The document discusses the hierarchy of knowledge in biochemistry, molecular biology, and biotechnology. It begins by explaining how biochemistry initially focused on proteins and enzymes, while molecular biology focused on nucleic acids and the structure and function of genes. Biotechnology emerged due to advances in molecular biology and recombinant DNA techniques. The key areas of each discipline are defined, including how molecular biology studies how organisms are made from simple molecules at the cellular level.
DNA is made of two linked strands that wind around each other to resemble a twisted ladder — a shape known as a double helix. Each strand has a backbone made of alternating sugar (deoxyribose) and phosphate groups. Attached to each sugar is one of four bases: adenine (A), cytosine (C), guanine (G) or thymine (T).
DNA is made of two linked strands that wind around each other to resemble a twisted ladder — a shape known as a double helix. Each strand has a backbone made of alternating sugar (deoxyribose) and phosphate groups. Attached to each sugar is one of four bases: adenine (A), cytosine (C), guanine (G) or thymine (T).
Recently, it was reported that the forkhead box O (FoxO) transcription factor promotes human cytomegalovirus (HCMV)
replication via direct binding to the promoters of the major immediate-early (MIE) genes, but how the FoxO factor impacts HCMV
replication remains unknown. In this report, we found that human cytomegalovirus (HCMV), a beta herpesvirus member, could
dramatically induce the expression of FOXOs in the infected human fibroblasts. The induced FOXOs were recruited into the viral
replication compartments (vRC) in the nucleus, especially at the late stage of infection. Suppression of FOXO expression by RNA
interference significantly inhibited HCMV replication, and the production of progeny virus was reduced remarkably.
Mechanistically, FOXO knockdown intensively crippled viral late gene expression at the transcriptional level, while it only
marginally affected viral DNA synthesis. This study highlights how FoxO enhances HCMV gene transcription and viral replication
to promote productive infection
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
Basavarajeeyam is an important text for ayurvedic physician belonging to andhra pradehs. It is a popular compendium in various parts of our country as well as in andhra pradesh. The content of the text was presented in sanskrit and telugu language (Bilingual). One of the most famous book in ayurvedic pharmaceutics and therapeutics. This book contains 25 chapters called as prakaranas. Many rasaoushadis were explained, pioneer of dhatu druti, nadi pareeksha, mutra pareeksha etc. Belongs to the period of 15-16 century. New diseases like upadamsha, phiranga rogas are explained.
Recently, it was reported that the forkhead box O (FoxO) transcription factor promotes human cytomegalovirus (HCMV)
replication via direct binding to the promoters of the major immediate-early (MIE) genes, but how the FoxO factor impacts HCMV
replication remains unknown. In this report, we found that human cytomegalovirus (HCMV), a beta herpesvirus member, could
dramatically induce the expression of FOXOs in the infected human fibroblasts. The induced FOXOs were recruited into the viral
replication compartments (vRC) in the nucleus, especially at the late stage of infection. Suppression of FOXO expression by RNA
interference significantly inhibited HCMV replication, and the production of progeny virus was reduced remarkably.
Mechanistically, FOXO knockdown intensively crippled viral late gene expression at the transcriptional level, while it only
marginally affected viral DNA synthesis. This study highlights how FoxO enhances HCMV gene transcription and viral replication
to promote productive infection
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
Basavarajeeyam is an important text for ayurvedic physician belonging to andhra pradehs. It is a popular compendium in various parts of our country as well as in andhra pradesh. The content of the text was presented in sanskrit and telugu language (Bilingual). One of the most famous book in ayurvedic pharmaceutics and therapeutics. This book contains 25 chapters called as prakaranas. Many rasaoushadis were explained, pioneer of dhatu druti, nadi pareeksha, mutra pareeksha etc. Belongs to the period of 15-16 century. New diseases like upadamsha, phiranga rogas are explained.
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists Saeid Safari
Preoperative Management of Patients on GLP-1 Receptor Agonists like Ozempic and Semiglutide
ASA GUIDELINE
NYSORA Guideline
2 Case Reports of Gastric Ultrasound
Recomendações da OMS sobre cuidados maternos e neonatais para uma experiência pós-natal positiva.
Em consonância com os ODS – Objetivos do Desenvolvimento Sustentável e a Estratégia Global para a Saúde das Mulheres, Crianças e Adolescentes, e aplicando uma abordagem baseada nos direitos humanos, os esforços de cuidados pós-natais devem expandir-se para além da cobertura e da simples sobrevivência, de modo a incluir cuidados de qualidade.
Estas diretrizes visam melhorar a qualidade dos cuidados pós-natais essenciais e de rotina prestados às mulheres e aos recém-nascidos, com o objetivo final de melhorar a saúde e o bem-estar materno e neonatal.
Uma “experiência pós-natal positiva” é um resultado importante para todas as mulheres que dão à luz e para os seus recém-nascidos, estabelecendo as bases para a melhoria da saúde e do bem-estar a curto e longo prazo. Uma experiência pós-natal positiva é definida como aquela em que as mulheres, pessoas que gestam, os recém-nascidos, os casais, os pais, os cuidadores e as famílias recebem informação consistente, garantia e apoio de profissionais de saúde motivados; e onde um sistema de saúde flexível e com recursos reconheça as necessidades das mulheres e dos bebês e respeite o seu contexto cultural.
Estas diretrizes consolidadas apresentam algumas recomendações novas e já bem fundamentadas sobre cuidados pós-natais de rotina para mulheres e neonatos que recebem cuidados no pós-parto em unidades de saúde ou na comunidade, independentemente dos recursos disponíveis.
É fornecido um conjunto abrangente de recomendações para cuidados durante o período puerperal, com ênfase nos cuidados essenciais que todas as mulheres e recém-nascidos devem receber, e com a devida atenção à qualidade dos cuidados; isto é, a entrega e a experiência do cuidado recebido. Estas diretrizes atualizam e ampliam as recomendações da OMS de 2014 sobre cuidados pós-natais da mãe e do recém-nascido e complementam as atuais diretrizes da OMS sobre a gestão de complicações pós-natais.
O estabelecimento da amamentação e o manejo das principais intercorrências é contemplada.
Recomendamos muito.
Vamos discutir essas recomendações no nosso curso de pós-graduação em Aleitamento no Instituto Ciclos.
Esta publicação só está disponível em inglês até o momento.
Prof. Marcus Renato de Carvalho
www.agostodourado.com
These lecture slides, by Dr Sidra Arshad, offer a quick overview of the physiological basis of a normal electrocardiogram.
Learning objectives:
1. Define an electrocardiogram (ECG) and electrocardiography
2. Describe how dipoles generated by the heart produce the waveforms of the ECG
3. Describe the components of a normal electrocardiogram of a typical bipolar lead (limb II)
4. Differentiate between intervals and segments
5. Enlist some common indications for obtaining an ECG
6. Describe the flow of current around the heart during the cardiac cycle
7. Discuss the placement and polarity of the leads of electrocardiograph
8. Describe the normal electrocardiograms recorded from the limb leads and explain the physiological basis of the different records that are obtained
9. Define mean electrical vector (axis) of the heart and give the normal range
10. Define the mean QRS vector
11. Describe the axes of leads (hexagonal reference system)
12. Comprehend the vectorial analysis of the normal ECG
13. Determine the mean electrical axis of the ventricular QRS and appreciate the mean axis deviation
14. Explain the concepts of current of injury, J point, and their significance
Study Resources:
1. Chapter 11, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 9, Human Physiology - From Cells to Systems, Lauralee Sherwood, 9th edition
3. Chapter 29, Ganong’s Review of Medical Physiology, 26th edition
4. Electrocardiogram, StatPearls - https://www.ncbi.nlm.nih.gov/books/NBK549803/
5. ECG in Medical Practice by ABM Abdullah, 4th edition
6. Chapter 3, Cardiology Explained, https://www.ncbi.nlm.nih.gov/books/NBK2214/
7. ECG Basics, http://www.nataliescasebook.com/tag/e-c-g-basics
- Video recording of this lecture in English language: https://youtu.be/kqbnxVAZs-0
- Video recording of this lecture in Arabic language: https://youtu.be/SINlygW1Mpc
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
Best Ayurvedic medicine for Gas and IndigestionSwastikAyurveda
Here is the updated list of Top Best Ayurvedic medicine for Gas and Indigestion and those are Gas-O-Go Syp for Dyspepsia | Lavizyme Syrup for Acidity | Yumzyme Hepatoprotective Capsules etc
Adv. biopharm. APPLICATION OF PHARMACOKINETICS : TARGETED DRUG DELIVERY SYSTEMSAkankshaAshtankar
MIP 201T & MPH 202T
ADVANCED BIOPHARMACEUTICS & PHARMACOKINETICS : UNIT 5
APPLICATION OF PHARMACOKINETICS : TARGETED DRUG DELIVERY SYSTEMS By - AKANKSHA ASHTANKAR
2. Molecular Biology and Hierarchy of
Knowledge
Biochemistry
• Initially focused
on the study of
proteins and
enzymes, and
only later turned
to nucleic acids
from 1600s to
1700s
• Coined in 1903
by Carl Neuber
Molecular
Biology
• From the
beginning focused
on the structure
and function of
the gene
• Originated in the
1930s and 1940s
• Named in 1938 by
Warren Weaver
Biotechnology
• The use of living
organisms or their
products to ……
• Emerged in the
1970s due to
advances in
molecular biology
and recombinant
DNA techniques
• Named in 1919 by
Karl Ereky
3. The focus of Biochemistry
• What is Biochemistry?
• Biochemistry asks how the remarkable properties of
living organisms arise from the thousands of different
lifeless biomolecules
• Biochemistry describes in the molecular logic of life
i.e. the structures, mechanisms and chemical
processes shared by all organisms and provides
organizing principles that underlie life in all its diverse
forms, principles we refer to collectively as.
• Biochemistry provides important insights and
practical applications in medicine, agriculture,
nutrition, and industry, its ultimate concern is with
the wonder of life itself.
• Other disciplines are emerging
4. Molecular Biology
• Studies of how living organisms and the cells making
them are made from simple molecules.
• It also describes how these molecules perform at
the cellular level to make an individual organism as
simple as acellular viruses and as complex as the
multicellular organisms like man.
• Involves the study of how life in this universe
possibly originated
• Relates the structure of specific molecules of
biological importance—such as proteins, enzymes,
and the nucleic acids DNA and RNA—to their
functional roles in cells and organisms.
5. Biotechnology
• The manipulation of biological organisms to
make products that benefit human beings in
areas such as food production, waste
disposal, mining, medicine, etc.
• Existed since ancient times (8000 – 5000BC)
• some of its most dramatic advances have
come in more recent years
• Modern achievements include the transfer of
a specific gene from one organism to another
by means of a set of genetic engineering
techniques
6. Genetic Engineering
• Alteration of an organism's genetic, or
hereditary, material to
–eliminate undesirable characteristics or
–produce desirable new ones.
• Involved in genetic engineering
techniques are
–the selective breeding of plants and
animals, hybridization and
– recombinant DNA
7. DNA: The focus
• DNA is the chemical basis of heredity.
• DNA comprises the genetic material by which the
information to make proteins and RNA is stored
and transmitted to offspring.
• DNA is a linear polymer of deoxyribonucleotides in
which the sequence of purine and pyrimidine
bases encodes cellular RNA and protein molecules.
• DNA is highly organized into chromosomes,
structures that allow the DNA to be packaged
tightly for storage in the nucleus of the cell.
8. POLYMER BUILDING IN
NUCLEIC ACIDS
• DNA is a long polymer made from repeating
units called nucleotides
• A nucleotide is made from
–a pentose (five-carbon) sugar
–Phosphate group that form phosphodiester
bond
–a base, which interacts with the other DNA
strand in the helix
11. Gene History
• Began with the work of Gregory Mendel – the
‘Father of Genetics’
• Performed experiments with plants in 1857
for 8 years
• His results explained the basic concept of
inheritance; distinguishing between the
–dominant and recessive traits
–Heterozygote and homozygote
–Genotype and phenotype
12. Gene History
• Other scientists, Hugo de Vries, Carl Correns
and Erich von Tschermak did similar studies in
1900 and got similar results
• The units that transmitted or contained the
genetic material was not yet known
13. Gene History
• Friedrich Miescher (1844 – 1895) discovered a
substance he called ‘nuclein’ in 1869
• He isolated a pure form of it
• His student, Richard Altmann in 1889, named
it ‘nucleic acid’
–This substance was found to exist only in
the chromosomes
• Darwin describe his finding ‘gemmule’
–This was latter named chromosome
14. Gene History
• Wilhelm Roux in 1883 speculated that
chromosomes are the carriers of inheritance
• Wilhelm Johannsen coined the word ‘gene’ in
1909 to describe the fundamental physical
unit of hereditary
• William Bateson coined the term ‘genetics’
from the word gene
• In 1910, Thomas Morgan showed that genes
reside on chromosomes
• Morgan and his students did the first
chromosomal map of fruit fly ‘Drosophilia’
15. Evidence of DNA as genetic material
• Early in the 20th century, the identification of
the molecules of inheritance loomed as a
major challenge to biologists
• Proteins were thought to be the only truly
complex molecules in cells, and therefore must
be responsible for heredity
16. Evidence of DNA as genetic material
• When T. H. Morgan’s group showed that
genes are located on chromosomes, the
two components of chromosomes—DNA
and protein—became candidates for the
genetic material
• The key factor in determining the genetic
material was choosing appropriate
experimental organisms
• The role of DNA in heredity was first
discovered by studying bacteria and the
viruses that infect them
17. Evidence of DNA as genetic material
1928: Frederick Griffith discovered
phenomenon of transformation in bacteria
• Used organism Streptococcus pneumoniae.
• Strep bacillus has two forms:
• slimy colonies (S strain) forms mucous
capsules, survives attack by macrophages in
lung, kills mice
• rough colonies (R strain) lacks capsules,
quickly killed by macrophage, no disease
19. Evidence of DNA as genetic material
• When Griffith mixed heat-killed S-strain with
live R-strain, resulting organisms killed mice,
and lungs were filled with S-strain.
• Conclusion: some chemical is surviving heat
treatment, retains genetic information, is able
to transmit that information to some R-strain
bacteria, convert them to S. Griffith didn't
know what was responsible
20. Evidence of DNA as genetic material
1952: Hershey & Chase prove that only DNA is
responsible for bacterial virus infection of host
cells.
– Viruses (called phage if host cells are bacteria) are
much simpler than cells, contain only DNA &
protein.
– They were able to use different radioactive isotopes
to distinguish DNA from protein: for DNA, used P-32
(lots of P in DNA, but none in protein); for protein,
used S-35 (proteins contain S in certain amino acids,
but DNA lacks S).
22. Evidence of DNA as genetic material
– H&C grew phage in hosts with either P or S
radioisotope. Then infected different bacteria for
short time, vortexed in blender to separate phage
coats from cells, and separated phage (very small)
from cells (larger) by centrifugation.
– Result: only P-32 isotope found in cells. All S-35
could be knocked loose by blending, but cells
were still infected and produced new phage.
Therefore only DNA, not protein, was responsible
for inheritance.
23. Biochemical basis of heredity
• The offspring inherits from the parents
• The material inherited is genetic passed as
some information
• The information is contained in the DNA
represented by the sequence of the bases
such as:
AGCCATTAGAACTTAAGGCCCCAAGGTTTGGAA
25. Electrophoresis
• Electrophoresis is a lab technique used to
separate DNA, RNA or protein molecules
based on their size and electric charge
• Developed by Arne Tiselius in 1937
• Steps:
• Prepare samples
• Prepare the gel and buffer
• Load the samples
• Running the system
• Visualise and document bands
26. Fill wells with
DNA solutions
Gel support
Agarose gel
+
Buffer solution Direction of movement
_
Electrophoresis
27. m 1 2 3 4 5 6 7 8
PCR analysis on 1% agarose gel of PLA2 like gene from T.brucei, T.evansi, Bee and
Wasp.
M- DNA marker (Fermentas); lane 1- T.brucei genomic DNA; lane 2- T.evansi
genomic DNA ; lane 3- T.evansi genomic DNA; lane 4- T.evansi genomic DNA; lane
5-T.brucei cDNA ; lane 6-Bee cDNA; lane 7-Wasp cDNA; lane 8-T.evansi cDNA.
1344 bp of PLA2
1,000 bp
250 bp
1,500 bp
29. Genome
• A genome is the complete collection of an
organism’s genetic material.
• The human genome is composed of about 20,000 to
25,000 genes located on the 23 pairs of
chromosomes in a human cell.
• A single human chromosome may contain more
than 250 million DNA base pairs, and scientists
estimate that the entire human genome consists of
about 3 billion base
• Human genes reside on 23 pairs of chromosomes
found in the nucleus of every body cell
• About 2 m (7 ft) of DNA is packaged into each
chromosome.
30. Genes
• Genes Are Segments of DNA That Code for
Polypeptide Chains and RNAs
• a gene was defined as a portion of a chromosome
that determines or affects a single character or
phenotype (visible property), such as eye color
• The modern biochemical definition of a gene is
DNA that encodes the primary sequence of some
final gene product, which can be either a
polypeptide or an RNA with a structural or
catalytic function
31. Chromosomes
• Microscopic structure within cells that carries
the molecule deoxyribonucleic acid (DNA)—
• Chromosomes are structures that allow the
DNA to be packaged tightly for storage in the
nucleus of the cell.
• Give rise to genomes – prokaryotic and
eukaryotic
• In addition to genes, chromosomes contain a
variety of regulatory sequences involved in
replication, transcription, and other processes.
32. Molecular Structure of Eukaryotic
Chromosomes
• DNA associated with histone proteins
• Nucleosome: Basic unit of chromosome structure
• Nucleosome Structure:
– Core: 2 molecule each of H2A, H2B, H3, H4 150 bp
DNA wrapped around histones
– Spacer: 1 molecule H1 + 20 bp DNA
– Coiling: Nucleosomes condense to produce chromatin
fiber, Fibers condense at prophase; chromosomes
visible
34. • Histones: Abundant nuclear proteins
– Ubiquitous, highly conserved
– General repressors of gene expression
– 5 major types (H1, H2A, H2B, H3, H4)
– Basic; rich in (+) lysine, arginine
– Bind to (-) phosphates in DNA
– Binding independent of DNA sequence
– Acetylation alters chromatin structure
– Makes DNA accessible for transcription
Molecular Structure of Eukaryotic
Chromosomes
35. • Many other proteins are associated with
chromosomes
–Nuclear scaffold proteins (chromosome
mechanics)
–Transcription factors (gene expression)
Molecular Structure of Eukaryotic
Chromosomes
38. • Viral genome
– Relatively small
– About 17.2μm
– Some linear double helix e.g. bacteriophage λ and
T2,
– Some are circular duplexes
– Someare single stranded circular e.g.
bacteriophageФX
Viral genome
39. Viral chromosomes
• few genes present – rely on host cell
• Comprise of DNA / RNA; linear / circular
• Generally 1 copy per virion; hundreds
sequenced
• Variety of replication strategies and pathways
• Some require RNA-dependent RNA
polymerases
• Replication pathways: Targets for drug action
40.
41. • Procaryotic genome
– Relatively large, about 200x that of bacteriophage
λ
– Bacterial cells have non nucleated genome
– E. coli has gnome of 4million base pairs about
2μm
– Some have plasmids
Prokaryotic genome
42.
43. Bacterial plasmids
• small DNA molecule within a cell that is
physically separated from a chromosomal DNA
and can replicate independently
• They are found in bacteria as small, circular,
double-stranded DNA molecules
• plasmids often carry genes that may benefit
the survival of the organism, for example
antibiotic resistance
• Plasmids are not generally classified as life
44. • Plasmids can be transmitted from one
bacterium to another
–even of another species
• Transmission is through three main
mechanisms:
–transformation,
–transduction,
–conjugation
Bacterial plasmids
45. Summary of Bacterial Chromosome
Organizations
Bacteria Chromosome Organization
Agrobacterium tumefaciens One linear and one circular
Bacillus subtilis Single and circular
Bacillus subtilis Single and linear
Borrelia burgdorferi Two circular
Brucella abortus Two circular
Brucella melitensis Two circular
Brucella ovis Two circular
Brucella suis biovar 1 Two circular
Brucella suis biovar 2 Two circular
Brucella suis biovar 4 Two circular
Escherichia coli Single and circular
Paracoccus denitrificans Three circular
Pseudomonas aeruginosa Single and circular
Rhodobacter sphaeroides Two circular
Streptomyces griseus Linear
Vibrio cholerae Two circular
Vibrio fluvialis Two circular
Vibrio parahaemolyticus Two circular
Vibrio vulnificus Two circular
46. Problems with Linear Chromosomes in
prokaryotes
• Two problems arise with linear chromosomes
– intracellular nuclease degradation -the free double-
stranded DNA ends need protection
– Replication of telomeres, which are the ends of the
linear DNA molecules - will require a different process
for DNA replication
• There are two types of telomeres
– palindromic hairpin loops, in which there are no free
double-stranded ends available
– invertron telomeres with a protein that binds to the
5’-ends
47. • Eukaryotic genome
– very large
– Genome divided into chromosomes varying in
number e.g. Drosophila (8); honey bee (16); frog
(26); cat (38); mouse (40); rat (42); man (46);
chicken (78)
– DNA is organized into introns and exons
Eukaryotic genome
48. Eukaryotic genome
• Human genome is composed of 20,000 to 25,000
genes located on the 23 pairs of chromosomes
• A chromosome has ≥250 million DNA base pairs,
• Has about 3 billion base
• About 2 m (7 ft) of DNA is packaged into each
chromosome.
• Man has about 10(13)cells, 2 x 10(10)km DNA
(earth circumference 40,000; gap btw earth and sun
1.44 x 10⁸km)
• About 3% codes for proteins
• About 40-50% is repetitive
• What is the function of the remaining 50%?
49. Eukaryotic genome
• Complex genomes have roughly 10x to 30x
more DNA than is required to encode all the
RNAs or proteins in the organism.
• Contributors to the non-coding DNA include:
– Introns in genes
– Regulatory elements of genes
– Multiple copies of genes, including pseudogenes
– Intergenic sequences
– Interspersed repeats
51. • The central dogma of molecular biology, showing
the general pathways of information flow via
replication, transcription, and translation.
Gene Function
cDNA
RNA
PROTEIN
Reversed
transcription
Translation
Transcription
gDNA
RNA replication
replication
54. Gene transmission
• The mechanism that drives evolution
• How genetic materials are passed from one
generation to the next
• Classical methods of gene transmission in nature:
– Bacterial conjugation
– Natural transformation
– Transduction
• Transmission can be vertical or horizontal
• Duplication and transmission of genetic material
is the basis for molecular inheritance
55. DNA replication
• The parent molecule unwinds, and two new
daughter strands are built based on base-
pairing rules
(a) The parent molecule has two
complementary strands of DNA.
Each base is paired by hydrogen
bonding with its specific partner,
A with T and G with C.
(b) The first step in replication is
separation of the two DNA
strands.
(c) Each parental strand now
serves as a template that
determines the order of
nucleotides along a new,
complementary strand.
(d) The nucleotides are connected
to form the sugar-phosphate
backbones of the new strands.
Each “daughter” DNA
molecule consists of one parental
strand and one new strand.
A
C
T
A
G
A
C
T
A
G
A
C
T
A
G
A
C
T
A
G
T
G
A
T
C
T
G
A
T
C
A
C
T
A
G
A
C
T
A
G
T
G
A
T
C
T
G
A
T
C
T
G
A
T
C
T
G
A
T
C
56. DNA Replication
• In order that a complete complement of the
genetic material may be inherited by daughter
cells during cell division or by offspring from
parents.
–Copied with high fidelity
–Mechanism
• Semiconservative
• Conservative
• Dispersive
58. DNA Replication is “Semi-
conservative”
• Each 2-stranded daughter
molecule is only half new
• One original strand was used as a
template to make the new strand
59. DNA Replication
• DNA molecules serve as templates for either
complementary DNA strands during the process
of replication or complementary RNA during the
process of transcription.
• The copying of DNA is remarkable in its speed
and accuracy
• Involves unwinding the double helix and
synthesizing two new strands.
• More than a dozen enzymes and other proteins
participate in DNA replication
• The replication of a DNA molecule begins at
special sites called origins of replication, where
the two strands are separated
60. Origins of Replication
• A eukaryotic chromosome may have hundreds or
even thousands of replication origins
Replication begins at specific sites
where the two parental strands
separate and form replication
bubbles.
The bubbles expand laterally, as
DNA replication proceeds in both
directions.
Eventually, the replication
bubbles fuse, and synthesis of
the daughter strands is
complete.
1
2
3
Bubble
Parental (template) strand
Daughter (new) strand
Replication fork
Two daughter DNA molecules
In eukaryotes, DNA replication begins at many sites
along the giant DNA molecule of each chromosome.
61. Enzymes in DNA replication
Helicase unwinds
parental double helix
Binding proteins
stabilize separate
strands
DNA polymerase III
binds nucleotides
to form new strands
Ligase joins Okazaki
fragments and seals
other nicks in sugar-
phosphate backbone
Primase adds
short primer
to template strand
DNA polymerase I
(Exonuclease) removes
RNA primer and inserts
the correct bases
63. Proofreading
• DNA must be faithfully replicated…but
mistakes occur
–DNA polymerase (DNA pol) inserts the
wrong nucleotide base in 1/10,000 bases
• DNA pol has a proofreading capability
and can correct errors
–Mismatch repair: ‘wrong’ inserted base can
be removed
–Excision repair: DNA may be damaged by
chemicals, radiation, etc. Mechanism to cut
out and replace with correct bases
64. Mutations
• A mismatching of base pairs, can occur at a rate
of 1 per 10,000 bases.
• DNA polymerase proofreads and repairs
accidental mismatched pairs.
• Chances of a mutation occurring at any one
gene is over 1 in 100,000
• Because the human genome is so large, even at
this rate, mutations add up. Each of us probably
inherited 3-4 mutations!
65. Proofreading and Repairing DNA
• Correction of mismatched DNA is done by repair
enzymes
• DNA polymerases proofread newly made DNA,
replacing any incorrect nucleotides
• A nuclease enzyme cuts the damaged DNA
strand at two points and remove the
damaged section
• Repair synthesis by a DNA polymerase fills
in the missing nucleotides.
• DNA ligase seals the gap, making the strand
complete
66. Accuracy of DNA Replication
• The chromosome of E. coli contains about 5 million
bases pairs
–Capable of copying this DNA in less than an hour
• The 46 chromosomes of a human cell contain
about 6 BILLION base pairs of DNA!!
–Printed one letter (A,C,T,G) at a time…would fill
up over 900 volumes of Campbell.
–Takes a cell a few hours to copy this DNA
–With amazing accuracy – an average of 1 per
billion nucleotides
68. Plasmids
• small DNA molecule that are not part of
chromosomal DNA
• can replicate independently
• circular, double-stranded DNA molecules
• carry genes beneficial to the organism, e.g.
antibiotic resistance
71. Vectors
• Artificially constructed plasmids
• used as vectors in genetic engineering and
biotechnology labs, where they are commonly
used to clone and amplify
• A wide variety of plasmids are commercially
available
• gene to be replicated is normally inserted into
a plasmid
73. Vectors
• Features of all cloning vectors:
–can independently replicate themselves and
the foreign DNA segments they carry;
–contain a number of unique restriction
endonuclease cleavage sites;
–carry a selectable marker (antibiotic resistance
genes etc; and
–are relatively easy to recover from the host
cell.
74. Transposable Elements
• Transposable elements (TEs) are
• DNA sequence that can change its position
within the genome
• capable of replicating themselves within
genomes independently of the host cell DNA.
• They typically range in length from 100 to
10,000 base pairs, but are sometimes far larger
• Along with viruses, TEs are the most intricate
selfish genetic elements.
76. Types of transposons
• TEs are two classes based on mechanism of
transposition
• Class I: Retrotransposons
• Class II: DNA transposons
77. Types of transposons
Class I: Retrotransposons
• mechanism of transposition is described as copy
and paste, occuring in two stages:
– they are transcribed from DNA to RNA,
– the RNA produced is then reverse transcribed to
DNA, catalyzed by a reverse transcriptase
• This copied DNA is then inserted at a new
position into the genome
• Class I are similar to retroviruses e.g. HIV
78. Types of transposons
Class II: DNA transposons
• Mechanism is cut-and-paste transposition
• does not involve an RNA intermediate
• The transpositions are catalyzed by several
transposase enzymes.
• The transposase cut the transposon leaving
staggered cut/ sticky ends at the target site
• The transposon is then inserted into a new
target site and ligated
79. Examples
• TEs were 1st discovered in maize (Zea mays) by
Barbara McClintock in 1948
• She noticed insertions, deletions and
translocations
• These changes in the genome lead to a change
in the color of corn kernels
81. Examples
• One family of TEs in the fruit fly Drosophila
melanogaster are called P elements
• Transposons in bacteria usually carry an
additional gene for function other than
transposition---often for antibiotic resistance
• The most common form of transposable
element in humans is the Alu sequence
82. In disease
• TEs are mutagens damaging the genome of
their host cell in different ways
• Diseases that are often caused by TEs include:
–hemophilia A and B,
–severe combined immunodeficiency,
–porphyria,
–predisposition to cancer, and
–Duchenne muscular dystrophy