Answer(D) They are performed with linked genes but not with unlin.pdf
•
0 likes•3 views
Answer: (D) They are performed with linked genes but not with unlinked genes; The complementation test is also called as cis-trans test. It is used to determine whether two mutations associated with a specific phenotype represent two different forms of the same gene (alleles) (AB/ab) or are variations of two different genes (Ab/aB). The complementation will not occur if the mutations are in the same gene It is relevant for recessive traits (traits normally not present in the phenotype due to masking by a dominant allele). Solution Answer: (D) They are performed with linked genes but not with unlinked genes; The complementation test is also called as cis-trans test. It is used to determine whether two mutations associated with a specific phenotype represent two different forms of the same gene (alleles) (AB/ab) or are variations of two different genes (Ab/aB). The complementation will not occur if the mutations are in the same gene It is relevant for recessive traits (traits normally not present in the phenotype due to masking by a dominant allele)..
Report
Share
Report
Share
Download to read offline
Recommended
Complementation
1. The document discusses complementation testing in genetics, which involves crossing two mutant strains to determine if their mutations occurred in the same or different genes.
2. If the mutations are in the same gene, the hybrid will be mutant, but if in different genes, the hybrid will have a wild type phenotype due to complementation.
3. The results of complementation tests allow researchers to classify mutations into complementation groups based on whether they fail to complement (allelic) or complement (non-allelic).
gene ation in plants
Gene action refers to how genes are expressed in an organism. There are different types of gene action including additive and non-additive gene action. Additive gene action is fixable through selection while non-additive gene action like dominance and epistasis are not fixable. Understanding gene action is important for plant breeders to design effective breeding programs. Gene interactions can occur between alleles of the same gene (dominance) or alleles of different genes (epistasis) and influence traits. The document discusses different types of dominance like complete, incomplete and overdominance as well as different types of epistatic interactions.
17465299.ppt
This document discusses polygenic inheritance and continuous variation. Polygenic traits are influenced by two or more genes and exhibit a wide range of overlapping phenotypes in a population, such as height, skin color, and intelligence. The additive model is presented, where dominant alleles each contribute equally to a quantitative trait like height, while recessive alleles make no contribution. The number of possible phenotypic classes increases with the number of gene pairs involved. Multifactorial and complex traits result from an interaction between genes and environmental factors, though determining these interactions can be difficult. Heritability estimates the genetic contribution to phenotypic variation by comparing relatives.
Concept of genes
Genes are the hereditary units. in next few slides we'll try to understand the concept of genes with suitable examples.
Complementation mapping and gene mapping.
This document discusses complementation mapping, which is used to determine if mutations in two strains are in the same or different genes. It involves performing cis-trans tests, where cis-heterozygotes have both mutant alleles on the same chromosome and trans-heterozygotes have them on different chromosomes. Complementation will not occur if the mutations are in the same gene, but will occur if they are in different genes. An example is given using two strains of white-eyed fruit flies, where a complementation test crossing flies from each strain would show if their mutations are in the same gene (A or B for eye color) based on whether the progeny have red or white eyes.
Gene interactions and multiple alleles.pptx
Gene interactions and multiple alleles control many traits in organisms. There are two main types of gene interaction - allelic/non-epistatic interaction which follows Mendelian ratios, and non-allelic/epistatic interaction where gene expression depends on other genes. Epistatic genes suppress others in traits like coat color. Multiple alleles originate from mutations at a locus and exist as allelic series like blood types (A, B, AB, O) and rabbit coat colors which are determined by multiple alleles at a gene locus.
Interaction of genes for slide share
This power point presentation is designed to explain deviation of Mendelian dihybrid ratio due to interaction of genes which may be of following types
1.Two gene pairs affecting same character – 9:3:3:1
2.Epistasis, one gene hides effect of other
a) Recessive Epistasis - 9:3:4
b) Dominant epistasis - 12:3:1
3.Complementary genes - 9:7 ( 2 genes responsible for production of a particular phenotype )
4. Duplicate genes – 15:1 ( same effect given by either of two genes )
5. Polymeric gene action - 9:6:1
6. Inhibitory gene action - 13 : 3
Each interaction is typical in itself and ratios obtained are different
linkage
This document discusses genetic linkage and crossing over. It defines linkage as genes being inherited together on the same chromosome. Crossing over occurs during meiosis when segments are exchanged between non-sister chromatids, resulting in new combinations of linked genes. The frequency of crossing over between two genes increases with genetic distance. Three-point crosses allow determining gene order and calculating linkage distances between loci. Double crossovers are also discussed.
Recommended
Complementation
1. The document discusses complementation testing in genetics, which involves crossing two mutant strains to determine if their mutations occurred in the same or different genes.
2. If the mutations are in the same gene, the hybrid will be mutant, but if in different genes, the hybrid will have a wild type phenotype due to complementation.
3. The results of complementation tests allow researchers to classify mutations into complementation groups based on whether they fail to complement (allelic) or complement (non-allelic).
gene ation in plants
Gene action refers to how genes are expressed in an organism. There are different types of gene action including additive and non-additive gene action. Additive gene action is fixable through selection while non-additive gene action like dominance and epistasis are not fixable. Understanding gene action is important for plant breeders to design effective breeding programs. Gene interactions can occur between alleles of the same gene (dominance) or alleles of different genes (epistasis) and influence traits. The document discusses different types of dominance like complete, incomplete and overdominance as well as different types of epistatic interactions.
17465299.ppt
This document discusses polygenic inheritance and continuous variation. Polygenic traits are influenced by two or more genes and exhibit a wide range of overlapping phenotypes in a population, such as height, skin color, and intelligence. The additive model is presented, where dominant alleles each contribute equally to a quantitative trait like height, while recessive alleles make no contribution. The number of possible phenotypic classes increases with the number of gene pairs involved. Multifactorial and complex traits result from an interaction between genes and environmental factors, though determining these interactions can be difficult. Heritability estimates the genetic contribution to phenotypic variation by comparing relatives.
Concept of genes
Genes are the hereditary units. in next few slides we'll try to understand the concept of genes with suitable examples.
Complementation mapping and gene mapping.
This document discusses complementation mapping, which is used to determine if mutations in two strains are in the same or different genes. It involves performing cis-trans tests, where cis-heterozygotes have both mutant alleles on the same chromosome and trans-heterozygotes have them on different chromosomes. Complementation will not occur if the mutations are in the same gene, but will occur if they are in different genes. An example is given using two strains of white-eyed fruit flies, where a complementation test crossing flies from each strain would show if their mutations are in the same gene (A or B for eye color) based on whether the progeny have red or white eyes.
Gene interactions and multiple alleles.pptx
Gene interactions and multiple alleles control many traits in organisms. There are two main types of gene interaction - allelic/non-epistatic interaction which follows Mendelian ratios, and non-allelic/epistatic interaction where gene expression depends on other genes. Epistatic genes suppress others in traits like coat color. Multiple alleles originate from mutations at a locus and exist as allelic series like blood types (A, B, AB, O) and rabbit coat colors which are determined by multiple alleles at a gene locus.
Interaction of genes for slide share
This power point presentation is designed to explain deviation of Mendelian dihybrid ratio due to interaction of genes which may be of following types
1.Two gene pairs affecting same character – 9:3:3:1
2.Epistasis, one gene hides effect of other
a) Recessive Epistasis - 9:3:4
b) Dominant epistasis - 12:3:1
3.Complementary genes - 9:7 ( 2 genes responsible for production of a particular phenotype )
4. Duplicate genes – 15:1 ( same effect given by either of two genes )
5. Polymeric gene action - 9:6:1
6. Inhibitory gene action - 13 : 3
Each interaction is typical in itself and ratios obtained are different
linkage
This document discusses genetic linkage and crossing over. It defines linkage as genes being inherited together on the same chromosome. Crossing over occurs during meiosis when segments are exchanged between non-sister chromatids, resulting in new combinations of linked genes. The frequency of crossing over between two genes increases with genetic distance. Three-point crosses allow determining gene order and calculating linkage distances between loci. Double crossovers are also discussed.
Genetics
This document discusses genetics and inheritance. It defines key genetics terms like genes, alleles, chromosomes, genomes, mutations, and genotypes and phenotypes. It provides examples of sickle cell anemia, specifically that a mutation in the gene coding for hemoglobin causes a substitution that changes one amino acid in hemoglobin. This results in sickled red blood cells that are less efficient at transporting gases, but provides some resistance to malaria.
AP BIOLOGY MENDELIAN GENETICS AND 2 Student Packet.pdf
Gregor Mendel conducted experiments on pea plants that demonstrated basic principles of heredity. He found that traits are transmitted through discrete factors (now called genes) and that these factors assort and segregate independently during the formation of gametes. Mendel's work established the foundations of classical or Mendelian genetics, including the laws of segregation and independent assortment. Later, scientists developed additional genetic concepts and tools, such as genetic linkage maps and the chi-square test, which allow for more sophisticated analysis of inheritance patterns.
Heredity and Evolution class 10 Science Study Material pdf download
Heredity is the fascinating study of how traits are passed down from one generation to the next. It forms the foundation for understanding the similarities and differences among living organisms, providing insights into the mechanisms of inheritance. From the color of our eyes to the texture of our hair, heredity influences a wide array of physical and physiological characteristics in all living beings.
For more information, visit-www.vavaclasses.com
05 basics of_linkagemapping
This document discusses linkage and gene mapping. It defines linkage as two genes being located on the same chromosome. Recombination during meiosis can result in new combinations of alleles, reducing linkage. Linkage disequilibrium occurs when alleles at different loci are non-randomly associated. Genetic markers can be mapped relative to each other by determining recombination fractions between them and using a mapping function to place them on a genetic map in centiMorgans. The maximum likelihood method is used to estimate recombination fractions when linkage phases are unknown.
Genetic Linkage
The document discusses genetic recombination and gene linkage. During meiosis, homologous chromosomes pair up and may exchange genetic material through crossing over. Tracking how closely linked genes segregate during crosses allows their relative positions on chromosomes to be determined. Genetic markers are used to infer the presence of other linked genes. Independent assortment of chromosomes leads to many possible combinations of alleles in gametes. The analysis of crosses differs depending on whether genes are on the same or different chromosomes. Recombination frequency between linked genes can be measured and used to create genetic maps.
Genetic fine str. analysis & complementation
The concept of the gene has evolved over time based on experimental evidence:
1. Early views were that a gene equals one character (Mendel) or metabolic function (Garrod).
2. Experiments in the 1940s-50s showed genes encode enzymes or polypeptides.
3. Benzer's experiments in the 1950s-60s demonstrated that genes have fine structure and recombination can occur within genes, not just between genes. The nucleotide, not the gene, is the basic unit of genetic structure.
4. Complementation tests show a gene is the basic unit of function, though it can be divided into smaller functional units (cistrons). Alternative splicing further complicates the
Alignment of pairs of sequence (Types of Similarity Sequences)
Types of Similarity sequences,
1. Homology ( Homologous sequences )
Orthology ( Orthologous sequences )
Paralogy ( Paralogous sequences )
2. Analogy ( Analogous sequences )
3. Xenelogy ( Xenelogous sequences )
All explained briefly with examples.
Ch 12 gene linkage groups and practice problems
1. The document discusses genetics concepts like linkage groups, chromosome mapping, parental and recombinant types. It provides examples of genetic crosses in pea plants and fruit flies to demonstrate these concepts.
2. Recombinant types result from crossovers during meiosis, where alleles switch positions on homologous chromosomes. The frequency of recombinants allows calculation of distance between genes.
3. A sample genetics problem is presented, asking the reader to analyze a dihybrid cross in pea plants and determine the chromosome arrangement and distance between genes.
Complementation of defined mutations
A complementation test (sometimes called a "cis-trans" test) can be used to test whether the mutations in two strains are in different genes. By taking an example of Benzer's work, complementation has been explained.
NonMendelian Genetics Part2
The document discusses several patterns of non-Mendelian inheritance including incomplete dominance, codominance, multiple alleles, and sex-linked traits. These patterns do not follow Mendel's laws of simple dominance and recessive inheritance. Incomplete dominance results in an intermediate phenotype, codominance shows both parental traits simultaneously, multiple alleles involve more than two allele choices for a trait, and sex-linked traits are inherited through the X chromosome.
Linkage and Recombination.ppt
Genes located on the same chromosome tend to be inherited together due to their physical linkage on the chromosome. However, linkage can be broken during meiosis via recombination between homologous chromosomes through the process of crossover. Recombination results in new combinations of parental alleles and limits the types of gametes produced under conditions of complete linkage. Morgan's experiments with Drosophila provided evidence of this by demonstrating non-Mendelian inheritance ratios when genes were linked versus unlinked.
Linkage and crossing over.. Dr. krishna
Cell Biology and Genetics. linkage and crossing over, type. brief notes for B.Sc., biotechnology students. pea plant and Drosophila
10.2 inherritance
This document discusses inheritance and related concepts. It defines key terms like linked genes, which are genes located on the same chromosome. When genes are linked, they may assort independently during meiosis leading to recombinants. It also discusses polygenic inheritance where multiple genes influence traits, often resulting in continuous variation. The document provides examples of dihybrid crosses using Punnett squares and sex-linked inheritance from Thomas Morgan's experiments with fruit flies. Homework includes defining terms and working exercises on linked genes and dihybrid crosses.
genetics-150405024530-conversion-gate01.pdf
Genetics is the branch of biology that deals with heredity and variation of traits among organisms. It studies how genes are transmitted from parents to offspring. The basic units of heredity are genes, and genes are made up of DNA. Genes carry the instructions to make proteins and control traits. Genetic disorders occur due to mutations or changes in genes that can be inherited. Some examples of genetic disorders include sickle cell anemia, cystic fibrosis, and Huntington's disease.
Life science grade 12
slides to share if your interested in learning more about life science and please feel free to ague where is neccesary
Genetics_-_Neo_Mendelism.pptx
This document provides an introduction to gene interactions, also known as neo-Mendelism or post-Mendelian genetics. It discusses how multiple gene pairs can interact to influence a single trait, modifying Mendel's expected inheritance ratios. Specifically, it describes different types of gene interactions including dominance, epistasis, inhibitory genes, masking genes, complementary/duplicate recessive genes, and duplicate dominant genes. These gene interactions result in non-Mendelian inheritance ratios such as 9:3:4, 13:3, 12:3:1, 9:7, and 15:1. The document uses examples from coat color in mice, feather color in fowl, and flower color in sweet peas to illustrate these concepts
Non additive gene action
Gene interactions occur when the expression of one gene depends on the presence or absence of another gene. There are several types of non-additive gene interactions:
1. Dominance - one allele masks the other (e.g. complete, incomplete, overdominance)
2. Epistasis - genes at different loci interact so one gene masks the other (e.g. supplementary, complementary, inhibitory, duplicate, masking)
3. Examples include flower color in sweet peas (complementary), anthocyanin in rice (inhibitory), and fruit shape in summer squash (polymeric).
Unit3 genetics
1) Genes are segments of DNA that contain information for hereditary traits and are located on chromosomes. Genes are transmitted from parents to offspring through gametes and each gene has alternative forms called alleles.
2) An individual's genotype refers to their combination of genes, while their phenotype is the observable traits. Phenotype depends on both genotype and environment.
3) Through his experiments with pea plants, Mendel discovered three laws of inheritance: the Law of Uniformity, the Law of Segregation, and the Law of Independent Assortment. These laws explain the basic principles of genetic inheritance and transmission of traits from parents to offspring.
Neo-Mendelian Inheritance.pptx
This document discusses non-Mendelian patterns of inheritance in genetics. It defines non-Mendelian inheritance as patterns that do not follow Mendel's laws. Several types of non-Mendelian inheritance are described, including codominance, incomplete dominance, overdominance, multiple allelism, lethal genes, and epistasis. Examples are provided for each type. The document also includes sample problems and their solutions to illustrate concepts like codominance and multiple allelism.
Genetics From Genes to Genomes 6th Edition hartwell Solutions Manual
Full download : https://alibabadownload.com/product/genetics-from-genes-to-genomes-6th-edition-hartwell-solutions-manual/
Genetics From Genes to Genomes 6th Edition hartwell Solutions Manual
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
The document shows the step-by-step solution to simplify the expression (7x*14x)^1/2. It first writes the expression as (7x*14x)^1/2, then simplifies the terms inside the radical to get (2*7*7*x^2)^1/2, and finally further simplifies the terms to get the final expression of 7x(2)^1/2.
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids.
Solution
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids..
More Related Content
Similar to Answer(D) They are performed with linked genes but not with unlin.pdf
Genetics
This document discusses genetics and inheritance. It defines key genetics terms like genes, alleles, chromosomes, genomes, mutations, and genotypes and phenotypes. It provides examples of sickle cell anemia, specifically that a mutation in the gene coding for hemoglobin causes a substitution that changes one amino acid in hemoglobin. This results in sickled red blood cells that are less efficient at transporting gases, but provides some resistance to malaria.
AP BIOLOGY MENDELIAN GENETICS AND 2 Student Packet.pdf
Gregor Mendel conducted experiments on pea plants that demonstrated basic principles of heredity. He found that traits are transmitted through discrete factors (now called genes) and that these factors assort and segregate independently during the formation of gametes. Mendel's work established the foundations of classical or Mendelian genetics, including the laws of segregation and independent assortment. Later, scientists developed additional genetic concepts and tools, such as genetic linkage maps and the chi-square test, which allow for more sophisticated analysis of inheritance patterns.
Heredity and Evolution class 10 Science Study Material pdf download
Heredity is the fascinating study of how traits are passed down from one generation to the next. It forms the foundation for understanding the similarities and differences among living organisms, providing insights into the mechanisms of inheritance. From the color of our eyes to the texture of our hair, heredity influences a wide array of physical and physiological characteristics in all living beings.
For more information, visit-www.vavaclasses.com
05 basics of_linkagemapping
This document discusses linkage and gene mapping. It defines linkage as two genes being located on the same chromosome. Recombination during meiosis can result in new combinations of alleles, reducing linkage. Linkage disequilibrium occurs when alleles at different loci are non-randomly associated. Genetic markers can be mapped relative to each other by determining recombination fractions between them and using a mapping function to place them on a genetic map in centiMorgans. The maximum likelihood method is used to estimate recombination fractions when linkage phases are unknown.
Genetic Linkage
The document discusses genetic recombination and gene linkage. During meiosis, homologous chromosomes pair up and may exchange genetic material through crossing over. Tracking how closely linked genes segregate during crosses allows their relative positions on chromosomes to be determined. Genetic markers are used to infer the presence of other linked genes. Independent assortment of chromosomes leads to many possible combinations of alleles in gametes. The analysis of crosses differs depending on whether genes are on the same or different chromosomes. Recombination frequency between linked genes can be measured and used to create genetic maps.
Genetic fine str. analysis & complementation
The concept of the gene has evolved over time based on experimental evidence:
1. Early views were that a gene equals one character (Mendel) or metabolic function (Garrod).
2. Experiments in the 1940s-50s showed genes encode enzymes or polypeptides.
3. Benzer's experiments in the 1950s-60s demonstrated that genes have fine structure and recombination can occur within genes, not just between genes. The nucleotide, not the gene, is the basic unit of genetic structure.
4. Complementation tests show a gene is the basic unit of function, though it can be divided into smaller functional units (cistrons). Alternative splicing further complicates the
Alignment of pairs of sequence (Types of Similarity Sequences)
Types of Similarity sequences,
1. Homology ( Homologous sequences )
Orthology ( Orthologous sequences )
Paralogy ( Paralogous sequences )
2. Analogy ( Analogous sequences )
3. Xenelogy ( Xenelogous sequences )
All explained briefly with examples.
Ch 12 gene linkage groups and practice problems
1. The document discusses genetics concepts like linkage groups, chromosome mapping, parental and recombinant types. It provides examples of genetic crosses in pea plants and fruit flies to demonstrate these concepts.
2. Recombinant types result from crossovers during meiosis, where alleles switch positions on homologous chromosomes. The frequency of recombinants allows calculation of distance between genes.
3. A sample genetics problem is presented, asking the reader to analyze a dihybrid cross in pea plants and determine the chromosome arrangement and distance between genes.
Complementation of defined mutations
A complementation test (sometimes called a "cis-trans" test) can be used to test whether the mutations in two strains are in different genes. By taking an example of Benzer's work, complementation has been explained.
NonMendelian Genetics Part2
The document discusses several patterns of non-Mendelian inheritance including incomplete dominance, codominance, multiple alleles, and sex-linked traits. These patterns do not follow Mendel's laws of simple dominance and recessive inheritance. Incomplete dominance results in an intermediate phenotype, codominance shows both parental traits simultaneously, multiple alleles involve more than two allele choices for a trait, and sex-linked traits are inherited through the X chromosome.
Linkage and Recombination.ppt
Genes located on the same chromosome tend to be inherited together due to their physical linkage on the chromosome. However, linkage can be broken during meiosis via recombination between homologous chromosomes through the process of crossover. Recombination results in new combinations of parental alleles and limits the types of gametes produced under conditions of complete linkage. Morgan's experiments with Drosophila provided evidence of this by demonstrating non-Mendelian inheritance ratios when genes were linked versus unlinked.
Linkage and crossing over.. Dr. krishna
Cell Biology and Genetics. linkage and crossing over, type. brief notes for B.Sc., biotechnology students. pea plant and Drosophila
10.2 inherritance
This document discusses inheritance and related concepts. It defines key terms like linked genes, which are genes located on the same chromosome. When genes are linked, they may assort independently during meiosis leading to recombinants. It also discusses polygenic inheritance where multiple genes influence traits, often resulting in continuous variation. The document provides examples of dihybrid crosses using Punnett squares and sex-linked inheritance from Thomas Morgan's experiments with fruit flies. Homework includes defining terms and working exercises on linked genes and dihybrid crosses.
genetics-150405024530-conversion-gate01.pdf
Genetics is the branch of biology that deals with heredity and variation of traits among organisms. It studies how genes are transmitted from parents to offspring. The basic units of heredity are genes, and genes are made up of DNA. Genes carry the instructions to make proteins and control traits. Genetic disorders occur due to mutations or changes in genes that can be inherited. Some examples of genetic disorders include sickle cell anemia, cystic fibrosis, and Huntington's disease.
Life science grade 12
slides to share if your interested in learning more about life science and please feel free to ague where is neccesary
Genetics_-_Neo_Mendelism.pptx
This document provides an introduction to gene interactions, also known as neo-Mendelism or post-Mendelian genetics. It discusses how multiple gene pairs can interact to influence a single trait, modifying Mendel's expected inheritance ratios. Specifically, it describes different types of gene interactions including dominance, epistasis, inhibitory genes, masking genes, complementary/duplicate recessive genes, and duplicate dominant genes. These gene interactions result in non-Mendelian inheritance ratios such as 9:3:4, 13:3, 12:3:1, 9:7, and 15:1. The document uses examples from coat color in mice, feather color in fowl, and flower color in sweet peas to illustrate these concepts
Non additive gene action
Gene interactions occur when the expression of one gene depends on the presence or absence of another gene. There are several types of non-additive gene interactions:
1. Dominance - one allele masks the other (e.g. complete, incomplete, overdominance)
2. Epistasis - genes at different loci interact so one gene masks the other (e.g. supplementary, complementary, inhibitory, duplicate, masking)
3. Examples include flower color in sweet peas (complementary), anthocyanin in rice (inhibitory), and fruit shape in summer squash (polymeric).
Unit3 genetics
1) Genes are segments of DNA that contain information for hereditary traits and are located on chromosomes. Genes are transmitted from parents to offspring through gametes and each gene has alternative forms called alleles.
2) An individual's genotype refers to their combination of genes, while their phenotype is the observable traits. Phenotype depends on both genotype and environment.
3) Through his experiments with pea plants, Mendel discovered three laws of inheritance: the Law of Uniformity, the Law of Segregation, and the Law of Independent Assortment. These laws explain the basic principles of genetic inheritance and transmission of traits from parents to offspring.
Neo-Mendelian Inheritance.pptx
This document discusses non-Mendelian patterns of inheritance in genetics. It defines non-Mendelian inheritance as patterns that do not follow Mendel's laws. Several types of non-Mendelian inheritance are described, including codominance, incomplete dominance, overdominance, multiple allelism, lethal genes, and epistasis. Examples are provided for each type. The document also includes sample problems and their solutions to illustrate concepts like codominance and multiple allelism.
Genetics From Genes to Genomes 6th Edition hartwell Solutions Manual
Full download : https://alibabadownload.com/product/genetics-from-genes-to-genomes-6th-edition-hartwell-solutions-manual/
Genetics From Genes to Genomes 6th Edition hartwell Solutions Manual
Similar to Answer(D) They are performed with linked genes but not with unlin.pdf (20)
AP BIOLOGY MENDELIAN GENETICS AND 2 Student Packet.pdf
AP BIOLOGY MENDELIAN GENETICS AND 2 Student Packet.pdf
Heredity and Evolution class 10 Science Study Material pdf download
Heredity and Evolution class 10 Science Study Material pdf download
Alignment of pairs of sequence (Types of Similarity Sequences)
Alignment of pairs of sequence (Types of Similarity Sequences)
Genetics From Genes to Genomes 6th Edition hartwell Solutions Manual
Genetics From Genes to Genomes 6th Edition hartwell Solutions Manual
More from rdtraders2007
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
The document shows the step-by-step solution to simplify the expression (7x*14x)^1/2. It first writes the expression as (7x*14x)^1/2, then simplifies the terms inside the radical to get (2*7*7*x^2)^1/2, and finally further simplifies the terms to get the final expression of 7x(2)^1/2.
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids.
Solution
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids..
wait, i am posting the solution.Solutionwait, i am posting the.pdf
This very short document does not provide any substantive information to summarize in 3 sentences or less. It simply states that the author is waiting to post a solution, but does not provide any details on the problem or nature of the solution.
There are many other contributing factors to the norms of culture th.pdf
There are many other contributing factors to the norms of culture that assert the statement
Solution
There are many other contributing factors to the norms of culture that assert the statement.
Thermal dimorphism is the capacity to form different structures at d.pdf
Thermal dimorphism is the capacity to form different structures at different temperatures. For
example, some fungi exhibit thermal dimorphism. They exist as molds when outside the human
body and as yeasts when they are in the human body. For example Penicillium marneffei grows
at room temperature as a mold and, it grows as yeast at body temperature.
The morphologic shift between hyphae or molds and yeast is the significant step for the
virulence, pathogenesis, and lifecycle of the dimorphic fungi. In the soil, the thermally dimorphic
fungi grow at 22–25°C as mycelia that produce infectious spores. Following soil disturbance,
aerosolized spores inhaled into the lungs of a mammalian host at 37°C convert to yeast to cause
pneumonia and various disorders.
Solution
Thermal dimorphism is the capacity to form different structures at different temperatures. For
example, some fungi exhibit thermal dimorphism. They exist as molds when outside the human
body and as yeasts when they are in the human body. For example Penicillium marneffei grows
at room temperature as a mold and, it grows as yeast at body temperature.
The morphologic shift between hyphae or molds and yeast is the significant step for the
virulence, pathogenesis, and lifecycle of the dimorphic fungi. In the soil, the thermally dimorphic
fungi grow at 22–25°C as mycelia that produce infectious spores. Following soil disturbance,
aerosolized spores inhaled into the lungs of a mammalian host at 37°C convert to yeast to cause
pneumonia and various disorders..
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
The prime factor of 210=2*3*5*7
Anyways, numbers can only be divided by their prime factors or combinations of their prime
factors and it is divisible by all of them
Now let n = n_1 * n_2 * ... * n_k
Then n * n=n^2 =( n_1 * n_2 * ... * n_k) *( n_1 * n_2 * ... * n_k) are all the prime numbers that
divide n^2 and no other prime number can divide them (or it would be in that multiplication).
Because 210 is a multiplication of prime factors (2*3*5*7) that divides n^2, then 210 must be in
that multiplication. Hence 210 divides n.
Solution
The prime factor of 210=2*3*5*7
Anyways, numbers can only be divided by their prime factors or combinations of their prime
factors and it is divisible by all of them
Now let n = n_1 * n_2 * ... * n_k
Then n * n=n^2 =( n_1 * n_2 * ... * n_k) *( n_1 * n_2 * ... * n_k) are all the prime numbers that
divide n^2 and no other prime number can divide them (or it would be in that multiplication).
Because 210 is a multiplication of prime factors (2*3*5*7) that divides n^2, then 210 must be in
that multiplication. Hence 210 divides n..
The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
The OSI Reference Model layers, in order from top to bottom
D. Application, Presentation, Session, Transport, Network, Data Link, Physical
1. Application Layer
topmost layer of the OSI reference model, is the application layer. This layer directly support
user applications, like software for file transfers, database access, and e-mail. It serves as a
window through which application processes can access network services.
2.Presentation Layer
It defines the format used to exchange data among networked computers. It is a network\'s
translator. When dissimilar systems want to communicate, certain translation and byte reordering
is done. It translates data from the format from the application layer into a recognized format. At
the receiving computer, this layer translates intermediary format into format that can be useful to
that computer\'s application layer.
3. Session Layer
It allows two applications on different computers to open, use, and close a connection called a
session. It performs name-recognition and other functions, such as security, that are needed to
allow two applications to communicate over the network.
4. Transport Layer
It provides an additional connection level beneath the session layer. It ensures that packets are
delivered error free, in sequence, and without losses or duplications. At the sending computer,
this layer repackages messages, dividing long messages into several packets and collecting small
packets together in one package. T
5. Network Layer
It is responsible for addressing messages and translating logical addresses and names into
physical addresses. This layer also determines the route from the source to the destination
computer. It determines which path the data should take based on network conditions
6. Data-Link Layer
It sends data frames from the network layer to the physical layer. It controls the electrical
impulses that enter and leave the network cable. On the receiving end, the data-link layer
packages raw bits from the physical layer into data frames.
7. Physical Layer
This layer transmits the unstructured, raw bit stream over a physical medium (such as the
network cable). The physical layer is totally hardware-oriented and deals with all aspects of
establishing and maintaining a physical link between communicating computers. The physical
layer also carries the signals that transmit data generated by each of the higher layers.
Solution
The OSI Reference Model layers, in order from top to bottom
D. Application, Presentation, Session, Transport, Network, Data Link, Physical
1. Application Layer
topmost layer of the OSI reference model, is the application layer. This layer directly support
user applications, like software for file transfers, database access, and e-mail. It serves as a
window through which application processes can access network services.
2.Presentation Layer
It defines the format used to exchange data among networked computers. It is a network\'s
translator. When dissimilar systems want .
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an interrupt signal on
the bus when it requires CPU’s attention.
Programmed I/O :
* It is used only in low end microcomputers.
* It has only single output and single input instruction.
* In this procees each instructions selects one I/O device and transfers a single character (byte).
Working:
I/O operation is requested by CPU.
Operation is performed by I/O module.
Status bits is being set by I/O module
Status bits are checked periodically by CPU.
CPU is not directly informed by I/O module.
CPU is not interrupted by I/O module.
CPU may wait or come back after some time.
Advantages :
It is easy to program and understand.
Disadvantages :
It has single input and single output instruction.
CPU spends most of its time in a tight loop waiting for the device to become ready.(Busy
Waiting)
Interrupt-driven I/O
Advantages :
Fast and efficient
Disadvantages :
* Interrupting a running process is an expensive business (requires saving context).
* Requires extra hardware (DMA controller chip).
Working :
CPU is interupted bye the I/O module.
Data is requested by CPU.
The data is trasferres by I/O module.
DMA ensures that CPU grants I/O module authority to read from or write to memory without
involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Solution
Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an in.
SolutionSolutionSolution.pdf
The document discusses a solution to an unspecified problem. It states that the solution involves taking certain steps, but provides no details on what the actual problem or steps are. The summary is unable to extract any meaningful information due to the lack of context and specifics provided in the document.
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
The document shows how to calculate the slope of a linear function by taking the change in y-values (f(x)) over the change in x-values. It gives an example where f(x) is 120 and x is 12, so the slope is 120/12 = 10. The slope is calculated to be 10.
Question not visible. Please update the question and then i can answ.pdf
Question not visible. Please update the question and then i can answer it
Solution
Question not visible. Please update the question and then i can answer it.
Please find the required program along with the comments against eac.pdf
Please find the required program along with the comments against each line, also find the output
at last :
#include
#include
#include
#include
using namespace std;
void listCodonPositions(string dna, string codon){
vector positions; // holds all the positions that codon occurs within dna
size_t pos = dna.find(codon, 0); // finds the first occurance of codon
if(pos != string::npos) //if no codon is found
cout << pos << \" \" << flush;
else
cout << \"No occurance\" << flush;
while(pos != string::npos) //iterate till no occurance is found in a dna
{
pos = dna.find(codon,pos+1); //find next occurance
if(pos != string::npos) //if no codon is found
cout << pos << \" \" << flush;
}
cout << endl;
}
int main()
{
string humanDNA =
\"CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCA
GCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGA
CCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTT
CCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTG
TCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAGCTGAGCACTGGAGTGGAG
TTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATG\";
string mouseDNA =
\"CGCAATTTTTACTTAATTCTTTTTCTTTTAATTCATATATTTTTAATATGTTTACTAT
TAATGGTTATCATTCACCATTTAACTATTTGTTATTTTGACGTCATTTTTTTCTATTTC
CTCTTTTTTCAATTCATGTTTATTTTCTGTATTTTTGTTAAGTTTTCACAAGTCTAATA
TAATTGTCCTTTGAGAGGTTATTTGGTCTATATTTTTTTTTCTTCATCTGTATTTTTAT
GATTTCATTTAATTGATTTTCATTGACAGGGTTCTGCTGTGTTCTGGATTGTATTTTTC
TTGTGGAGAGGAACTATTTCTTGAGTGGGATGTACCTTTGTTCTTG\";
string unknownDNA =
\"CGCATTTTTGCCGGTTTTCCTTTGCTGTTTATTCATTTATTTTAAACGATATTTATAT
CATCGGGTTTCATTCACTATTTTTCTTTTCGATAAATTTTTGTCAGCATTTTCTTTTAC
CTCTTCTTTCTGTTTATGTTAATTTTCTGTTTCTTAACCCAGTCTTCTCGATTCTTATCT
ACCGGACCTATTATAGGTCACAGGGTCTTGATGCTTTGGTTTTCATCTGCAAGAGTCT
GACTTCCTGCTAATGCTGTTCTGTGTCAGGGTGCATCTGAGCACTGATGTGGAGTTTT
CTTGTGGATATGAGCCATTCATAGTGTGGGATGTGCCATAGTTCATG\";
string codon;
cout << \"Enter codon : \" << endl;
cin >> codon;
char exit[] = \"*\";
while(strcmp(codon.c_str(),exit)!=0){
cout << \"Occurances in humanDNA : \"<< endl;
listCodonPositions(humanDNA,codon);
cout << \"Occurances in mouseDNA : \"<< endl;
listCodonPositions(mouseDNA,codon);
cout << \"Occurances in unknownDNA : \"<< endl;
listCodonPositions(unknownDNA,codon);
cout << \"Enter codon : \" << endl;
cin >> codon;
}
}
--------------------------------------------------------------------------------
OUTPUT :
Enter codon :
AAA
Occurances in humanDNA :
3 43
Occurances in mouseDNA :
No occurance
Occurances in unknownDNA :
43 91
Enter codon :
TGC
Occurances in humanDNA :
8 22 31 52 95 141 208 224 248 258 266 310
Occurances in mouseDNA :
269
Occurances in unknownDNA :
8 22 208 224 242 248 266 326
Enter codon :
*
Solution
Please find the required program along with the comments against each line, also find the output
at last :
#include
#include
#include
#include
using namespace std;
void listCodonPositions(string dna, string codon){
vector positions; // holds all the positions that codon occurs within dna
size_t pos = dna.find(codon, 0); // finds the first oc.
Order the steps of the viral life cycle.1. viral entry into host.pdf
Order the steps of the viral life cycle.
1. viral entry into host
2. disassembly of virus
3. replication of virus
4. transcription of virus
5. assembly of new viral units
6. release of new virus
Order these human vaccines by year of introduction from earliest to most recent.
1. Smallpox - 1796
2. plague - 1890
3. tetanus - 1930
4. polio - 1955
5. rubella - 1963
Question 10.
Gamma rays and X rays are ionizing radiations
Question 13.
The disadvantages of intravenous injection for drug administration are:
Risk of overdose
Risk of infection
Solution
Order the steps of the viral life cycle.
1. viral entry into host
2. disassembly of virus
3. replication of virus
4. transcription of virus
5. assembly of new viral units
6. release of new virus
Order these human vaccines by year of introduction from earliest to most recent.
1. Smallpox - 1796
2. plague - 1890
3. tetanus - 1930
4. polio - 1955
5. rubella - 1963
Question 10.
Gamma rays and X rays are ionizing radiations
Question 13.
The disadvantages of intravenous injection for drug administration are:
Risk of overdose
Risk of infection.
Listing of the type of alleles present in an organisms cellGenotyp.pdf
Listing of the type of alleles present in an organisms cell
Genotype
The allele for polydactylism (extra finger or toe) is expressed to different digrees in different
individuals that have it
Variable expressivity
Height in humans is determined by the interaction of genes on different loci
Polygenic inheritance
Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB
Codominance
All the genes in a cell of organism
Genome
Solution
Listing of the type of alleles present in an organisms cell
Genotype
The allele for polydactylism (extra finger or toe) is expressed to different digrees in different
individuals that have it
Variable expressivity
Height in humans is determined by the interaction of genes on different loci
Polygenic inheritance
Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB
Codominance
All the genes in a cell of organism
Genome.
An Operating System (OS) is an interface between a computer user and.pdf
An Operating System (OS) is an interface between a computer user and computer hardware. An
operating system is a software which performs all the basic tasks like file management, memory
management, process management, handling input and output.
The kernel is a used for operating system need to be protected from user programs to maintain
the proper operation of the computer system .The kernel is a computer program that constitutes
the central core of a computer\'s operating system. It has complete control over everything that
occurs in the system.As such, it is the first program loaded on startup, and then manages the
remainder of the startup, as well as input/output requests from software, translating them into
data processing instructions for the central processing unit.
kernel is usually loaded into a protected area of memory, which prevents it from being
overwritten by other, less frequently used parts of the operating system or by applications. The
kernel performs its tasks, such as executing processes and handling interrupts, in kernel space,
whereas everything a user normally does, such as writing text in a text editor or running
programs in a GUI, is done in user space. This separation prevents user data and kernel data from
interfering with each other and thereby diminishing performance or causing the system to
become unstable.
Solution
An Operating System (OS) is an interface between a computer user and computer hardware. An
operating system is a software which performs all the basic tasks like file management, memory
management, process management, handling input and output.
The kernel is a used for operating system need to be protected from user programs to maintain
the proper operation of the computer system .The kernel is a computer program that constitutes
the central core of a computer\'s operating system. It has complete control over everything that
occurs in the system.As such, it is the first program loaded on startup, and then manages the
remainder of the startup, as well as input/output requests from software, translating them into
data processing instructions for the central processing unit.
kernel is usually loaded into a protected area of memory, which prevents it from being
overwritten by other, less frequently used parts of the operating system or by applications. The
kernel performs its tasks, such as executing processes and handling interrupts, in kernel space,
whereas everything a user normally does, such as writing text in a text editor or running
programs in a GUI, is done in user space. This separation prevents user data and kernel data from
interfering with each other and thereby diminishing performance or causing the system to
become unstable..
Internal Evidence General.pdf
Internal Evidence General Ledger Files canceled Payrolled
Checks Payroll time records Receiving Reports Minutes of the Board of
Directors Cancelled Notes Payable
External Evidence Vendors Invoices Bank Statements
Purchase Requisitions Remittance Advices Signed Leased Agreements
Duplicate Copies of bills of Lading Notes Receivable
External Evidence are more reliable than the internal evidences because External evidences
are the evidences which we gets from the third party there is no involvement of the
management or employee of the organisations. Internal Evidences are prepared internally
within the organisation and the chances of manipulation in internal evidences are more than
the external evidences.
Solution
Internal Evidence General Ledger Files canceled Payrolled
Checks Payroll time records Receiving Reports Minutes of the Board of
Directors Cancelled Notes Payable
External Evidence Vendors Invoices Bank Statements
Purchase Requisitions Remittance Advices Signed Leased Agreements
Duplicate Copies of bills of Lading Notes Receivable
External Evidence are more reliable than the internal evidences because External evidences
are the evidences which we gets from the third party there is no involvement of the
management or employee of the organisations. Internal Evidences are prepared internally
within the organisation and the chances of manipulation in internal evidences are more than
the external evidences..
In reaction # 3 either the cis or trans diol may .pdf
In reaction # 3 either the cis or trans diol may be used as a reactant. These isomers
are rapidly interconverted under the rearrangement conditions, indicating that the initial water
loss is reversible; a result confirmed by isotopic oxygen exchange. The clear preference for a
methylene group shift versus a methyl group shift may reflect inherent migratory aptitudes, or
possibly group configurations in the 3º-carbocation intermediate. In the conformation shown
here both methyl and methylene groups may shift, or an epoxide ring may be formed reversibly.
An alternative chair-like conformation having an equatorial methyl group should be more stable,
but would not be suitable for a methyl shift. The predominant ring contraction is therefore
understandable. Reaction # 4 is an unusual case in which a strained ring contracts to an even
smaller ring. Phenyl groups generally have a high migratory aptitude, so the failure to obtain 2,2-
diphenylcyclobutanone as a product might seem surprising. However, the carbocation resulting
from a phenyl shift would be just as strained as its precursor; whereas the shift of a ring
methylene group generates an unstrained cation stabilized by phenyl and oxygen substituents.
Conjugative stabilization of the phenyl ketone and absence of sp2 hybridized carbon atoms in the
small ring may also contribute to the stability of the observed product. Finally, reaction # 5
clearly shows the influence of reaction conditions on product composition, but explaining the
manner in which different conditions perturb the outcome is challenging. Treatment with cold
sulfuric acid should produce the more stable diphenyl 3º-carbocation, and a methyl group shift
would then lead to the observed product. The action of a Lewis acid in acetic anhydride, on the
other hand, may selectively acetylate the less hindered dimethyl carbinol. In this event the
acetate becomes the favored leaving group (presumably coordinated with acid), followed by a
1,2-phenyl shift. It is reported that the symmetrically substituted isomeric diol (drawn in the
shaded box) rearranges exclusively by a methyl shift, but the configuration of the starting
material was not stated (two diastereomers are possible). Because of the influence of other
factors (above), it has not been possible to determine an unambiguous migratory order for
substituents in the pinacol rearrangement. However, some general trends are discernible.
Benzopinacol, (C6H5)2C(OH)C(OH)(C6H5)2, undergoes rapid rearrangement to
(C6H5)3CCOC6H5 under much milder conditions than required for pinacol. Indeed, it is often
the case that phenyl or other aromatic substituents adjacent to a forming carbocation will
facilitate that ionization in the course of their migration to the cationic site. In non-aromatic
compounds of the type (CH3)2C(OH)C(OH)RCH3, migration of R increases in the manner R =
CH3 < R = C2H5 << R = (CH3)3C. Since the shifting alkyl group must carry part of the overall
positive charge, alkyl substit.
Intermolecular forces exist between molecules and.pdf
Intermolecular forces exist between molecules and influence the physical
properties. We can think of H2O in its three forms, ice, water and steam. ... However, the
physical properties of H2O are very different in the three states.
Solution
Intermolecular forces exist between molecules and influence the physical
properties. We can think of H2O in its three forms, ice, water and steam. ... However, the
physical properties of H2O are very different in the three states..
H2 concentration will decrease and H2O concentrat.pdf
H2 concentration will decrease and H2O concentration will increase
Solution
H2 concentration will decrease and H2O concentration will increase.
More from rdtraders2007 (20)
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed.pdf
wait, i am posting the solution.Solutionwait, i am posting the.pdf
wait, i am posting the solution.Solutionwait, i am posting the.pdf
There are many other contributing factors to the norms of culture th.pdf
There are many other contributing factors to the norms of culture th.pdf
Thermal dimorphism is the capacity to form different structures at d.pdf
Thermal dimorphism is the capacity to form different structures at d.pdf
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
Question not visible. Please update the question and then i can answ.pdf
Question not visible. Please update the question and then i can answ.pdf
Please find the required program along with the comments against eac.pdf
Please find the required program along with the comments against eac.pdf
Order the steps of the viral life cycle.1. viral entry into host.pdf
Order the steps of the viral life cycle.1. viral entry into host.pdf
Listing of the type of alleles present in an organisms cellGenotyp.pdf
Listing of the type of alleles present in an organisms cellGenotyp.pdf
An Operating System (OS) is an interface between a computer user and.pdf
An Operating System (OS) is an interface between a computer user and.pdf
In reaction # 3 either the cis or trans diol may .pdf
In reaction # 3 either the cis or trans diol may .pdf
Intermolecular forces exist between molecules and.pdf
Intermolecular forces exist between molecules and.pdf
H2 concentration will decrease and H2O concentrat.pdf
H2 concentration will decrease and H2O concentrat.pdf
Recently uploaded
clinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...Nguyen Thanh Tu Collection
https://app.box.com/s/qhtvq32h4ybf9t49ku85x0n3xl4jhr15South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)Academy of Science of South Africa
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.Pengantar Penggunaan Flutter - Dart programming language1.pptx
Pengantar Penggunaan Flutter - Dart programming language1.pptx
ANATOMY AND BIOMECHANICS OF HIP JOINT.pdf
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
How to Fix the Import Error in the Odoo 17
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
How to Manage Your Lost Opportunities in Odoo 17 CRM
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
Advanced Java[Extra Concepts, Not Difficult].docx
This is part 2 of my Java Learning Journey. This contains Hashing, ArrayList, LinkedList, Date and Time Classes, Calendar Class and more.
Wound healing PPT
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
Chapter wise All Notes of First year Basic Civil Engineering.pptx
Chapter wise All Notes of First year Basic Civil Engineering
Syllabus
Chapter-1
Introduction to objective, scope and outcome the subject
Chapter 2
Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country.
Chapter 3
Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements.
Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station.
Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps.
Chapter 4
Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation
Chapter 5
Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures.
Chapter 6
Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems.
Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect
Text Books:
1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers.
2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers.
3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House.
4. BCP, Surveying volume 1
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...Nguyen Thanh Tu Collection
https://app.box.com/s/y977uz6bpd3af4qsebv7r9b7s21935vdBÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...Nguyen Thanh Tu Collection
https://app.box.com/s/tacvl9ekroe9hqupdnjruiypvm9rdaneMain Java[All of the Base Concepts}.docx
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh
Recently uploaded (20)
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)
Pengantar Penggunaan Flutter - Dart programming language1.pptx
Pengantar Penggunaan Flutter - Dart programming language1.pptx
Liberal Approach to the Study of Indian Politics.pdf
Liberal Approach to the Study of Indian Politics.pdf
How to Manage Your Lost Opportunities in Odoo 17 CRM
How to Manage Your Lost Opportunities in Odoo 17 CRM
Chapter wise All Notes of First year Basic Civil Engineering.pptx
Chapter wise All Notes of First year Basic Civil Engineering.pptx
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx
NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
Answer(D) They are performed with linked genes but not with unlin.pdf
- 1. Answer: (D) They are performed with linked genes but not with unlinked genes; The complementation test is also called as cis-trans test. It is used to determine whether two mutations associated with a specific phenotype represent two different forms of the same gene (alleles) (AB/ab) or are variations of two different genes (Ab/aB). The complementation will not occur if the mutations are in the same gene It is relevant for recessive traits (traits normally not present in the phenotype due to masking by a dominant allele). Solution Answer: (D) They are performed with linked genes but not with unlinked genes; The complementation test is also called as cis-trans test. It is used to determine whether two mutations associated with a specific phenotype represent two different forms of the same gene (alleles) (AB/ab) or are variations of two different genes (Ab/aB). The complementation will not occur if the mutations are in the same gene It is relevant for recessive traits (traits normally not present in the phenotype due to masking by a dominant allele).