The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
•
0 likes•3 views
The OSI Reference Model layers, in order from top to bottom D. Application, Presentation, Session, Transport, Network, Data Link, Physical 1. Application Layer topmost layer of the OSI reference model, is the application layer. This layer directly support user applications, like software for file transfers, database access, and e-mail. It serves as a window through which application processes can access network services. 2.Presentation Layer It defines the format used to exchange data among networked computers. It is a network\'s translator. When dissimilar systems want to communicate, certain translation and byte reordering is done. It translates data from the format from the application layer into a recognized format. At the receiving computer, this layer translates intermediary format into format that can be useful to that computer\'s application layer. 3. Session Layer It allows two applications on different computers to open, use, and close a connection called a session. It performs name-recognition and other functions, such as security, that are needed to allow two applications to communicate over the network. 4. Transport Layer It provides an additional connection level beneath the session layer. It ensures that packets are delivered error free, in sequence, and without losses or duplications. At the sending computer, this layer repackages messages, dividing long messages into several packets and collecting small packets together in one package. T 5. Network Layer It is responsible for addressing messages and translating logical addresses and names into physical addresses. This layer also determines the route from the source to the destination computer. It determines which path the data should take based on network conditions 6. Data-Link Layer It sends data frames from the network layer to the physical layer. It controls the electrical impulses that enter and leave the network cable. On the receiving end, the data-link layer packages raw bits from the physical layer into data frames. 7. Physical Layer This layer transmits the unstructured, raw bit stream over a physical medium (such as the network cable). The physical layer is totally hardware-oriented and deals with all aspects of establishing and maintaining a physical link between communicating computers. The physical layer also carries the signals that transmit data generated by each of the higher layers. Solution The OSI Reference Model layers, in order from top to bottom D. Application, Presentation, Session, Transport, Network, Data Link, Physical 1. Application Layer topmost layer of the OSI reference model, is the application layer. This layer directly support user applications, like software for file transfers, database access, and e-mail. It serves as a window through which application processes can access network services. 2.Presentation Layer It defines the format used to exchange data among networked computers. It is a network\'s translator. When dissimilar systems want .
Report
Share
Report
Share
Download to read offline
Recommended
Topology Chapter 2.pptx
The document describes the OSI reference model, which defines seven layers of network communication from the physical layer to the application layer. Each layer provides services to the layer above it and receives services from the layer below. The physical layer transmits raw bits of data and the application layer supports user applications. Between these layers are the data link layer, network layer, transport layer, session layer, and presentation layer, each of which performs specific functions to prepare data for transmission across a network. Protocols like TCP and IP operate at different layers to ensure reliable and ordered delivery of data packets from one device to another.
Presentation on osi layer
All in ppt for OSI layer. All layers is explained in very easy manner. TCP/IP comparison is also mentioned
OSI Model and TCP/IP Model.
The OSI Model (Open Systems Interconnection Model) is a conceptual framework used to describe the functions of a networking system. The OSI model characterizes computing functions into a universal set of rules and requirements in order to support interoperability between different products and software. In the OSI reference model, the communications between a computing system are split into seven different abstraction layers: Physical, Data Link, Network, Transport, Session, Presentation, and Application.
TCP/IP Model helps you to determine how a specific computer should be connected to the internet and how data should be transmitted between them. It helps you to create a virtual network when multiple computer networks are connected together. The purpose of the TCP/IP model is to allow communication over large distances.
OSI model
The document describes the seven layers of the OSI model:
1. The physical layer is responsible for the movements of individual bits from one hop to the next.
2. The data link layer is responsible for moving frames from one hop to the next.
3. The network layer is responsible for the delivery of individual packets from the source host to the destination host.
Osi model
The document discusses the seven layers of the OSI model:
1. The physical layer is responsible for the movements of individual bits from one node to the next.
2. The data link layer is responsible for moving frames from one node to the next.
3. The network layer is responsible for the delivery of individual packets from the source host to the destination host.
Osi model
The document describes the seven layers of the OSI model:
1. The physical layer is responsible for the movements of individual bits from one node to the next.
2. The data link layer is responsible for moving frames from one node to the next.
3. The network layer is responsible for the delivery of individual packets from the source host to the destination host.
Osi model and tcpip model.
The document summarizes the OSI model and TCP/IP model. The OSI model has 7 layers (physical, data link, network, transport, session, presentation, application) that define a framework for network architecture. The TCP/IP model has 4 layers (application, transport, internet, network interface) and focuses on data transmission between networked computers. Both models break communication functions into layers to define protocols and network interactions.
OSI Model
The document discusses the 7-layer OSI model, which characterizes and standardizes communication functions across different systems to enable interoperability. It describes each of the 7 layers - physical, data link, network, transport, session, presentation, and application layer - and their respective roles and functions in managing the flow of data from one application to another. Each layer provides services to the layer above and receives services from the layer below, with layers 1-4 relating to communications technologies and layers 5-7 relating to user applications.
Recommended
Topology Chapter 2.pptx
The document describes the OSI reference model, which defines seven layers of network communication from the physical layer to the application layer. Each layer provides services to the layer above it and receives services from the layer below. The physical layer transmits raw bits of data and the application layer supports user applications. Between these layers are the data link layer, network layer, transport layer, session layer, and presentation layer, each of which performs specific functions to prepare data for transmission across a network. Protocols like TCP and IP operate at different layers to ensure reliable and ordered delivery of data packets from one device to another.
Presentation on osi layer
All in ppt for OSI layer. All layers is explained in very easy manner. TCP/IP comparison is also mentioned
OSI Model and TCP/IP Model.
The OSI Model (Open Systems Interconnection Model) is a conceptual framework used to describe the functions of a networking system. The OSI model characterizes computing functions into a universal set of rules and requirements in order to support interoperability between different products and software. In the OSI reference model, the communications between a computing system are split into seven different abstraction layers: Physical, Data Link, Network, Transport, Session, Presentation, and Application.
TCP/IP Model helps you to determine how a specific computer should be connected to the internet and how data should be transmitted between them. It helps you to create a virtual network when multiple computer networks are connected together. The purpose of the TCP/IP model is to allow communication over large distances.
OSI model
The document describes the seven layers of the OSI model:
1. The physical layer is responsible for the movements of individual bits from one hop to the next.
2. The data link layer is responsible for moving frames from one hop to the next.
3. The network layer is responsible for the delivery of individual packets from the source host to the destination host.
Osi model
The document discusses the seven layers of the OSI model:
1. The physical layer is responsible for the movements of individual bits from one node to the next.
2. The data link layer is responsible for moving frames from one node to the next.
3. The network layer is responsible for the delivery of individual packets from the source host to the destination host.
Osi model
The document describes the seven layers of the OSI model:
1. The physical layer is responsible for the movements of individual bits from one node to the next.
2. The data link layer is responsible for moving frames from one node to the next.
3. The network layer is responsible for the delivery of individual packets from the source host to the destination host.
Osi model and tcpip model.
The document summarizes the OSI model and TCP/IP model. The OSI model has 7 layers (physical, data link, network, transport, session, presentation, application) that define a framework for network architecture. The TCP/IP model has 4 layers (application, transport, internet, network interface) and focuses on data transmission between networked computers. Both models break communication functions into layers to define protocols and network interactions.
OSI Model
The document discusses the 7-layer OSI model, which characterizes and standardizes communication functions across different systems to enable interoperability. It describes each of the 7 layers - physical, data link, network, transport, session, presentation, and application layer - and their respective roles and functions in managing the flow of data from one application to another. Each layer provides services to the layer above and receives services from the layer below, with layers 1-4 relating to communications technologies and layers 5-7 relating to user applications.
BAPANKAR15800121011 SOFT.pptx
The document discusses the Open Systems Interconnection (OSI) model, which defines seven layers of network architecture - physical, data link, network, transport, session, presentation, and application. It describes the key functions of each layer, such as the physical layer dealing with physical connections and bits, the data link layer handling framing and addressing, and the application layer providing services to end users. The purpose of the OSI model is to facilitate communication between different computer systems by dividing the network communication process into standardized layers.
The Osi Model
The OSI model was developed by ISO to establish a common way for different networks and systems to communicate. It is a 7 layer model where each layer has a specific function. The physical layer deals with transmitting raw bits of data and the application layer deals with processes and programs. The layers in between ensure data is packaged and transmitted reliably and efficiently between applications on different systems. The OSI model provides a standard framework for designing network protocols and allows systems from different vendors to communicate through the use of common protocols at each layer.
OSI Reference Model
The Open Systems Interconnection (OSI) model describes seven layers that computer systems use to communicate over a network. It was the first standard model for network communications, adopted by all major computer and telecommunication companies in the early 1980s.
In this PPT, you will be able to get complete, short & sweet slides of OSI Model...
OSI MODEL
Osi Model,introduction,seven layers,protocol,physical layer,data link layer,network layer,transport layer,presentation layer,application layer,TCP/IP protocols,conclusion
OSI MODEL
Introduction,OSI Model,Seven Layers of OSI Model,Protocols, TCP/IP Layers,Physical layer,Data link layer,Network layer,Transport layer,Session layer,Presentation layer,Application layer,Conclusion
Assignment3
The document discusses the OSI model which defines 7 layers of abstraction for networking including the physical, data link, network, transport, session, presentation and application layers. It then explains each of these layers and their functions. The document also covers the TCP/IP model which has 4 layers - application, transport, internet and network interface layers - and describes the purpose and role of each layer.
Class work4
The document discusses the OSI (Open Systems Interconnection) model, which is a reference model for how applications communicate over a network. It describes the 7 layers of the OSI model from physical to application layer. The physical layer deals with transmitting raw data bits. The data link layer packages data into frames and corrects errors. The network layer routes frames between networks using logical addresses. The transport layer manages data packet delivery and error checking.
THE OSI MODEL
The document discusses the OSI model, which is a conceptual framework that characterizes computing functions into seven abstraction layers to support interoperability between network systems. The seven layers are the physical, data link, network, transport, session, presentation, and application layers. Each layer has a specific role, with the physical layer concerned with transmitting raw data and the application layer allowing direct interaction between software applications and users.
006 Osi Model
The document provides an overview of the seven-layer OSI model for computer networking. It describes each layer and its functions, including the physical, data link, network, transport, session, presentation and application layers. The physical layer defines cable specifications, the data link layer provides addressing and error detection, and the network layer enables routing between different networks using logical addresses. Higher layers include the transport layer for reliable data transmission, and the session, presentation and application layers for establishing communication between applications and presenting data to the end user.
seven layer OSI model
The International Standards Organization (ISO) developed the Open Systems Interconnection (OSI) model. It divides network communication into seven layers. ... Layers 5-7, called the the upper layers, contain application-level data
#imannjeet #mannjeet mn
Networking Standards And Protocols
The document discusses the OSI model, which is a standard framework for network communication. It divides network architecture into seven layers: physical, data link, network, transport, session, presentation, and application. Each layer only communicates with the layers directly above and below it and has a specific set of functions. This layered approach makes networks easier to design, troubleshoot, and maintain when changes are made. The physical layer deals with physical connections and bit transmission. The data link layer organizes bits into frames and controls flow. The network layer decides how data moves between networks. Higher layers ensure reliable and secure delivery of data between applications.
OSI &TCP/IP Model
This is a notes about basic introduction of OSI Model & TCP/IP Model. It contain details about the seven layers of the OSI Model which are Application layer, Presentation Layer, Session Layer, Transport Layer, Network Layer, Data Link Layer, Physical Layer
Osi model in networking
The document is an assignment submission that describes the 7 layers of the OSI model. It begins with assignment details such as the name, course, and student submitting it. It then provides a 3 paragraph overview of the OSI model, describing it as a conceptual framework for networking systems that characterizes functions into 7 abstraction layers: Physical, Data Link, Network, Transport, Session, Presentation, and Application. Each layer is then briefly defined in 1-2 sentences explaining its basic function.
OSI models
The document discusses the OSI model, which is a standard framework for network architecture. The OSI model divides network communication into 7 layers, with each layer building on the services of the layer below. The layers are physical, data link, network, transport, session, presentation, and application. Each layer has a specific role, with lower layers handling physical transmission and higher layers focusing on services for applications and users.
Osi model
The document discusses the OSI model, which is a standard networking framework that defines 7 layers of abstraction to establish communication between devices. The 7 layers are physical, data link, network, transport, session, presentation, and application layers. Each layer provides services to the layer above it and receives services from the layer below it. Data moves down the layers as it is encapsulated with protocol information and back up as headers are stripped at the receiving end. The model separates networking functions and standardizes how systems communicate over a network.
Osi model 1
The document describes the OSI model, which is a standard networking framework that defines 7 layers of communication. The physical layer deals with physical communication and data transmission over a medium. The data link layer handles frame creation and error checking. The network layer implements routing and logical addressing. The transport layer provides reliable data delivery and flow control between applications. The session layer manages dialogues and connections between devices. The presentation layer defines data formats. The application layer supports application software and programs. Overall, the OSI model provides a layered approach to network communication and data transfer.
DCN _ unit 2.pptx
The document discusses communication architectures and protocol layers. It introduces the OSI reference model, which divides communication tasks into 7 layers - physical, data link, network, transport, session, presentation, and application layer. Each layer provides services to the layer above it and communicates with corresponding layers on other systems. The layers simplify complex communication tasks and allow standardized protocols for each layer.
The osi model
The document discusses the seven layers of the OSI model:
1) The physical layer defines physical connections and transmission of raw bit streams.
2) The data link layer provides addressing and error checking for physical transmission between nodes.
3) The network layer establishes logical addressing for routing packets across multiple networks.
4) The transport layer provides end-to-end communication services between applications.
5) The session layer manages communication sessions, including synchronization and maintenance of sessions.
6) The presentation layer handles formatting and encryption of data for applications.
7) The application layer provides interfaces for end users and applications, such as web browsing and email.
Network internet
This document provides an overview of computer networks. It defines what a computer network is and discusses how computers connect and share resources over a network. It describes different types of networks including LANs, MANs, and WANs. The document also covers network devices, transmission media, IP addressing, and performance metrics like latency and bandwidth. In summary, it serves as a high-level introduction to fundamental computer networking concepts.
Networks internet
This document provides an overview of computer networks. It defines what a computer network is and discusses how computers connect and share resources over a network. It also covers different types of networks like LAN, MAN, and WAN. Additionally, it describes common network devices like hubs, switches, routers, and gateways. The document also discusses network topologies, transmission media, and addressing in TCP/IP networks. In summary, it serves as a comprehensive introduction to fundamental computer networking concepts.
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
The document shows the step-by-step solution to simplify the expression (7x*14x)^1/2. It first writes the expression as (7x*14x)^1/2, then simplifies the terms inside the radical to get (2*7*7*x^2)^1/2, and finally further simplifies the terms to get the final expression of 7x(2)^1/2.
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids.
Solution
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids..
More Related Content
Similar to The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
BAPANKAR15800121011 SOFT.pptx
The document discusses the Open Systems Interconnection (OSI) model, which defines seven layers of network architecture - physical, data link, network, transport, session, presentation, and application. It describes the key functions of each layer, such as the physical layer dealing with physical connections and bits, the data link layer handling framing and addressing, and the application layer providing services to end users. The purpose of the OSI model is to facilitate communication between different computer systems by dividing the network communication process into standardized layers.
The Osi Model
The OSI model was developed by ISO to establish a common way for different networks and systems to communicate. It is a 7 layer model where each layer has a specific function. The physical layer deals with transmitting raw bits of data and the application layer deals with processes and programs. The layers in between ensure data is packaged and transmitted reliably and efficiently between applications on different systems. The OSI model provides a standard framework for designing network protocols and allows systems from different vendors to communicate through the use of common protocols at each layer.
OSI Reference Model
The Open Systems Interconnection (OSI) model describes seven layers that computer systems use to communicate over a network. It was the first standard model for network communications, adopted by all major computer and telecommunication companies in the early 1980s.
In this PPT, you will be able to get complete, short & sweet slides of OSI Model...
OSI MODEL
Osi Model,introduction,seven layers,protocol,physical layer,data link layer,network layer,transport layer,presentation layer,application layer,TCP/IP protocols,conclusion
OSI MODEL
Introduction,OSI Model,Seven Layers of OSI Model,Protocols, TCP/IP Layers,Physical layer,Data link layer,Network layer,Transport layer,Session layer,Presentation layer,Application layer,Conclusion
Assignment3
The document discusses the OSI model which defines 7 layers of abstraction for networking including the physical, data link, network, transport, session, presentation and application layers. It then explains each of these layers and their functions. The document also covers the TCP/IP model which has 4 layers - application, transport, internet and network interface layers - and describes the purpose and role of each layer.
Class work4
The document discusses the OSI (Open Systems Interconnection) model, which is a reference model for how applications communicate over a network. It describes the 7 layers of the OSI model from physical to application layer. The physical layer deals with transmitting raw data bits. The data link layer packages data into frames and corrects errors. The network layer routes frames between networks using logical addresses. The transport layer manages data packet delivery and error checking.
THE OSI MODEL
The document discusses the OSI model, which is a conceptual framework that characterizes computing functions into seven abstraction layers to support interoperability between network systems. The seven layers are the physical, data link, network, transport, session, presentation, and application layers. Each layer has a specific role, with the physical layer concerned with transmitting raw data and the application layer allowing direct interaction between software applications and users.
006 Osi Model
The document provides an overview of the seven-layer OSI model for computer networking. It describes each layer and its functions, including the physical, data link, network, transport, session, presentation and application layers. The physical layer defines cable specifications, the data link layer provides addressing and error detection, and the network layer enables routing between different networks using logical addresses. Higher layers include the transport layer for reliable data transmission, and the session, presentation and application layers for establishing communication between applications and presenting data to the end user.
seven layer OSI model
The International Standards Organization (ISO) developed the Open Systems Interconnection (OSI) model. It divides network communication into seven layers. ... Layers 5-7, called the the upper layers, contain application-level data
#imannjeet #mannjeet mn
Networking Standards And Protocols
The document discusses the OSI model, which is a standard framework for network communication. It divides network architecture into seven layers: physical, data link, network, transport, session, presentation, and application. Each layer only communicates with the layers directly above and below it and has a specific set of functions. This layered approach makes networks easier to design, troubleshoot, and maintain when changes are made. The physical layer deals with physical connections and bit transmission. The data link layer organizes bits into frames and controls flow. The network layer decides how data moves between networks. Higher layers ensure reliable and secure delivery of data between applications.
OSI &TCP/IP Model
This is a notes about basic introduction of OSI Model & TCP/IP Model. It contain details about the seven layers of the OSI Model which are Application layer, Presentation Layer, Session Layer, Transport Layer, Network Layer, Data Link Layer, Physical Layer
Osi model in networking
The document is an assignment submission that describes the 7 layers of the OSI model. It begins with assignment details such as the name, course, and student submitting it. It then provides a 3 paragraph overview of the OSI model, describing it as a conceptual framework for networking systems that characterizes functions into 7 abstraction layers: Physical, Data Link, Network, Transport, Session, Presentation, and Application. Each layer is then briefly defined in 1-2 sentences explaining its basic function.
OSI models
The document discusses the OSI model, which is a standard framework for network architecture. The OSI model divides network communication into 7 layers, with each layer building on the services of the layer below. The layers are physical, data link, network, transport, session, presentation, and application. Each layer has a specific role, with lower layers handling physical transmission and higher layers focusing on services for applications and users.
Osi model
The document discusses the OSI model, which is a standard networking framework that defines 7 layers of abstraction to establish communication between devices. The 7 layers are physical, data link, network, transport, session, presentation, and application layers. Each layer provides services to the layer above it and receives services from the layer below it. Data moves down the layers as it is encapsulated with protocol information and back up as headers are stripped at the receiving end. The model separates networking functions and standardizes how systems communicate over a network.
Osi model 1
The document describes the OSI model, which is a standard networking framework that defines 7 layers of communication. The physical layer deals with physical communication and data transmission over a medium. The data link layer handles frame creation and error checking. The network layer implements routing and logical addressing. The transport layer provides reliable data delivery and flow control between applications. The session layer manages dialogues and connections between devices. The presentation layer defines data formats. The application layer supports application software and programs. Overall, the OSI model provides a layered approach to network communication and data transfer.
DCN _ unit 2.pptx
The document discusses communication architectures and protocol layers. It introduces the OSI reference model, which divides communication tasks into 7 layers - physical, data link, network, transport, session, presentation, and application layer. Each layer provides services to the layer above it and communicates with corresponding layers on other systems. The layers simplify complex communication tasks and allow standardized protocols for each layer.
The osi model
The document discusses the seven layers of the OSI model:
1) The physical layer defines physical connections and transmission of raw bit streams.
2) The data link layer provides addressing and error checking for physical transmission between nodes.
3) The network layer establishes logical addressing for routing packets across multiple networks.
4) The transport layer provides end-to-end communication services between applications.
5) The session layer manages communication sessions, including synchronization and maintenance of sessions.
6) The presentation layer handles formatting and encryption of data for applications.
7) The application layer provides interfaces for end users and applications, such as web browsing and email.
Network internet
This document provides an overview of computer networks. It defines what a computer network is and discusses how computers connect and share resources over a network. It describes different types of networks including LANs, MANs, and WANs. The document also covers network devices, transmission media, IP addressing, and performance metrics like latency and bandwidth. In summary, it serves as a high-level introduction to fundamental computer networking concepts.
Networks internet
This document provides an overview of computer networks. It defines what a computer network is and discusses how computers connect and share resources over a network. It also covers different types of networks like LAN, MAN, and WAN. Additionally, it describes common network devices like hubs, switches, routers, and gateways. The document also discusses network topologies, transmission media, and addressing in TCP/IP networks. In summary, it serves as a comprehensive introduction to fundamental computer networking concepts.
Similar to The OSI Reference Model layers, in order from top to bottomD. Appl.pdf (20)
More from rdtraders2007
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
The document shows the step-by-step solution to simplify the expression (7x*14x)^1/2. It first writes the expression as (7x*14x)^1/2, then simplifies the terms inside the radical to get (2*7*7*x^2)^1/2, and finally further simplifies the terms to get the final expression of 7x(2)^1/2.
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids.
Solution
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids..
wait, i am posting the solution.Solutionwait, i am posting the.pdf
This very short document does not provide any substantive information to summarize in 3 sentences or less. It simply states that the author is waiting to post a solution, but does not provide any details on the problem or nature of the solution.
There are many other contributing factors to the norms of culture th.pdf
There are many other contributing factors to the norms of culture that assert the statement
Solution
There are many other contributing factors to the norms of culture that assert the statement.
Thermal dimorphism is the capacity to form different structures at d.pdf
Thermal dimorphism is the capacity to form different structures at different temperatures. For
example, some fungi exhibit thermal dimorphism. They exist as molds when outside the human
body and as yeasts when they are in the human body. For example Penicillium marneffei grows
at room temperature as a mold and, it grows as yeast at body temperature.
The morphologic shift between hyphae or molds and yeast is the significant step for the
virulence, pathogenesis, and lifecycle of the dimorphic fungi. In the soil, the thermally dimorphic
fungi grow at 22–25°C as mycelia that produce infectious spores. Following soil disturbance,
aerosolized spores inhaled into the lungs of a mammalian host at 37°C convert to yeast to cause
pneumonia and various disorders.
Solution
Thermal dimorphism is the capacity to form different structures at different temperatures. For
example, some fungi exhibit thermal dimorphism. They exist as molds when outside the human
body and as yeasts when they are in the human body. For example Penicillium marneffei grows
at room temperature as a mold and, it grows as yeast at body temperature.
The morphologic shift between hyphae or molds and yeast is the significant step for the
virulence, pathogenesis, and lifecycle of the dimorphic fungi. In the soil, the thermally dimorphic
fungi grow at 22–25°C as mycelia that produce infectious spores. Following soil disturbance,
aerosolized spores inhaled into the lungs of a mammalian host at 37°C convert to yeast to cause
pneumonia and various disorders..
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
The prime factor of 210=2*3*5*7
Anyways, numbers can only be divided by their prime factors or combinations of their prime
factors and it is divisible by all of them
Now let n = n_1 * n_2 * ... * n_k
Then n * n=n^2 =( n_1 * n_2 * ... * n_k) *( n_1 * n_2 * ... * n_k) are all the prime numbers that
divide n^2 and no other prime number can divide them (or it would be in that multiplication).
Because 210 is a multiplication of prime factors (2*3*5*7) that divides n^2, then 210 must be in
that multiplication. Hence 210 divides n.
Solution
The prime factor of 210=2*3*5*7
Anyways, numbers can only be divided by their prime factors or combinations of their prime
factors and it is divisible by all of them
Now let n = n_1 * n_2 * ... * n_k
Then n * n=n^2 =( n_1 * n_2 * ... * n_k) *( n_1 * n_2 * ... * n_k) are all the prime numbers that
divide n^2 and no other prime number can divide them (or it would be in that multiplication).
Because 210 is a multiplication of prime factors (2*3*5*7) that divides n^2, then 210 must be in
that multiplication. Hence 210 divides n..
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an interrupt signal on
the bus when it requires CPU’s attention.
Programmed I/O :
* It is used only in low end microcomputers.
* It has only single output and single input instruction.
* In this procees each instructions selects one I/O device and transfers a single character (byte).
Working:
I/O operation is requested by CPU.
Operation is performed by I/O module.
Status bits is being set by I/O module
Status bits are checked periodically by CPU.
CPU is not directly informed by I/O module.
CPU is not interrupted by I/O module.
CPU may wait or come back after some time.
Advantages :
It is easy to program and understand.
Disadvantages :
It has single input and single output instruction.
CPU spends most of its time in a tight loop waiting for the device to become ready.(Busy
Waiting)
Interrupt-driven I/O
Advantages :
Fast and efficient
Disadvantages :
* Interrupting a running process is an expensive business (requires saving context).
* Requires extra hardware (DMA controller chip).
Working :
CPU is interupted bye the I/O module.
Data is requested by CPU.
The data is trasferres by I/O module.
DMA ensures that CPU grants I/O module authority to read from or write to memory without
involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Solution
Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an in.
SolutionSolutionSolution.pdf
The document discusses a solution to an unspecified problem. It states that the solution involves taking certain steps, but provides no details on what the actual problem or steps are. The summary is unable to extract any meaningful information due to the lack of context and specifics provided in the document.
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
The document shows how to calculate the slope of a linear function by taking the change in y-values (f(x)) over the change in x-values. It gives an example where f(x) is 120 and x is 12, so the slope is 120/12 = 10. The slope is calculated to be 10.
Question not visible. Please update the question and then i can answ.pdf
Question not visible. Please update the question and then i can answer it
Solution
Question not visible. Please update the question and then i can answer it.
Please find the required program along with the comments against eac.pdf
Please find the required program along with the comments against each line, also find the output
at last :
#include
#include
#include
#include
using namespace std;
void listCodonPositions(string dna, string codon){
vector positions; // holds all the positions that codon occurs within dna
size_t pos = dna.find(codon, 0); // finds the first occurance of codon
if(pos != string::npos) //if no codon is found
cout << pos << \" \" << flush;
else
cout << \"No occurance\" << flush;
while(pos != string::npos) //iterate till no occurance is found in a dna
{
pos = dna.find(codon,pos+1); //find next occurance
if(pos != string::npos) //if no codon is found
cout << pos << \" \" << flush;
}
cout << endl;
}
int main()
{
string humanDNA =
\"CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCA
GCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGA
CCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTT
CCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTG
TCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAGCTGAGCACTGGAGTGGAG
TTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATG\";
string mouseDNA =
\"CGCAATTTTTACTTAATTCTTTTTCTTTTAATTCATATATTTTTAATATGTTTACTAT
TAATGGTTATCATTCACCATTTAACTATTTGTTATTTTGACGTCATTTTTTTCTATTTC
CTCTTTTTTCAATTCATGTTTATTTTCTGTATTTTTGTTAAGTTTTCACAAGTCTAATA
TAATTGTCCTTTGAGAGGTTATTTGGTCTATATTTTTTTTTCTTCATCTGTATTTTTAT
GATTTCATTTAATTGATTTTCATTGACAGGGTTCTGCTGTGTTCTGGATTGTATTTTTC
TTGTGGAGAGGAACTATTTCTTGAGTGGGATGTACCTTTGTTCTTG\";
string unknownDNA =
\"CGCATTTTTGCCGGTTTTCCTTTGCTGTTTATTCATTTATTTTAAACGATATTTATAT
CATCGGGTTTCATTCACTATTTTTCTTTTCGATAAATTTTTGTCAGCATTTTCTTTTAC
CTCTTCTTTCTGTTTATGTTAATTTTCTGTTTCTTAACCCAGTCTTCTCGATTCTTATCT
ACCGGACCTATTATAGGTCACAGGGTCTTGATGCTTTGGTTTTCATCTGCAAGAGTCT
GACTTCCTGCTAATGCTGTTCTGTGTCAGGGTGCATCTGAGCACTGATGTGGAGTTTT
CTTGTGGATATGAGCCATTCATAGTGTGGGATGTGCCATAGTTCATG\";
string codon;
cout << \"Enter codon : \" << endl;
cin >> codon;
char exit[] = \"*\";
while(strcmp(codon.c_str(),exit)!=0){
cout << \"Occurances in humanDNA : \"<< endl;
listCodonPositions(humanDNA,codon);
cout << \"Occurances in mouseDNA : \"<< endl;
listCodonPositions(mouseDNA,codon);
cout << \"Occurances in unknownDNA : \"<< endl;
listCodonPositions(unknownDNA,codon);
cout << \"Enter codon : \" << endl;
cin >> codon;
}
}
--------------------------------------------------------------------------------
OUTPUT :
Enter codon :
AAA
Occurances in humanDNA :
3 43
Occurances in mouseDNA :
No occurance
Occurances in unknownDNA :
43 91
Enter codon :
TGC
Occurances in humanDNA :
8 22 31 52 95 141 208 224 248 258 266 310
Occurances in mouseDNA :
269
Occurances in unknownDNA :
8 22 208 224 242 248 266 326
Enter codon :
*
Solution
Please find the required program along with the comments against each line, also find the output
at last :
#include
#include
#include
#include
using namespace std;
void listCodonPositions(string dna, string codon){
vector positions; // holds all the positions that codon occurs within dna
size_t pos = dna.find(codon, 0); // finds the first oc.
Order the steps of the viral life cycle.1. viral entry into host.pdf
Order the steps of the viral life cycle.
1. viral entry into host
2. disassembly of virus
3. replication of virus
4. transcription of virus
5. assembly of new viral units
6. release of new virus
Order these human vaccines by year of introduction from earliest to most recent.
1. Smallpox - 1796
2. plague - 1890
3. tetanus - 1930
4. polio - 1955
5. rubella - 1963
Question 10.
Gamma rays and X rays are ionizing radiations
Question 13.
The disadvantages of intravenous injection for drug administration are:
Risk of overdose
Risk of infection
Solution
Order the steps of the viral life cycle.
1. viral entry into host
2. disassembly of virus
3. replication of virus
4. transcription of virus
5. assembly of new viral units
6. release of new virus
Order these human vaccines by year of introduction from earliest to most recent.
1. Smallpox - 1796
2. plague - 1890
3. tetanus - 1930
4. polio - 1955
5. rubella - 1963
Question 10.
Gamma rays and X rays are ionizing radiations
Question 13.
The disadvantages of intravenous injection for drug administration are:
Risk of overdose
Risk of infection.
Listing of the type of alleles present in an organisms cellGenotyp.pdf
Listing of the type of alleles present in an organisms cell
Genotype
The allele for polydactylism (extra finger or toe) is expressed to different digrees in different
individuals that have it
Variable expressivity
Height in humans is determined by the interaction of genes on different loci
Polygenic inheritance
Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB
Codominance
All the genes in a cell of organism
Genome
Solution
Listing of the type of alleles present in an organisms cell
Genotype
The allele for polydactylism (extra finger or toe) is expressed to different digrees in different
individuals that have it
Variable expressivity
Height in humans is determined by the interaction of genes on different loci
Polygenic inheritance
Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB
Codominance
All the genes in a cell of organism
Genome.
An Operating System (OS) is an interface between a computer user and.pdf
An Operating System (OS) is an interface between a computer user and computer hardware. An
operating system is a software which performs all the basic tasks like file management, memory
management, process management, handling input and output.
The kernel is a used for operating system need to be protected from user programs to maintain
the proper operation of the computer system .The kernel is a computer program that constitutes
the central core of a computer\'s operating system. It has complete control over everything that
occurs in the system.As such, it is the first program loaded on startup, and then manages the
remainder of the startup, as well as input/output requests from software, translating them into
data processing instructions for the central processing unit.
kernel is usually loaded into a protected area of memory, which prevents it from being
overwritten by other, less frequently used parts of the operating system or by applications. The
kernel performs its tasks, such as executing processes and handling interrupts, in kernel space,
whereas everything a user normally does, such as writing text in a text editor or running
programs in a GUI, is done in user space. This separation prevents user data and kernel data from
interfering with each other and thereby diminishing performance or causing the system to
become unstable.
Solution
An Operating System (OS) is an interface between a computer user and computer hardware. An
operating system is a software which performs all the basic tasks like file management, memory
management, process management, handling input and output.
The kernel is a used for operating system need to be protected from user programs to maintain
the proper operation of the computer system .The kernel is a computer program that constitutes
the central core of a computer\'s operating system. It has complete control over everything that
occurs in the system.As such, it is the first program loaded on startup, and then manages the
remainder of the startup, as well as input/output requests from software, translating them into
data processing instructions for the central processing unit.
kernel is usually loaded into a protected area of memory, which prevents it from being
overwritten by other, less frequently used parts of the operating system or by applications. The
kernel performs its tasks, such as executing processes and handling interrupts, in kernel space,
whereas everything a user normally does, such as writing text in a text editor or running
programs in a GUI, is done in user space. This separation prevents user data and kernel data from
interfering with each other and thereby diminishing performance or causing the system to
become unstable..
Internal Evidence General.pdf
Internal Evidence General Ledger Files canceled Payrolled
Checks Payroll time records Receiving Reports Minutes of the Board of
Directors Cancelled Notes Payable
External Evidence Vendors Invoices Bank Statements
Purchase Requisitions Remittance Advices Signed Leased Agreements
Duplicate Copies of bills of Lading Notes Receivable
External Evidence are more reliable than the internal evidences because External evidences
are the evidences which we gets from the third party there is no involvement of the
management or employee of the organisations. Internal Evidences are prepared internally
within the organisation and the chances of manipulation in internal evidences are more than
the external evidences.
Solution
Internal Evidence General Ledger Files canceled Payrolled
Checks Payroll time records Receiving Reports Minutes of the Board of
Directors Cancelled Notes Payable
External Evidence Vendors Invoices Bank Statements
Purchase Requisitions Remittance Advices Signed Leased Agreements
Duplicate Copies of bills of Lading Notes Receivable
External Evidence are more reliable than the internal evidences because External evidences
are the evidences which we gets from the third party there is no involvement of the
management or employee of the organisations. Internal Evidences are prepared internally
within the organisation and the chances of manipulation in internal evidences are more than
the external evidences..
In reaction # 3 either the cis or trans diol may .pdf
In reaction # 3 either the cis or trans diol may be used as a reactant. These isomers
are rapidly interconverted under the rearrangement conditions, indicating that the initial water
loss is reversible; a result confirmed by isotopic oxygen exchange. The clear preference for a
methylene group shift versus a methyl group shift may reflect inherent migratory aptitudes, or
possibly group configurations in the 3º-carbocation intermediate. In the conformation shown
here both methyl and methylene groups may shift, or an epoxide ring may be formed reversibly.
An alternative chair-like conformation having an equatorial methyl group should be more stable,
but would not be suitable for a methyl shift. The predominant ring contraction is therefore
understandable. Reaction # 4 is an unusual case in which a strained ring contracts to an even
smaller ring. Phenyl groups generally have a high migratory aptitude, so the failure to obtain 2,2-
diphenylcyclobutanone as a product might seem surprising. However, the carbocation resulting
from a phenyl shift would be just as strained as its precursor; whereas the shift of a ring
methylene group generates an unstrained cation stabilized by phenyl and oxygen substituents.
Conjugative stabilization of the phenyl ketone and absence of sp2 hybridized carbon atoms in the
small ring may also contribute to the stability of the observed product. Finally, reaction # 5
clearly shows the influence of reaction conditions on product composition, but explaining the
manner in which different conditions perturb the outcome is challenging. Treatment with cold
sulfuric acid should produce the more stable diphenyl 3º-carbocation, and a methyl group shift
would then lead to the observed product. The action of a Lewis acid in acetic anhydride, on the
other hand, may selectively acetylate the less hindered dimethyl carbinol. In this event the
acetate becomes the favored leaving group (presumably coordinated with acid), followed by a
1,2-phenyl shift. It is reported that the symmetrically substituted isomeric diol (drawn in the
shaded box) rearranges exclusively by a methyl shift, but the configuration of the starting
material was not stated (two diastereomers are possible). Because of the influence of other
factors (above), it has not been possible to determine an unambiguous migratory order for
substituents in the pinacol rearrangement. However, some general trends are discernible.
Benzopinacol, (C6H5)2C(OH)C(OH)(C6H5)2, undergoes rapid rearrangement to
(C6H5)3CCOC6H5 under much milder conditions than required for pinacol. Indeed, it is often
the case that phenyl or other aromatic substituents adjacent to a forming carbocation will
facilitate that ionization in the course of their migration to the cationic site. In non-aromatic
compounds of the type (CH3)2C(OH)C(OH)RCH3, migration of R increases in the manner R =
CH3 < R = C2H5 << R = (CH3)3C. Since the shifting alkyl group must carry part of the overall
positive charge, alkyl substit.
Intermolecular forces exist between molecules and.pdf
Intermolecular forces exist between molecules and influence the physical
properties. We can think of H2O in its three forms, ice, water and steam. ... However, the
physical properties of H2O are very different in the three states.
Solution
Intermolecular forces exist between molecules and influence the physical
properties. We can think of H2O in its three forms, ice, water and steam. ... However, the
physical properties of H2O are very different in the three states..
H2 concentration will decrease and H2O concentrat.pdf
H2 concentration will decrease and H2O concentration will increase
Solution
H2 concentration will decrease and H2O concentration will increase.
elemental form of sodium and hydrogen is very rea.pdf
elemental form of sodium and hydrogen is very reactive ...that\'s why it is not
advisable to use them in their elemental form
Solution
elemental form of sodium and hydrogen is very reactive ...that\'s why it is not
advisable to use them in their elemental form.
More from rdtraders2007 (20)
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
(7x14x)^12=(277x^2)^12=7x(2)^12Solution(7x14x)^12=(2.pdf
You can think of H as being heat energy added ( + ), or heat removed.pdf
You can think of H as being heat energy added ( + ), or heat removed.pdf
wait, i am posting the solution.Solutionwait, i am posting the.pdf
wait, i am posting the solution.Solutionwait, i am posting the.pdf
There are many other contributing factors to the norms of culture th.pdf
There are many other contributing factors to the norms of culture th.pdf
Thermal dimorphism is the capacity to form different structures at d.pdf
Thermal dimorphism is the capacity to form different structures at d.pdf
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
The prime factor of 210=2357 Anyways, numbers can only be divid.pdf
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
slope = f(x) x= 12012= 10Solutionslope = f(x) x= 120.pdf
Question not visible. Please update the question and then i can answ.pdf
Question not visible. Please update the question and then i can answ.pdf
Please find the required program along with the comments against eac.pdf
Please find the required program along with the comments against eac.pdf
Order the steps of the viral life cycle.1. viral entry into host.pdf
Order the steps of the viral life cycle.1. viral entry into host.pdf
Listing of the type of alleles present in an organisms cellGenotyp.pdf
Listing of the type of alleles present in an organisms cellGenotyp.pdf
An Operating System (OS) is an interface between a computer user and.pdf
An Operating System (OS) is an interface between a computer user and.pdf
In reaction # 3 either the cis or trans diol may .pdf
In reaction # 3 either the cis or trans diol may .pdf
Intermolecular forces exist between molecules and.pdf
Intermolecular forces exist between molecules and.pdf
H2 concentration will decrease and H2O concentrat.pdf
H2 concentration will decrease and H2O concentrat.pdf
elemental form of sodium and hydrogen is very rea.pdf
elemental form of sodium and hydrogen is very rea.pdf
Recently uploaded
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...Nguyen Thanh Tu Collection
https://app.box.com/s/tacvl9ekroe9hqupdnjruiypvm9rdaneBÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...Nguyen Thanh Tu Collection
https://app.box.com/s/qhtvq32h4ybf9t49ku85x0n3xl4jhr15Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
clinical examination of hip joint (1).pdf
described clinical examination all orthopeadic conditions .
How to deliver Powerpoint Presentations.pptx
"How to make and deliver dynamic presentations by making it more interactive to captivate your audience attention"
Beyond Degrees - Empowering the Workforce in the Context of Skills-First.pptx
Iván Bornacelly, Policy Analyst at the OECD Centre for Skills, OECD, presents at the webinar 'Tackling job market gaps with a skills-first approach' on 12 June 2024
How to Setup Warehouse & Location in Odoo 17 Inventory
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
Physical pharmaceutics notes for B.pharm students
ANATOMY AND BIOMECHANICS OF HIP JOINT.pdf
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
Leveraging Generative AI to Drive Nonprofit Innovation
In this webinar, participants learned how to utilize Generative AI to streamline operations and elevate member engagement. Amazon Web Service experts provided a customer specific use cases and dived into low/no-code tools that are quick and easy to deploy through Amazon Web Service (AWS.)
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...Nguyen Thanh Tu Collection
https://app.box.com/s/y977uz6bpd3af4qsebv7r9b7s21935vdBBR 2024 Summer Sessions Interview Training
Qualitative research interview training by Professor Katrina Pritchard and Dr Helen Williams
Walmart Business+ and Spark Good for Nonprofits.pdf
"Learn about all the ways Walmart supports nonprofit organizations.
You will hear from Liz Willett, the Head of Nonprofits, and hear about what Walmart is doing to help nonprofits, including Walmart Business and Spark Good. Walmart Business+ is a new offer for nonprofits that offers discounts and also streamlines nonprofits order and expense tracking, saving time and money.
The webinar may also give some examples on how nonprofits can best leverage Walmart Business+.
The event will cover the following::
Walmart Business + (https://business.walmart.com/plus) is a new shopping experience for nonprofits, schools, and local business customers that connects an exclusive online shopping experience to stores. Benefits include free delivery and shipping, a 'Spend Analytics” feature, special discounts, deals and tax-exempt shopping.
Special TechSoup offer for a free 180 days membership, and up to $150 in discounts on eligible orders.
Spark Good (walmart.com/sparkgood) is a charitable platform that enables nonprofits to receive donations directly from customers and associates.
Answers about how you can do more with Walmart!"
Temple of Asclepius in Thrace. Excavation results
The temple and the sanctuary around were dedicated to Asklepios Zmidrenus. This name has been known since 1875 when an inscription dedicated to him was discovered in Rome. The inscription is dated in 227 AD and was left by soldiers originating from the city of Philippopolis (modern Plovdiv).
Recently uploaded (20)
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
BÀI TẬP DẠY THÊM TIẾNG ANH LỚP 7 CẢ NĂM FRIENDS PLUS SÁCH CHÂN TRỜI SÁNG TẠO ...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
Traditional Musical Instruments of Arunachal Pradesh and Uttar Pradesh - RAYH...
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
Liberal Approach to the Study of Indian Politics.pdf
Liberal Approach to the Study of Indian Politics.pdf
Beyond Degrees - Empowering the Workforce in the Context of Skills-First.pptx
Beyond Degrees - Empowering the Workforce in the Context of Skills-First.pptx
How to Setup Warehouse & Location in Odoo 17 Inventory
How to Setup Warehouse & Location in Odoo 17 Inventory
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
RHEOLOGY Physical pharmaceutics-II notes for B.pharm 4th sem students
Leveraging Generative AI to Drive Nonprofit Innovation
Leveraging Generative AI to Drive Nonprofit Innovation
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
Walmart Business+ and Spark Good for Nonprofits.pdf
Walmart Business+ and Spark Good for Nonprofits.pdf
B. Ed Syllabus for babasaheb ambedkar education university.pdf
B. Ed Syllabus for babasaheb ambedkar education university.pdf
The OSI Reference Model layers, in order from top to bottomD. Appl.pdf
- 1. The OSI Reference Model layers, in order from top to bottom D. Application, Presentation, Session, Transport, Network, Data Link, Physical 1. Application Layer topmost layer of the OSI reference model, is the application layer. This layer directly support user applications, like software for file transfers, database access, and e-mail. It serves as a window through which application processes can access network services. 2.Presentation Layer It defines the format used to exchange data among networked computers. It is a network's translator. When dissimilar systems want to communicate, certain translation and byte reordering is done. It translates data from the format from the application layer into a recognized format. At the receiving computer, this layer translates intermediary format into format that can be useful to that computer's application layer. 3. Session Layer It allows two applications on different computers to open, use, and close a connection called a session. It performs name-recognition and other functions, such as security, that are needed to allow two applications to communicate over the network. 4. Transport Layer It provides an additional connection level beneath the session layer. It ensures that packets are delivered error free, in sequence, and without losses or duplications. At the sending computer, this layer repackages messages, dividing long messages into several packets and collecting small packets together in one package. T 5. Network Layer It is responsible for addressing messages and translating logical addresses and names into physical addresses. This layer also determines the route from the source to the destination computer. It determines which path the data should take based on network conditions 6. Data-Link Layer It sends data frames from the network layer to the physical layer. It controls the electrical impulses that enter and leave the network cable. On the receiving end, the data-link layer packages raw bits from the physical layer into data frames. 7. Physical Layer This layer transmits the unstructured, raw bit stream over a physical medium (such as the network cable). The physical layer is totally hardware-oriented and deals with all aspects of establishing and maintaining a physical link between communicating computers. The physical layer also carries the signals that transmit data generated by each of the higher layers.
- 2. Solution The OSI Reference Model layers, in order from top to bottom D. Application, Presentation, Session, Transport, Network, Data Link, Physical 1. Application Layer topmost layer of the OSI reference model, is the application layer. This layer directly support user applications, like software for file transfers, database access, and e-mail. It serves as a window through which application processes can access network services. 2.Presentation Layer It defines the format used to exchange data among networked computers. It is a network's translator. When dissimilar systems want to communicate, certain translation and byte reordering is done. It translates data from the format from the application layer into a recognized format. At the receiving computer, this layer translates intermediary format into format that can be useful to that computer's application layer. 3. Session Layer It allows two applications on different computers to open, use, and close a connection called a session. It performs name-recognition and other functions, such as security, that are needed to allow two applications to communicate over the network. 4. Transport Layer It provides an additional connection level beneath the session layer. It ensures that packets are delivered error free, in sequence, and without losses or duplications. At the sending computer, this layer repackages messages, dividing long messages into several packets and collecting small packets together in one package. T 5. Network Layer It is responsible for addressing messages and translating logical addresses and names into physical addresses. This layer also determines the route from the source to the destination computer. It determines which path the data should take based on network conditions 6. Data-Link Layer It sends data frames from the network layer to the physical layer. It controls the electrical impulses that enter and leave the network cable. On the receiving end, the data-link layer packages raw bits from the physical layer into data frames. 7. Physical Layer This layer transmits the unstructured, raw bit stream over a physical medium (such as the network cable). The physical layer is totally hardware-oriented and deals with all aspects of establishing and maintaining a physical link between communicating computers. The physical layer also carries the signals that transmit data generated by each of the higher layers.