The document summarizes a study on the distribution of Hepatitis B virus (HBV) genotypes in Libya. The study found that out of 60 genotyped samples: 1) 90% were genotype D, 2) 1.7% were genotype A, 3) 1.7% were genotype E, and 4) 6.6% were a mixed genotype D/E. This establishes that HBV genotype D is the most prevalent in Libya, which is consistent with other Mediterranean and Middle Eastern countries. The study recommends further exploring the nucleotide sequences of genotype D isolates in Libya and potentially breaking genotype D into sub-genotypes.
For over 10 decades, agents of infectious diseases have been identified through their phenotype directly in specimen and after a growth in culture.
Today, we are in a molecular era, there is an opportunity to detect organisms more rapidly and accurately based on their genetic signatures.
Biomedical science research discovery offers a growing numbers of a nucleic acid amplification tests (NAATS) among which is polymerase chain reaction (PCR) for detection and identification of bacterial, parasitic, fungi and viral pathogens.
These assays improve patient care, reduce antibiotic usage, enhance test utilization and increase laboratory and hospital efficiency.
In this seminar, we will explore the clinical usefulness and potential of both conventional and real-time PCR assays in Clinical Microbiology.
For over 10 decades, agents of infectious diseases have been identified through their phenotype directly in specimen and after a growth in culture.
Today, we are in a molecular era, there is an opportunity to detect organisms more rapidly and accurately based on their genetic signatures.
Biomedical science research discovery offers a growing numbers of a nucleic acid amplification tests (NAATS) among which is polymerase chain reaction (PCR) for detection and identification of bacterial, parasitic, fungi and viral pathogens.
These assays improve patient care, reduce antibiotic usage, enhance test utilization and increase laboratory and hospital efficiency.
In this seminar, we will explore the clinical usefulness and potential of both conventional and real-time PCR assays in Clinical Microbiology.
Avances en genética. Utilidad de la NGS y la bioinformática.BBK Innova Sarea
27 Octubre 2014. Presentación de Pablo Lapunzina, Director del Instituto de Medicina Genética Médica y Molecular (INGEMM), de IDIPAZ y de CEBERER, en la "Jornada Avances en Genética y Tecnología Social. La experiencia de la Fundación Síndrome de Dravet ".
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and CharacterizationJohn Blue
Metagenomic Sequencing for Virus Discovery and Characterization - Dr. Ben Hause, Kansas State University, from the 2015 North American PRRS Symposium, December 4 - 5, 2015, Chicago, IL, USA.
More presentations at http://www.swinecast.com/2015-north-american-prrs-symposium
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
T-Cell receptor (TCR) repertoire sequencing by next-generation
sequencing (NGS) is a valuable tool for building a deeper
understanding of the adaptive immune system. As immunotherapy,
particularly T-cell therapies, show increasing potential in treating
cancer, the ability to gain a detailed, unbiased view of the TCR
repertoire becomes imperative for biomarker discovery, immune
response to treatment, and study of tumor microenvironments. A key
question the field seeks to understand is the relationship between
circulating T-cells and infiltrating T-cells at the tumor site. Here, we
present a novel AmpliSeq approach for TCR repertoire sequencing
using the Ion Torrent S5 sequencer which leverages simplified
workflows and offers up to 600 bp reads which allow for a more
complete characterization of the entire V(D)J region of TCRβ. With a
unique long read length capability, this method can leverage mRNA as
input, which minimizes requirement as starting materials (10-500ng for
typical use cases) and focusing sequencing to productive TCRβ
arrangements.
Decades of cancer research including comprehensive molecular profiling combined with the
development of a broad array of targeted therapies have created the opportunity to transform
cancer care in the near future by implementing precision oncology based approaches. An
important element of this system is the widespread availability of robust and cost-effective
multivariate profiling methods in order to characterize relevant cancer associated molecular
alterations.
Current commercially available multivariate profiling methods vary dramatically with regard to
the number of cancer genes interrogated. Given that many large scale and detailed molecular
profiling studies have been completed, the landscape of somatic alterations in solid tumors is
reasonably well-known. Furthermore, the specific gene variants that are relevant to application
of targeted therapies are also a matter of record. Therefore, we set out to define the number of
relevant cancer genes for precision oncology research based on the currently available
empirical evidence.
In vitro transcription and transfection of HCV genomic repliconBinodGupta27
ABSTRACT:
Introduction: Hepatitis C virus (HCV) is a positive stranded RNA virus that causes acute and chronic hepatitis and hepatocellular carcinoma. Aims & Objectives: The study was conducted to establish the transfection of Huh 7.5 derived cell lines with In-vitro transcript of HCV pF6/JFH-1 for production of infectious virus particles in naïve Huh 7.5 cells, its detection by RT-PCR. Materials and Method: Huh 7.5 cells, a highly permissive cell lines for HCV replication, were grown in Dulbecco’s Modified Eagle’s Medium and pFL-J6/JFH plasmid was linearized with XbaI and subjected to in-vitro transcription using MEGAscript Kit (Ambion, USA) Huh-7.5 cells were transfected with 2.5 μg transcript using Lipofectamine 2000 transfection reagent (Invitrogen, USA) . The culture supernatant was collected after 24, 48 and 72 hr after incubation in fresh media and viral RNAs were isolated from it using Trizol LS reagent (Ambion, USA) and quantified by real-time quantitative RT-PCR. Total RNA was extracted from cells using Trizol reagent (Ambion, USA) and then RNA was subjected to cDNA synthesis using RevertAid reverse transcription (Thermo Fisher Scientific, USA). The PCR products were resolved by electrophoresis in 1.5% (w/v) agarose gels and images were captured by a Chemidoc XRS system (Bio-Rad, USA). Results: We observed Huh7.5 cells were cultured in DMEM. Plasmid FL-J6/JFH1 was linearized with the restriction enzyme XbaI and HCV RNA was obtained by In-vitro transcription and was transfected to grown Huh 7.5 cells shown by band on agarose gel and total RNA isolated after 24 hours of post infection followed by RT-PCR gave distinct band on gel whereas 48 and 72 hr did not. Infection of Huh 7.5 cells with cell culture supernatant from cells transfected with HCV in vitro transcript gave a distinct band. This will help in understanding entire viral life cycle and its non-structural gene products like NS4B and NS5A that enhance the replicative capacity of replicons in Huh 7.5 cell lines for development of drug and vaccines.
Avances en genética. Utilidad de la NGS y la bioinformática.BBK Innova Sarea
27 Octubre 2014. Presentación de Pablo Lapunzina, Director del Instituto de Medicina Genética Médica y Molecular (INGEMM), de IDIPAZ y de CEBERER, en la "Jornada Avances en Genética y Tecnología Social. La experiencia de la Fundación Síndrome de Dravet ".
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and CharacterizationJohn Blue
Metagenomic Sequencing for Virus Discovery and Characterization - Dr. Ben Hause, Kansas State University, from the 2015 North American PRRS Symposium, December 4 - 5, 2015, Chicago, IL, USA.
More presentations at http://www.swinecast.com/2015-north-american-prrs-symposium
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
T-Cell receptor (TCR) repertoire sequencing by next-generation
sequencing (NGS) is a valuable tool for building a deeper
understanding of the adaptive immune system. As immunotherapy,
particularly T-cell therapies, show increasing potential in treating
cancer, the ability to gain a detailed, unbiased view of the TCR
repertoire becomes imperative for biomarker discovery, immune
response to treatment, and study of tumor microenvironments. A key
question the field seeks to understand is the relationship between
circulating T-cells and infiltrating T-cells at the tumor site. Here, we
present a novel AmpliSeq approach for TCR repertoire sequencing
using the Ion Torrent S5 sequencer which leverages simplified
workflows and offers up to 600 bp reads which allow for a more
complete characterization of the entire V(D)J region of TCRβ. With a
unique long read length capability, this method can leverage mRNA as
input, which minimizes requirement as starting materials (10-500ng for
typical use cases) and focusing sequencing to productive TCRβ
arrangements.
Decades of cancer research including comprehensive molecular profiling combined with the
development of a broad array of targeted therapies have created the opportunity to transform
cancer care in the near future by implementing precision oncology based approaches. An
important element of this system is the widespread availability of robust and cost-effective
multivariate profiling methods in order to characterize relevant cancer associated molecular
alterations.
Current commercially available multivariate profiling methods vary dramatically with regard to
the number of cancer genes interrogated. Given that many large scale and detailed molecular
profiling studies have been completed, the landscape of somatic alterations in solid tumors is
reasonably well-known. Furthermore, the specific gene variants that are relevant to application
of targeted therapies are also a matter of record. Therefore, we set out to define the number of
relevant cancer genes for precision oncology research based on the currently available
empirical evidence.
In vitro transcription and transfection of HCV genomic repliconBinodGupta27
ABSTRACT:
Introduction: Hepatitis C virus (HCV) is a positive stranded RNA virus that causes acute and chronic hepatitis and hepatocellular carcinoma. Aims & Objectives: The study was conducted to establish the transfection of Huh 7.5 derived cell lines with In-vitro transcript of HCV pF6/JFH-1 for production of infectious virus particles in naïve Huh 7.5 cells, its detection by RT-PCR. Materials and Method: Huh 7.5 cells, a highly permissive cell lines for HCV replication, were grown in Dulbecco’s Modified Eagle’s Medium and pFL-J6/JFH plasmid was linearized with XbaI and subjected to in-vitro transcription using MEGAscript Kit (Ambion, USA) Huh-7.5 cells were transfected with 2.5 μg transcript using Lipofectamine 2000 transfection reagent (Invitrogen, USA) . The culture supernatant was collected after 24, 48 and 72 hr after incubation in fresh media and viral RNAs were isolated from it using Trizol LS reagent (Ambion, USA) and quantified by real-time quantitative RT-PCR. Total RNA was extracted from cells using Trizol reagent (Ambion, USA) and then RNA was subjected to cDNA synthesis using RevertAid reverse transcription (Thermo Fisher Scientific, USA). The PCR products were resolved by electrophoresis in 1.5% (w/v) agarose gels and images were captured by a Chemidoc XRS system (Bio-Rad, USA). Results: We observed Huh7.5 cells were cultured in DMEM. Plasmid FL-J6/JFH1 was linearized with the restriction enzyme XbaI and HCV RNA was obtained by In-vitro transcription and was transfected to grown Huh 7.5 cells shown by band on agarose gel and total RNA isolated after 24 hours of post infection followed by RT-PCR gave distinct band on gel whereas 48 and 72 hr did not. Infection of Huh 7.5 cells with cell culture supernatant from cells transfected with HCV in vitro transcript gave a distinct band. This will help in understanding entire viral life cycle and its non-structural gene products like NS4B and NS5A that enhance the replicative capacity of replicons in Huh 7.5 cell lines for development of drug and vaccines.
Polymorphism of the Il28b Gene (Rs8099917, Rs12979860) and Virological Response of Pakistani Hepatitis C Virus Genotype 3 Patients to Pegylated Interferon Therapy
In vitro transcription and transfection of HCV genomic repliconBinodGupta27
Introduction: Hepatitis C virus (HCV) is a positive stranded RNA virus that causes acute and chronic hepatitis and hepatocellular carcinoma. Aims & Objectives: The study was conducted to establish the transfection of Huh 7.5 derived cell lines with In-vitro transcript of HCV pF6/JFH-1 for production of infectious virus particles in naïve Huh 7.5 cells, its detection by RT-PCR. Materials and Method: Huh 7.5 cells, a highly permissive cell lines for HCV replication, were grown in Dulbecco’s Modified Eagle’s Medium and pFL-J6/JFH plasmid was linearized with XbaI and subjected to in-vitro transcription using MEGAscript Kit (Ambion, USA) Huh-7.5 cells were transfected with 2.5 μg transcript using Lipofectamine 2000 transfection reagent (Invitrogen, USA) . The culture supernatant was collected after 24, 48 and 72 hr after incubation in fresh media and viral RNAs were isolated from it using Trizol LS reagent (Ambion, USA) and quantified by real-time quantitative RT-PCR. Total RNA was extracted from cells using Trizol reagent (Ambion, USA) and then RNA was subjected to cDNA synthesis using RevertAid reverse transcription (Thermo Fisher Scientific, USA). The PCR products were resolved by electrophoresis in 1.5% (w/v) agarose gels and images were captured by a Chemidoc XRS system (Bio-Rad, USA). Results: We observed Huh7.5 cells were cultured in DMEM. Plasmid FL-J6/JFH1 was linearized with the restriction enzyme XbaI and HCV RNA was obtained by In-vitro transcription and was transfected to grown Huh 7.5 cells shown by band on agarose gel and total RNA isolated after 24 hours of post infection followed by RT-PCR gave distinct band on gel whereas 48 and 72 hr did not. Infection of Huh 7.5 cells with cell culture supernatant from cells transfected with HCV in vitro transcript gave a distinct band. This will help in understanding entire viral life cycle and its non-structural gene products like NS4B and NS5A that enhance the replicative capacity of replicons in Huh 7.5 cell lines for development of drug and vaccines.
ABSTRACT- Multiple Drug resistance (MDR) tuberculosis timely diagnose is of utmost clinical relevance and needs to be diagnose at initial stages for the proper treatment. The current study was done to detect the several genes for MDR tuberculosis (TB) in clinical isolates by molecular tools. 60 clinical isolates were collected and subjected for AFB smear preparation, Nested PCR (IS6110) for mycobacterium tuberculosis complex detection and MDR TB PCR targeting rpoB, kat G, mab A promoter. 12 came positive for AFB smears, out of which 08 were pulmonary and 04 were extra pulmonary. Nested PCR targeting IS6110 gene was amplified at 123 base pairs with 340 base pairs as IC (internal control) was seen in 25 cases which include 19 pulmonary and 6 extra pulmonary. The Positive TB PCR specimens were subjected for MDRTB PCR Only 06 cases yielded, an amplicon of 315 bp confirming the rpoB gene resistance for resistance for rifampcin drug. In any of the 06 positives none of the other resistance gene other than rpoB was amplified. Targeting multiple genes at once, additional information will be gained from a single test run that otherwise would require several times the reagents and more time to perform. Current study signifies the usage of quick, cost effective, DNA sequences based method for MDR TB detection where disease will be diagnosed earlier and hence treatment would be started at an early stage.
Keywords: Multiple drug resistance, amplicon, Polymerase chain reaction, Nested PCR, Rifampicin.
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
New Drug Discovery and Development .....NEHA GUPTA
The "New Drug Discovery and Development" process involves the identification, design, testing, and manufacturing of novel pharmaceutical compounds with the aim of introducing new and improved treatments for various medical conditions. This comprehensive endeavor encompasses various stages, including target identification, preclinical studies, clinical trials, regulatory approval, and post-market surveillance. It involves multidisciplinary collaboration among scientists, researchers, clinicians, regulatory experts, and pharmaceutical companies to bring innovative therapies to market and address unmet medical needs.
Report Back from SGO 2024: What’s the Latest in Cervical Cancer?bkling
Are you curious about what’s new in cervical cancer research or unsure what the findings mean? Join Dr. Emily Ko, a gynecologic oncologist at Penn Medicine, to learn about the latest updates from the Society of Gynecologic Oncology (SGO) 2024 Annual Meeting on Women’s Cancer. Dr. Ko will discuss what the research presented at the conference means for you and answer your questions about the new developments.
The prostate is an exocrine gland of the male mammalian reproductive system
It is a walnut-sized gland that forms part of the male reproductive system and is located in front of the rectum and just below the urinary bladder
Function is to store and secrete a clear, slightly alkaline fluid that constitutes 10-30% of the volume of the seminal fluid that along with the spermatozoa, constitutes semen
A healthy human prostate measures (4cm-vertical, by 3cm-horizontal, 2cm ant-post ).
It surrounds the urethra just below the urinary bladder. It has anterior, median, posterior and two lateral lobes
It’s work is regulated by androgens which are responsible for male sex characteristics
Generalised disease of the prostate due to hormonal derangement which leads to non malignant enlargement of the gland (increase in the number of epithelial cells and stromal tissue)to cause compression of the urethra leading to symptoms (LUTS
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
NVBDCP.pptx Nation vector borne disease control programSapna Thakur
NVBDCP was launched in 2003-2004 . Vector-Borne Disease: Disease that results from an infection transmitted to humans and other animals by blood-feeding arthropods, such as mosquitoes, ticks, and fleas. Examples of vector-borne diseases include Dengue fever, West Nile Virus, Lyme disease, and malaria.
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
micro teaching on communication m.sc nursing.pdfAnurag Sharma
Microteaching is a unique model of practice teaching. It is a viable instrument for the. desired change in the teaching behavior or the behavior potential which, in specified types of real. classroom situations, tends to facilitate the achievement of specified types of objectives.
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journeygreendigital
Tom Selleck, an enduring figure in Hollywood. has captivated audiences for decades with his rugged charm, iconic moustache. and memorable roles in television and film. From his breakout role as Thomas Magnum in Magnum P.I. to his current portrayal of Frank Reagan in Blue Bloods. Selleck's career has spanned over 50 years. But beyond his professional achievements. fans have often been curious about Tom Selleck Health. especially as he has aged in the public eye.
Follow us on: Pinterest
Introduction
Many have been interested in Tom Selleck health. not only because of his enduring presence on screen but also because of the challenges. and lifestyle choices he has faced and made over the years. This article delves into the various aspects of Tom Selleck health. exploring his fitness regimen, diet, mental health. and the challenges he has encountered as he ages. We'll look at how he maintains his well-being. the health issues he has faced, and his approach to ageing .
Early Life and Career
Childhood and Athletic Beginnings
Tom Selleck was born on January 29, 1945, in Detroit, Michigan, and grew up in Sherman Oaks, California. From an early age, he was involved in sports, particularly basketball. which played a significant role in his physical development. His athletic pursuits continued into college. where he attended the University of Southern California (USC) on a basketball scholarship. This early involvement in sports laid a strong foundation for his physical health and disciplined lifestyle.
Transition to Acting
Selleck's transition from an athlete to an actor came with its physical demands. His first significant role in "Magnum P.I." required him to perform various stunts and maintain a fit appearance. This role, which he played from 1980 to 1988. necessitated a rigorous fitness routine to meet the show's demands. setting the stage for his long-term commitment to health and wellness.
Fitness Regimen
Workout Routine
Tom Selleck health and fitness regimen has evolved. adapting to his changing roles and age. During his "Magnum, P.I." days. Selleck's workouts were intense and focused on building and maintaining muscle mass. His routine included weightlifting, cardiovascular exercises. and specific training for the stunts he performed on the show.
Selleck adjusted his fitness routine as he aged to suit his body's needs. Today, his workouts focus on maintaining flexibility, strength, and cardiovascular health. He incorporates low-impact exercises such as swimming, walking, and light weightlifting. This balanced approach helps him stay fit without putting undue strain on his joints and muscles.
Importance of Flexibility and Mobility
In recent years, Selleck has emphasized the importance of flexibility and mobility in his fitness regimen. Understanding the natural decline in muscle mass and joint flexibility with age. he includes stretching and yoga in his routine. These practices help prevent injuries, improve posture, and maintain mobilit
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journey
Hbv genotypes in libya
1. Distribution of Hepatitis B Virus
genotypes in Libya using PCRbased diagnostics
Presented By:
Milud.A.Salem
2. Introduction to Hepatitis B
Virus
350 million people are infected with HBV
worldwide¹.
HBV infection develop to CHB, cirrhosis or
HCC¹.
Libya has an intermediate prevalence of the
HBV infection reaching around 2.2%².
¹Hu and Hirshfield, 2006. Advanced techniques in diagnostic microbiology, pp. 342-343
²Elzouki et al. Journal of Gastroenterology. 2006; 21 (2):114
3. ≥8% - high
2-7% - intermediate
< 2 - low
Terrault and Wright 1998. Sleisenger and fordtran's gastrointestinal and liver Disease, pp.1123-1170
6. Genotypes of HBV
Classified into 9 genotypes to date (A-I) based
on 8% or more of DNA sequence differences.
HBV genotypes were found to have varied
geographic distributions.
Schaefer S. World Journal of Gastroenterology. 2007, 13(1):14-21.
7. HBV genotypes have clinical significance:
1) Disease severity:
genotypes C and D are more associated with
sever liver disease than genotypes B and A¹.
genotype D has a high rate of developing HCC².
2) Induction of chronicity:
CHB is more often induced in patients with
genotype A than with genotypes B and C³
¹Chan et al. Journal of Clinical Microbiology. 2003; 41:1277–1279
²Thakur et al. Journal of Gastroenterology and Hepatology. 2002; 17:165–170
³Schaefer. Journal of Viral Hepatitis. 2005; 12:111-124.
8. 3) Prevalence of seroconversion:
genotypes A and B have a higher seroconversion
rate than genotypes D and C, respectively¹.
4) Mutations variants:
precore variant is common with genotypes D and
B in comparison with genotypes A and C,
respectively. the core promoter mutation is more
frequent in individuals with genotype C than
genotype B ²
¹Mahtab et al. Hepatobiliary and Pancreatic Diseases International. 2008; 7(2): 457-464.
²Lindh et al. Journal of Infection Disease. 1999; 179:775–782.
9. 5) Viraemia levels:
high DNA levels in HBV genotype D patients with
HBeAg negative, and in HBV genotype C patients
with HBeAg positive.¹
6) Response to anti-viral drugs and vaccines:
The response to IFN is higher with genotypes A and
B than genotypes D and C, respectively², while the
response don’t vary between genotypes A and D
with lamivudine³ but higher with genotype C than B³.
The immune escape after vaccination occurred in
region with genotype D prevalence .
4
¹Westland et al.Gastroenterology. 2003; 125:107-116.
²Zhang et al.Journal of Medical Virology. 1996; 48:8–16.
³Buti et al. Journal of Hepatology. 2002; 36:445-446.
4Carman et al. Lancet. 1990; 336 (8711): 325–329
10. Objective of this study
To determine genotypes of HBV among
Libyan patients who were referred to the
St.James clinical Laboratory, Tripoli, using
INNO-LiPA HBV genotyping assay
11. Materials and Methods
HBV-DNA quantification
clinical plasma specimens
DNA purification
RoboGene® HBV quantification kit
DNA Quantification
Rotor-Gene 3000™
12. BV
H
e ® kit
Gen tion
ob o i fi c a
R nt
qua
H
RC
SEA
RE 0
T
ET e 300
B
OR -Gen
C or
Rot
13. Materials and Methods
HBV Genotyping
clinical plasma isolates
DNA purification
Wizard® SV genomic DNA purification system, Promega
Outer amplification
INNO-LiPA primer
Gel electrophoresis
2% agarose gel
+
Genotyping using
INNO- LiPA assay
-
Nested amplification
INNO-LiPA primer
14. mic m,
eno yste
g
S V i on s
®
ard rificat
Wiz pu
t
NA ega ki
D
m
Pro
r
TT l Cycle
RBE rma
CO The
RBE RCH
CO EA
RES
15. s
e si
hor )
p
tro Plus
c
el e X L
g el el
ini
M em (G
t
sys
O
NN
I
iP A
-L
VG
HB
ot y
en
kit
ing
p
16. Materials and Methods
INNO-LiPA major steps
Denaturation
5 min
Denaturation of amplified
Biotinylated DNA
Hybridization
60 min
Hybridization with specific
oligonucleotide probes
immobilized on membrane-based
strips
Stringent wash
30 min
Remove unbound
DNA
Color development
60 min
Incubate with conjugate
and substrate resulting in
purple brown precipitate
17. Results and discussion
HBV-DNA quantification
121 clinical plasma isolates
DNA purification
RoboGene® HBV quantification kit
DNA Quantification
Rotor-Gene 3000™
DNA quantity in samples ranged from
50 IU/ ml and 3.6x10ˉ IU/ml
18. Results and discussion
HBV-DNA purification and amplification
clinical plasma isolates
DNA quantity > 1000 IU/ml (85/121 samples)
DNA purification
Wizard® SV genomic DNA purification system, Promega
Outer amplification
INNO-LiPA primer
54 samples
-
Gel electrophoresis
Nested amplification
2% agarose gel
INNO-LiPA primer
31 samples +
+ 33 samples
Genotyping using
INNO- LiPA assay
19. 456
411 415
1
3
5´
CATC CTGCTGCTATGCCTCATC TTCTTG TTGGTTCTTCTGGATTA TCAAGGTATGTTGCCCG TTTGTCCTCTAATTCC AGGATCAACAACAACCAGTACG
GTAG GACGACGATACGGAGTAGAAGAACAACCAAGAAGACCTAAT AGTTCCATACAACGGGCAAACAGGAGATTAAGGTCCTAGTTGTTGTTGGT CATGC
GGACCATGCAAAACCTGCACGACTCCTGCTCAAGGCA ACTCTATGTTTCCCTCATGTTGCTG TACAAAACCTACGGATGGAAATTGCACCTGTATTCCCAT
CCTGGTACGTTTTGGACGTGCTGAGGACGAGTTCCGTTGAGATACAAAGGGAGTACAACGACATGTTTTGGATGCCTACCTTTAACGTGGACATAAGGGTA
CCCATCGT CCTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCT TGGCTCAGTTTACTAGTGCCATT TGTTCAGTGGTTCGTAGGG
GGGTAGCAGGACCCGAAAGCGTTTTATGGATACCCTCACCCGGAGTCAGGCAAAGAGAACCGAGTCAAATGATCACGGTAAACAAGTCACCAAGCATCCC
798
CTTTCCC CCACTGTTTGGCTTTCAGCTATATGGATGATGTGGTATTGGGGGCCAAGACTGTACAGCATCGTGAGTCCCTTTATACCG CTGTTACCAATTTT
GAAAGGGGGTGACAAACCGAAAGTCGATATACCTACTACACCATAACCCCCGGTTCTGACATGTCGTAGCACTCAGGGAAATATGGC GACAATGGTTAAAA
4
824
2
3´
837
CTTTTGT CTCTG GGTATACATTTAA END OF HbsAg
GAAAACAGAGAC CCATATGTAAATT
Outer amplification fragment
Nested amplification fragment
Osiowy and Giles. Journal of clinical Virology; 2003: 5473-5477.
1= sense outer primer sequence
2= anti-sense outer primer sequence
3= sense nested primer sequence
4= anti-sense nested primer sequence
21. Results and discussion
HBV genotypes
Denaturation
5 min
Denaturation of amplified
Biotinylated DNA
Hybridization
60 min
Hybridization with specific
oligonucleotide probes
immobilized on membrane-based
strips
Stringent wash
30 min
Remove unbound
DNA
Color development
60 min
Incubate with conjugate
and substrate resulting in
purple brown precipitate
26. Results and discussion
HBV genotypes
(60 samples) Genotypable using INNO- LiPA assay
Genotype A
1 patient
Genotype E
1 patient
Genotype D
54 patients
1.7%
1.7%
90%
Mixed
genotype D/E
4 patients
6.6%
27. Conclusion
These results showed that HBV genotype D is
the most prevalent genotype in Libya.
This study agree with other studies in
Mediterranean and Middle East countries where
HBV genotype D is predominates.
HBV D/E hybrid may represent CHB patients
or IDUs.¹
¹ Chen et al.Journal of Medical Virology. 2004; 74: 536-542.
28. Author
Study
place
Detection
method
Samples
.No
%Genotypes
A
B
C
D
E
109
91
84.6
Italy
LiPA
272
Sharara et al.
((2004
Lebanon
/
67
Zekri et al.
((2007
Egypt
Type-specific
primers
70
10
Al ashgar et al.
((2008
Saudi
Arabia
INNO-LiPA
54
5.6
85.2
Basaras et al.
((2007
Spain
INNO-LiPA
14
28.6
64.3
Bahri et al.
((2006
Tunisia
RFLP
138
8
80
9
Khelifa and
( Thibault (2009
Algeria
sequencing
75
5
93
2
This study
)(2009
Libya
INNO-LiPA
60
1.7
90
1.7
D/E
100
RFLP
A/E
Alavian et al.
((2006
Iran
Ezzikouri, et al.
((2008
Morocco
Dal Molin et al,
((2006
INNO-LiPA
26
73
98
25.7
8.6
2
15.7
37.1
5.6
3.6
7.1
6.6
29. Recommendation
Further studies are needed to explore the
nucleotide sequences of HBV genotype D
isolates in Libya.
*This work may open new avenues for further
studying the molecular virology of HBV.
*HBV genotype D may need to be broken down
into sub-genotype.