's handling of the Baby Powder Class Action Lawsuit elaborate upon the following:
·
How did JNJs response differ from the Tylenol Crisis in the Baby Powder Lawsuit?
·
Given what you've learned from the Tylenol Crisis what are three potential recommendations/improvements JNJ could have made in the Baby Powder Lawsuit?
·
Ethics Analysis - consider your decision from the perspective of a senior advisor to senior leadership at JNJ (
there is NO right answer here, YOU MAY GIVE OPINION IN FIRST PERSON IN THIS SECTION ONLY (this is a special exception)):
·
· With what ethical actions do you agree or disagree regarding how JNJ handled the Tylenol Crisis?
· With what ethical actions do you agree or disagree regarding how JNJ handled the Baby Powder Crisis?
·
Be sure to reference at least 3 concepts from Chapters 9 and/or 12 in the textbook in answering this mini-paper. Please mark your references with "(textbook)" to make clear the references from the book.
Johnson & Johnson’s Tylenol Crisis
Background
“The killer’s motives remain unknown, but his — or her, or their — technical
savvy is as chilling today as it was 30 years ago.
On Sept. 29, 1982, three people died in the Chicago area after taking
cyanide-laced Tylenol at the outset of a poisoning spree that would claim seven
lives by Oct. 1. The case has never been solved, and so the lingering question —
why? — still haunts investigators.
Food and Drug Administration officials hypothesized that the killer bought
Extra-Strength Tylenol capsules over the counter, injected cyanide into the red
half of the capsules, resealed the bottles, and sneaked them back onto the shelves
of drug and grocery stores. The Illinois attorney general, on the other hand,
suspected a disgruntled employee on Tylenol’s factory line. In either case, it was a
sophisticated and ambitious undertaking with the seemingly pathological go.
Please write these 2 assignments in first person.docxSusanaFurman449
Please write these 2 assignments in
first person view. No need for citation. Please give me two files, the first one is a
Short Paper(600-700 words); the second one is
Long Discussion(450-500 words).
They are all about Art and Politics in Renaissance Florence Period
1. Short Paper
Street corners, guild halls, government offices, and confraternity centers contained works of art that made the city of Florence a visual jewel at precisely the time of its emergence as a European cultural leader. In shared religious and secular spaces, people from the city of Florence commissioned altarpieces, chapels, buildings, textiles, all manner of objects – at home, interior spaces were animated with smaller-scale works, such as family portraits, birth trays, decorated pieces of furniture, all of which relied on patrons, artists, and audiences working with the beauty and power of sensory experience. Like people all over Europe, viewers believed in the power of images, and they shared an understanding of the persuasiveness of art and architecture. Florentines accepted the utterly vital role that art could play as a propagator of civic, corporate, religious, political and individual identity.
Select one or two of the test case studies [that is, talk about Cosimo or Lorenzo the Magnificent or Savonarola's impact on Florence or the new Republic under Soderini] from this Module on Art and Politics in Renaissance Florence, and explore your understanding of people in Florence, who was so alive to the power and communication possibilities in works of art, objects, and spaces throughout the city and beyond.
Word count:
600-700 words
No need for citations.
2. Long Discussion
In this longer discussion forum, create an initial post of
450-500 words that explores these key concepts;
In this discussion post, talk about the political and social messages that you can see in the various works of art commissioned by the Medici, all the while being aware of the debate that was circulating about power and religion. If the content of the work of art is religious, how does the work convey political messages?
a video that may help
https://www.youtube.com/watch?v=UAqE21zjQH4
.
Personal Leadership Training plan AttributesColumbia South.docxSusanaFurman449
Personal Leadership Training plan : Attributes
Columbia Southern University
Dr. Mark Friske
Current Issues in Leadership
LDR 6302-22.01.00
10/14/2022
Introduction
Personal leadership style
personal leadership style attributes
Characteristics of a democratic leader
Charismatic leadership style
Charismatic leader
Transformational leadership style
Transformational leader
Charismatic vs. transformational
Impacts of transformational leadership
Reflection
Personal leadership style
Democratic leadership style
Embraces diversity and open dialogue as core values.
The leader's role is to provide direction and exercise authority.
Commands respect and admiration from those who follow you.
Moral principles and personal beliefs underpin all choices.
Seek out a wide range of perspectives (Cherry, 2020).
Behaviorist theory is the one that fits my style of leadership the best.
Being the change you wish to see in the world is crucial, in my opinion. According to Johann Wolfgang von Goethe, "Behavior is the mirror in which everyone exhibits their picture." My main priorities are the well-being of the team members and developing effective solutions via cooperative effort.
personal leadership style attributes
Active participant
Each person is given a fair chance to speak their mind, and there is no pressure to conform to any one viewpoint.
Values other standpoints
I find it fascinating to hear the perspectives of others. To me, it's crucial that everyone in the team pitches in to find the most effective answer. To me, it's important to give everyone a voice on the team since they all have something unique to offer.
Characteristics of democratic leader
Attribute:
Talk About It
Subcontract Work
Get Other People's Opinions
Friendly
Approachable
Trustworthy
Participative
Motivate Originality
Regard for Others
Build Confidence
Life example
Working as a Management Analyst in the realm of government spending, I am frequently required to communicate with the Program Management Team of a third party firm. No collimated staff members prevent me from personally performing some of the work necessary to maintain an accurate external organization ledger. As a result, I need to be approachable, polite, and nice to my coworkers so that they would feel comfortable confiding in me and trusting me with their ideas. By consistently soliciting feedback from staff and management, I want to foster a culture of collaboration. This fosters innovation on the team and opens minds to new points of view.
Charismatic leadership style
They have excellent communication skills.
Passionate in furthering Their Cause.
Professionals have a lot of experience in their field.
Act with a level head (Siangchokyoo, et al. 2020).
Leadership traits and behavior are under scrutiny.
Win Over Huge Crowds.
Possible drawbacks
Frustratingly Diminished Clarity
Not Enough People to Make It Happen
Charismatic leader
Charismatic leader example:
pr.
Need help on researching why women join gangs1.How does anxi.docxSusanaFurman449
Need help on researching why women join gangs
1.How does anxiety increase the chance of girls joining groups or gangs.
2. sexual abuse on girls joining gangs
3. long-term consequences on girls joining gangs
4. depression and anxiety impact on girls joining gangs
5.death rates of girls joining gangs
6. health risks of girls joining gangs
.
Jung Typology AssessmentThe purpose of this assignment is to ass.docxSusanaFurman449
Jung Typology Assessment
The purpose of this assignment is to assess your personality and how that information might help guide your career choice. Understanding personalities can also help managers know how to motivate employees.
Find out about your personality by going to the Human Metrics website (www.humanmetrics.com - and TAKE the Jung Typology Test - Jung, Briggs, Meyers Types. It is a free test. (Disclaimer: The test, like all other personality tests, is only a rough and preliminary indicator of personality.)
·
Complete the typology assessment
·
Read the corresponding personality portrait and career portrait.
·
Think about your career interests, then answer the following:
How are your traits compatible for your potential career choice (Business Administration)? This should be around 250 words of writing.
R E S E A R CH
Co-administration of multiple intravenous medicines: Intensive
care nurses' views and perspectives
Mosopefoluwa S. Oduyale MPharm1 | Nilesh Patel PhD, BPharm (Hons)1 |
Mark Borthwick MSc, BPharm (Hons)2 | Sandrine Claus PhD, MRSB, MRSC3
1Reading School of Pharmacy, University of
Reading, Reading, UK
2Pharmacy Department, John Radcliffe
Hospital, Oxford University Hospitals NHS
Foundation Trust, Oxford, UK
3LNC Therapeutics, Bordeaux, France
Correspondence
Mosopefoluwa S. Oduyale, Reading School of
Pharmacy, University of Reading, Harry
Nursten Building, Room 1.05, Whiteknights
Campus, Reading RG6 6UR, UK.
Email: [email protected]
Funding information
University of Reading
Abstract
Background: Co-administration of multiple intravenous (IV) medicines down the
same lumen of an IV catheter is often necessary in the intensive care unit (ICU) while
ensuring medicine compatibility.
Aims and objectives: This study explores ICU nurses' views on the everyday practice
surrounding co-administration of multiple IV medicines down the same lumen.
Design: Qualitative study using focus group interviews.
Methods: Three focus groups were conducted with 20 ICU nurses across two hospi-
tals in the Thames Valley Critical Care Network, England. Participants' experience of
co-administration down the same lumen and means of assessing compatibility were
explored. All focus groups were recorded, transcribed verbatim, and analysed using
thematic analysis. Functional Resonance Analysis Method was used to provide a
visual representation of the co-administration process.
Results: Two key themes were identified as essential during the process of co-admin-
istration, namely, venous access and resources. Most nurses described insufficient
venous access and lack of compatibility data for commonly used medicines (eg, anal-
gesics and antibiotics) as particular challenges. Strategies such as obtaining additional
venous access, prioritizing infusions, and swapping line of infusion were used to man-
age IV administration pro.
Journal of Organizational Behavior J. Organiz. Behav. 31, .docxSusanaFurman449
Journal of Organizational Behavior
J. Organiz. Behav. 31, 24–44 (2010)
Published online 22 May 2009 in Wiley InterScience
(www.interscience.wiley.com) DOI: 10.1002/job.621
Towards a multi-foci approach to
workplace aggression: A meta-analytic
review of outcomes from different
yperpetrators
M. SANDY HERSHCOVIS1* AND JULIAN BARLING2
1I. H. Asper School of Business, University of Manitoba, Winnipeg, Manitoba, Canada
2Queen’s School of Business, Queen’s University, Kingston, Ontario, Canada
Summary Using meta-analysis, we compare three attitudinal outcomes (i.e., job satisfaction, affective
commitment, and turnover intent), three behavioral outcomes (i.e., interpersonal deviance,
organizational deviance, and work performance), and four health-related outcomes (i.e.,
general health, depression, emotional exhaustion, and physical well being) of workplace
aggression from three different sources: Supervisors, co-workers, and outsiders. Results from
66 samples show that supervisor aggression has the strongest adverse effects across the
attitudinal and behavioral outcomes. Co-worker aggression had stronger effects than outsider
aggression on the attitudinal and behavioral outcomes, whereas there was no significant
difference between supervisor, co-worker, and outsider aggression for the majority of the
health-related outcomes. These results have implications for how workplace aggression is
conceptualized and measured, and we propose new research questions that emphasize a multi-
foci approach. Copyright # 2009 John Wiley & Sons, Ltd.
I admit that, before I was bullied, I couldn’t understand why employees would shy-away from doing
anything about it. When it happened to me, I felt trapped. I felt like either no one believed me or no
one cared. This bully was my direct boss and went out of his way to make me look and feel
incompetent. . . I dreaded going to work and cried myself to sleep every night. I was afraid of
losing my job because I started to question my abilities and didn’t think I’d find work elsewhere.
(HR professional as posted on a New York Times blog, 2008).
Introduction
Growing awareness of psychological forms of workplace aggression has stimulated research interest in
the consequences of these negative behaviors. Workplace aggression is defined as negative acts that are
* Correspondence to: M. Sandy Hershcovis, I. H. Asper School of Business, University of Manitoba, Winnipeg, Manitoba,
Canada. E-mail: [email protected]
yAn earlier version of this study was presented at the 65th Annual Meeting of the Academy of Management, Honolulu, HI.
Received 28 April 2008
Revised 17 March 2009
Copyright # 2009 John Wiley & Sons, Ltd. Accepted 4 April 2009
mailto:[email protected]
www.interscience.wiley.com
25 AGGRESSION META-ANALYSIS
perpetrated against an organization or its members and that victims are motivated to avoid (Neuman &
Baron, 2005; Raver & Barling, 2007). Much of this research (e.g., .
LDR535 v4Organizational Change ChartLDR535 v4Page 2 of 2.docxSusanaFurman449
LDR/535 v4
Organizational Change Chart
LDR/535 v4
Page 2 of 2
Organizational Change Chart
Organizational Information
Select an organization that needed a change to its culture as you complete the organizational change information chart.
For each type of information listed in the first column, include details about the organization in the second column.
Indicate your suggested actions for improvement in the third column.
Type
Details
Suggested Actions for Improvement
Vision
Insert the organization’s vision.
Mission
Insert the organization’s mission.
Purpose
Insert the organization’s purpose.
Values
Insert a list of the organization’s values.
Diversity and Equity
Insert the types of the diversity and equity observed in the organization.
Inclusion
Insert examples of overall involvement of diverse groups inclusion in decision-making and process change.
Goal
Identify the goal set for organizational change.
Strategy
Identify the implementation strategies followed to implement the organizational change.
Communication
Identify the communication methods used to communicate organizational change and the change progress.
Organizational Perceptions
Considering the same organizational culture and change goal, rate your agreement from 1 to 5 in the second column with the statement in the first column. Use the following scale:
1. Strongly disagree
2. Somewhat disagree
3. Neither agree nor disagree
4. Somewhat agree
5. Strongly agree
Statement
Rating (1 – 5)
Employees know the organization’s vision.
Employees know the organization’s mission.
Employees know the organization’s purpose.
Employees know the organization’s values.
Overall, the organization is diverse and equitable.
Diverse groups are included in decision making and processes for change.
The change goal was successfully met.
The implementation strategies were effective.
The organization’s communication about the change was effective.
Kotter's 8-Steps to Change
Consider the goal for organizational change that you identified and the existing organizational culture.
For each of Kotter's 8-Steps to Change listed in the first column, rate whether you observed that step during the implementation process in the second column. Use the following scale to rate your observation:
1. Never observed
2. Rarely observed
3. Sometimes observed
4. Often observed
Identify actions you suggest for improvement in the third column.
Step Name
Rating (1 – 4)
Suggested Actions for Improvement
Step 1: Create Urgency.
Step 2: Form a Powerful Coalition.
Step 3: Create a Vision for Change.
Step 4: Communicate the Vision.
Step 5: Remove Obstacles.
Step 6: Create Short-Term Wins.
Step 7: Build on the Change.
Step 8: Anchor the Changes in Corporate Culture.
Copyright 2022 by University of Phoenix. All rights reserved.
Copyright 2022 by University of Phoenix. All rights reserved.
image1.png
.
In this paper, you will select an ethics issue from among the topics.docxSusanaFurman449
In this paper, you will select an ethics issue from among the topics below and provide a 3-4 page paper on the issue.
In the paper, you will address the following:
1. Explain the topic (20%)
2. Why the topic or issue is controversial (25%)
3. Is the controversy justified? Why or why not? (20%)
4. Summarize current research about the issue and at least two credible sources. At least one reference source should discuss the issue from a pro and the other should discuss from a con perspective. (20%)
5. Cite references in APA format (15%)
Topics may include:
Research on animals
Medical Research on prisoners or ethnic minorities
Patient rights and HIPAA
Torture of military prisoners
Off-shore oil drilling and the potential threat to biodiversity
Development in emerging nations and its impact on biodiversity
Stem cell research
Healthcare Accessibility: Right or privilege
Genetically modified organisms
Genetic testing and data sharing
Reproductive rights
Pesticides and Agriculture
Organ transplants and accessibility
Assisted Suicide
Medicinal use of controlled substances/illicit drugs
.
In the past few weeks, you practiced observation skills by watchin.docxSusanaFurman449
In the past few weeks, you practiced observation skills by watching
Invictus, a movie that tells “the inspiring true story of how Nelson Mandela joined forces with the captain of South Africa's rugby team to help unite their country.”
[1]. While watching the film, you were instructed to pay special attention to the factors relating to group dynamics for teams, which include but are not limited to
1. Team beginnings
2. Leader’s behaviors,
3. Communication Patterns,
4. Conflict resolution style,
5. Power styles,
6. Decision making style,
7. Creativity,
8. Diversity.
You were also instructed to identify leadership decisions and leadership styles developed by Nelson Mandela and Francois Pinnear (captain of the rugby team).
Write a paper (1000 words) to the following three questions:
1. Which leadership decision/style has impressed you the most? Why do you feel this way?
2. How does the leader contribute to the development of their leadership ability?
3. What specific decisions made this leader make them such an effective leader? Provide insight on how those under this leadership are affected by decisions made.
.
Overview After analyzing your public health issue in Milestone On.docxSusanaFurman449
Overview: After analyzing your public health issue in Milestone One and studying socioeconomic factors affecting healthcare in this module, you will write a short paper to identify and analyze socioeconomic barriers and supports involved in addressing the public health issue. Your paper must include an introduction to your public health issue, a discussion of socioeconomic barriers to change, a discussion of supports for change, and a conclusion with a call to action for your readers. Assume your readers will include healthcare administrators and managers, as well as healthcare policy makers and legislators.
Prompt: Write a short paper including the following sections:
I. Introduction
A. Introduce your public health issue and briefly explain what needs to change to address the issue.
II. Barriers
A. Identify two potential socioeconomic barriers to change and describe each with specific details.
B. Consider patient demographics (e.g., age, ethnicity, and education), geographic factors (e.g., urban/rural location), and psychographic factors (e.g., eating habits and employment status).
C. Justify your points by referencing your textbook or other scholarly resources.
III. Supports
A. Identify two possible socioeconomic supports for change and describe each with specific details.
B. B. Consider patient demographics (e.g., age, ethnicity, and education), geographic factors (e.g., urban/rural location), and psychographic factors (e.g., eating habits and employment status).
C. C. Justify your points by referencing your textbook or other scholarly resources.
IV. Conclusion
A. Conclude with a clear call to action: What can your readers do to assist in the implementation of the necessary changes?
Rubric Guidelines for Submission: Your short paper must be submitted as a 2-page Microsoft Word document with double spacing, 12-point Times New Roman font, one-inch margins, and at least three sources cited in APA format.
.
Judicial OpinionsOverview After the simulation, justices writ.docxSusanaFurman449
Judicial Opinions
Overview: After the simulation, justices write judicial opinions in reaction to the oral argument, merits briefs, conference, and draft opinions as well as the facts of the case, Constitution, and case law. Justices circulate drafts so they know how their colleagues plan to rule and why, and so they can respond to one another in their final judicial opinion draft.
Instructions: You are a Supreme Court justice preparing an opinion for announcement. Read the case materials: case hypothetical, merits briefs, and judicial opinion drafts of your colleagues, and review your notes from oral argument and conference. Write a majority opinion resolving the major legal question in light of the facts of the case, Constitution, and case law, as well as all case materials: merits briefs, oral argument, and the views of your colleagues (in conference and draft opinions). Opinions must support an argument, refute counterarguments, and respond to attorneys (oral argument and/or merits briefs), and fellow justices (conference and/or draft opinions).
Opinions should contain the following five elements, in the following order:
1. an introductory statement of the nature, procedural posture, and prior result of the case;
2. a statement of the issues to be decided;
3. a statement of the material facts;
4. a discussion of the governing legal principles and resolution of the issues; and
5. the disposition and necessary instructions.
Each of these is developed further below.
Assessment: Complete opinions must support an argument, refute counterarguments, and respond to attorneys (oral argument and/or merits briefs), and fellow justices (conference and/or draft opinions). Strong opinions will be well organized, logically argued, and well supported through reference to and explanation of Supreme Court decisions and legal principles. Assessment rests on how well you make use of, identify, and explain relevant course material. It also rests on staying in character and not diverging from your justice’s political ideology and/or judicial philosophy.
Introduction
The purpose of the Introduction is to orient the reader to the case. It should state briefly what the case is about, the legal subject matter, and the result. It may also cover some or all of the following:
1. The parties: The parties should be identified, if not in the Introduction, then early in the opinion, preferably by name, and names should be used consistently throughout. (The use of legal descriptions, such as “appellant” and “appellee,” tends to be confusing, especially in multi-party cases.)
2. The procedural and jurisdictional status: relevant prior proceedings, and how the case got before the court should be outlined.
Statement of issues
The statement of issues is the cornerstone of the opinion; how the issues are formulated determines which facts are material and what legal principles govern. Judges should not be bound by the attorneys’.
IntroductionReview the Vila Health scenario and complete the int.docxSusanaFurman449
Introduction
Review the Vila Health scenario and complete the interviews with staff at Vila Health Skilled Nursing Facility (SNF). After completing the scenario, you will update the patient safety plan for the SNF and present it to the executive team. The safety plan will include meeting accrediting body requirements as well as regulatory obligations. The plan must be based on evidenced-based best practices and include tools, approaches, and mechanisms for reporting, tracking, and reducing patient safety incidents.
Instructions
After reviewing the Vila Health scenario, present your findings to the executive team at Vila Health by creating a 15-20 slide PowerPoint presentation. To be successful in this assignment, ensure you complete the following steps:
Research the health care organization's (Vila Health SNF) safety plan and propose recommendations to ensure the successes of their best practices.
Assess and propose how to link health care safety goals to those of the organizational strategic plan in order to create and sustain an organization-wide safety culture.
Analyze evidence-based practices within the organization's health care safety program, including falls prevention, medication errors, or others.
Establish protocols to identify and monitor patients who qualify for being at risk for falls, readmission, suicide, or others.
Develop mechanisms to coordinate and integrate risk management approaches into the organization's health care safety strategy.
Create mechanisms and tools as monitors for patients identified for being at risk.
Create ongoing evaluation procedures that provide continuous safe, quality patient care, and sustained compliance with evidence-based practices, professional standards, and regulations.
Submission Requirements
Your presentation should meet the following requirements:
Length:
15–20 slide PowerPoint presentation, excluding the cover slide and references list. Include slide numbers, headings, and running headers.
References:
3–5 current peer-reviewed references.
Format:
Use current APA style and formatting, for citations and references.
Font and font size:
Fonts and styles used should be consistent throughout the presentation, including headings.
.
In studying Social Problems, sociologists (and historians) identify .docxSusanaFurman449
In studying Social Problems, sociologists (and historians) identify "the defining moment" or a specific trigger event that brought about the need for social change (or the need to resist the status quo).
Give a brief history/background story of the social issue, and why and/or how it became a Social Problem. Provide supporting evidence.
What was the "defining moment" that catapulted the social issue into the political arena?
What was public policy was framed to address the problem?
.
I need help correcting an integrative review.This was the profes.docxSusanaFurman449
I need help correcting an integrative review.
This was the professor's feedback: Great job on your first draft :) Few things Past tense throughout the integrative review. Some of the sections are light on detail - need to check the requirements (Integrative review guidelines). This is an integrative review - not a study or project refer to it as an integrative review all the time.
.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
How to Make a Field invisible in Odoo 17Celine George
It is possible to hide or invisible some fields in odoo. Commonly using “invisible” attribute in the field definition to invisible the fields. This slide will show how to make a field invisible in odoo 17.
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
How libraries can support authors with open access requirements for UKRI fund...
HMSV 346 Diversity Issues in Human Services Spring 2021
1. HMSV 346 Diversity Issues in Human Services / Spring 2021
1/2
(George Floyd) Advocacy Project
Objective: Students will understand the importance of advocacy
and develop the attitude, knowledge, and
skills needed to effectively advocate on behalf of oppressed or
marginalized groups.
Background: A few months ago, George Floyd died when four
Minneapolis police officers were trying to
subdue and arrest him. His death, which was caught on video,
raised the now common concerns about
police brutality towards African Americans, and ignited
protests, unrest, and debate throughout the country.
Personal and Professional Relevance: Such incidents (the death
of Floyd and others) and subsequent
chain of events impact you in two distinct ways:
• As an individual bound by your personal identities, thoughts,
values, etc.,
2. • As a soon-to-be human service professional bound by a
professional code of ethics.
While your reactions to these events as an individual are quite
likely to be emotional and subjective, it is
essential that as a human service professional you maintain
objectivity in understanding and addressing
these events. The primary objective of this project is to develop
fundamental skills necessary to advocate
on behalf of an oppressed or marginalized group. Successful
completion of this project/assignment requires
you to answer the following questions and complete the
following parts:
Part I
1. What is your personal reaction, thoughts, feelings, etc. about
such incidents?
2. There are various perspectives about who is responsible for
such incidents:
a. Some claim that incidents such as these are caused by those
(some African Americans) who violate
the law or disobey the lawful orders of cops.
b. Others claim that such situations are caused by those racists
(some cops) who are ready to inflict
violence on African Americans at the slightest pretext or for no
reason whatsoever.
c. Some believe that such incidents happen because of a
3. combination of both (a) and (b).
d. A few believe that it is neither a, b, nor c, but there are other
or more reasons for why such
incidents happen.
What is your personal opinion about the reason(s) for such
incidents? Choose only one of the above (a, b, c,
or d) and elaborate.
Part II
3. Are such incidents relevant to human services practice with
clients? In other words, are incidents such
as these likely to impact certain groups of clients?
• If yes, then elaborate upon these impacts/consequences.
• If no, then provide a strong justification for your answer.
4. Human service professionals are required to consider the
National Organization of Human Services’
ethical standards in professional decision making. Identify
which ethical standards may apply to
understanding and addressing such incidents (Hint: Check out
the standards pertaining to
Responsibility to the Public and Society). Provide a brief
justification as to why you believe these
standards may apply to such incidents.
5. What steps would you take as a human service practitioner to
4. ensure that people-in-power (police
commissioners, lawmakers, funders, community leaders, etc.)
take appropriate action to prevent such
incidents?
• Ideally, your response to this question (5) are influenced
solely by the NOHS ethical standards. If
you believe that the standards are not sufficient enough to
address such incidents, then state so and
clarify what would be your course of action as a human service
professional to ensure that people-
in-power do what is needed.
HMSV 346 Diversity Issues in Human Services / Spring 2021
2/2
• Ideally, your response to this question (5) is based on what
you believe to be the reason for such
incidents (so keep in mind your choice for question 2), but this
is not a requirement. So if you do
not want to be restricted by your choice for question 2, then that
is acceptable.
• Clearly specify what needs to change or what the change
would look like.
5. Part III
6. Identify a person (example: member of congress, U.S.
senator, governor, state legislator, police chief,
CSB manager, county supervisor, human services director, etc.)
who has the power to make the
changes you seek.
• The person(s) you identify does not have to be specific to
Hampton Roads, Minneapolis, or where
you live. You can choose any person anywhere in the country.
• Permission from the course instructor is required before
selecting a person/persons for
advocacy.
• Send an “advocacy email” to this identified person.
o In this email, briefly state the importance of the issue (why
things need to change) and how the
change would look like.
o Use the NAMI toolkit to develop your email, which should be
to the point.
o It is highly recommended that you cite credible journal
articles, books, reports, organizations,
etc., in support of your position.
o Submission of Part III in Blackboard requires posting a copy
of your advocacy email and a
snapshot of a confirmation of receipt of your advocacy email.
Not all recipients will provide
confirmation of receipt, so a snapshot of your advocacy email
6. (taken before you send it!) will
suffice in lieu of a confirmation of receipt.
o Sample advocacy emails are available in the “Advocacy
Project” folder under “Assignments &
Submissions” on Blackboard.
Part IV
7. Reflection:
a. Was your advocacy effort effective? In other words, did it
bring about the change you were
seeking? (Do not exaggerate! You will lose points if you do).
Share the reasons for your answer.
b. What did you learn about the importance of advocacy? Do
you see it as an effective tool?
c. What would you do differently in the future to be a more
effective advocate?
8. Submit your reflection (answers to question 7 above) on
Blackboard along with parts II and III (not
part I).
9. Respond meaningfully to the postings of three of your
classmates. State what you liked about their
advocacy effort and why, and state what would you do
differently and why. [Important: Please do not
scold or humiliate anyone for their opinion about this issue or
what they want to change. Very politely
state your disagreement, if any, by simply saying what you
would do differently and why].
7. Note
• This assignment is worth 50 points. Parts I & II are worth 10
points each. Parts III & IV are worth 15
points each.
• Your answers to all of the above questions (excluding
responses to classmates in discussion board)
must be at least 2 pages or 1000 words long, but should not
exceed 5 pages or 2500 words.
• Use only single-spaced lines.
• APA style is not required, but all parts and your advocacy
email must be professionally written and
formatted (ex: Aligned left, free from grammatical,
compositional, and spelling errors, etc.)
• Citations will add value to your submissions especially to your
advocacy email. If citations are used,
then references are required.
ARTICLE
Exercise enhances motor skill learning by
neurotransmitter switching in the adult midbrain
Hui-quan Li 1,2✉ & Nicholas C. Spitzer 1,2✉
Physical exercise promotes motor skill learning in normal
individuals and those with neu-
rological disorders but its mechanism of action is unclear. We
find that one week of voluntary
8. wheel running enhances the acquisition of motor skills in
normal adult mice. One week of
running also induces switching from ACh to GABA expression
in neurons in the caudal
pedunculopontine nucleus (cPPN). Consistent with regulation of
motor skills, we show that
the switching neurons make projections to the substantia nigra
(SN), ventral tegmental area
(VTA) and ventrolateral-ventromedial nuclei of the thalamus
(VL-VM). Use of viral vectors
to override transmitter switching blocks the beneficial effect of
running on motor skill
learning. We suggest that neurotransmitter switching provides
the basis by which sustained
running benefits motor skill learning, presenting a target for
clinical treatment of movement
disorders.
https://doi.org/10.1038/s41467-020-16053-7 OPEN
1 Neurobiology Section, Division of Biological Sciences and
Center for Neural Circuits and Behavior, La Jolla, CA 92093-
0357, USA. 2 Kavli Institute for Brain
and Mind, University of California San Diego, La Jolla, CA
92093-0357, USA. ✉email: [email protected]; [email protected]
NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
10. M
otor skill learning is fundamental to everyday life and is
regulated by a neural network involving the cortex,
thalamus, basal ganglia, brain stem, cerebellum, and
spinal cord1,2. Both neuronal and glial plasticity are essential
for
motor skill learning and disruption of this plasticity causes
motor
deficits3,4. Aerobic physical exercise promotes the abil ity to
acquire new motor skills5 and serves as a therapy for many
motor
disorders6–8, but its basis of action is not well understood.
Run-
ning is a natural motor activity for mice9 and generates
plasticity
in multiple brain regions4,10,11. Neurotransmitter switching is
a
newly appreciated form of plasticity that refers to the ability of
neurons to change their transmitter identity in response to sus-
tained stimuli, typically leading to changes in behavior12. We
hypothesized that chronic running induces neurotransmitter
switching in a circuit that is important for motor skill learning.
We find that mice that have run on a wheel for a week have an
enhanced ability to acquire motor skill on the rotarod and
balance beam. This enhancement in learning is temporally cor-
related with an activity-dependent transmitter switch of
midbrain
cholinergic neurons that now express GABA. The change in
transmitters corresponds to changes in the levels of transcripts
of
their transmitter synthetic enzymes. The switching neurons
11. project to nuclei that regulate motor skill learning, including the
SN, VTA, and VL-VM. Overriding the switch using viral tools
to
restore the loss of the synthetic enzyme for ACh or prevent the
gain of the synthetic enzyme for GABA blocks enhancement of
the ability to acquire motor skills.
Results
Sustained running enhances motor skill learning. We investi -
gated the impact of chronic voluntary running on motor skill
learning by exposing adult mice to running wheels for one week
(Fig. 1a). Each mouse spent consistent time on the wheel every
Ctrl
0
10
20
30
40
50
1 2 3 1 2 3
Ctrl
Run
Test
Run 1-wk Rest 1-wk
Retest
23. 1 2 3 4 5 6 7 8 9 1 2 3
Ctrl
Run
Rest 1-wkRun 1-wk
Training Training
Enhanced motor
skill learning
Enhanced
performance
continues
Rest 2-wk
No enhancement
or
Fig. 1 Sustained running enhances motor skill learning. a Top:
Runner mice were housed with running wheels and control mice
with wheelbases. Bottom:
timeline for running and behavioral tests. b Mean speed (left, n
= 6 animals per group) and mean episode duration (right, n = 7
animals per group) of
running on day 1 (naive) or day 7 (1-week trained). c Speed at
fall on an accelerative rotarod of each trial during training or
each test the day after training.
d Mean speed at fall on this rotarod in three tests on the day
after training. e Time to cross a 1-m long, 4-mm diameter rod
balance beam during each trial
of training or each test the day after training. f Mean time to
24. cross this balance beam in three tests the day after training. For
c–f, n = 19 Ctrls and 20
Runners. g Timelines for immediate behavioral testing and
retesting. h, i Mice that had run for 1 week or non-runner
controls were tested with (h) rotarod
and (i) balance beam (4 mm rod). After rest for 1, 2 or 4 weeks,
mice were retested. For h, n = 12 animals per group for 0 and 1
week, 7 Ctrls and 6 Runners
for 2 weeks, and 7 per group for 4 weeks. For i, n = 12 animals
per group for 0 week, 10 for each group for 1 week, 7 per each
group for 2 and 4 weeks.
j Top: timelines for delayed behavioral testing. Bottom:
performances on rotarod (left) and balance beam (right, 4 mm
rod) after 1 week of running followed
by 1 week of rest compared to controls that never ran. n = 8
animals for Ctrl and 9 for Run+Rest. k Time dependence of
enhanced motor skill learning.
When motor skills are trained (green) immediately after 1 week
of running, runner mice show enhanced learning. Enhancement
of acquired motor skills is
sustained for at least two weeks. When motor skills are trained
(red) after 1 week of running followed by 1 week of rest, no
enhancement in learning is
observed. Statistical significance *p < 0.05, **p < 0.01, ***p <
0.001 was assessed by two-sided paired t-test (b) or two-sided
Welch’s t-test (other panels).
Data shown are mean ± SEM.
ARTICLE NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7
2 NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications
www.nature.com/naturecommunications
25. day, indicating continuous interest, and their running skill
improved as measured by increased running speed, increased
duration of running episodes and more stable movement on the
wheel (Fig. 1b and Supplementary Fig. 1a, b). At the end of the
running period we assessed performance on the accelerating
rotarod and narrow balance beam to evaluate motor skill acqui -
sition13–15. In comparison to mice without running wheels,
mice
that ran for one week demonstrated enhanced learning of motor
skills, mastering an accelerating rotarod more rapidly and
accommodating to balance beams more quickly (Fig. 1c–f and
Supplementary Fig. 1c, d).
We calculated the slopes of learning curves to assess the speed
of motor skill learning. Mean data points for each training trial
were plotted and fitted and the coefficient of determination (R2)
was used to justify the fit. The mean speed at fall from a rotarod
for the nine trials on the training day was fitted by a one-phase
association model (R2 > 0.96 for controls; R2 > 0.95 for
runners).
yðtÞ ¼ y0 þ ðA � y0Þ 1 � e�kt
� �
ð1Þ
y(t) is the speed at fall on trial number t, y0 is the speed at fall
for
the first trial (t = 0), A is the plateau and k is a rate
constant.The
slopes were calculated with
y0ðtÞ ¼ dy
dt
26. ¼ ke�ktðA � y0Þ ð2Þ
To calculate the initial slope, y′(0), we used
y0ð0Þ ¼ g k; Að Þ ¼ kðA � y0Þ ð3Þ
The standard errors were calculated with
∂g
∂k
¼ ðA � y0Þ ð4Þ
∂g
∂A
¼ k ð5Þ
δg ¼
ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
∂g
∂k
δk
� �2
þ ∂g
∂A
δA
� �2
s
¼
ffiffiffiffiffiffiffiffi ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
27. A � y0ð Þ2δk2 þ k2δA2
q
ð6Þ
The values of the slopes are presented as g ± δg (mean ± sem).
Initial slopes were 17 ± 4 rpm/trial for runners and 5 ± 2
rpm/trial
for controls, significantly steeper for the runners (p = 0.01,
Welch’s t-test) (Fig. 1c).
The mean time to cross a 4 mm rod beam for the three trials on
the training day was fitted by linear regression (R2 > 0.98 for
controls; R2 > 0.99 for runners)
yðtÞ ¼ y0 þ kt ð7Þ
y(t) is the time to cross the beam on trial number t, y0 is the
time
for the first trial (t = 0) and k is the slope
y0ðtÞ ¼ k ð8Þ
The values of the slopes are presented as k ± δk (mean ± sem).
The
slopes were −4.7 ± 0.5 s/trial for runners and −2.4 ± 0.3 s/trial
for
controls, again significantly steeper for runners (p < 0.001,
Welch’s
t-test) (Fig. 1e). Additionally, sustained running improved
rotorod
and balance beam test performance (Fig. 1d, f and
Supplementary
Fig. 1d) but did not affect basal locomotor activity as measured
by
infrared beam crossings in home cages (Supplementary Fig. 1e,
f).
The steeper slopes of the behavioral acquisition curves demon-
28. strate enhanced learning relative to the controls, in accordance
with previous studies16,17. If the change in behavior induced
by
wheel running were one of performance, these curves would be
parallel and the slopes would be equal.
To explore further the effect of running on enhancement of
motor skill learning, we removed running wheels from mouse
cages after the first motor skill tests and retested the mice after
different resting periods (Fig. 1g). Enhanced performance on
both
rotarod and balance beam was sustained up to 2 weeks but not
4 weeks (Fig. 1h,i). Moreover, when mice were not trained on
the
rotarod and balance beam until 1 week after running, their
motor
skill learning was not enhanced (Fig. 1j). This result suggests
that
running creates a sensitive period in the adult brain during
which
motor skill learning is improved and shows that the gain in
motor
skills persists longer than the duration of this period (Fig. 1k).
Running induces transmitter switching in the midbrain cPPN.
Because transmitter switching is activity-dependent18–20, we
first
searched for c-fos expression (Fig. 2a) to determine sites of
increased brain activity associated with running and to identify
neurons likely to switch their transmitter. Mice that ran for
1 week exhibited a six-fold increase in the number of c-fos+
neurons in the pedunculopontine nucleus (PPN) of the midbrain
compared to non-runner controls when examined immediately
after the end of the last running period (Fig. 2b, c). The dentate
gyrus also showed increased c-fos expression in runners, as
29. expected21. The PPN was an attractive candidate for running-
induced transmitter switching because it regulates gait and bal -
ance control in health22,23 and disease24. However, the rostral
and
caudal PPN (rPPN and cPPN) are distinct. Both contain gluta-
matergic, GABAergic and cholinergic neurons, but there are
important differences in the proportions of their transmitter
phenotypes25, their projection targets and activity during
movement23,26, and their roles in behavior27,28. Accordingly
we
looked for differences in the activation of the rPPN and cPPN.
Specifically, we asked whether running activates cholinergic
neurons (marked by choline acetyltransferase, ChAT, which
synthesizes ACh) differently in the rPPN and cPPN, because
these neurons are involved in the gait and postural disorders of
Parkinson’s disease29. One week of running increased the
number
of c-fos+ neurons in both rPPN and cPPN (Supplementary
Fig. 2a, b). However, running increased the percentage of c-
fos+
neurons in the ChAT+ neuron population by 22-fold (from 21 of
984 to 315 of 670) in the cPPN but increased the percentage by
only two-fold (from 62 of 347 to 127 of 321) in the rPPN (Fig.
2d,
e, the left panel of 2f, and Supplementary Fig. 2c). Moreover,
the
percentage of ChAT+ neurons in the c-fos+ neuron population
was not different between controls and runners in the rPPN (62
of 309 vs. 127 of 644) but increased six-fold from controls to
runners in the cPPN (from 21 of 261 to 315 of 673) (Fig. 2f,
right). Significantly, running increased the number of cfos+
non-
cholinergic (ChAT-) neurons in the cPPN by only 1.5-fold (from
240 to 358), much less than the 15-fold (21–315) increase in the
number of c-fos+ ChAT+ neurons (Supplementary Fig. 2c).
30. These results show that cPPN cholinergic neurons are more
strongly activated by sustained running than rPPN cholinergic
neurons or cPPN non-cholinergic neurons, identifying cPPN
cholinergic neurons as candidates for transmitter switching. The
increase in the proportion of c-fos+ neurons in the ChAT+
cPPN neurons occurred after as early as 3 days of running
(Supplementary Fig. 2d, e).
Indeed, chronic running for one week was accompanied by a
decrease in the number of cPPN neurons expressing both ChAT
(605 ± 19; Fig. 2g, h) and the vesicular acetylcholine
transporter
(VAChT; 459 ± 51; Supplementary Fig. 2i). This change was
accompanied by an equal increase in the number of cPPN
neurons expressing the gene encoding glutamic acid decarbox-
ylase (GAD1; 551 ± 95), the enzyme that generates GABA
(Fig. 2i, j). No neurogenesis or apoptosis was observed in
the cPPN of either control or runner mice (Supplementary
Fig. 3a–f). These results suggest that ~600 cPPN neurons
switched their transmitter from ACh to GABA. There was no
NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7 ARTICLE
NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications 3
www.nature.com/naturecommunications
www.nature.com/naturecommunications
change in the number of ChAT+ neurons in the rPPN or the
adjacent lateral dorsotegmental nucleus and no difference in the
number of neurons expressing the vesicular glutamate transpor -
ter 2 (vGluT2) in the cPPN (Supplementary Fig. 3g–l).
31. To determine whether cholinergic cPPN activity plays a role in
the running-induced ACh-to-GABA switch, we expressed Kir2.1
inward-rectifier potassium channels specifically in cPPN choli -
nergic neurons to suppress their activity20 and examined the
impact on running-induced gain of GAD1 and loss of ChAT. We
used a well-characterized ChAT-Cre transgenic mouse line30,31
that exhibited the same running-dependent loss of ChAT and
gain of GAD1 expression as wild-type mice (Supplementary
Fig. 2f). We found that runner mice that had received AAV-
DIO-
Kir2.1 showed no difference in the number of ChAT+ or
GAD1+ neurons in the cPPN vs non-runner control mice and
were significantly different from the runner mice that received a
control AAV construct (Supplementary Fig. 2g, h). These
results
suggest that cholinergic cPPN activity is required for
transmitter
switching. Because one-third of cholinergic cPPN neurons lose
ChAT, the larger fold change in c-fos expression in the
cholinergic population of the cPPN compared to the rPPN
(Fig. 2d, e) is caused by both an increase of c-fos and decrease
of
ChAT expression. Considering that two-thirds of cholinergic
cPPN neurons do not switch their transmitter, the predominant
increase in c-fos expression in ChAT+ neurons (Supplementary
Fig. 2c) is consistent with cell-population-autonomous and non-
cell-autonomous activity-dependence of transmitter switching
previously reported19.
Mice that had run for 1 week, not subjected to motor skill
training, and allowed 1 week of rest now exhibited the same
number of ChAT+ and GAD1+ neurons as control mice that
had never run on a running wheel (Fig. 2k). No apoptosis or
32. neurogenesis was detected in the cPPN of these mice
(Supplementary Fig. 3c–f), indicating that the transmitter
switch had spontaneously reversed. The time during which
the transmitter switch reversed (Fig. 2k) corresponds to the
time during which the benefit of running on motor skill
acquisition disappeared (Fig. 1j, k), indicating a temporal
correlation between transmitter switching and the ability for
enhanced motor skill learning. This finding raised the
possibility that the transmitter switch is necessary for running
to enhance motor skill learning. Note that the transmitter
switch had reversed one week after running (Supplementary
Fig. 2j), even when training and testing on the rotorod and
balance beam occurred immediately after running, while the
acquired motor skills persisted for at least 2 weeks (Fig. 1g–i).
These results suggest that the transmitter switch is not
necessary for maintaining the acquired motor skills.
cPPNrPPN
*
cPPNrPPN
c-
fo
s+
/C
h
A
T
+
(
41. p = 0.41
*
p = 0.13
cPPN
RunCtrl
RunCtrl
Run + RestCtrl
p = 0.07
Fig. 2 Running activates the pedunculopontine nucleus (PPN)
and triggers neurotransmitter switching in the caudal PPN. a
Motor circuitry screened
for activity. b Double staining of neuronal marker NeuN and
activity marker c-fos in a control (upper) and 1-week runner
(lower). Middle and right panels
are higher magnifications of the boxes in the left panels. Scp,
superior cerebellar peduncle. Dorsal (D) and medial (M) axes
are shown at top. Scale bar,
(left) 200 μm, (middle) 50 μm. c c-fos immunoreactive neuron
number in each region or nucleus of controls and 1-week runner
mice. DG, dentate gyrus;
M1, primary motor cortex; M2, secondary motor cortex; STN,
subthalamic nucleus; GPe, globus pallidus external; STR,
striatum; SNc, substantia nigra pars
compacta; SNr, substantia nigra pars reticulata; PPN,
pedunculopontine nucleus; LDT, laterodorsal tegmental nucleus.
For b, c, n = 12 sections from 4
animals per group. d, e Double staining of ChAT and c-fos in
the rostral (d) or caudal (e) PPN of a 1-week runner. White
arrowheads identify examples of c-
42. fos+ChAT+ cells. Scale bar, 100 μm. f Percentage of the c-
fos+ChAT+ neurons in the total ChAT+ neurons (left) or in the
total c-fos+ neurons (right).
For d–f, n = 3 animals per group. g 3,3′-diaminobenzidine
(DAB) staining of ChAT in the cPPNs of a control and 1-week
runner. Dotted lines outline the
PPN. Dark brown stain identifies ChAT+ neurons. Scale bar,
100 μm. h Stereological counts of g. n = 6 animals per group. i
In situ hybridization of GAD1 in
the cPPN of a control and 1-week runner. Scale bar, 100 μm. j
Stereological counts of i. n = 7 animals per group. k
Stereological counts of ChAT+ or GAD1+
neurons in the cPPN of mice that experienced 1 week of running
followed by 1 week of rest and of control mice that never ran on
a running wheel. n = 5
animals per group. Statistical significance *p < 0.05, **p < 0.01
was assessed by two-sided Welch’s t-test (c, f) or Mann–
Whitney U test (other panels).
Data shown are mean ± SEM.
ARTICLE NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7
4 NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications
www.nature.com/naturecommunications
The number of neurons expressing ChAT was inversely
correlated with the number of neurons expressing GAD1 and
directly correlated with the enhanced learning of motor skills
(Supplementary Fig. 4a–e), suggesting that the level of
transmitter
switch determines the enhancement level of motor skill
43. learning.
The amount of running was not correlated with the motor skill
acquisition (Supplementary Fig. 4f–i), perhaps because the
variation in running duration is small (coefficient of variation,
0.17). Running is a categorical rather than a continuous variable
and enables individual variability in transmitter switching and
motor skill learning.
To seek more direct evidence for neurotransmitter switching,
we selectively tagged cholinergic neurons with genetic markers
to
reveal their change in transmitter identity following the exercise
challenge. We injected a Cre-dependent AAV vector (AAV-
DIO-
mRuby2) into the cPPN of ChAT-Cre mice to permanently label
cholinergic neurons with mRuby2, including those that subse-
quently lose ChAT after running (Fig. 3a, b). We then scored
the
number of mRuby2+ neurons that express ChAT and/or GABA
immunofluorescence. The anti-GABA antibodies were validated
in the superior colliculus where immunostaining of GAD67
identifies cell bodies (Supplementary Fig. 5). The colocalization
between GABA and GAD67 demonstrates the specificity of the
anti-GABA antibodies to detect GABAergic neurons. Co-
labeling
of mRuby2, ChAT and GABA revealed that in control mice,
65%
(548/844) of cPPN cholinergic neurons tagged by mRuby2
expressed only ChAT, while 29% (245/844) of them co-
expressed
ChAT and GABA, 4% (34/844) expressed neither and 2% (17/
844) expressed only GABA (Fig. 3c). In runners, 24% (177/738)
of mRuby2+ neurons expressed only ChAT, 31% (229/738) co-
expressed ChAT and GABA, 12% (89/738) expressed neither
and
33% (243/738) expressed only GABA (Fig. 3c). The decrease in
44. neurons expressing only ChAT and increase in neurons
expressing only GABA in the ChAT-Cre line identify the
expression of GABA in formerly cholinergic neurons. The
increase in the number of neurons that express neither ChAT
nor GABA suggests that switching neurons lose ChAT before
gaining GABA. The apparent constancy of the percent of co-
expressing neurons may indicate that switching and co-
expressing populations are distinct.
Transcript levels of transmitter synthetic enzymes change. To
understand whether the loss of ChAT and gain of GAD1 occur
in
the same population of neurons at the transcript level, we used
sensitive fluorescence in situ hybridization to analyze the levels
of
mRNA of transmitter synthetic enzymes in cPPN neurons from
runners and controls. We used the expression of neuronal nitric
oxide synthase (nNOS) as a biomarker restricted to ChAT+
neurons in the PPN32 (Fig. 4a, b). Although the number of
ChAT+ neurons decreased with one week of running (Fig. 2g,
h),
the number of nNOS+ neurons did not change (Fig. 4c). We
then
combined immunofluorescent labeling of nNOS with RNAscope
to detect mRNA encoding ChAT and GAD67 in nNOS+ neu-
rons. By measuring the number of transcript puncta (Fig. 4d–g)
and the total fluorescent area and fluorescence intensity per cell
(Supplementary Fig. 6), we demonstrated a decrease in the
number of ChAT transcripts and an increase in the number of
GAD1 transcripts in neurons expressing nNOS in runners.
While
RNAscope revealed the presence of ChAT transcripts in all
nNOS
neurons in controls (Fig. 4e), immunostaining identified 11% of
nNOS neurons that did not show detectable ChAT immunor-
eactivity (Fig. 4b). These results imply that in nNOS neurons of
45. controls, the bottom 11% of the distribution of ChAT mRNA
puncta (Fig. 4e; expressing <8 puncta) lack detectable ChAT
immunostaining. We next grouped neurons into the four cate-
gories (as in Fig. 3) on the basis of ChAT and GAD1 mRNA
expression (see Methods). In control mice, 45% of the cPPN
nNOS+ cells were classic cholinergic neurons, while 44% of
them
co-expressed ChAT and GAD1, 6% expressed neither and 5%
expressed GAD1 (Fig. 4e). However, in runners, the percentages
changed to 18% for classic cholinergic neurons, 43% for co-
expressing cells, 12% for neither and 27% that expressed GAD1
(Fig. 4e). These changes in the four categories are comparable
to
those identified by immunocytochemistry (Fig. 3c), further sup-
porting a running-induced switch from ChAT to GAD1 in nNOS
neurons. More modest co-expression of ChAT and GAD tran-
scripts has been observed in the adult rodent PPN33–35; the dif-
ference is likely to result from different ways to detect and
score a
positive neuron using thresholding probes (see Methods). The
RNAscope assay reveals that switching involves up and down
regulation of transcript levels and may not entail complete
GABA mRuby2ChAT MERGE
Run
Ctrl
CtrlCtrl
*
Classic Neither Switched
**
47. Ctrl Run Ctrl Run Run Run
**
Co-expressing
a b
c
AAV-hSyn-DIO-mRuby2
4-wk virus expression
ChAT-IRES-Cre
1-wk run
Start
running
GABA-IHC
ChAT-IHC
GABA mRuby2ChAT
p = 0.99
MERGE
Fig. 3 A subset of cholinergic cPPN neurons lose ChAT and
gain GABA. a Experimental strategy to permanently label
cholinergic cPPN neurons with
mRuby2 fluorescent protein by expressing Cre-dependent AAV-
DIO-mRuby2 in ChAT-Cre mice and determine whether the loss
of ChAT and gain of
48. GABA occur in mRuby2+ neurons. The coronal brain section
was drawn according to the Franklin & Paxinos brain atlas57. b
Double immunostaining of
GABA and ChAT in the cPPN of a control and a 1-week runner
ChAT-Cre mouse expressing AAV-DIO-mRuby2 in the cPPN.
Purple arrows, mRuby2
neurons that express ChAT but not GABA (classic ChAT
neurons). Gray arrows, mRuby2 neurons that express both
ChAT and GABA (co-expressing
neurons). Yellow arrows, mRuby2 neurons that express GABA
but not ChAT (switched neurons). Cyan arrow, a mRuby2
neuron that expresses neither
GABA nor ChAT. Scale bar, 50 μm. c The percentage of each
class of mRuby2+ neurons (n = 844 for controls and 738 cells
for runners). For b, c, n = 3
animals per group. Statistical significance *p < 0.05, **p < 0.01
was assessed by Mann–Whitney U test. Data shown are mean ±
SEM.
NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7 ARTICLE
NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications 5
www.nature.com/naturecommunications
www.nature.com/naturecommunications
disappearance and de novo appearance of transcripts of trans-
mitter synthetic enzymes.
Switching neurons project to the SN, VTA, and thalamus. To
further test the link between neurotransmitter switching and
motor skill learning, we identified targets innervated by the
49. switching cholinergic neurons. PPN neurons project to the sub-
stantia nigra (SN), the ventral tegmental area (VTA) and the
ventrolateral-ventromedial nuclei of the thalamus (VL-VM), all
of
which regulate motor skill learning36–41. Anterograde tracing
of
mRuby2 in ChAT-Cre neurons (see Methods) followed by ret-
rograde tracing with retrobeads demonstrated synaptic connec-
tions between cholinergic cPPN neurons and neurons in the SN,
VTA and VL-VM (Fig. 5a–c and Supplementary Fig. 7a–c).
cPPN
neurons originating projections to all three targets had lower
mean numbers of ChAT transcript puncta in runners compared
to controls, as demonstrated by triple labeling of retrograde
beads, ChAT transcripts and nNOS protein (Fig. 5d–f and Sup-
plementary Fig. 7d, e). As noted above, nNOS neurons
expressing
<8 puncta appear to be those lacking ChAT immunoreactivity.
In
controls, the percentages of neurons that express less than 8
ChAT transcript puncta and project to the SN, VTA, and VL-
VM
were 11%, 8 and 6%, and increased to 42%, 11 and 19% in
runners. Neurons in the increased percentages of cells
expressing
low numbers of ChAT-transcript puncta are likely to include
those that switch transmitters. The greater increase in number of
the low-transcript neurons projecting to the SN (37 for Run vs.
9
for Ctrl) suggests that cPPN neurons switching transmitters
make
a major projection to the SN with smaller projections to the
VTA
(10 for Run vs. 7 for Ctrl) and VL-VM (15 for Run vs. 5 for
Ctrl)
(Fig. 5f).
50. To determine whether running up-regulates the level of
vesicular GABA transporter at the cholinergic cPPN terminals
in the SN, we injected an AAV vector expressing Cre-dependent
synaptophysin fused with EGFP (AAV8-phSyn1(S)-FLEX-tdTo-
mato-T2A-SypEGFP-WPRE) into the cPPN of ChAT-Cre mice
to label the cholinergic cPPN terminals. Immunostaining of the
cPPN with anti-tdTomato and anti-ChAT antibodies demon-
strated expression of the construct in the cholinergic cPPN
neurons (Supplementary Fig. 7f). Immunostaining the SN with
anti-VGAT or anti-VAChT antibodies identified an increase in
the number of EGFP+ putative terminals labeled with VGAT
and
a decrease in those labeled with VAChT in runners compared to
control mice (Fig. 5g–j). These results suggest that the ACh-to-
GABA switch observed in cPPN neuronal cell bodies extends to
their presynaptic terminals.
Enhanced motor skill learning requires transmitter switch. To
determine whether neurotransmitter switching is necessary for
the beneficial effect of running on motor skill learning, we
injected AAV-DIO-ChAT into the cPPN of ChAT-Cre mice to
continuously express ChAT in all cholinergic neurons (Fig. 6a,
b
and Supplementary Fig. 8a–d). The ChAT-Cre line30,31 demon-
strated the same running-dependent transmitter switch as wild-
type mice, even with expression of control constructs (AAV-
DIO-
mRuby2, Fig. 6c; AAV-DIO-shScr, Fig. 7b). Overexpression of
ChAT did not change the number of ChAT+ neurons in the
cPPN of control ChAT-Cre mice and maintained the number of
ChAT+ neurons at control levels after sustained running
(Fig. 6c). Although the overexpression of ChAT caused a 3-fold
increase in the level of ChAT expression in control mice (Fig.
6d
51. and Supplementary Fig. 8c), it did not affect their basal motor
skill learning (Fig. 6f, g and Supplementary Fig. 9e, f) or
running
activity in runner mice (Fig. 6e and Supplementary Fig. 9a, b).
This may result from feedback inhibition of ChAT by ACh42,43
that is likely to maintain ACh levels of the non-switching
neurons
Ctrl Run
e
Ctrl Run
g
10
15
20
0
5
P
u
n
ct
a
n
u
56. ro
n
0
20
40
60
ChAT
Ctrl Run
***
80
MERGE
MERGE
MERGE
MERGE-ZOOM
MERGE-ZOOM
Fig. 4 A subset of cPPN nNOS neurons of runner mice lose
ChAT transcripts and gain GAD1 transcripts. a Double staining
of the cPPN in a non-runner
control mouse for nNOS (green) and ChAT (red). Scale bar, 100
μm. b Co-localization of nNOS and ChAT in the cPPN. For a, b,
n = 1068 cells from three
non-runner control mice. c Stereological counts of DAB
57. staining of nNOS in control and 1-week runner cPPNs. n = 6
animals per group. Mann–Whitney U
test. NS, not significant. d Triple staining of ChAT and GAD1
transcripts and nNOS protein in the cPPN of a control and a 1-
week runner mouse. Right
panels are boxed regions in merged images at higher
magnification. Scale bar, 20 μm. e Scatterplot of numbers of in
situ stained ChAT puncta (y-axis)
against numbers of in situ stained GAD1 puncta (x-axis). Each
dot represents one neuron. The vertical line divides neurons that
contain zero from those
containing more GAD1 transcript puncta and the horizontal line
divides neurons that contain less from those containing more
than eight ChAT transcript
puncta. f, g Y-axes are the mean number of ChAT (f) and GAD1
(g) fluorescent puncta in single nNOS+ neurons. For d–g, n = 4
animals per group; n = 123
cells for Ctrl and 137 cells for Run. Statistical significance *p <
0.05, ***p < 0.001 was assessed by two-sided Welch’s t-test.
Data shown are mean ± SEM.
ARTICLE NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7
6 NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications
www.nature.com/naturecommunications
in the physiological range. Mice that had received AAV-DIO-
ChAT acquired the same running skill as wild-type mice or
ChAT-Cre mice injected with AAV-DIO-mRuby2 but their
motor learning on the rotarod and balance beam, tested directly
after 1 week of running, was not enhanced (Fig. 6f, g). The
58. slopes
of the learning curves for both rotarod and balance beam beha-
viors were significantly steeper for runner mice expressing
AAV-
DIO-mRuby2 (10 ± 2 rpm/trial and −3.9 ± 1.0 s/trial) than for
runners expressing the AAV-DIO-ChAT (6 ± 1 rpm/trial, −1.3 ±
0.4 s/trial; p = 0.037 and p = 0.035) and test performances of
runners expressing AAV-DIO-mRuby2 were significantly better
(Supplementary Fig. 9e, f). Overriding the loss of ChAT also
prevented enhancement of motor skill learning when mice ran,
were trained and tested, rested for one week and then re-tested
(Fig. 6f, g). This finding makes it unlikely that exogenous
expression of ChAT had simply delayed the improvement in
motor skill learning.
Expression of shRNA for GAD1 (AAV-DIO-shGAD1) to
suppress the gain of GAD67 in cholinergic cPPN neurons
similarly prevented improved motor learning following one
week
of running, compared to mice expressing a Cre-dependent
scrambled shRNA sequence (AAV-DIO-shScr; Fig. 7a–f,
Supple-
mentary Figs. 8 and 9). Knockdown of GAD1 maintained the
number of GAD1+ neurons at control levels in the cPPN after
sustained running (Fig. 7b). Because immunostaining of GAD67
in the PPN detects a large number of synaptic puncta that makes
Ctrl Run
0.50
0.75
1.00
66. ci
e
n
t
M
1
j
50
0.25
Fig. 5 Running reduces the number of ChAT transcripts in a
subset of cholinergic cPPN neurons that project to the VTA, SN
and VL-VM. a
Experimental design to validate cholinergic innervation of
target nuclei by the cPPN. Red or green retrobeads (beads) were
injected bilaterally into target
nuclei with one color per side. Substantia nigra (SN) provides
an example. b Triple labeling of retrobeads and ChAT in a
coronal section of cPPN in a mouse
injected with retrobeads. Scale bar, 50 μm. c Summary of the
percentage of cholinergic neurons (ChAT+) that project to
corresponding nuclei. Ipsi,
ipsilaterally. Contra, contralaterally. Both, both ipsi - and
contralaterally. Neither, no retrobeads. n = 3 animals examined
per region. n = 829 cells for the
VTA, 806 cells for the SN, and 812 for the VL-VM. d
Experimental design to identify the target(s) of neurons with
decreased numbers of ChAT transcripts.
SN is shown as an example. e Triple-labeling of retrobeads,
ChAT mRNA transcripts, and nNOS proteins in both control and
runner cPPNs. Scale bar,
20 μm. f Y-axis is the mean number of ChAT fluorescent puncta
67. in single nNOS+ cells. Each dot represents one neuron. n = 4
animals per group. n = 89
cells for VTA-Ctrl, 91 for VTA-Run, 81 for SN-Ctrl, 87 for SN-
Run, 82 for VL-VM- Ctrl, 80 for VL-VM-Run. g Experimental
design to identify presynaptic
changes in transporter expression of cholinergic cPPN axons in
the SN. AAV8-phSyn1-FLEX-tdTomato-T2A-Syptophysin-
EGFP-WPRE (AAV-FLEX-
SypEGFP-T2A-TdTomato) was injected into the cPPN of ChAT-
Cre mice. Coronal sections containing the SN were
immunostained for EGFP and VAChT or
EGFP and VGAT. h Double immunostaining of VAChT and
EGFP or VGAT and EGFP in the SN of non-runner controls or
1-week runners injected with AAV-
FLEX-SypEGFP-T2A-TdTomato. Scale bar, 10 μm. i Percentage
of VAChT+ or VGAT+ terminals in putatively cholinergic
terminals in the SN. j The
coefficient M1 of antibody colocalization with putative
cholinergic presynaptic terminals. n = 10139 EGFP+ terminals
for VAChT-Ctrl, 9629 for VAChT-
Run, 10174 for VGAT-Ctrl and 10611 for VGAT-Run. For each
group, data were quantified from 12 z-stack images from three
animals. Statistical significance
*p < 0.05, **p < 0.01, ***p < 0.001 was assessed by two-sided
Welch’s t-test. Data shown are mean ± SEM.
NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7 ARTICLE
NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications 7
www.nature.com/naturecommunications
www.nature.com/naturecommunications
68. it challenging to analyze cell bodies, the knockdown efficiency
of
GAD67 expression by shGAD1 was tested in the motor cortex
and measured to be 65% (Supplementary Fig. 8e, f). Moreover,
shGAD1 blocked the increase in the expression of GABA in
cholinergic cPPN neurons of runner mice (Fig. 7c), indicating
that GAD1 has the dominant role in regulating the level of
GABA
in these neurons and that shGAD1 effectively prevents the gain
in
GABA caused by running. Suppressing the gain of GAD1 did
not
affect acquisition of the wheel running skill (Fig. 7d and
Supplementary Fig. 9c, d) but motor learning on the rotarod
and balance beam, tested directly after one week of running,
was
not enhanced for a period that was extended to one week of rest
(Fig. 7e,f). The slopes of the learning curves were again steeper
for
runner mice expressing AAV-DIO-shScr (9 ± 1 rpm/trial, −6.7 ±
0.9 s/trial) than for runners expressing AAV-DIO-shGAD1 (5 ±
2 rpm/trial, −3.7 ± 1.0 s/trial; p = 0.073 and p = 0.041) and test
performances for runners expressing AAV-DIO-shScr were
again
significantly better (Supplementary Fig. 9g, h). These results
suggest that both the loss of ACh and gain of GABA are
required
for enhancement of motor skill learning. Overriding the loss of
ChAT or suppressing the gain of GAD1 did not affect running-
induced c-fos expression in cholinergic cPPN neurons (Supple-
mentary Fig. 10). We tested for population-level control of the
change in expression of one transmitter by overriding the
change
in expression of the other. Notably, suppressing the gain in
69. GAD1
expression did not affect the loss of ChAT expression and vice
versa (Fig. 7g). Although expression of these two transmitter
synthetic enzymes is inversely correlated, the two are not
reciprocally regulated.
Discussion
Our findings provide insight into the mechanism by which sus-
tained running improves acquisition of motor skills (Fig. 8).
The functional significance of ACh-to-GABA transmitter
switching is demonstrated by changes in behavior that are
reversed by overriding the switch. Switching involves changes
in
levels of transcripts of transmitter synthetic enzymes. Activity-
dependent transcription factor phosphorylation18,19 and micro-
RNA regulation44, which have been implicated in transmitter
switching in the developing nervous system, are candidates for
implementing the switch in the adult CNS. Transmitter
switching
in the cPPN, particularly when it may change the sign of the
synapse from excitatory to inhibitory, appears to rewire motor
circuitry to enhance motor skills. Acquisition of motor skills
requires many components including balance, coordination,
Balance beam
T
im
e
t
o
c
ro
ss
71. 40
e f g
cPPN neuron counts
a c
Wheel running
d
1-wk rest
Immediate test
4-wk virus expression
ChAT-IRES-Cre
1-wk run
Start running
AAV-hSyn-DIO-ChAT-flag-P2A-mRuby2
or AAV-hSyn-DIO-mRuby2
Retest
ChAT-Run
ChAT-Ctrl
mRuby2-Run
mRuby2-Ctrl
b
mRuby2
76. 10
20
50
40
** *** * *
* ** * **
p = 0.73 p = 0.95
p = 0.99 p = 0.99 p = 0.96 p = 0.93
p = 0.94 p = 0.97 p = 0.99 p = 0.99
p = 0.86
Fig. 6 Loss of ChAT in cholinergic cPPN neurons is necessary
for running-enhanced motor skill learning. a Experimental
design to override the loss of
ChAT in ChAT-Cre neurons and determine behavioral
relevance. The coronal brain section was drawn according to the
Franklin and Paxinos brain atlas57.
b Top: mRuby2 and nuclear marker DRAQ-5 show mRuby2
expression in a coronal cPPN section of an animal bilaterally
injected with AAV-DIO-ChAT-
P2A-mRuby2 constructs. Coordinates adapted to Allen Brain
Atlas. AQ, aqueduct. LDT, laterodorsal tegmental nucleus.
Scale bar, 500 μm. Bottom:
double-labeled image of nNOS and mRuby2 in boxed region of
the upper image. Scale bar, 200 μm. n = 34 animals. c ChAT+
neuron number in the cPPN
of runners and non-running controls that were injected with
AAV-DIO- mRuby2 or AAV-DIO-ChAT. n = 5 animals per
77. group. Nonparametric
Kruskal–Wallis test followed by Dunn’s correction. d ChAT
fluorescence intensity for mRuby2-expressing cells in ChAT-
Cre mice injected with AAV-DIO-
ChAT or AAV-DIO-mRuby2. Fluorescence intensity was
normalized by non-transfected cells (mRuby2 negative). n = 56
and 58 cells for mRuby2 and
ChAT. n = 3 animals per group. Welch’s t-test. e Wheel running
speed of mice that were injected with AAV-DIO-ChAT or AAV-
DIO-mRuby2 at the cPPN.
n = 10 animals per group. Linear regression followed by two-
sided Welch’s t-test. f, g Rotarod (f) and balance beam (g, 4 mm
rod) tests show that
expression of mRuby2 did not affect enhancement of acquisition
and maintenance of motor skills gained by running (mRuby2-
Run vs. mRuby2-Ctrl),
whereas exogenous ChAT expression blocked the enhancement
(ChAT-Run vs. mRuby2-Run). The blockade was sustained after
rest for 1 week. For
immediate rotarod test, numbers of animals are 9 for mRuby2-
Ctrl, 16 for ChAT-Ctrl, 9 for mRuby2-Run, 18 for ChAT-Run.
For rotarod retest, numbers of
animals are 9 for mRuby2-Ctrl, 6 for ChAT-Ctrl, 9 for mRuby2-
Run, 7 for ChAT-Run. For immediate test of balance beam,
numbers of animals are 10 for
mRuby2-Ctrl, 9 for ChAT-Ctrl, 10 for mRuby2-Run, 9 for
ChAT-Run. For balance beam retest, numbers of animals are 6
for mRuby2-Ctrl, ChAT-Ctrl,
mRuby2-Run and 7 for ChAT-Run. ANOVA followed by
Tukey’s test. *p < 0.05, **p < 0.01, ***p < 0.001. Data shown
are mean ± SEM.
ARTICLE NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7
8 NATURE COMMUNICATIONS | (2020) 11:2195 |
78. https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications
www.nature.com/naturecommunications
motivation, attention and muscle strength. Interestingly, the
PPN
regulates many of them23,45, and transmitter switching in the
cPPN may contribute to motor skill learning through regulating
one, several or even all of these aspects. The persistence of
learned
behaviors after the transmitter switch has reversed implies that
there is continued capacity for plasticity in locomotor circuitry.
We examined three targets of the cPPN and found that cho-
linergic cPPN neurons projecting to each of the three targets
showed a significant reduction of ChAT transcripts (Fig. 5).
This
suggests that the reduction of ChAT expression might be
observed in cholinergic cPPN neurons projecting to other
targets
as well. Multi-target regulation is not surprising because choli-
nergic PPN neurons have an average of five axonal collaterals
that
allow a single cholinergic neuron to project to many targets23.
Cholinergic cPPN neurons may regulate motor function and
other behaviors by gating the activity of downstream targets
through transmitter switching.
Dopaminergic and noradrenergic neurons are implicated in
fine motor function plasticity that regulates paw and digit
movements46–49. Our results unexpectedly indicate that
acquisi-
tion of high-demand rotarod and balance beam performance
requires transmitter switching in cholinergic cPPN neurons.
79. Overriding transmitter switching did not affect the ability to run
on a running wheel (Figs. 6 and 7), perhaps because running is
not an exceptionally taxing motor skill. Consistent with these
results, selective lesions of cholinergic PPN neurons impair
b Wheel runninga
1-wk rest
AAV-CAG-DIO-shGAD1 -EGFP
or AAV-CAG-DIO-shScr-EGFP
Immediate test
4-wk virus expression
ChAT-IRES-Cre
1-wk run
Start running Retest
d
e f g
3000
2000
0
N
e
u
86. shGAD1-Run
shGAD1-Ctrl
shScr-Run
shScr-Ctrl
30
*** ***
p = 0.20 p = 0.75
*** ***
p = 0.95 p = 0.93 p = 0.28
*** *
p = 0.12 p = 0.99
** *
p = 0.87 p = 0.97
* **
p = 0.98 p = 0.79
** *
p = 0.59 p = 0.96
Fig. 7 Gain of GAD1 in cholinergic cPPN neurons is also
necessary for running-enhanced motor skill learning. a
87. Experimental design to override the gain
of GAD1 in ChAT-Cre neurons and examine behavioral
relevance. The coronal brain section was drawn according to the
Franklin and Paxinos brain atlas57.
b Numbers of GAD1 in situ stained neurons in the cPPNs of
runners and non-running controls that were injected with AAV-
DIO-shScr (scramble shRNA)
or AAV-DIO-shGAD1 (shRNA for GAD1). n = 7 for shGAD1-
Run, and five animals for the other three groups. Nonparametric
Kruskal–Wallis test followed
by Dunn’s correction. c Percentage of neurons immunostained
as GABA+, EGFP+ and ChAT- in the total EGFP+ neurons in
cPPNs of ChAT-Cre runners
and non-running controls that were injected with AAV-DIO-
shScr or AAV-DIO-shGAD1. n = 1243 cells for shScr-Ctrl,
1258 for shScr-Run, 957 for shGAD1-
Ctrl, and 1226 for shGAD1-Run from three animals per group.
Nonparametric Kruskal–Wallis test followed by Dunn’s
correction. d Wheel running speed of
ChAT-Cre mice that express AAV-DIO-shScr or AAV-DIO-
shGAD1 in the cPPN. n = 8 animals per group. Two-sided
Welch’s t-test. e, f Rotarod (e) and
balance beam (f, 4-mm rod) tests show that expression of shScr
did not affect the enhancement of acquisition and maintenance
of motor skills gained by
running (shScr-Ctrl vs. shScr-Run) whereas knocking down
GAD1 blocked the enhancement (shGAD1-Run vs. shScr-Run).
Blockade was sustained after
rest for 1 week. For e, animal numbers are 9 for shScr-Ctrl, 7
for shGAD1-Ctrl, 9 for shScr-Run and 9 for shGAD1-Run for
immediate test and 8 for shScr-
Ctrl, 7 for shGAD1-Ctrl, 8 for shScr-Run and 9 for shGAD1-
Run for retest. For f, numbers of animals are 8 for shScr -Ctrl, 7
for shGAD1-Ctrl, 8 for shScr-Run,
and 9 for shGAD1-Run for both immediate test and retest. g
Numbers of GAD1 in situ stained neurons in the cPPN of 1-
88. week runners and non-runner
controls that express AAV-DIO-ChAT and numbers of ChAT
immunostained neurons in 1-week runners and non-runner
controls that express AAV-DIO-
shGAD1. n = 6 animals per group for ChAT-Run and ChAT-Ctrl
and 5 for shGAD1-Run and shGAD1-Ctrl. Mann–Whitney U
test. *p < 0.05, **p < 0.01,
***p < 0.001. Data shown are mean ± SEM.
RunnerNaive
cPPN
Targets
cPPN
Targets
Basic
motor skill
learning
Runner with transmitter switching overridden
or
a b
c
ChAT expression
cPPN
Targets
89. Enhanced
motor skill
learning
cPPN
Targets
Basic
motor skill
learning nNOS
ChAT
GAD1
ChAT and GAD1
GAD1 knockdown
Fig. 8 Transmitter switching in the cPPN regulates motor skill
learning. a,
b Chronic running induces neurotransmitter switching from ACh
to GABA
in the cPPN and enhances motor skill learning. c Both ChAT
loss and GAD1
gain are necessary for running-enhanced motor skill learning.
NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7 ARTICLE
NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications 9
90. www.nature.com/naturecommunications
www.nature.com/naturecommunications
learning of high-demand running on an accelerating-speed
rotarod but do not affect learning of low-demand running on a
fixed-speed rotarod or basal locomotion50. In contrast, glutama-
tergic and GABAergic PPN neurons regulate gait and speed of
locomotion51–53.
Control of voluntary movement and procedural learning are
core functions of the basal ganglia. SNr inhibitory neurons
serve
as the major output of the basal ganglia and project to the PPN;
in
turn, PPN ascending axons project to the SNc and SNr to
modulate the function of the basal ganglia23. We propose a
model
in which conversion of cPPN excitatory cholinergic input to
inhibitory GABAergic input of inhibitory neurons in the SN
enables feedback control of SN neurons regulating motor coor-
dination and skill learning, as supported by their decrease in c -
fos
expression (Fig. 2c). Gait speed, stride and balance of
Parkinson’s
disease and stroke patients are improved following sustained
treadmill training54–56. Our finding that transmitter switching
after running is a critical event for improving motor skill
learning
suggests that transmitter switching may be important in many
circumstances where sustained exercise benefits behavior.
Methods
Mice. All animal procedures were carried out in accordance
with NIH guidelines
and approved by the University of California, San Diego
91. Institutional Animal Care
and Use Committee or Scripps Institutional Animal Care and
Use Committee.
C57BL/6J (JAX#000664) mice were obtained from Jackson
Laboratories. ChAT-
IRES-Cre (JAX#006410) mice were obtained from the
Byungkook Lim lab and
Jackson Laboratories. PV-IRES-Cre (JAX#008069) mice were
provided by the
Stefan Leutgeb lab. Animals were maintained on a 12 h:12 h
light:dark cycle (light
on: 10:00 pm–10:00 am) with food and water ad libitum.
Vivarium temperature
was between 65 and 75 °F (~18 and 23 °C) with 40–60%
humidity. The ChAT-
IRES-Cre colony was maintained by breeding homozygous male
ChAT-Cre mice
with female wild-type C57BL/6J mice. Heterozygous ChAT-Cre
offspring were
used in the study. Both heterozygous and homozygous PV-
IRES-Cre mice were
used. All experiments were performed on 8- to 12-week-old
male mice.
Wheel running. Mice were single-housed in hamster cages and
provided with
FastTrac (Bio-serv, K3250) or digital (Med Associates ENV-
044) running wheels
that are identical in shape and size. Mice were allowed
voluntary running for one
week and were continuously recorded with Swann DVR4-2600
infrared video
cameras. Control mice were housed with running wheelbases
without wheels.
Episode duration and time with the wheel were hand-scored
using JWatcher
92. software. The maximum angular excursion of mouse movements
on the running
wheels was plotted using Image J and measured with a
protractor. The digital
running wheels recorded running distance and running speed
was calculated as
distance divided by time.
Rotarod. Training and tests were performed as the rotarod (Ugo
Basile, 57624)
accelerated from 5 rpm to 80 rpm in 6 min. The rpm at which
mice fell off was
recorded by the rotarod. Mice were trained for nine trials on the
first day, followed
by three tests the next day and three retests after 1, 2, or 4-
weeks rest. There was a
10-min interval between each trial/test. The single digit
accuracy of the slopes of
learning curves reflects the accuracy of recording the rpm at fall
by the rotarod.
Balance beam. Mice were trained and tested with balance beams
1 meter long and
0.75 meters above the floor. Twelve millimeters and 6 mm
square beams (S-12 and
S-6) were single plastic horizontal bars while 6 and 4 mm rod
beams (R-6 and R-4)
consisted of two stainless steel parallel bars 5 cm apart. On the
training day mice
were trained to cross S-12 for three trials, S-6 for three trials,
R-6 for three trials
and then R-4 for three trials, each 10 min apart. On the test and
retest day mice
were allowed to cross all four beams in the same order, three
times for each, 10 min
apart. A video camera was installed at the end of the beam
93. where mice started
walking. At the other end of the beam, a black box with an entry
facing the beam
was installed to attract mice to cross the beams. Time to cross
the beam and enter
the escape box was hand-scored and the investigator was
double-blinded to the
history of the mice. The slopes of learning curves are accurate
to one decimal place
because the time to cross the beam was hand scored and human
response time is
0.1~0.2 s.
Motor skill learning. The mean speed at fall from a rotarod for
the nine trials on
the training day was fitted by a one-phase association model.
Mean data points for
each training trial were plotted and fitted using GraphPad Prism
7 software and the
coefficient of determination (R2) was used to justify the fit (R2
> 0.96 for controls
and R2 > 0.95 for runners, with MATLAB). The mean time to
cross a 4 mm rod
beam for the three trials on the training day was fitted by linear
regression (R2 >
0.98 for controls and R2 > 0.99 for runners, with MATLAB).
Locomotor activity. Mice were tested for 120 min in
polycarbonate cages (42 ×
22 × 20 cm) placed in frames (25.5 × 47 cm) mounted with two
levels of photocell
beams at 2 and 7 cm above the bottom of the cage (San Diego
Instruments, San
Diego, CA). The two sets of beams detect both horizontal
(roaming) and vertical
94. (rearing) behavior. A thin layer of bedding material covered the
bottom of the cage.
Data were collected in 1-min epochs.
Histology and immunocytochemistry. Animals were perfused
transcardially with
phosphate-buffered saline (PBS) followed by 4%
paraformaldehyde (PFA) in PBS
right after the last episode of running, i.e., mice started to run
at 10 am at light-off
and kept running until they were perfused between 2 and 3 pm.
Brains were
dissected and post-fixed in 4% PFA for 16 to 24 h at 4 °C,
washed in PBS for 1 min
and transferred to 30% sucrose in PBS for 2 days at 4 °C. Forty-
micrometers
coronal sections were cut on a microtome (Leica SM2010R) and
stained.
For immunostaining, sections were permeabilized and blocked
in 24-well
culture plates for 2 h in a blocking solution (5% normal horse
serum, 0.3% Triton
X-100 in PBS) at 22–24 °C. Primary and secondary antibodies
were diluted in the
blocking solution. Incubation with primary antibodies was
performed for 48 h on a
rotator at 4 °C. After washing in PBS (three times, 15 min
each), secondary
antibodies were added for 2 h at 22–24 °C. For
immunofluorescence, sections were
mounted with Fluoromount-G (Southern Biotech) or ProLong
Gold Antifade
Mountant (Life Technologies) containing DRAQ-5 (Thermo
Fisher, 62251, 1:1000
dilution; when nuclear staining was needed) after washes in
95. PBS (three times,
15 min each).
For DAB (3,3′-Diaminobenzidine) staining, sections were
treated with 0.3%
hydrogen peroxide for 30 min, washed in PBS (three times, 5
min each), incubated
with Vectastain Elite ABC HRP mixture (Vector Laboratories,
PK-6100) for
45 min, washed in PBS (three times, 15 min each), and signals
were developed
using the DAB Peroxidase Substrate kit (Vector Laboratories,
SK-4100).
Primary antibodies used in this study were goat anti-ChAT
(Millipore, AB144P,
1:500), rabbit-anti-nNOS (Thermo Fisher, 61-7000, 1:500),
goat-anti-cFos (Santa
Cruz, sc-52G, 1:300), rabbit-anti-cFos (Santa Cruz, sc-52,
1:300), mouse-anti-cFos
(Abcam, ab208942, 1:500), rabbit-anti-PV (Swant, PV25,
1:2000), goat-anti-
VAChT (Millipore, ABN100, 1:500), goat-anti-VGAT (Synaptic
system, 131004,
1:1000), mouse-anti-NeuN (Millipore, MAB377, 1:500), rabbit-
anti-GABA (Sigma-
Aldrich, A2052, 1:1000) rabbit-anti-GFP (Thermo Fisher,
A11122, 1:1000), chicken
anti-GFP (Abcam, ab13970, 1:1000), guinea pig anti-GFP
(Synaptic Systems,
132005, 1:3000), rabbit-anti-zsGreen (Takara, 632474, 1:500),
goat-anti-
doublecortin (Santa Cruz, sc-8066, 1:300) and rabbit-anti-Ki67
(Cell Signaling,
9129, 1:300). Secondary antibodies for immunofluorescence
were from Jackson
96. ImmunoResearch Labs and used at a concentration of 1:600:
Alexa Fluor-488
donkey-anti-rabbit (705-545-003), Alexa Fluor-488 donkey-
anti-guinea pig (706-
545-148), Alexa Fluor-488 donkey-anti-mouse (715-545-150),
Alexa Fluor-488
donkey-anti-goat (705-545-147), Alexa Fluor-594 donkey-anti-
goat (705-585-147),
Alexa Fluor-594 donkey-anti-mouse (715-585-150), Alexa
Fluor-647 donkey-anti-
goat (705-605-147) and Alexa Fluor-647 donkey-anti-rabbit
(711-605-152).
Biotinylated goat anti-rabbit (BA-1000) and horse anti-goat
(BA-9500) secondary
antibodies for DAB staining were from Vector Laboratories and
used at a
concentration of 1:300.
In situ hybridization PFA fixed brains were dissected, post-
fixed in 4% PFA for
16 to 24 h at 4 °C and transferred to 30% DEPC-sucrose in PBS
for 2 days.
Subsequently, brains were embedded in 30% DEPC-sucrose and
frozen with dry
ice. Forty-micrometers cryosections were collected on
Superfrost Plus slides (VWR,
48311-703) and used for mRNA in situ hybridization.
Complementary DNAs
(cDNAs) of gad1 or slc17a6 (sequences from Allen Brain Atlas:
gad1,
RP_040324_01_F01; slc17a6, RP_050921_01_E03) were cloned
from mouse cDNA
library in ~800-base-pair segments into a pGEM vector and
sequenced to verify
that they were correct. Antisense complementary RNA (cRNA)
probes were
97. synthesized with T7 (Promega, P2075) or Sp6 polymerases
(Promega, P1085) and
labeled with digoxigenin (Roche, 11175025910). Hybridization
was performed with
1 to 5 μg/ml cRNA probes at 65 °C for 20 to 24 h. Probes were
detected using Anti-
Digoxigenin-AP Fab fragments (Roche, 11093274910, 1:5000).
Signals were
developed for 8 h using a mixture of 4-Nitro blue tetrazolium
chloride (Roche,
11383213001) and BCIP 4-toluidine salt solution (Roche,
11383221001). We
counted all GAD1+ neurons in the cPPN, including those that
looked intense,
moderate or faint.
Fluorescent RNAscope in situ hybridization was performed
according to the
manufacturer’s instructions (Advanced Cell Diagnostics) with
some modifications:
In an RNase-free environment, 12-μm fixed brain sections were
mounted on
Superfrost Plus slides immediately after microtome sectioning
and air-dried in a
60 °C oven for 30 min. Sections were rehydrated in PBS for 2
min and incubated for
5 min in 1× target retrieval solution at 95 °C. Sections were
then rinsed with
distilled water for 5 s and rinsed in 100% ethanol for 5 seconds.
After air-drying,
sections were incubated with the following solutions in a
HybEZ humidified oven
at 40 °C with three rinsing steps in between each: protease III,
30 min; probes, 2 h;
amplification (Amp) 1-fluorescence (FL), 30 min; Amp 2-FL,
15 min; Amp 3-FL,
98. 30 min; and Amp 4-FL, 15 min. Ready-to use Amp 1-FL, Amp
2-FL, Amp 3-FL,
ARTICLE NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7
10 NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications
www.nature.com/naturecommunications
Amp 4-FL and 50× washing solution for rinsing steps were
included in the
RNAscope Multiplex Fluorescent Reagent kit. Standard
immunofluorescent
staining was subsequently performed in the dark15. Probes for
mouse chat mRNA
(Catalog number: 408731-C2) and gad1 mRNA (Catalog
number: 400951) were
from Advanced Cell Diagnostics. Sections were 6–7 μm thick
post-processing. Six
optical sections (1 µm Z step) of each physical section were
examined and regions
of interest (ROIs) were drawn around the boundaries of nNOS
cells on the optical
section that showed the best focal plane for each cell (largest
cross-sectional area).
These ROIs were scored for ChAT and GAD1 transcript puncta
using Image J. The
average area of ROIs was consistent between the control and
runner groups. We
included negative controls using a probe targeting a bacterial-
origin gene dapB
(Catalog number: 310043; GeneBank: EF191515) in each batch
99. of experiments and
validated that the negative control group showed <1 punctum in
100 cells.
Based on the expression of ChAT and GAD1 transcript puncta,
the neurons
were grouped into four categories (1) classic cholinergic
neurons: ≥8 ChAT
transcript puncta, no GAD1 transcript puncta; (2) co-expressing
neurons: ≥8
ChAT puncta, ≥1 GAD1 puncta); (3) neurons expressing
neither: <8 ChAT puncta,
no GAD1 puncta; (4) switched neurons: <8 ChAT puncta, ≥1
GAD1 puncta. We
are aware that other studies have arrived at a lower percent of
costaining than
reported here. The difference is likely to be caused by different
ways to detect and
score a positive neuron. Detection by IHC and ISH can be
greatly affected and is
ultimately determined by the sensitivity and thresholding of the
method. From the
distribution of GAD1 puncta number (Fig. 4e) we infer that
scoring only neurons
that contain 5 or more GAD1 puncta, would yield an incidence
of 4% of ChAT
neurons that co-express GAD1, which would be consistent with
percentages
previously reported33–35. We have not found descriptions of
counting thresholds in
other reports and believe that in most cases investigators count
neurons that
contain moderate to intense GAD1 and have regarded those with
a low level of
transcripts as negative.
100. Birthdating. Mice were intraperitoneally injected with BrdU (50
mg/kg) once every
12 h for 1 week. PFA-fixed brains were dissected, post-fixed
and dehydrated as
described above. Forty-micrometers cryosections were collected
and treated with
1 M HCl for 30 min at 45 °C for DNA denaturation. After
rinsing in PBS (three
times, 5 min each), sections were incubated in a mixture of
0.3% Triton X-100 and
5% horse serum in PBS for 1 h, incubated in rat-anti BrdU
antibody (AbD Serotec,
MCA2060, 1:300) at 4 °C overnight, rinsed in PBS (three times,
5 min each) and
amplified by Alexa Fluor-488 donkey anti-rat antibody (Life
Technologies, A21208,
1:600). Sections were mounted with Fluoromount containing
DRAQ-5 (1:1000).
TUNEL assay. The In Situ Cell Death Detection (TUNEL) Kit
with TMR Red
(Roche, 12156792910) was used to detect in situ apoptosis.
Forty-micrometers
cryosections were re-fixed with 1% PFA for 20 min at 22–24 °C
and rinsed with
PBS (three times, 5 min each). Sections were then
permeabilized in 0.1% sodium
citrate and 1% Triton X-100 for 1 h at 22–24 °C. After rinsing
in PBS (three times,
5 min each), sections were incubated with TUNEL reaction
solution according to
the vendor’s instruction, i.e., incubated in a mixture of 25 μL of
terminal-
deoxynucleotidyl transferase solution and 225 μL of label
solution. Incubation was
performed in a humidified chamber for 3 h at 37 °C in the dark.
101. Sections were
rinsed and mounted with Fluoromount containing DRAQ-5
(1:1000). For a
positive control, sections were treated with DNase I (10 U/mL,
New England
Biolabs, M0303S) for 1 h at 37 °C and rinsed in PBS (three
times, 5 min each),
followed by incubation with the TUNEL mixture.
Imaging and data analysis. Fluorescent images were acquired
with a Leica SP5
confocal microscope with a 25×/0.95 water-immersion objective
and a z resolution
of 1 μm. Leica Application Suite X software was used for
fluorescent cell counting
and all sections within the confocal stacks were examined
without maximal pro-
jection. RNAscope in situ signals were quantified using Image
J. Exemplar images
are maximum intensity projections of 6 consecutive confocal
sections when
RNAscope signals are included (Figs. 4d and 5e) and 16–24
confocal sections for
other immunofluorescence images. For the synaptophysin-EGFP
signals, images
were acquired with a 63×/0.90 water-immersion objective at
zoom 2 magnification
with a z resolution of 1 μm. Colocalization was quantified using
Image J with the
JACoP plugin. Exemplar images for DAB staining and in situ
hybridization were
acquired with a NanoZoomer Slide scanner (Hamamatsu S360)
with a 20×/0.75 air
objective. Counting DAB-stained c-fos neurons per unit area
was performed with
Image J on images harvested from the NanoZoomer. To delimit
102. the PPN in sec-
tions stained for c-fos (Supplementary Fig. 2a, b), or for
TUNEL and Ki67/DCX
(apoptosis and neurogenesis, Supplementary Fig. 3a–f), an
adjacent section was
stained for ChAT to define the boundaries of the PPN.
Images were analyzed exhaustively or by sampling. Exhaustive
analysis entailed
scoring all neurons in every other section through the entire
brain region of interest
and reporting the number of cells for the number of mice
examined. Sampling
involved scoring and reporting a specific number of cells from a
specified number
of sections from a particular number of mice. In these cases,
exact cell and/or
section numbers are shown in the figure legends.
Stereological counting. Stereo Investigator software (MBF
Bioscience) was used to
exhaustively count DAB immunostained or in situ
hybridization-stained cells.
Counting was carried out using optical fractionator sampling on
a Zeiss Axioskop 2
microscope (40×/0.65 Ph2 objective) equipped with a motorized
stage. The
population of midbrain PPN neurons was outlined on the basis
of ChAT immu-
nolabeling, with reference to a coronal atlas of the mouse
brain57 and anatomical
landmarks such as fiber tracts. Caudal PPN refers to the caudal
half of PPN with
reference to a transverse line normal to and halfway along the
rostrocaudal axis;
rostral PPN refers to the rostral half. To count GABAergic and
103. glutamatergic
neurons in the sections stained by in situ hybridization, an
adjacent section was
stained for ChAT to define the ROI for the boundaries of PPN.
The area of the ROI
and the cell density were compared between the control and
experimental groups
to ensure that the counted areas were comparable between the
two groups and that
changes in cell density were consistent with changes in the
absolute counts. Pilot
experiments with continuous counting determined that counting
every other sec-
tion was sufficient to estimate the number of cholinergic,
GABAergic, glutama-
tergic and nitroxidergic neurons in the cPPN of each brain.
Consequently, five to
six sections were counted for each mouse brain. The average
section thickness was
measured prior to counting. Sections shrank from 40 μm to 22–
24 μm after
staining and dehydration. Exhaustive counting was performed
and no sampling
grid was skipped because the distribution of neurons in the
cPPN is uneven.
Counting was performed by two investigators double-blinded to
the origin of
the sections.
Viral constructs and injection. Seven to eight-week-old male
mice were anesthe-
tized with a mixture of 120 mg/kg ketamine and 16 mg/kg
xylazine and head-fixed on
a stereotaxic apparatus (David Kopf Instruments Model 1900)
for all stereotaxic
surgeries. The caudal PPN was targeted bilaterally (cPPN:
104. anterior–posterior (AP),
−4.80 mm from bregma; mediolateral (ML), ±1.25 mm; dorsal–
ventral (DV),
−3.25 mm from the dura). A total of 300 nL of the Cre-on viral
vectors were injected
into each cPPN of ChAT-Cre mice at a rate of 100 nL/min using
a syringe pump
(PHD Ultra™, Harvard apparatus, no. 70-3007) installed with a
microliter syringe
(Hampton, no.1482452A) and capillary glass pipettes with
filament (Warner
Instruments, no. G150TF-4). Pipettes were left in place for 5
min after injection. Titers
of recombinant AAV vectors ranged from 7.1 × 1012 to 2.2 ×
1013 viral particles/ml,
based on quantitative PCR analysis. AAV8-phSyn1(S)-FLEX-
tdTomato-T2A-
SypEGFP-WPRE was purchased from the Salk Viral Vector
Core and used to trace
the axonal terminals58. AAV-DJ-CMV-DIO-Kir2.1 and AAV-
DJ-CMV-DIO-EGFP
were both ordered from the Stanford Viral Vector Core and used
to suppress neu-
ronal activity or as a control20,59. pAAV-hSyn-DIO-ChAT-
P2A-mRuby2 and pAAV-
hSyn-DIO-mRuby2 plasmids were constructed in our lab and
AAV2/8 vectors were
packaged in the Salk Viral Vector Core. Vector Biolabs
produced AAV8-CAG-DIO-
shRNAmir-mGAD1-EGFP and AAV8-CAG-DIO-shRNAmir-
Scramble-EGFP vec-
tors. The shRNA sequence for mouse GAD1 is
5′-
GTCTACAGTCAACCAGGATCTGGTTTTGGCCACTGACTGA
CCAGATCC
105. TTTGACTGTAGA-3′.
Tract tracing. For anterograde tracing, 300 nL of Cre-on AAV8-
DIO-mRuby2
vectors were unilaterally injected into the cPPN of ChAT-Cre
mice as described
above and axonal tracts were imaged by Leica confocal
microscope. For retrograde
tracing, a volume of 100 nL of retrobeads (Red Retrobeads™ IX
or Green Retro-
beads™ IX, Lumafluor) was injected at 100 nL/min into the SN
or VTA and VL-
VM. Pipettes were left in place for 10 min after injection. Three
weeks after
injection, mice were sacrificed for brain examination or housed
with running
wheels to examine running-induced loss of ChAT transcripts
using RNAscope
combined with nNOS immunostaining. ChAT transcripts in
neurons that con-
tained retrobeads were quantified using Image J. Retrobead
infusion coordinates
were SN (from bregma AP −3.20 mm; ML ±1.50 mm; and DV
from the dura,
−4.00 mm), VTA (AP, −3.10 mm; ML, ±0.50 mm; and DV,
−4.25 mm), and VL-
VM (AP, −2.20 mm; ML, ±1.75 mm; and DV, −3.25 mm).
Statistics and reproducibility. For comparisons between two
groups, data were
analyzed by Welch’s t-test for normally distributed data and the
Mann–Whitney U
test for data not normally distributed, using Graph Pad Prism 7.
For repeated
samples, data were analyzed by paired t-test. Correlation was
analyzed by the
106. Pearson correlation using Graph Pad Prism 7. All tests are two-
tailed. Statistical
analyzes of the data were performed using Prism 7 software for
the number of
animals for each experiment indicated in the figure legends.
Means and SEMs are
reported for all experiments. For comparisons between multiple
groups, ANOVA
followed by Tukey’s test was used for normally distributed
data. The nonpara-
metric Kruskal–Wallis test followed by Dunn’s correction was
used for data that
were not normally distributed. Experiments were carried out
independently twice
(Figs. 2b, c, 4a, b, 5b, c, h–j, 7b and Supplementary Figs. 1f,
3a–f, 5, 7f, 8f), three
times (Fig. 1b, h–j, 2d–k, 3, 4c–h, 5e–f, 6c–d, 7c, g, and
Supplementary Figs. 1a–d,
2b–f, i–j, 3g–l, 4a–c, f–i, 6, 7d–e, 8, 9a–d and 10), or four or
more times (Figs. 1c–f,
6e–g, 7d–f and Supplementary Figs. 2g, i, 4d, e, 9e–h).
Reporting summary. Further information on research design is
available in
the Nature Research Reporting Summary linked to this article.
NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7 ARTICLE
NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications 11
https://www.ncbi.nlm.nih.gov/nuccore/EF191515
www.nature.com/naturecommunications
www.nature.com/naturecommunications
107. Data availability
All data generated or analyzed during this study are included in
this published article and
its supplementary information files. Source data are provided as
a Source data file.
Received: 30 May 2019; Accepted: 7 April 2020;
References
1. Bostan, A. C. & Strick, P. L. The basal ganglia and the
cerebellum: nodes in an
integrated network. Nat. Rev. Neurosci. 19, 338–350 (2018).
2. Esposito, M. S. et al. Brainstem nucleus MdV mediates
skilled forelimb motor
tasks. Nature 508, 351–356 (2014).
3. Dayan, E. & Cohen, L. G. Neuroplasticity subserving motor
skill learning.
Neuron 72, 443–454 (2011).
4. McKenzie, I. A. et al. Motor skill learning requires active
central myelination.
Science 346, 318–322 (2014).
5. Statton, M. A. et al. A single bout of moderate aerobic
exercise improves
motor skill acquisition. PLoS ONE 10, e0141393 (2015).
6. Palmer, S. S. et al. Exercise therapy for Parkinson’s dis ease.
Arch. Phys. Med.
Rehabil. 67, 741–745 (1986).
7. Kane, K. & Bell, A. A. core stability group program for
108. children with
developmental coordination disorder: 3 clinical case reports.
Pediatr. Phys.
Ther. 21, 375–382 (2009).
8. Rafie, F. et al. Physical exercises and motor skills in autistic
children. Iran. J.
Public Health 44, 724–725 (2015).
9. Meijer, J. H. & Robbers, Y. Wheel running in the wild. Proc.
Roy. Soc. B 281,
20140210 (2014).
10. Murphy, T. H. & Corbett, D. Plasticity during stroke
recovery: from synapse
to behaviour. Nat. Rev. Neurosci. 10, 861–872 (2009).
11. Petzinger, G. M. et al. Exercise-enhanced neuroplasticity
targeting motor and
cognitive circuitry in Parkinson’s disease. Lancet Neurol. 12,
716–726 (2013).
12. Spitzer, N. C. Neurotransmitter switching in the developing
and adult brain.
Ann. Rev. Neurosci. 40, 1–19 (2017).
13. Shiotsuki, H. et al. A rotarod test for evaluation of motor
skill learning. J.
Neurosci. Methods 189, 180–185 (2010).
14. Buitrago, M. M. et al. Short and long-term motor skill
learning in an
accelerated rotarod training paradigm. Neurobiol. Learn. Mem.
81, 211–216
(2004).
109. 15. Pothakos, K., Kurz, M. J. & Lau, Y. S. Restorative effect of
endurance exercise
on behavioral deficits in the chronic mouse model of
Parkinson’s disease with
severe neurodegeneration. BMC Neurosci. 10, 6 (2009).
16. Mackintosh, N. J. A theory of attention: variations in the
associability of
stimuli with reinforcement. Psychological Rev. 82, 276–298
(1975).
17. Morris, R. G. et al. Selective impairment of learning and
blockade of long-term
potentiation by an N-methyl-D-aspartate receptor antagonist,
AP5. Nature
319, 774–776 (1986).
18. Marek, K. W., Kurtz, L. M. & Spitzer, N. C. cJun integrates
calcium activity
and tlx3 expression to regulate neurotransmitter specification.
Nat. Neurosci.
13, 944–950 (2010).
19. Güemez-Gamboa, A. et al. Non-cell-autonomous mechanism
of activity-
dependent neurotransmitter switching. Neuron 82, 1004–1016
(2014).
20. Meng, D. et al. Neuronal activity regulates neurotransmitter
switching in the
adult brain following light-induced stress. Proc. Natl Acad. Sci.
USA 115,
5064–5071 (2018).
21. Clark, P. J. et al. Adult hippocampal neurogenesis and c-Fos
110. induction during
escalation of voluntary wheel running in C57BL/6J mice.
Behav. Brain Res.
213, 246–252 (2010).
22. Boisgontier, M. P. et al. Individual differences in brainstem
and basal ganglia
structure predict postural control and balance loss in young and
older adults.
Neurobiol. Aging 50, 47–59 (2017).
23. Mena-Segovia, J. & Bolam, J. P. Rethinking the
pedunculopontine nucleus:
from cellular organization to function. Neuron 94, 7–18 (2017).
24. Smith, Y. et al. Parkinson’s disease therapeutics: new
developments and
challenges since the introduction of levodopa.
Neuropsychopharmacol 37,
213–246 (2012).
25. Mena-Segovia, J. et al. GABAergic neuron distribution in
the
pedunculopontine nucleus defines functional subterritories. J.
Comp. Neurol.
515, 397–408 (2009).
26. Tattersall, T. L. et al. Imagined gait modulates neuronal
network dynamics in
the human pedunculopontine nucleus. Nat. Neurosci. 17, 449–
454 (2014).
27. Thevathasan, W. et al. Alpha oscillations in the
pedunculopontine nucleus
correlate with gait performance in parkinsonism. Brain 135,
148–160 (2012).
111. 28. Gut, N. K. & Winn, P. Deep brain stimulation of different
pedunculopontine
targets in a novel rodent model of parkinsonism. J. Neurosci.
35, 4792–4803
(2015).
29. Karachi, C. et al. Cholinergic mesencephalic neurons are
involved in gait
and postural disorders in Parkinson disease. J. Clin. Invest. 120,
2745–2754
(2010).
30. Madisen, L. et al. A robust and high-throughput Cre
reporting and
characterization system for the whole mouse brain. Nat.
Neurosci. 13, 133–140
(2010).
31. Chen, E. et al. Altered baseline and nicotine-mediated
behavioral and
cholinergic profiles in ChAT-Cre mouse lines. J. Neurosci. 38,
2177–2188
(2018).
32. Vincent, S. R. et al. NADPH-diaphorase: a selective
histochemical marker for
the cholinergic neurons of the pontine reticular formation.
Neurosci. Lett. 43,
31–36 (1983).
33. Saunders, A., Granger, A. J. & Sabatini, B. L. Corelease of
acetylcholine and
GABA from cholinergic forebrain neurons. elife 27, 4 (2015).
34. Wang, H. L. & Morales, M. Pedunculopontine and
112. laterodorsal tegmental
nuclei contain distinct populations of cholinergic, glutamatergic
and
GABAergic neurons in the rat. Eur. J. Neurosci. 29, 340–358
(2009).
35. Luquin, E. et al. Stereological estimates of glutamatergic,
GABAergic, and
cholinergic neurons in the pedunculopontine and laterodorsal
tegmental
nuclei in the rat. Front. Neuroanat. 12, 34 (2018).
36. Xiao, C. et al. Cholinergic mesopontine signals govern
locomotion and reward
through dissociable midbrain pathways. Neuron 90, 333–347
(2016).
37. Dautan, D. et al. Segregated cholinergic transmission
modulates dopamine
neurons integrated in distinct functional circuits. Nat. Neurosci.
19,
1025–1033 (2016).
38. Gambhir, H., Mathur, R. & Behari, M. Progressive
impairment in motor skill
learning at 12 and 20 weeks post 6-OHDA- SNc lesion in rats.
Parkinsonism
Relat. Disord. 17, 476–478 (2011).
39. Leemburg., S. et al. Motor skill learning and reward
consumption differentially
affect VTA activation. Sci. Rep. 8, 687 (2018).
40. Steriade, M. et al. Fast oscillations (20-40 Hz) in
thalamocortical systems and
their potentiation by mesopontine cholinergic nuclei in the cat.
113. Proc. Natl
Acad. Sci. USA 88, 4396–4400 (1991).
41. Jeljeli, M. et al. Effects of ventrolateral-ventromedial
thalamic lesions on
motor coordination and spatial orientation in rats. Neurosci.
Res. 47, 309–316
(2003).
42. Kaita, A. A. & Goldberg, A. M. Control of acetylcholine
synthesis—the
inhibition of choline acetyltransferase by acetylcholine. J.
Neurochem. 16,
1185–1191 (1969).
43. Morris, D., Maneckjee, A. & Hebb, C. The kinetic
properties of human
placental choline acetyltransferase. Biochem. J. 125, 857–863
(1971).
44. Dulcis, D. et al. Neurotransmitter switching regulated by
miRNAs controls
changes in social preference. Neuron 95, 1319–1333 (2017).
45. Perez-Lloret, S. & Barrantes, F. J. Deficits in cholinergic
neurotransmission
and their clinical correlates in Parkinson’s disease, N.P.J.
Parkinsons Dis. 2,
16001 (2016).
46. Hosp, J. A. et al. Dopaminergic projections from midbrain
to primary
motor cortex mediate motor skill learning. J. Neurosci. 31,
2481–2487
(2011).
114. 47. Guo, L. et al. Dynamic rewiring of neural circuits in the
motor cortex in
mouse models of Parkinson’s disease. Nat. Neurosci. 18, 1299–
1309 (2015).
48. Vitrac, C. & Benoit-Marand, M. Monoaminergic modulation
of motor cortex
function. Front. Neural Circuits 11, 72 (2017).
49. Chandler, D. J., Gao, W. J. & Waterhouse, B. D.
Heterogeneous organization
of the locus coeruleus projections to prefrontal and motor
cortices. Proc. Natl
Acad. Sci. USA 111, 6816–6821 (2014).
50. MacLaren, D. A. et al. Deficits in motor performance after
pedunculopontine
lesions in rats – impairment depends on demands of task. Eur. J.
Neurosci. 40,
3224–3236 (2014).
51. Caggiano, V. et al. Midbrain circuits that set locomotor
speed and gait
selection. Nature 553, 455–460 (2018).
52. Roseberry, T. K. et al. Cell-type-specific control of
brainstem locomotor
circuits by basal ganglia. Cell 164, 526–537 (2016).
53. Lee, A. M. et al. Identification of a brainstem circuit
regulating visual cortical
state in parallel with locomotion. Neuron 83, 455–466 (2014).
54. Mehrholz, J. et al. Treadmill training for patients with
Parkinson’s disease.
Cochrane Database Syst. Rev. 8, CD007830 (2015).
115. 55. Polese, J. C. et al. Treadmill training is effective for
ambulatory adults with
stroke: a systematic review. J. Physiother. 59, 73–80 (2013).
56. Gaßner, H. et al. Perturbation treadmill training improves
clinical
characteristics of gait and balance in Parkinson’s Disease. J.
Parkinsons Dis. 9,
413–426 (2019).
57. Franklin, K. & Paxinos, G. The Mouse Brain In Stereotaxic
Coordinates 3rd
edn (Elsevier, New York, 2008).
58. Abs, E. et al. Learning-related plasticity in dendrite-
targeting layer 1
interneurons. Neuron 100, 684–699 (2018).
59. Knowland, D. et al. Distinct ventral pallidal neural
populations mediate
separate symptoms of depression. Cell 170, 284–297 (2017).
ARTICLE NATURE COMMUNICATIONS |
https://doi.org/10.1038/s41467-020-16053-7
12 NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications
www.nature.com/naturecommunications
Acknowledgements
We thank Kyle Jackson, Vaidehi Gupta, and Wuji Jiang for
experimental assistance, Alex
116. Glavis-Bloom for technical support and Larry Squire and Takaki
Komiyama for com-
ments on the manuscript. We thank all members of the Spitzer
lab for suggestions on
experimental design and the manuscript. We thank Stefan
Leutgeb and Byungkook Lim
for providing transgenic mice. We thank Jennifer Santini and
the UCSD Microscopy
Core for technical support with imaging and Amanda Roberts
and the Scripps Animal
Models Core for suggestions on behavior experiments. This
research was supported by
grants to N.C.S from the Ellison Medical Foundation, the W. M.
Keck Foundation, NIH
NS047101 and the Overland Foundation.
Author contributions
H.-q.L. and N.C.S. conceived the study, designed the
experiments, interpreted the results
and wrote the paper. H.-q.L. performed the experiments and
analyzes.
Competing interests
The authors declare no competing interests.
Additional information
Supplementary information is available for this paper at
https://doi.org/10.1038/s41467-
020-16053-7.
Correspondence and requests for materials should be addressed
to H.-q.L. or N.C.S.
Peer review information Nature Communications thanks
Konstantinos Ampatzis,
Michael Nusbaum and the other anonymous reviewer(s) for their
118. NATURE COMMUNICATIONS | (2020) 11:2195 |
https://doi.org/10.1038/s41467-020-16053-7 |
www.nature.com/naturecommunications 13
https://doi.org/10.1038/s41467-020-16053-7
https://doi.org/10.1038/s41467-020-16053-7
http://www.nature.com/reprints
http://creativecommons.org/licenses/by/4.0/
http://creativecommons.org/licenses/by/4.0/
www.nature.com/naturecommunications
www.nature.com/naturecommunicationsExercise enhances
motor skill learning by neurotransmitter switching in the adult
midbrainResultsSustained running enhances motor skill
learningRunning induces transmitter switching in the midbrain
cPPNTranscript levels of transmitter synthetic enzymes
changeSwitching neurons project to the SN, VTA, and
thalamusEnhanced motor skill learning requires transmitter
switchDiscussionMethodsMiceWheel runningRotarodBalance
beamMotor skill learningLocomotor activityHistology and
immunocytochemistryBirthdatingTUNEL assayImaging and data
analysisStereological countingViral constructs and
injectionTract tracingStatistics and reproducibilityReporting
summaryData availabilityReferencesAcknowledgementsAuthor
contributionsCompeting interestsAdditional information