DNA

2. Chromosomes found in the nucleusChromosomes found in the nucleus
carry thecarry the hereditary materialhereditary material -- DNA-- DNA
 DNA (deoxyribonucleic acid) - DNADNA (deoxyribonucleic acid) - DNA
controls cellular activity bycontrols cellular activity by influencing theinfluencing the
production of enzymesproduction of enzymes..
 Basically, DNA tells your body how toBasically, DNA tells your body how to
grow!grow!

3.  --DNA is a very long--DNA is a very long
chain polymer made upchain polymer made up
of thousands ofof thousands of
repeating units calledrepeating units called
nucleotidesnucleotides..
 --Nucleotide Unit is--Nucleotide Unit is
composed of acomposed of a
phosphatephosphate group, agroup, a
pentose (5 Carbon)pentose (5 Carbon)
sugar (deoxyribose)sugar (deoxyribose) ,,
and aand a nitrogenous basenitrogenous base..
 --The Nitrogenous Bases--The Nitrogenous Bases
are;are; adenineadenine (A)(A) thyminethymine
(T)(T) guanineguanine (G)(G) cytosinecytosine
(C)(C)

4.  DNA is a very long chain polymer made up ofDNA is a very long chain polymer made up of
thousands of repeating units calledthousands of repeating units called nucleotidesnucleotides..
Nucleotide Unit is composed of:Nucleotide Unit is composed of:
– aa phosphatephosphate groupgroup
– aa pentose (5 Carbon) sugar (deoxyribose)pentose (5 Carbon) sugar (deoxyribose)
– aa nitrogenous basenitrogenous base..
 The Nitrogenous Bases areThe Nitrogenous Bases are
– adenineadenine (A)(A)
– thyminethymine (T)(T)
– guanineguanine (G)(G)

5. DNA nucleotidesDNA nucleotides
Phosphate group
Pentose sugar
Nitrogenous base

6. Sugar phosphate
backbone
Nucleotide
Polynucleotide
chain

8.  ** Consists of two chains of** Consists of two chains of
nucleotide units in a twistednucleotide units in a twisted
ladder-like structureladder-like structure. (spiral. (spiral
staircase)staircase)
 This spiral staircase isThis spiral staircase is
called ancalled an alpha helixalpha helix..
 The sides of the ladder areThe sides of the ladder are
made up of alternatingmade up of alternating
deoxyribose sugar --deoxyribose sugar --
phosphatephosphate group units.group units.
 The rungs of the ladder areThe rungs of the ladder are
made of 2 nitrogenousmade of 2 nitrogenous
bases per rung linkedbases per rung linked
together by atogether by a weakweak
hydrogen bondhydrogen bond..

9.  Only 2 combinations of baseOnly 2 combinations of base
pairs can form the rungs ofpairs can form the rungs of
the DNA molecule.the DNA molecule.
Adenine - Thymine (A-T)Adenine - Thymine (A-T)
ANDAND
Guanine – Cytosine (G-C)Guanine – Cytosine (G-C)
 This specific matching up ofThis specific matching up of
the nitrogenous bases isthe nitrogenous bases is
calledcalled complementarycomplementary
basebase pairing.pairing.

10. Okay… show the resulting base pairingsOkay… show the resulting base pairings
below!below!
ATGCCTACGTTAGATTACAACCTAAGCAATATGCCTACGTTAGATTACAACCTAAGCAAT
TACGGATGCAATCTAATGTTGGATTCGTTATACGGATGCAATCTAATGTTGGATTCGTTA
Did you find the hidden word?!Did you find the hidden word?! 

12. DNA makes ProteinDNA makes Protein
 ** One gene codes for one polypeptide** One gene codes for one polypeptide
chain.chain.
 gene = the sequence of nucleotides ingene = the sequence of nucleotides in
a DNA molecule necessary toa DNA molecule necessary to
synthesize a polypeptide (protein)synthesize a polypeptide (protein)
 DNA ultimately determines theDNA ultimately determines the
sequence of amino acids in specificsequence of amino acids in specific
proteins.proteins.
 Enzymes are specific because of their
protein makeup
 Cell function is specialized because ofCell function is specialized because of
its enzymesits enzymes
 Therefore, DNA determines function ofTherefore, DNA determines function of
cells in an organism.cells in an organism.

13. Aim: Review the
structure and function of
DNA
Do Now:
•Complete lab pages P1-
P2 pages O9 and with
signature for model
or
•work on pages DD2-DD3
questions 17-27

16. ProteinsProteins
 The work of a cell isThe work of a cell is
carried out by thecarried out by the
many different kindsmany different kinds
of molecules itof molecules it
assembles, mostlyassembles, mostly
proteins. proteins.
 Proteins are long,Proteins are long,
folded moleculesfolded molecules
made up of up to 20made up of up to 20
different kinds ofdifferent kinds of
amino acids whichamino acids which
interact to produceinteract to produce
specific proteinspecific protein
shapes.shapes.

17.  The specific shape of theThe specific shape of the
protein (exs. enzymes andprotein (exs. enzymes and
hormones) determines thehormones) determines the
specific function of thatspecific function of that
protein.protein.
 Offspring resemble theirOffspring resemble their
parents because theyparents because they
inherit similar genes thatinherit similar genes that
code for the production ofcode for the production of
proteins that form similarproteins that form similar
structures and performstructures and perform
similar functions.similar functions.

19. History of the MoleculeHistory of the Molecule
 James Watson and Francis CrickJames Watson and Francis Crick won thewon the
Nobel Prize by determining the structureNobel Prize by determining the structure
of the DNA molecule (early 1950's) with X-of the DNA molecule (early 1950's) with X-
Ray images provided byRay images provided by Rosalind FranklinRosalind Franklin
 determined the structure of the DNAdetermined the structure of the DNA
molecule - figured out that DNA looks likemolecule - figured out that DNA looks like
two threads twisted around each othertwo threads twisted around each other,,
held together by manyheld together by many bridgesbridges betweenbetween
the strandsthe strands