Fpr1 interacts with several key proteins in the heat shock response pathway, including Tor1, Hsf1, Hsp90, and itself. A yeast two-hybrid screen showed these interactions occur under both 26°C and 39°C conditions. Rapamycin inhibits many of the interactions but Fpr1's interaction with Hsp90. This suggests Fpr1 plays an important role in the heat shock response and may be essential for Hsf1 and Hsp90 interactions.

1. Fpr1 engages in key protein-protein interactions with heat
shock response proteins Hsp90, Hsf1, and Tor1
Adam Harding ∙ Maddiah Mazahr ∙ Joseph Brightmore ∙ Stefan Millson
Abstract
The heat shock response (HSR) is triggered within
cells during cell stress. Proteins within the HSR include
Hsp90, Hsf1, and Tor1. Tor1 phosphorylates Hsf1 on
Serine-326, upregulating Hsp90 transcription. Tor1 is a
target in cancer treatment, as it is over-expressed in
cancer cells, leading to cell resistance. The inhibitor
drug to Tor1 is rapamycin. Fpr1 is a rapamycin binding
partner, and interacts with Hsp90. Fpr1 interactions with
other proteins in the HSR are unknown. The aims of this
investigation were to identify protein-protein interactors
of Fpr1 and other HSR proteins, and observe the effect
of rapamycin. The interactions would be tested using
yeast 2-hybrid screens. Saccharomyces cerevisiae cells
were transformed with vectors pADC and pBDC, and
grown under varying temperatures and rapamycin
concentrations before being screened for interactions.
The vector DNA contained a Lac Z operon to allow for
interaction strength to be reported via ß-galactosidase
activity. Results showed that Fpr1 interacts with Tor1,
Hsf1, Hsp90, and itself under 26°C conditions, with
rapamycin inhibiting all interactions except Fpr1-Hsp90.
At 39°C, identical interactions were found, but with the
addition of Tor2- Hsp90 and Fpr1. Rapamycin no longer
inhibited Fpr1-Tor1 interactions, while Hsf1-Tor1 and
Fpr1-Hsp90 interactions increased. Low levels of
rapamycin resulted in an Hsp90-Tor1 interaction. Hsf1
is therefore seemingly dependent on Fpr1 in order to
bind Tor1. This dependence is suspected to also be
required for Hsf1-Hsp90 interactions, suggesting that
Fpr1 plays a more essential role in the HSR than initially
thought.
Key Words: Fpr1 ∙ Hsp90 ∙ Tor1 ∙ Yeast 2-Hybrid ∙
Rapamycin
Background
Cancer
Cancer is a clonal disease characterised by the
abnormal and prolific growth of cells as a result of the
inhibition of certain cell division mechanisms
originating in a single cell—primarily due to the cell
developing an autonomy from signal pathways
(Hejmadi, 2010) (Fig. 1).
Despite its notoriety and prevalence throughout
society, with 14.1 million cases reported each year
(Cancer Research UK, 2012), the mortality rates are
consistently decreasing each year (SEER, 2012) as
research shifts to work around the challenges of
acquired cancer resistance. This resistance is a
fundamental factor in cancer cell survival against
therapeutics, and insensitivity to drug-induced apoptosis
(Gottesman, 2002).
Accumulated drug resistance of cancer cells adds
another level of complexity to successful treatment, as
managing to successfully damage a cancer cell would
guarantee the death of a healthy cell—as is exemplified
in the form of current chemotherapy methods. Whilst
chemotherapy capitalises on the speed at which cancer
cells divide in order to damage them, the caveat is that
healthy cells also die (albeit slower) as treatment affects
the reproduction mechanism used in both cell types
(Cancer Research UK, 2015).
There are several methods in treating cancer: drugs;
radiotherapy; immunotherapy—commonly monoclonal
antibodies; and surgery (Cancer Research UK, 2014).
Whilst radiotherapy and surgery are relatively
straightforward—targetting a tumour with either focused
energy or a scalpel respectively—and often used in
conjunction for the best outcome, drugs are a very broad
and less predictable category of treatment (i.e. side
effects vary between individuals, as does response to the
drugs themselves) (NHS, 2013).
As such, the versatility and treatment potential of
drugs makes them one of the key areas of focus in terms
of research, with novel and unexpected origins, such as
with oleocanthal in olive oil (LeGendre, 2015) or
malaria proteins (Salanti A et al., 2015).
The high potential of drug therapy forms the basis of
this investigation, focusing on a pathway which involves
A Harding ∙ M Mazahr ∙ J Brightmore ∙ S Millson (✉)
School of Life Sciences, Joseph Banks Laboratories,
University of Lincoln, Brayford Pool, Lincoln LN6 7TS,
UK
E-mail: smillson@lincoln.ac.uk
Phone: 01522 88 6995

2. 4 seemingly linked proteins which are vital to cell
survival and, crucially in the context, relied on by cancer
cells to survive: the TOR pathway, which features
(mammalian) TOR, Hsp90, Hsf1, and, potentially, Fpr1
(Fig. 2).
Rapamycin & TOR (Target of
Rapamycin)
The Target of Rapamycin, TOR (in yeast:
mammalian TOR in humans; mTOR), is a serine/
threonine phosphoinositide 3-kinase-related protein
kinase, responsible for controlling cell growth in
response to nutrients and other growth factors. TOR
signalling is frequently upregulated in cancers, whilst
the protein itself is deregulated to enable the prolific
growth needed to sustain the cancer (Ballou, 2008 &
Yang, 2013). Whilst functionally crucial on its own,
TOR recruits the proteins RAPTOR (Regulatory-
Associated Protein of TOR), RICTOR (Rapamycin
Insensitive Companion of TOR) and mLST8, to form
vital complexes in the pathway known as TORC1 & 2
(Fig. 3) (Ballou, 2008).
RAPTOR is a conserved adaptor protein with
multiple functions within the TOR pathway, and is
encoded by the RPTOR gene highly expressed in
skeletal muscle. Amino acid availability dictates the
levels of RPTOR within the lysosomes; and in stressed
cells, RPTOR associates with SPAG5 and accumulates
in stress granules, leading to a considerable reduction of
presence within the lysosomes.
RAPTOR and TOR form a stoichiometric complex,
stabilised by nutrient deprivation and other conditions
contributing to the suppression of the TOR pathway.
RAPTOR also associates with eukaryotic initiation
factor 4E-binding protein-1 (4EBP1) and S6 kinase:
upregulation of S6 kinase results in downregulation of
TOR. RAPTOR also further helps to maintain cell size
and TOR expression (Lieff, 2015).
mLST8 is thought to be a requisite activating subunit
of TOR complexes (TORC1 & 2), with a
structure suggestive of mLST8 being able to influence
the organisation of the active site. If mLST8 is not
present, TOR associates with Heat Shock Proteins
(HSPs) (Ballou, 2008).
Rapamycin (pharmaceutically known as sirolimus)
and its analogues (or ‘rapalogues’) are drugs with TOR
as the primary target. These drugs bind to a domain
separate from the catalytic site of TOR, blocking a
subset of TOR functions. They are also highly selective
for TOR, so are very effective in cancer treatment,
however they can potentially activate a TOR dependant
survival pathway which results in treatment failure
(Ballou, 2008). In contrast, small molecules that
compete with ATP in the TOR catalytic site would
inhibit all of the kinase-dependant functions of TOR,
without activating the survival pathway. Despite the
wide acceptance of Rapamycin as a treatment, it has
poor aqueous solubility and poor chemical stability, and
is hepatotoxic when used long term, restricting its use
(Mita, 2008).
The current rapalogues, which show promising
antiproliferative activity against a large array of
malignancies, include: Everolimus; Temsirolimus; and
Ridaforolimus (formerly known as Deforolimus), which
currently has few indications of success and is currently
not clinically approved (Benjamin, 2011).
TOR contains an intrinsically active kinase
conformation, with catalytic residues and a catalytic
mechanism similar to other canonical protein kinases.
The active site is highly recessed due to a domain
known as the FKBP12-rapamycin-binding (FRB)
domain, and an inhibitory helix located from the
catalytic cleft. TOR-activating mutations correspond to
structural framework that holds these elements in place,
Fig. 1. Basic illustration of oncogenesis. A mutation controlling growth forms in a single cell, which begins to grow
uncontrollably and proliferates. Over time, more mutations form to the point where the cells become cancerous, and eventually
detach from the origin site and spread throughout the body (metastasis) to form tumours.

3. showing that the kinase is controlled by restricted access.
In vitro biochemistry also shows that the FRB domain
acts as a gatekeeper, with the rapamycin-binding site
interacting with substrates to allow them access to the
restrictive active site (Yang, 2013).
TORC1 & 2 Pathways
Whilst both incorporating TOR and mLST8, the
primary difference between TORC1 and TORC2 is their
incorporation of RAPTOR and RICTOR proteins,
respectively (Fig. 3) (Lieff, 2015).
TORC1 is defined by the Raptor subunit, and is
comprised of TOR, Raptor, and mLST8. The primary
role of TORC1 is to phosphorylate the ribosomal protein
S6 kinase and the translation repressor 4EBP1.
Importantly, TORC1 is rapamycin sensitive.
TORC1 regulates some biological processes within the
cell, including translation; ribosome biogenesis;
autophagy; and glucose metabolism.
TORC2 is defined by the Rictor subunit, and is
comprised of TOR, RICTOR (Rapamycin-Insensitive
Companion of TOR), mLST8, and mSin 1 (target of
rapamycin complex 2 subunit MAPKAP1). The primary
role of TORC2 is to phosphorylate the protein kinase
Akt (involved in cell growth). Due to the RICTOR
subunit, TORC2 is rapamycin insensitive. The full extent
of the biological influence of TORC2 is less known than
TORC1, although it is suggested that it controls cell
survival and organisation of the actin cytoskeleton
(Ballou, 2008).
When rapamycin is introduced into the TOR system,
Fpr1 (FKBP12 as the human orthologue) extends from
the FRB towards mLST8, almost entirely capping the
catalytic cleft of the molecule. At their closest, FKBP12
and mLST8 are only 8 amino acids apart. As such, it is
suggestible that rapamycin-FKBP12 partly causes
inhibition by considerably reducing the accessibility of
the already highly recessed active site within the
catalytic cleft. The rapamycin-binding site corresponds
to the FRB surface closest to the active site, further
suggesting that the binding site itself interacts with
substrates to facilitate entry into the active site of TOR
(Yang, 2013).
Mutation of Ser 2035, a rapamycin contact at the
centre of the region, reduces phosphorylation of S6K1
and 4EBP1, which also explains how rapamycin can
inhibit TORC1 & 2 in the absence of FKBP12
(however, the concentrations needed are 100-fold
greater than when FKBP12 is present). This reduction
can be as great as 80% inhibition of phosphorylation of
cis-S6K1, and up to 75% inhibition of trans-S6K1
(Ballou, 2008).
As promising as focusing on inhibiting TOR would
seem, studying the interactions and potential inhibiting
effects of the other proteins in the pathway would be of
great benefit. If a cancer cell acquires resistance to TOR
inhibitors, then an alternative is needed.
Heat Shock Factor 1 (Hsf1) & Heat Shock
Protein 90 (Hsp90)
When cells are subjected to immense heat or
proteotoxic stress, a collection of proteins known as the
heat shock proteins (HSPs) build up as a defence
mechanism. Alongside their involvement in the stress
response, many of the HSPs act as molecular
chaperones, such as Hsp60 and Hsp70, whilst some are
more specific to the stress response, such as Hsp90
(Chou, 2012).
Regardless of their association within the response,
these molecules are essential in conducting quality
control of cell machinery. They can aid in the folding
and maintenance of new proteins, or can lead to the
degradation of incorrect/incomplete proteins (Goodsell,
2008). Hsp90 is an interesting and highly viable target
due to its central role in cell signalling and hormone
pathways; it is essential for maintaining the activity of
some 200 proteins, and, crucially, interacts within the
TOR pathway (Jackson, 2013 & Trepel, 2010).
TOR is not only responsible for regulating cellular
processes resulting from nutrient availability, but also
Fig. 2. TOR and its interacting proteins. TOR regulates
Hsf1, which regulates Hsp90. Fpr1 is known to regulate
TOR, with an unknown method of regulating Hsp90
directly.
Fig 3. Diagram of the Raptor incorporated TORC1 (left),
and Rictor incorporated TORC2 (right) molecules (Lieff,
2015)

4. plays a large role in responses to stresses. A reduction in
TOR levels leads to increased sensitivity to heat shock,
which in turn causes malfunctions in proteins
maintaining their optimal shape and activity. Alongside
this, a reduction in TOR is accompanied by a drastic
reduction in cellular ability to synthesise HSPs (Chou,
2012).
HSP transcription itself is regulated by heat shock
transcription factor 1 (Hsf1) (Fig. 4). Hsf1 is a trimeric
heat shock transcription factor, responsible for
regulating the heat-shock response. Hsf1 is a primary
regulators of HSPs: specifically, Hsp90-family
chaperones Hsc82 and Hsp82, and Hsp90. As part of a
negative feedback route, Hsf1 negatively regulates TOR
signalling to prevent overexpression if TOR is the origin
of the upregulation (Medillo et al., 2012).
Hsf1 is regulated by being phosphorylated by TOR
on Serine-326 (S326), one of the major transcriptional
activation residues. This interaction occurs immediately
after heat shock is induced, alongside other stress
responses. If S326 is mutated into an alanine, the cell
loses the ability to activate an Hsf1-regulated
promoter-reporter construct. As such, the TOR-S326
complex has a pivotal role in regulating Hsf1, in turn
regulating the HSPs, as Hsf1 requires TOR protein
kinases to activate. Furthermore, TOR inhibitors, such
as rapamycin, also prevent Hsf1-S326 phosphorylation,
suggesting that TORC1 is involved in Hsf1 regulation
(Medillo et al., 2012).
Inhibition of Hsp90 promotes activation of Hsf1,
which in turn upregulates of other HSPs.
Simultaneously, Hsf1 activation downregulates TORC1
activity and sensitises the cell to rapamycin (Bulman,
2001)).
Fpr1 / FKBP12
Fpr1, in yeast, or FKBP12 as the human orthologue,
is a peptidyl-prolyl cis-trans isomerase, and aids in the
correct folding of proteins. It is also a rapamycin-
binding protein which inhibits TORC1 in the presence
of rapamycin. Fpr1 is part of a group of prolyl
isomerases made up of three structurally unrelated
families: the FKBPs, such as FKBP12, (which are
FK506 binding proteins), the cyclophilins, and the
parvulins (Koltin et al., 1991).
Fpr1 binds rapamycin, and the immunosuppressant
macrolide FK506. Binding to either results in the
inhibition of its peptidyl-prolyl isomerase activity, and is
toxic to yeast. This toxicity is not due to the inhibition -
as Fpr1 null mutants are viable - but rather by the
interactions caused by the binding itself: Fpr1-FK506
complexes bind to the calcineurin A subunit and
negatively regulates calcineurin function; and Fpr1-
rapamycin binds to TOR1 & 2 (Limson, 2010).
A basic summary of Fpr1's features can be found in
Table 1.
When rapamycin is bound to its target in yeast - the
peptidyl-prolyl isomerase Fpr1 - the Fpr1-
rapamycin complex inhibits activity of kinases in
TORC1 complexes. To this extent, inhibition of TORC1
by rapamycin is seemingly dependent on Fpr1.
Furthermore, deletion of the Fpr1 gene also removes the
inhibitory effects of rapamycin. When rapamycin binds
to Fpr1 it competitively releases other proteins which
also interact with Fpr1: Hmo1 and Fap1 (Dolinski,
1999). These are both DNA-binding proteins.
Therefore, rapamycin and Fpr1 interact in a way
which potentially affects transcription and/or repair
mechanisms within the cell, adding to the potential for
rapamycin to knock-out fundamental mechanisms in
cancer (Limson, 2010).
Application in Cancer Treatment
Around 3% of intracellular Hsp90 is located within
cell nuclei (Trepel, 2010), regulating several nuclear
events. One such regulation is of steroid hormone
receptors (SHRs): Hsp90 regulates their location,
stability, ligand binding competencies, and
transcriptional activities. Some SHRs within the nucleus
have been shown to be carcinogenic, making Hsp90 a
promising target for inhibition (Zhao, 2005).
Fig. 4. Summary of Hsf1 activation and DNA interaction
to activate HSPs (Image credit: Åkerfelt, 2010)
Table 1. Summary of Fpr1 features in yeast

5. Due to the number of proteins that Hsp90 chaperones,
some are inevitably involved in either carcino- or onco-
genesis. Interestingly, some of them interact with Hsp90
as a benefit to cancer; such as in the case of Hsp90-BCL-
6 complexes in diffuse large B cell lymphomas (Trepel,
2010); whilst others a detriment, such as with Hsp90-
IRF1 interactions in acute myeloid leukaemia (Choo et
al., 2006 & Trepel, 2010).
In theory, based on these examples and the large
number of proteins that Hsp90 chaperones, there is a
chance that there are more client proteins which have a
key role in cancer, be they beneficial or detrimental. As
such, the versatility of Hsp90 proves it to be a promising
and highly potential target for inhibition to help treat
various cancers. In conjunction, the close interaction of
Hsp90 with TOR, Hsf1, and Fpr1 highlight these
proteins as potential targets as well, with potentially
increased positive results in multi-drugging scenarios.
Materials & Methods
Fpr1 Amplification & Cloning
The genomic sequence for Fpr1 was used to design
the necessary primers (Eurofins Genomics) to transform
the protein-coding sequences into cells. The first 17
bases of both forward and reverse primers corresponded
to yeast primers, designed by Professor Stan Fields
(Fields, 2000), and contained a starting ATG codon to
which 6 codons of Fpr1 sequence were then added.
Primers for a nested PCR were also designed to form the
overhangs between the protein DNA sequence and yeast
vector DNA, to allow for a successful recombination
into the host cells during the transformation.
For use in affinity chromatography, a HIS tag
sequence was included within the forward primer. Nickel
has a high affinity for HIS tags (repeated sequences of
the codon CAT), and was the reasoning behind this. 6
repeats were used here, but longer sequences can be
effective, especially in larger proteins which may contain
folds that obscure the HIS tagged region. Both the
forward and reverse primers featured longer overhang
sequences to combine with the vector, and 7 codons of
Fpr1 were then included in the sequence.
The designed primers were:
Non-HIS Forward:
AATTCCAGCTGACCACCATGTCTGAAGTAATTGAA
GGT
Non-HIS Reverse:
GATCCCCGGGAATTGCCATGTTAGTTGACCTTCAA
CAATTC
Nested Forward:
CTATCTATTCGATGATGAAGATACCCCACCAAACC
CAAAAAAAGAGATCGAATTCCAGCTGACCACCATG
Nested Reverse:
CTTGCGGGGTTTTTCAGTATCTACGATTCATAGA
TCTCTGCAGGTCGACGGATCCCCGGGAATTGCCA
TG
HIS Tag (underlined) Forward:
ACAGAACCAATAGAAAAATAGAATCATTCTGAAA
TATGCATCATCATCATCATCATTCTGAAGTAATT
GAAGGTAAC
HIS Tag Reverse:
CATAAATCATAAGAAATTCGCCCGGAATAAGCTT
GGTTAGTTGACCTTCAACAATTC
An initial polymerase chain reaction (PCR) was used
to extend and amplify the primer sequences with a yeast
genomic DNA template to fully sequence the coded
protein for use in cell transformation. Several iterations
of PCR were performed to attain an optimal primer
melting temperature (Tm) value, as the included
overhangs on the primer sequence lowered the true Tm
value from the provided value. The reaction mixture for
both the PCR and nested PCR can be found in Table 2.
dNTP mix in solution contained dATP, dCTP, dTTP,
dGTP; final concentration of 2 mM (Fermentas, York,
UK) Phusion High Fidelity DNA Polymerase
(Invitrogen, Thermo Fisher Scientific, UK). The
parameters used in the PCR can be found in Table 3.
Following this PCR, gel electrophoresis was used to
positively identify the presence of a correct sequence.
Formed bands within the gel were then extracted and
mixed in 15µl dH2O for use as the DNA template in the
subsequent nested PCR. The parameters used in the
nested PCR can be found in Table 4.
The gel electrophoresis was a 1% agarose gel,
containing: agarose (Bioline Ltd., UK); dissolved in 1x
Tris-acetate (TAE) buffer (0.04 M Tris-acetate; 1 mM
EDTA, pH 8.0); with 1.5µl of SYBR Safe (Invitrogen,
Thermo Fisher Scientific, UK) added for visualisation.
Linearised Vector Formation
The vectors to be combined with the relevant DNA
sequences (FPR1, HSF1 and HSP90) were pADC
Table 2. PCR and nested PCR reaction mixture

6. ('prey', containing a leucine auxotrophic marker) and
pBDC ('bait', containing a tryptophan auxotrophic
marker). Both contained a Lac Z operon to allow for
later observations in ß-galactosidase activity. These
vectors were chemically transformed into competent E.
coli (BL21 DE3): 50µl of E. coli were mixed with 0.5µl
of vector and heat shocked; 10 minutes on ice, 1 minute
at 42°C, and returned to ice for 5 minutes; 500µl of SOC
was then added and the mixture incubated at 37°C for 90
minutes. After incubation, the mixtures were centrifuged
at 3,000xg for 30 seconds and 400µl of the resultant
supernatant removed. The remaining 100µl E. coli
mixture was then pour plated onto LB-Ampicillin agar
(See agar setup section, below) and incubated at 37°C
overnight. Individual colonies were then transferred to
solutions containing 10ml LB and 20µl ampicillin,
which was incubated further overnight at 37°C.
Following this incubation, pure vector DNA was
extracted using QiaPrep™ Spin Miniprep Kit and
procedure (QiaGen, UK).
Once the pure vectors had been obtained, the DNA
was cut using restriction enzymes in the following 50µl
volume setup: 26µl of dH2O; 10x Restriction Buffer;
10µl of vector DNA (2 separate setups - 1 for pADC and
1 for pBDC); 2µl of Pvu II; and 2µl of NCO I (New
England Biolabs, UK).
This mixture was gently mixed by inverting and then
incubated at 37°C overnight to form linearised vectors.
Yeast Transformation
The yeast strains used for the transformations were
PJ69-4a and PJ69-4α, to be transformed with pADC and
pBDC, respectively. Prior to the transformations, the
yeast cells were cultured and diluted in YPD for 3 hours
to ensure that they were in the log growth phase.
2 sets of transformations were made for each strain:
PJ69-4a:
Control - 5µl of pADC vector
Fpr1 “DNA Mix” - 10µl of nested PCR product + 5µl of
pAD vector
PJ69-4α:
Control - 5µl of pBDC vector
Fpr1 “DNA Mix” - 10µl of nested PCR product + 5µl of
pBD vector
For the transformation, the cultures were centrifuged
at 3,000xg for 5 minutes, and washed twice in ~5ml
dH2O. The pellets were resuspended in 20ml of dH2O
and centrifuged for a further 5 minutes at 3,000xg,
before being resuspended in 1ml dH2O. 1.5ml of
solution (≥500µl from wet cell volume) was transferred
to microfuge tube and centrifuged at 3,000xg for 15
seconds. 1ml of 100mM Lithium Acetate (LiAc) was
added, and cells resuspended. The cells were then left to
incubate at room temperature for 30 minutes, before
aliquoting between eppendorfs (aliquots were dependent
on how many transformation plates were required—i.e.
2 plates would use 500µl, etc.). These were centrifuged
at 3,000xg for 30 seconds, and the LiAc poured off. The
following were then added and vortexed until a
homogenous solution formed: 240µl 50% PEG, 50µl
1M LiAc, 50µl ssDNA from salmon sperm, and the
“DNA Mix”. The mixtures were then left to incubate at
room temperature for 20 mins, before being centrifuged
at 8,000xg for 1 minute. The supernatant was then
poured off, and the pellets resuspended in 200µl of
water, ready for spread plating.
Following this procedure, the PJ69-4a and PJ69-4α
samples were spread onto –Leucine (–Leu) and
–Tryptophan (–Trp) agar respectively, and incubated for
3 days at 28°C.
Yeast PCR
To check if the transformation of the plasmids were
successful, individual colonies were taken from each
plate containing the Fpr1 sequence and transferred to a
PCR tube, before being lysed via bead beating in dH2O,
or alternatively in a microwave for 2 minutes in the
presence of water to act as a microwave sink. To each
PCR tube containing the cells, a reaction master mix
(totalling 25µl per PCR tube used) was added, which
included: dH2O; HF 5x Phusion Buffer; dNTPs; forward
and reverse nested PCR primers; and Phusion HF DNA
polymerase. The PCR parameters used for this PCR can
be found in Table 4.
Table 3. Initial PCR parameters Table 4. Nested PCR and Yeast PCR parameters

7. HIS-Tagged Sequences
For stages involving HIS-tagged protein (See Protein
Extraction and Purification, below), the PCR stages
followed the same procedure as the nested PCR to create
non-HIS-tagged sequences. Due to not requiring ß-
galactosidase to provide information, pADC/BDC were
vectors were not used. The vector used instead was
HSC, and was cloned into the yeast strain PP30.
Cell Growth
Due to the auxotrophic markers within the vectors
pADC and pBDC, each vector can be grown on
Synthetically Designed Complete (SDC) media minus
Leucine (-Leu) and Tryptophan (-Trp) respectively. This
allows for the identification of whether the
transformation of the vectors into the PJ69-4 strains
were successful or not. The resultant hybrids could be
positively identified by observing growth/amount of
growth on their selective agar.
The HSC vector, used in HIS-tagged transformations,
is capable of growing on -Leu media, and serves for the
same selection purpose.
Media Used
The following media were those used at various
stages throughout the growth cells. Total volume of
water added as per the requirement of media varied
throughout. If the media required was agar, 2% agar was
added.
YPD: 1% Peptone; 1% Yeast Extract; 2% D-
Glucose
-Leu: Yeast Nitrogen base minus amino acids,
6.9g/L; complete amino acid supplement -Trp, -Leu,
640mg/L; Tryptophan, 250mg/L; 2% D-Glucose
-Trp: Yeast Nitrogen base minus amino acids,
6.9g/L; complete amino acid supplement -Trp, 740mg/
L; 2% D-Glucose
-LTHA (Agar only): Yeast Nitrogen base minus
amino acids, 6.9g/L; complete amino acid supplement –
Trp –Leu –His –A; 2% D-glucose
-LTH + 4mM 3AT: Yeast Nitrogen base minus
amino acids, 6.9g/L; complete amino acid supplement
–Trp –Leu –His –Ade, Adenine, 50mg/L; 2% D-
glucose; 500mM 3AT, 8ml/L
D-Glucose from Thermo Fisher Scientific Inc., UK.
Yeast nitrogen bases and complete supplements from
Formedium™, UK
Agar from Melford Biolaboratories, UK.
All media were autoclaved after the solution pH was
made to 6.5 to dissolve. If agar, media was pour plated
under aseptic conditions before being stored at 2°C until
required for use.
Protein Extraction and Purification
Colonies expressing HIS-tagged protein were
inoculated in 500ml of YPD media at 28°C overnight in
a shaking incubator at 180rpm. The cultures were
pelleted at 10,000xg for 10 minutes, then washed and
resuspended in 10ml of dH2O, and transferred to a 50ml
Falcon tube. The cells were further pelleted at 5,000xg
for 5 minutes and resuspended in twice the wet cell
volume of bead beater buffer (1 PBS tablet + Pierce™
EDTA-Free Protease Inhibitor Tablet (Thermo Fisher
Scientific, UK)).
The solution was transferred to 1ml eppendorfs, with
unwashed glass beads added, and the solutions bead
beaten for 90s. The mixtures were then centrifuged at
13,000xg for 2 minutes, and the lysates from each
sample collated in one universal tube.
The lysate mixture was roughly diluted to ~20ml
with 20mM Imidazole in PBST, and a Nickel-column
fast performance liquid chromatography (FPLC) was
performed, washing through with 3 gradient
concentrations of 500mM against 25mM Imidazole: 0%,
25%, and 75%.
Once these fractions were collected, they were loaded
and run through SDS-PAGE with a product to dye ratio
of 2:1. Once run, the SDS gels (see Table 5 for
compositions) were transferred in 1x transfer buffer
(buffer from 10x stock solution: 36.25g glycine, 72.5g
Tris base, 4.625g SDS pellets, 1L dH2O) onto
nitrocellulose membrane, with a HIS-antibody stain and
follow-up Western Blot performed through the
following procedure:
The membrane was submerged in Ponceau red
staining solution (Sigma-Aldrich, UK) for ~10 seconds,
and rinsed with water. Excess membrane not containing
the gel silhouette was cut away. PBST was then made,
volume dependent on number of blots required (~200ml
per membrane) by adding 1 PBS tablet (Melford
Biolaboratories, UK) per 100ml of H2O + 0-1% Tween.
50ml of Blocking Buffer (BB) was then made by adding
2.5g Bovine Serum Albumin (BSA) (Sigma-Aldrich,
UK) to 50ml of PBST for each membrane (i.e. 2
membranes required 100ml BB). Each membrane was
washed in ~15ml of BB for 1 hour, before pouring off
BB. 15ml BB was added to each membrane + 3.75μl
Anti-HIS antibody (1:4000 dilution) for 30-60 minutes.
The membrane was then washed for 5 minutes, at least 5
times in ~15ml PBST. Another 15ml BB was then added
+ 3.75μl Mouse antibody (1:4000 dilution) for double
the length of time Anti-HIS antibody was applied. The

8. membrane was washed again in the same way
previously. Excess PBST was then drained from the
membrane and dab-dried. Amersham™ ECL™ (GE
Healthcare Life Sciences, UK) solution (composed of
300µl solution A & B) was then gently applied to cover
the membrane. The image was then developed onto X-
ray paper (Thermo Fisher Scientific, UK).
Yeast 2-Hybrids
Once transformations were shown to be successful,
either by yeast PCR or significant enough difference
between control and transformation agar plates, the baits
and preys were mated to recombine the vectors,
allowing the Lac Z reporter gene to activate in the
presence of ß-galactosidase. The greater the strength of
the interaction between bait and prey proteins, the
greater the reporter signal.
Mating involved streak plating colonies from the
transformation plates onto their required media (note
that colonies on the transformation plate itself can be
used—in this instance a streak was taken to allow for
repeated matings). Once grown, colonies from bait and
prey plates were mixed in individual eppendorf tubes
containing 400µl of YPD media, and thoroughly
resuspended to mix. The mates were then incubated at
28°C overnight, and streak plated onto complete
supplement agar with tryptophan and leucine dropouts
(SDC-LT), and incubated at 28°C for a further night. If
recombination occurred, the combined auxotrophic
markers would allow for effective growth. The mating
combinations of baits and preys can be found in Table 6.
When successfully mated, the hybrids were screened
across a variety of conditions, including heat shock and
drugged environments. Initially, single colonies were
grown at 28°C overnight in 20ml SDC-LT media, before
Table 6. Yeast 2-hybrid bait and prey mating combinations. AD-Hsp90 was not created, therefore BD-Hsf1 and BD-Fpr1 were
mated without.
being diluted typically 1:3 for 2-3 hours to return them
to logarithmic growth phase (if less/more cells appeared
to be present, the dilutions were lowered/increased
respectively). Following dilution, the conditions to treat
the cells with were applied. These included: control
temperature of 26°C incubation, heat shock conditions
of 39°C water bath incubation, and the addition of
Rapamycin (Melford Biolaboratories, UK) at varying
concentrations (from 1mM stock solution). All
treatments lasted for 90 minutes, and were allowed to
return to roughly room temperature before continuing.
After treatment, the cells were pelleted at 5,000xg for 5
minutes. Pellets were then resuspended in 1ml dH2O and
transferred to 1.5ml screw-top microfuge tubes, and
washed, pouring off the water.
1ml of Z Buffer (Miller Buffer, 2-mercaptoethanol
(2.7nM), and ONPG (30mM) (Sigma-Aldrich, UK)) was
then added to each tube , followed by unwashed glass
beads (roughly 1:1 with wet cell volume). The samples
were then homogenised over a period of 90 seconds via
bead beating.
The samples were then observed for colour change to
yellow. When that point was reached, the time was
noted, and the reaction was stopped using 200mM
CaCO3 solution.
The samples were then shaken to ensure cell debris
was evenly suspended in solution, and 4x100µl of each
sample was pipetted into one lane of a 96-Well plate
(Sarstedt AG & Co., DE). Each plate used was limited
to only one bait under one condition at a time, both due
to quantity of samples and to avoid confusion. Once
each lane contained 4 rows of samples of cell debris, the
microfuge tubes were centrifuged at 8,000xg for 1
minute. The remaining lysates were pipetted in the next
4 rows of each lane (See Fig. 5 for visual representation
of setup).
The plates were then vortexed at 800rpm to ensure
the cell-debris wells were not settled at the bottom,
followed by photo spectrometry readings being taken of
each plate at 420nm and 595nm. The readings were then
used to calculate the ß-galactosidase intensity in Miller
Units (MU), using the following equation:
Table 5. SDS Gel compositions to create 2 gels

9. Drug Assays
Drug assays were conducted on several mutated yeast
strains to check for regrowth and inhibition to use as
comparisons against the yeast 2-hybrid results, to
potentially further identify how interactions are affected.
The strains used in assays were: unmodified strain
(wild type), ΔTOR1, ΔFPR1, rapamycin resistant TOR1
(T1.1), rapamycin resistant TOR2 (T2.1), and rapamycin
resistant TOR2 with TOR1 delete (ΔT1 T2.1).
Single colonies were grown at 28°C overnight in
20ml YPD media, before being diluted 1:100 for 2-3
hours to return them to logarithmic growth phase
(dilutions were lowered/increased as per amount of cells
grown). 200µl of each strain were pipetted into the first
lane well of a 96-well plate, followed by addition of
either 10nM Rapamycin or 100mM sodium molybdate
(a Hsp90 inhibitor) (Sigma-Aldrich, UK).
The samples were then serial diluted 10 times down
to 1:1,000, with a control well containing undiluted and
non-drugged cells. The plates were then incubated at 28°
C for 3 days. Following incubation, the plates were
vortexed and read at 595nm. To calculate % regrowth of
cells over the growth period, the following equation was
used:
Where X were diluted samples (lanes 1-11), and C were
control samples. Subtracting 0.08 negates the
interference from the growth media. % inhibition was
calculated by subtracting % regrowth from 100.
Results
Fpr1 PCR & Transformations
A 2-step nested PCR was required to synthesise the
necessary DNA sequence that would both allow for the
transcription of Fpr1 (and Hsf1, also being developed
in a project alongside by Maddiah Mazahr), and also be
successfully integrated into the yeast vector. The first
step was constructing the Fpr1 coding sequence onto
yeast genomic DNA, whilst the second was attaching
overhanging codons to the end of the Fpr1-DNA
sequence, which complemented to the exposed ends of
a restricted yeast vector (either AD-preys or BD-baits)
during the yeast transformations.
Both steps utilised different primers to achieve the
correct sequences, which therefore required different
thermocycler setups to optimise the PCR reaction. The
optimal setups were eventually found, and are shown in
Table 2 and 3 in methods. The results of the step 1 and
step 2 PCRs can be found in Fig. 6 (A & B
respectively).
The yeast transformations required the DNA
sequences to include overhanging codons to
complement and recombine with the ends of pADC and
pBDC vector DNA, linearised via restriction digest. A
gel electrophoresis followed to identify if the vector
DNA was the correct size and a suitable quantity to be
transformed (Fig. 6C).
Despite a high concentration of DNA, only the
subsequent transformation into PJ694-α yeast strains
was presumed successful, as the colony numbers across
each transformation suggested success (Table 7), with
no growth from the PJ694-a cells. Despite this success,
the low vector acceptance into cells also resulted in the
PJ694-α cells not actually containing the Hsf1 and Fpr1
plasmids, as seen in the yeast PCR gel image in Fig. 8.
The nested PCR was repeated (Fig. 7A) with 6 samples
to increase the chances of a successful reaction and
second transformation. The outcome of this repeat led
to successfully transformed Fpr1 preys, but not baits, as
indicated by a colony count (Table 8), which was
unsurprising given the low concentration of DNA
present. Due to time constraints, not having a bait for
Fpr1 was deemed acceptable at this time, and that yeast
2-hybrid work would be prioritised.
Throughout work on the yeast 2-hybrids, the nested
PCR was repeated with 4 samples – 2 using PCR DNA
Fig. 5. 96-well plate setup to perform the yeast 2-hybrid
screens. Each lane contained a total of 8 samples (4 debris,
4 lysate) of mated hybrids (i.e. BD-Hsf1 + AD-Fpr1, etc.)
Table 7. Colony counts of initial, unsuccessful transformation
Where L is Lysates, D is the cell Debris samples, and
Time is time taken for colour change in minutes. If
values were <0.045, 0.04 was substituted.

10. and 2 using gel extraction as DNA templates – to
attempt more transformations, as the results for the
screenings suggested that Fpr1 was involved in some
interactions, and therefore a bait was required. The
result of this PCR was significantly more positive than
previous attempts (Fig. 7B), and 3 transformations were
Fig. 6. Nested PCR gel electrophoresis images of Fpr1 and restriction digest of yeast DNA vectors. A) First stage PCR, a
clear band between 200-400bp reference markers is present, showing clear presence of the Fpr1 DNA sequence. B) Sec-
ond stage PCR, a clear and high concentration band is present between 400-600bp reference markers, showing the over-
hang codons successfully integrated into the Fpr1 DNA sequence. C) Restriction digest electrophoresis shows clear bands
at ~10kbp, confirming the vector DNA is present and at appropriate size.
A B C
A B
Fig. 7. Second rounds of the nested PCRs. A) Multiple, low concentration bands of Fpr1 formed, later being transformed
and unsuccessfully accepted into the cell, as shown by the yeast PCR (Fig. 3). B) 4 PCR products, 2 utilising DNA ex-
tracted from the gel of previous round of PCR (E1 and E2), and 2 using the previous round PCR product itself (P1 and
P2). P1 and P2 were used in a successful transformation as they showed the clearest and highest concentration of Fpr1
DNA.
Fig. 8. Gel image of the yeast PCR of cells transformed with Fpr1 and Hsf1 DNA, both pADC and pBDC. No samples
showed positive, with only dimer primers forming for every sample. Whilst some appear between 200-400bp, the amount
of smearing indicated a negative result.
Table 8. Colony counts of successful transformation for all
but BD-Fpr1 cells

11. performed to provide the best possible chance of
successful bait transformation.
Yeast 2-Hybrids
As Hsf1 and Hsp90 baits had been successfully
transformed, yeast 2-hybrids were mated from these
using Fpr1 in prey only form until a bait was
successfully created, whilst troubleshooting the
transformations to aim for positive Fpr1 baits. The full
list of mates used in this yeast 2-hybrid can be found in
Table 4.
Numerous sets of yeast 2-hybrid screens were
designed: the first were designed to identify interactions,
if any, between BD-Hsp90 & BD-Hsf1 baits and the AD
-prey proteins mated with them (Fig. 9). This screen
showed that the recombination had been successful, and
the screens could now involve varying conditions to
observe the effect on interactions. The second set of
screens involved control and heat shock temperatures
(26°C and 39°C respectively), and rapamycin at a
100nM concentration to check the intensity of ß-
galactosidase activity between the interacting proteins
(Fig. 10).
Initial Interactions
As CDC37 and SHE4 are previously identified
interactors of Hsp90 (Millson et al., 2014), it was
unsurprising that both interacted under both control and
heat shock conditions, with CDC37 showing
considerable interaction at ~25 and ~11 MU
respectively.
With the remaining unknown interactors, Hsf1
showed some interaction under control conditions (~7
MU), but increased considerably under heat shock
conditions (16 MU). This result further supports the
initial theory that Hsf1 is an important regulator of
Hsp90 within the heat shock response. As it is thought
that TOR directly phosphorylates Hsf1, the decreased
interaction in the presence of rapamycin supports this.
TOR1 showed good interaction under control conditions
(14 MU), with a slight increase under heat shock
conditions (17 MU), suggesting a slight role of TOR1
impacting Hsp90 during the heat shock response. TOR2
showed a considerable increase between control and
heat shock conditions of ~16 MU, suggesting that there
is a far more direct interaction with Hsp90 compared to
TOR2. Fpr1 showed good interaction, with a slight
decrease under heat shock conditions. As the nature of
the interaction between Hsp90 and Fpr1 is currently
unknown, this only suggests a different pathway for
Fpr1 during heat shock.
Hsf1 interacted with both TOR1 and TOR2, which
increased slightly between the control and heat shock
conditions. An interaction was also seen with Fpr1,
which behaved similarly to TOR in that there was a
slight increase in interaction strength between control
and heat shock conditions. Some small galactosidase
activity was seen with SHE4, but to no significant level
to be suggestive of any relevant or notable interactions.
CDC37 had, by far, the most intense interaction at ~35
MU. As the increase was so slight between control and
heat shock conditions, it suggests CDC37 consistently
interacts, but to no extent as part of a heat shock
response interaction with Hsf1. Interestingly, the
control (empty vector) protein had stronger interactions
with Hsf1 than SHE4, suggesting self-activation of
Hsf1 and its binding partners was occurring.
These screens consistently showed the expected
decrease in all interactions in both BD-Hsp90 and BD-
Hsf1 in the presence of rapamycin, as supported by the
current theory that both Hsp90 and Hsf1 rely on TOR
activity.
Rapamycin Interactions
Given the drop in interactions were considerable
across all samples, the following screen involved
concentrations of rapamycin samples 4 times greater
and weaker than the previous screen, 400nM and 25nM
respectively, as well as a control of no rapamycin. 26°C
was the constant temperature, with no heat shock
occurring. 400nM rapamycin is concentrated enough to
be toxic to the cells, making the far weaker 25nM the
concentration of interest.
The results (Fig. 11) showed a considerable increase
of Hsf1 interaction at 25nM, over twice that of no
rapamycin. Simultaneously, TOR1 interactions with
Hsf1 are considerably lower in the presence of
rapamycin. This provides a problem with the current
Fig. 9. Initial yeast 2-hybrid screen to ensure that
recombination was successful and interactions were taking
place between BD– Hsp90 and Hsf1 and the AD-Interactor
proteins. AD-Hsp90 was not available, hence BD-Hsf1 was
tested only against AD-Hsf1.

12. A B
Fig. 10. Yeast 2-hybrid screens of BD- Hsp90 (A) and Hsf1 (B) under various conditions: 26°C (control), 39°C (heat shock),
and 100mM Rapamycin at 26°C. Interactions fell considerably in the rapamycin samples, prompting a repeat using varying
concentrations.
A B
Fig. 11. Yeast 2-hybrid screens of BD– Hsp90 (A) and Hsf1 (B) under varying concentrations of rapamycin at 26°C. Unlike
the previous screens, rapamycin levels affect in various ways as opposed to simply stopping most interactions. The spike at
25nM rapamycin in BD-Hsp90 vs AD-Hsf1, the constant interaction strength of BD-Hsp90 vs AD-Fpr1, and the increase in
activity with no rapamycin in BD-Hsf1 vs AD-TOR1, led to the speculation of an alternate pathway than initially thought.
400nM rapamycin samples showed unexpectedly high activity in most samples, suggesting artifacting due to too great a
concentration. BD-Hsf1 vs AD-Control remains unusually high in activity.
A B
Fig. 12. Yeast 2-hybrid screens of BD– Hsp90 (A) and Hsf1 (B) under varying concentrations of rapamycin at 26°C. 100nM
rapamycin was reintroduced to provide a theoretically smoother curve of ß-galactosidase activity. This smooth increase did
occur between BD-Hsp90 vs Fpr1, which also had the highest activity even at 400nM rapamycin (>3 MU). BD-Hsf1 vs Fpr1
also show an interesting increase in activity, but only at 25nM rapamycin, before activity drops and appears to climb steadily
again. BD-Hsf1 vs Control again shows activity.

13. Fpr1 baits were eventually successfully created, and
mated with all of the preys used in the initial yeast 2-
hybrids. The Fpr1 mates were also grown with the
same Hsp90 and Hsf1 mates as the most recent screen
(Fig. 12 setup), so that the Fpr1 interactions, if any,
would be in line with those of the other baits and show
consistent results.
The setup involved Rapamycin combined with the
mates in 0nM, 25nM, 100nM, and 400nM
concentrations. In addition, a set of control and heat
shock environments were included (26°C and 39°C
respectively). Both temperature conditions would
provide information on the interactions of BD-Fpr1, as
well as indicating any changes in interactions with BD-
HSP90/Hsf1 in the presence of varying Rapamycin
concentrations. After screening, all results showed
uncharacteristic spikes at 400nM, potentially due to
artifacting occurring as a result of such a high
concentration. As such, all 400nM readings were
excluded from the results.
The results for Hsp90 (Fig. 13) showed results
similarly consistent to previous screens, especially with
Fpr1 at 39°C, where interactions showed no
considerable change. The largest notable result from
this screen was with AD-Hsf1 under 26°C, where a
considerable increase in interaction occurred at 100nM
(MU increase 4-fold). Interestingly, this increase
mimics that of what was seen in the previous heat
shock screen (Fig. 10), but where there was no
rapamycin present. A similar, yet not as large, increase
in interaction also occurred with AD-TOR1 at 25nM
Rapamycin in 39°C., also similar to the previous heat
shock screen. Under heat shock conditions, AD-Control
showed more increased interactions than before.
The results for Hsf1 (Fig. 14) showed more of note
than the BD-Hsp90 screen, and also supported previous
results. At 26°C, an increase in concentration of
Rapamycin causes a decrease in interaction between all
AD-interactors—most notably AD-TOR1. At 39°C,
there is a considerably strong interaction between BD-
Hsf1 and AD-TOR1 when no Rapamycin is present—a
far greater interaction than any other protein at this
temperature. This interaction dramatically decreases
(dropping 3 MU) when rapamycin is introduced at
25nM, with a slight increase at 100nM, but not as
greatly as the 0nM peak. Interestingly, this spike
mimics the interactions seen previously, but under 26°
C conditions. Interactions with AD-Fpr1 increase
between 0nM and 25nM rapamycin, but then decrease
as the concentration reaches 100nM. This is similar to
the screen seen in Fig. 12, but to a lesser extent,
showing slight consistency. Unlike all previous screens,
interactions with AD-Control are low and do not
change.
theorised pathway (Fig. 2), where TOR1 activates Hsf1,
which in turn activates Hsp90. Instead, a down-
regulation of Hsf1 by TOR1 suggests an up-regulation
of Hsp90 by Hsf1. Conversely, TOR2 maintained
consistent interactions with Hsp90, with no notable
increases, in respect to decreasing rapamycin strengths,
with Hsf1. Fpr1, however, showed a surprisingly
consistently high level of interaction with Hsp90 (~5
MU), with rapamycin concentrations displaying no
effect. Fpr1 interactions increase slightly with Hsf1 in
respect to decreasing rapamycin, but to a similar effect
as TOR2. Fpr1 is a rapamycin binding partner, which is
supported by the previous hybrid screen and the Hsf1
interaction here. However, the consistent level of
interaction with Hsp90, and the large increase of
interaction between Hsp90 and Hsf1 at 25nM, suggests
Fpr1 is somewhere involved. As such, focus shifted at
this point to successfully transforming BD-Fpr1 cells, as
well as testing the effect of rapamycin on the
interactions of BD-Hsp90, AD– Hsf1, Fpr1 & TOR1,
and BD-Hsf1, AD– TOR1 and Fpr1. AD– SHE4,
CDC37, and TOR2 were ignored due to the former 2
having known interactions, and the latter showing
consistent from all screens so far.
These screens were conducted for two reasons: to
once again identify the interactions, but also to try and
provide some clarity on the so-far very different results.
As such, 100nM rapamycin was reintroduced as a
sample type, along with 0, 25 and 400nM. Again, no
heat shock was implemented at this stage.
The screens (Fig. 12) showed some increase in
interaction between Hsp90 and Hsf1 at high levels of
rapamycin, whilst TOR1 interactions—as expected and
as seen consistently so far—decreased in the presence of
rapamycin, dropping to ~2MU in both Hsp90 and Hsf1
baits. As before, BD-Hsf1 and the control showed
greater interaction than some of the other preys.
Interestingly, Fpr1 showed increasing interactions with
BD-Hsp90 as rapamycin concentration increased to
400nM, at which point the interaction falls considerably.
Against BD-Hsf1, interaction spiked in 25nM
rapamycin to nearly triple the other concentrations.
The interactions seen by Fpr1 not only pressed the
issue of obtaining Fpr1 baits, but also raised questions
due to the unexpected reporter activity. As rapamycin
levels increase, and Fpr1 subsequently binds it, its
removal is suggested from any active pathways.
However, these results showed the direct opposite with
the Hsp90 bait, and a considerable opposite at 25nM
with the Hsf1 bait. We therefore posited that, whilst
Fpr1 does bind to rapamycin, there must be a second
binding site to allow the continued interactions with the
bait proteins.
Rapamycin, Heat Shock, and Fpr1

14. A B
A B
A B
Fig. 13. Yeast 2-hybrid screens of BD-Hsp90 in the presence of various rapamycin concentrations under 26°C non-heat shock
(A) and 39°C heat shock (B) conditions. A great interaction is shown between Hsp90 and Hsf1 at 26°C 100nM, whilst TOR1
shows a spike of interaction at 39°C 25nM.
Fig. 14. Yeast 2-hybrid screens of BD-Hsf1 in the presence of various rapamycin concentrations under 26°C non-heat shock
(A) and 39°C heat shock (B) conditions. Interaction with TOR1 decreases as rapamycin concentration increases at 26°C,
whilst a spike in interaction is seen with TOR1 at 39°C. Fpr1 interactivity decreases with rapamycin at 26°C, but conversely
increases at 39°C. As before, interaction is seen with the Control at 26°C, but not at 39°C as before.
Fig. 15. Yeast 2-hybrid screens of BD-Fpr1 in the presence of various rapamycin concentrations under 26°C non-heat shock
(A) and 39°C heat shock (B) conditions. Interactions between TOR1 and Fpr1 at 26°C effectively exchange between 0nM and
25nM rapamycin, the most notable feature of which is that Fpr1 interacts greatly with itself when it cannot bind to rapamycin.
At 39°C, interaction with TOR1 is at its greatest, before considerably dropping at 25nM rapamycin. Interestingly, Fpr1 no
longer interacts with itself, even in the presence of no rapamycin.

15. the 3 day samples.
The outcomes (Fig. 16) confirmed the main
suspicion that BD-Hsf1 was self activating: all 3AT
samples (Fig. 16I) showed effective growth, to almost
the same extent as –LT (Fig. 16C). AD– TOR2 and
Fpr1 were the only exceptions, although growth was
still notable. –LTHA plates (fig. 16F) however
displayed little to no growth, showing that the
recombination had still worked and was preventing the
cells from producing their own histidine/adenine, and
preventing growth.
Similarly, BD-Fpr1 showed strong self activation
with the control on the 3AT plates (Fig. 16G), as well
as a small amount with AD-TOR1. Interestingly,
growth of the control on the –LT plates (Fig. 16A) was
notably poorer than the other AD-interactors, with
TOR1 having not grown much better. Negligible
growth was seen across all mates on the –LTHA plate
(Fig. 16D).
The Hsp90 baits displayed almost all expected
results, with good growth on –LT (Fig. 16B), less
growth on –LTHA (Fig. 16E), showing good promoter
inhibition, and very little growth on the 3AT plates
(Fig. 16H), showing little to no self activation. The
only exception was AD-Fpr1, which grew quite
effectively on the –LTHA plate, but not to the same
extent as most of the BD-Hsf1 samples.
Drug Assays
No discernible information was found with the drug
assays. This was primarily due to continuous
contamination of the plates used to grow the cells in
both agar and assay forms.
Western Blots
The western blots of HIS-tagged Fpr1 varied
somewhat in their success. Interestingly, purified
protein from FPLC run through SDS-PAGE
continuously resulted in negative blots where no bands
formed. Lysing the cells directly and running the
resulting lysate directly through SDS-PAGE showed
the bands, however not within the region of 12kDa.
This was presumed to be the case as no anti-Fpr1
antibody has been commercially developed, therefore a
successful blot relied on very efficient binding of the
anti-HIS antibodies. Peer troubleshooting speculated
that these antibodies had degraded.
Discussion
Rapamycin Interference
The results for BD-Fpr1 (Fig. 15) include the most
notable interactions, despite no previous screens to draw
from. At 26°C, interactions between AD– Hsf1, CDC37,
SHE4, and Control all decrease as rapamycin
concentration increases. The interactions with Hsf1 and
Control are similar in intensity, suggesting some self
activation with the empty control vector similar to BD-
Hsf1 previously, which was tested with selective media
plates (Fig. 16). Interaction with AD-TOR2 increases
slightly at 25nM from 0nM, before dropping to the same
level at 100nM, showing some influence by rapamycin.
The most notable of interactions occur between AD-
TOR1 and AD-Fpr1, however. At 0nM, interaction with
TOR1 is second highest at 1 MU, whilst Fpr1 spikes to
~2 MU. At 25nM, these intensities switch, with TOR1
dramatically spiking to ~2 MU, and Fpr1 dropping to 1
MU. Both interactions further drop at 100nM to 0.5 MU.
At 39°C, interactions with AD– CDC37 and SHE4
drop as rapamycin concentration increased. As before,
interactions with AD– Hsf1 and Control are similar,
both of which drop greatly between 0nM and 25nM,
before rising slightly at 100nM. Interaction with AD-
Fpr1 remained consistently low. Once again however,
the greatest interaction occurs with AD-TOR1, which is
considerable at 4.5 MU at 0nM, before dropping off
greatly to <1 MU at 25nM, followed by a slight increase
at 100nM. Unexpectedly, AD-TOR2 also shows good
interaction, reflected by the second highest ß-
galactosidase activity at 2 MU at 0nM rapamycin. This
significantly drops at 25nM, but interestingly does not
rise again at 100nM as AD– Hsf1, TOR1, and Fpr1 did.
Selective Media Plates
As BD-Hsf1 and AD-Control consistently showed ß-
galactosidase activity greater than some other AD-
interactors, in addition to results varying greatly
between screens of the other yeast 2-hybrids, selective
agar was used to check for self activation and growth
promotion. These were tested using –LTH + 4nM 3-
Amino-1,2,4-triazole (abbreviated here to 3AT) plates,
and –Leu –Trp –His –Ade (–LTHA) plates respectively.
If self activation was occurring, 3AT would not
competitively inhibit the cells and they would grow
effectively, with similar principles applying to the –
LTHA plates, but relying on the relevant ORFs in the
yeast DNA. –Leu –Trp (–LT) plates were also used to
act as controls, as the yeast 2-hybrids had already shown
they could grow reliably due to continuous streak plates
being created to maintain cell health. Cells were grown
on the media over 3 days and observed. Note that 3AT
has an effective time of 3-11 days, so cells were
returned to incubation following this observation,
however no noteworthy differences occurred in this
time. As such, images and the following analysis refer to

16. A B
C D
E F
Fig. 16. Selective media plates after 3 days of growth. Plate setups were:
SDC–LT with Fpr1 (A), Hsp90 (B), and Hsf1 (C) hybrids;
SDC–LTHA with Fpr1 (D), Hsp90 (E), and Hsf1 (F) hybrids;
SDC–TLH + 4nM 3AT with Fpr1 (G), Hsp90 (H), and Hsf1 (I) hybrids.
All –LT plates grew effectively. BD-Hsp90 v AD-Fpr1 displayed quite effective growth on –LTHA agar, whilst all other
samples did not. Very little growth was seen with any Hsf1 bait on this agar. Hsp90 baits also did not grow effectively on –TLH
+ 4nM 3AT agar.
G H
I

17. and non-heat shock conditions respectively. However,
this was not replicated during the successive screens
and was removed from the list of interactors to be
tested. Interestingly, BD-Hsp90 interaction with AD-
Fpr1 was higher at 26°C compared to 39°C, whilst BD-
Hsf1 interaction was lower, indicating a greater
interaction with the latter during heat shock. However,
this indication was not supported in the BD-Fpr1
screen, with very little change occurring between low
and high temperature. In light of 100nM rapamycin
behaving as expected and reducing all interactions, the
notable difference in these screens was the extreme at
which the drop occurred—in all follow up screens, the
difference was rarely greater than 50%.
Several screens (Fig. 10, 11 & 12) indicated that
Hsp90 and TOR1 interacted in the presence of no
rapamycin, with interactions decreasing as
concentration of rapamycin increased. Further screens
also continued to show a strong interaction between
Hsp90 and Hsf1 in the presence of rapamycin at 25 and
100nM concentrations, whilst Hsf1 and TOR1
interaction decreased in the presence of rapamycin
(Fig. 14). This suggested that TOR1 interacts with Hsf1
to some extent regardless of heat shock conditions
when no rapamycin is present, and can no longer do so
in the opposite circumstance. Meanwhile, Hsf1 begins
to interact with Hsp90 as access to TOR1 is decreased
as a result of the rapamycin. The latter set of screens
(Fig. 13 & 14) further supported both of these
observations, where high interaction was seen between
Hsf1 and TOR1, and a considerable rise in interaction
between Hsp90 and Hsf1 occurs at 100nM rapamycin.
Whilst it became clear that rapamycin resulted in Hsf1
relocating to Hsp90, the mechanism of action remains
unclear.
Whilst it is unknown if the interaction between Hsf1
and TOR1 under these conditions is causing a
regulatory phosphorylation, which is known to take
place under heat shock (Mendillo, 2012), the stress
induced by rapamycin and the movement of Hsf1 to
Hsp90 is suggestive that this is the case in line with
published evidence.
Prior to obtaining the Fpr1 baits, an interaction that
proved interesting was between BD-Hsp90 and AD-
Fpr1 in the presence of rapamycin: two screens (Fig. 11
& 12) showed different results, the former showing no
change at all and the latter showing a steady increase as
rapamycin increased, but always at a consistently
higher level than the other interactors (with the
exception of Hsf1 at 25nm rapamycin). Despite no
Hsp90 prey available to test if the interaction was
mirrored when using Fpr1 baits, the high level of
interaction in the previous screen (Fig. 10) further
supported the theory that an interaction was present.
Once the Fpr1 bait had been obtained, the screens (Fig.
Throughout almost all yeast 2-hybrid screens
conducted, 400nM rapamycin caused the largest
inconsistencies in results. This effect can be attributed to
interference caused by aggregation of rapamycin due to
its cytotoxicity inhibiting effective cell function
(Thorne, 2010). This is especially apparent in the latter
of the screens conducted (Fig. 13-15), whereby 400nM
had to be excluded from the results altogether due to
such great interference. 400nM in the previous screens
(Fig. 11 & 12) also showed high levels of interaction,
but the level of this interference was considerably lower
and was therefore included.
Conversely, the initial screen involving rapamycin (Fig.
10) seemed to indicate that rapamycin wrongly inhibited
all interactions to an extreme, even at 100nM. However,
this was shown to be consistent in almost every
following screen, both in 26°C and 39°C conditions,
whereby 100nM rapamycin showed the lowest levels of
interaction at a high concentration, assuming 400nM
was excluded due to its interference.
The inconsistencies initially noted with rapamycin were
therefore ignored, as every successive screen contained
elements which supported its predecessor, allowing for
precise observations.
Known Interactors and the Control
Vector
Yeast 2-hybrid reporter activity between BD– Hsp90
& Hsf1 and AD– CDC37 & SHE4 all supported
previously published interactions (Millson et al., 2005 &
2014), whereby activity decreased during both heat
shock conditions and when rapamycin was present. BD-
Fpr1 also mimicked these interactions in ß-galactosidase
activity, but at such a lower level that it was almost
negligible. What became apparent from initial screens
and confirmed by the latter screens, was that Hsp90,
Hsf1, Fpr1, Tor1, and even Tor2, were involved in a
very sensitive pathway. Whilst BD– Hsf1 and Fpr1
seemed to interact consistently with the empty vector
(AD-Control), this was deemed to be a result of self-
activation via selective media (Fig. 16), almost
exclusively found between these proteins alone, and
therefore not affecting the rest of the results.
Interactions at 26°C and Updated
Pathway
As expected, in the early interaction screens Hsp90
and Hsf1 interacted greater under heat shock conditions,
as did Hsf1 and TOR1, supporting the theorised
pathway so far (Fig. 2). Both also notably interacted
with TOR2, with a considerable increase with Hsp90
and slight increase with Hsf1 when under heat shock

18. binding sites between interactor proteins and
rapamycin: low levels allow Fpr1 to bind effectively in
conjunction with rapamycin, but high levels inhibit
TOR1 action with Fpr1 altogether.
As described above, 100nM also causes a spike in
Hsp90-Hsf1 interaction, as well as a decrease in Hsf1-
TOR1 interaction. Coupled with the interaction seen
between Fpr1 and TOR1, this led to the speculation that
Hsf1 and Fpr1 were both required in order for each
other to bind to TOR1. Once phosphorylated by TOR1,
Hsf1 then relocates to Hsp90, releasing Fpr1 from itself
and subsequently TOR1, as supported by the
interactions seen in Fig. 13, 14 and 15.
This information allowed an updated pathway to be
identified between these key proteins (Fig. 17). Whilst
the initial theory (Fig. 2) was rudimentary in nature,
some basic similarities were maintained, but only in the
context of 26°C, and not taking rapamycin into
account. The updated pathway also highlights a key
change in that Hsf1 interacts with TOR1 as part of its
apparent dependence on Fpr1 to do so, rather than vice
versa.
Interactions at 39°C and Updated Pathway
At 39°C heat shock (HS), Hsp90 showed greater
interactions with Hsf1 than at 26°C, supporting the
already established interactions (Ali, 1998). Both
screens including heat shock (Fig. 10 & 13) also
showed an increase in interaction with Hsp90 and
TOR1. This interaction increased when 25nM
rapamycin was included. Simultaneously, interaction
between Hsf1 and Fpr1 also increased considerably at
25nM from relatively low interactions at 0nM, whilst
Hsf1-TOR1 interaction was considerably low. These
elements combined again suggest the role of Fpr1 being
13) once again showed that interactions between Hsp90
and Fpr1 remain almost identical, regardless of
rapamycin concentration, albeit at a very low level of ~1
MU.
As the interactions between Hsp90, Hsf1, and TOR1
became identified, focus shifted onto how Fpr1
interacts, with the expectation that some missing pieces
of the pathway would become clear.
The BD-Fpr1 screen (Fig. 15) curiously showed an
interaction with Hsf1, which decreased as rapamycin
concentration increased. This was equally reflected to a
similar degree in the Hsf1 screen conducted at the same
time (Fig. 14).
Alongside this, the most notable results of the screen
showed that Fpr1 interacts highly with itself when no
rapamycin is present. This is likely due to the
association Fpr1 has with the DNA-binding proteins
Hmo1 and Fap1 (Kunz, 2000), potentially causing Fpr1
to be involved in bridged interactions with other Fpr1 as
they compete for these proteins. When rapamycin is
present, Fpr1 favours it and is sequestered from any
previous interactions. This is supported by the
considerable drop of these self-interactions as rapamycin
concentration increases.
Interestingly, in conjunction with these high levels of
self-interaction, Fpr1 also interacted with TOR1 with
greater interaction than the remaining interactors when
no rapamycin was present. At 25nM rapamycin, this
interaction doubles, whilst the previously noted self-
interaction halves. This provided clear evidence that
rapamycin-bound Fpr1 relocates to TOR1, potentially to
begin inhibition of forming TORC1 complexes as a
result of the stress caused by the rapamycin. However,
at 100nM rapamycin concentration, this interaction
plummets to lower than when no rapamycin is present.
This is potentially due to the difference in TOR1
Fig. 18. The speculated pathway between Hsp90, Hsf1, Fpr1,
TOR1 and TOR2 at 39°C. ‘Low R’ represents rapamycin
concentrations of 25nM. ‘R’ represents rapamycin
concentrations ≥100nM. Double arrows represent
dramatically increased interaction relative to 26°C.
Fig. 17. The newly identified pathway between Hsp90, Hsf1,
Fpr1, and TOR1 at 26°C. ‘Low R’ represents rapamycin
concentrations of 25nM. ‘R’ represents rapamycin
concentrations ≥100nM

19. interaction with TOR1 and Hsp90. Equally, Hsp90 has
been suggested to bind to Fpr1 and other homologous
immunophilins (Cox, 2000), which was further
supported by the high levels of interaction in Fig. 10,
11A, 12A, and 13B.
As such, it was suggested that Fpr1 is constantly
associating with itself, Hsp90, and its associated
proteins Fap1 and Hog1 when no rapamycin is present.
When introduced, rapamycin causes Fpr1 to
disassociate from Hsp90 and begin binding rapamycin.
Simultaneously, the stress induced onto the cell from
the rapamycin elicits a response from Hsf1 to begin
transcription of the shock proteins. It hereby begins
binding to Fpr1, in greater amounts than Fpr1 to
rapamycin, in order to further bind to TOR1 and
become phosphorylated, followed by Hsp90
interactions. As Hsf1 interacts with Hsp90, Fpr1 is also
re-associated with Hsp90. The total movement of Fpr1
is relatively unchanged, and therefore no difference in
interactions occur between Hsp90 and Fpr1.
The alternative theory focused on the interactions
between Hsp90 and Fpr1 that do change. The core
process is a repeat of the previous theory, however
assuming that a either greater amount of Fpr1 binds to
Hsf1 than rapamycin, or Fpr1-rapamycin complexes
can bind to Hsf1 and not inhibit the activity of TOR1
phosphorylation.
One hurdle to consider in either theory is that of
Hsf1 under HS conditions; it translocates to the nucleus
during the shock response in order to begin its
transcription activity (Medillo, 2012). In order for the
proposed interactions to occur, Hsp90 must also
translocate to the nucleus to maintain/increase the level
of interaction with the Hsf1-Fpr1 complex. One
proposed idea to support the suggested theories is that
Fpr1 or Hsf1 might be involved in the regulation of a
Hsp90 co-chaperone responsible for modifying the C-
terminus of Hsp90. As Hsp90 is held within the cell
cytoplasm via an anchoring signal located between
amino acids 333-664 (Passinen et al., 2001), it is
possible that a modification could break this anchor,
and allow a Hsf1-bound Hsp90 to translocate to the
nucleus and maintain interactions. This modification is
potentially a result of other immunophilins, perhaps
even Fpr1 or other FK506 binding proteins (Dawson et
al., 1994).
Conclusion
Multiple yeast 2-hybrid screens revealed that a
linear pathway was not present between the heat shock
proteins Hsp90, Hsf1, TOR1, and Fpr1, but rather a
complex system of varying co-interactions. Evidence
suggested that Hsf1 and Fpr1 require association with
a binding partner to Hsf1, however this time evidence
indicated that it may be essential for Hsf1 to form any
bond.
This is supported further by the interactions seen
between Hsf1, Fpr1 and TOR1. Under HS with no
rapamycin, there is great interaction between Hsf1 and
TOR1, as well as between Fpr1 and TOR1. Both
intensities drop dramatically when 25nM rapamycin is
present, before rising slightly at 100nM. This direct
mirroring further indicates some degree of co-operation
between Fpr1 and Hsf1, compounded by a further
interaction mirroring with Hsp90-Hsf1 as previously
mentioned.
One intriguing interaction was with TOR2: both
Hsp90 and Fpr1 showed good interactions with it when
no rapamycin was present. The interactions with TOR2
dropped in both cases when rapamycin was present, in a
similar but less drastic way to TOR1.
The mechanisms of these interactions remain unknown,
as Hsp90 was initially thought to not share significant
direct interactions with TOR1 or TOR2, both of which
seem to be incorrect in light of results shown. In the
context of Fpr1, the interaction is likely due to the
structural similarity between TOR2 and TOR1,
indicating their interaction is caused by the same
mechanisms of rapamycin-bound Fpr1 binding to them.
The final curiosity that arose was again the affect of
rapamycin on the interaction between Hsp90 and Fpr1.
Similar to previous screens, the levels of ß-
galactosidase activity did not change in response to
rapamycin in the screens represented by Fig. 11A &
13A, but however did vary in Fig. 12A.
Collectively, this information allowed for the
construction of a pathway identifying the interactions
between these proteins (Fig. 18). The most notable
feature is the increase in number of interactions under
HS when compared to 26°C conditions, including the
appearance of the Hsp90-Fpr1 interaction and TOR2.
The pathway assumes that the changing interaction
between Hsp90 and Fpr1 found in Fig. 12A was as
relevant as the other screens, but does not account for
rapamycin having an influence based on this particular
scenario being the minority.
Hsp90 and Fpr1 Interactions
Given the inconsistency between the results of the
Hsp90-Fpr1 screens, whereby in the majority of cases ß
-galactosidase activity did not change in response to
rapamycin and in others it did, even regardless of HS.
Speculation arose as to which scenario was accurate
and, if so, what potential mechanisms were involved.
The initial theory was focused on the interactions not
changing in intensity. Evidence gathered suggested that
Hsf1 and Fpr1 required one another to form any

20. each other in order to bind TOR1, and potentially for
Hsf1 to bind Hsp90, before translocating to the cell
nucleus and reducing interactions. TOR2 interactions
were to a similar degree, but only under heat shock
conditions. Fpr1 showed strong self-interactions likely
as a result of associating constantly with Fap1 and
Hog1.
Rapamycin inhibited interactions between Hsf1, Fpr1,
and TOR1, as well as inhibiting Fpr1 self-interaction.
Interactions between Hsf1 and Hsp90 were promoted in
the presence of rapamycin under both normal and heat
shock conditions, while Hsp90 largely increased
interaction with TOR1 only under heat shock, which
was further upregulated in the presence of rapamycin.
Interactions between Fpr1 and Hsp90 remained
inconsistent, with only speculation as to why either set
of outcomes occurred.
Further work is required with a focus on the
and IRF2 transcription factors in leukaemogenesis.
Current Gene Therapy. 6(5):543-50
Chou SD, Prince T, Gong J and Calderwood S (2012).
mTOR Is Essential for the Proteotoxic Stress
Response, Hsf1 Activation and Heat Shock Protein
Synthesis. PLoS One. 7(6): e39679
Cox MB & Smith DF (2013). Madame Curie Bioscience
Database, NCBI Bookshelf. Available: http://
www.ncbi.nlm.nih.gov/books/n/eurekah/
Dawson TM, Steiner JP, Lyons WE, Fotuhi M, Blue M,
Snyder SH (1994). The immunophilins, FK506
binding protein and cyclophilin, are discretely
localized in the brain: relationship to calcineurin.
Neuroscience. 62(2):569-80
Dolinski KJ and Heitman J (1999). Hmo1p, a high
mobility group 1/2 homolog, genetically and
physically interacts with the yeast FKBP12 prolyl
isomerase. Genetics. 151(3):935-44
Fields S (2000). Fields Lab Home Page Protocols.
Available: http://depts.washington.edu/sfields/
protocols/primers.html
Gottesman M (2002). Mechanisms of Cancer Drug
Resistance. Annual Review of Medicine. 53:615-627
Goodsell D (2008). Hsp90. http://www.rcsb.org/
pdb/101/motm.do?momID=108
Hejmadi, M (2010). Introduction to Cancer Biology 2nd
Ed. P7-9.
Jackson SE (2013). Hsp90: structure and function.
Topics in Current Chemistry. 328:155-240.
Koltin Y, Faucette L, Bergsma DJ, Levy MA, Cafferkey
R, Koser PL, Johnson RK, Livi GP (1991). Rapamycin
sensitivity in Saccharomyces cerevisiae is mediated by
a peptidyl-prolyl cis-trans isomerase related to human
References
Åkerfelt M, Morimoto RI and Sistonen L (2010). Heat
shock factors: integrators of cell stress, development
and lifespan. Nature Reviews Molecular Cell Biology.
11:545-555
Ali A, Bharadwaj S, O’Carroll R, Ovsenek N (1998).
Hsp90 interacts with and regulates the activity of heat
shock factor 1 in xenopus oocytes. Molecular Cell
Biology. 18(9):4649-60
Ballou LM and Lin RZ (2008). Rapamycin and mTOR
kinase inhibitors. Journal of Chemical Biochemistry.
1:27-36.
Benjamin D, Colombi M, Moroni Christoph, Hall M N
(2011). Rapamycin and derivative compounds
(rapalogues): structures and approved drugs. Nature
Reviews Drug Discovery. 10:868-880.
Bulman AL, Hubl ST, Nelson HC (2001). The DNA-
binding domain of yeast heat shock transcription factor
independently regulates both the N– and C-terminal
activation domains. Journal of Biological Chemistry.
276(43):40,254-62
Cancer Research UK (2012). Worldwide Cancer
Statistics. Available: http://www.cancerresearchuk.org/
cancer-info/cancerstats/world/
Cancer Research UK (2014). Cancer Treatments.
Available: http://www.cancerresearchuk.org/about-
cancer/cancers-in-general/treatment/&http://
www.cancerresearchuk.org/about-cancer/cancers-in-
general/treatment/biological/types/
Cancer Research UK (2015). Chemotherapy. Available:
http://www.cancerresearchuk.org/about-cancer/cancers
-in-general/treatment/chemotherapy/
Choo A, Palladinetti P, Passioura T, Shen S, Lock R,
Symonds G and Dolnikov A (2006). The role of IRF1
interactions of Hsp90 and Fpr1, in addition to
identifying a comprehensive mechanism of action
between the binding of Hsf1 and Fpr1 to TOR1,
specifically that of how reliant on each other the proteins
are in order to form such a bond. Whilst there is good
external evidence to suggest that the Fpr1 self-
interactions are a result of its associating proteins,
additional work on this matter would also be
recommended, as the interactions may also be a result of
proteins within the heat shock response.
Acknowledgements
Thank you the University of Lincoln for providing state
of the art facilities and support staff. Many thanks to my
supervisor, Dr Stefan Millson, for being of constant
encouragement and support throughout the research
period. A big thank you to the folks in Bay 7 for

21. FK506-binding protein. Molecular and Cellular
Biology. 11(3):1718-23
Kunz J, Loeschmann A, Deuter-Reinhard M, Hall MN
(2000). FAP1, a homologue of human transcription
factor NF-X1, competes with rapamycin for binding to
FKBP12 in yeast. Molecular Microbiology. 37(6):1480
-93.
LeGendre O, Breslin PAS and Foster DA (2015). (-)-
Oleocanthal rapidly and selectively induces cancer cell
death via lysosomal membrane permeabilization.
Molecular & Cellular Oncology. 2(4)
Lieff J (2015). The Very Intelligent Protein mTOR.
Available: http://jonlieffmd.com/blog/intelligent-
protein-mtor
Limson MV & Sweder KS (2010). Rapamycin inhibits
yeast nucleotide excision repair independently of tor
kinases. Toxicology Sciences: An Official Journal of
the Society of Toxicology. 113(1):77-84.
Medillo ML, Santagata S, Koeva M, Bell GW, Hu R,
Tamimi RM, Fraenkel E, Ince TA, Whitesell L,
Lindquist S (2012). Hsf1 drives a transcriptional
program distinct from heat shock to support highly
malignant human cancers. Cell.150(3):549-562.
Millson S, Truman AW, King V, Prodromou C, Pearl
LH, Piper PW (2005). A Two-Hybrid Screen of the
Yeast Proteome for Hsp90 Interactors
Uncovers a Novel Hsp90 Chaperone Requirement in
the
Activity of a Stress-Activated Mitogen-Activated
Protein Kinase, Slt2p (Mpk1p). Eukaryotic Cell. 4
(5):849-860
Millson S, Oosten-Hawle P, Alkuriji MA, Truman A,
Siderius M, Piper PW (2014). Cdc37 engages in stable,
S14A mutation-reinforced association with the most
atypical member of the yeast kinome, Cdk-activating
kinase (Cak1). Cell Stress Chaperones. 19(5):695-703.
Mita M, Sankhala K, Abdel-Karim I, Mita A, Giles F
(2008). Deforolimus (AP23573) a novel mTOR
inhibitor in clinical development. Expert Opinion on
Investigational Drugs. 17(12):1947-54.
NHS (2013). Chemotherapy. Available: http://
www.nhs.uk/Conditions/chemotherapy/Pages/
Definition.aspx
Passinen S, Valkila J, Manninen T, Syvälä H, Ylikomi T
(2001). The C-terminal half of Hsp90 is responsible
for its cytoplasm localization. European Journal of
Biochemistry. 268(20):5337-42
Salanti A, Clausen TM, Sorensen PH (2015). Targeting
Human Cancer by a Glycosaminoglycan Binding
Malaria Protein. Cancer Cell. 28(4):500-514
SEER (2012). SEER Stat Fact Sheets: All Cancer Sites.
Available: http://seer.cancer.gov/statfacts/html/all.html
Thorne N, Auld DS, Inglese J (2010). Apparent Activity
in High-Throughput Screening: Origins of Compound-
Dependent Assay Interference. Current Opinions in
Chemical Biology. 14(3):315-324.
Trepel J, Mollapour M, Giaccone G, Neckers L (2010).
Targeting the Dynamic Hsp90 Complex in Cancer.
Nature Reviews Cancer. 10(8):537-549.
Yang H, Rudge DG, Koos J, Vaidialingam B, Yang HJ,
Pavletich NP(2013). mTOR kinase structure,
mechanism and regulation. Nature. 497:217-224.
Zhao R and Houry WA (2005). Hsp90: a chaperone for
protein folding and gene regulation. Biochemistry and
Cell Biology. 83(6):703-10.