Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an interrupt signal on
the bus when it requires CPU’s attention.
Programmed I/O :
* It is used only in low end microcomputers.
* It has only single output and single input instruction.
* In this procees each instructions selects one I/O device and transfers a single character (byte).
Working:
I/O operation is requested by CPU.
Operation is performed by I/O module.
Status bits is being set by I/O module
Status bits are checked periodically by CPU.
CPU is not directly informed by I/O module.
CPU is not interrupted by I/O module.
CPU may wait or come back after some time.
Advantages :
It is easy to program and understand.
Disadvantages :
It has single input and single output instruction.
CPU spends most of its time in a tight loop waiting for the device to become ready.(Busy
Waiting)
Interrupt-driven I/O
Advantages :
Fast and efficient
Disadvantages :
* Interrupting a running process is an expensive business (requires saving context).
* Requires extra hardware (DMA controller chip).
Working :
CPU is interupted bye the I/O module.
Data is requested by CPU.
The data is trasferres by I/O module.
DMA ensures that CPU grants I/O module authority to read from or write to memory without
involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Solution
Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an in.
discuss the drawbacks of programmed and interrupt driven io and des.pdfinfo998421
discuss the drawbacks of programmed and interrupt driven i/o and describe in general the
functionality of the DNA
Solution
Programmed I/O
Programmed I/O (PIO) refers to data transfers initiated by a CPU under driver software control
to access registers or memory on a device.
The CPU issues a command then waits for I/O operations to be complete. As the CPU is faster
than the I/O module, the problem with programmed I/O is that the CPU has to wait a long time
for the I/O module of concern to be ready for either reception or transmission of data. The CPU,
while waiting, must repeatedly check the status of the I/O module, and this process is known as
Polling. As a result, the level of the performance of the entire system is severely degraded.
Programmed I/O basically works in these ways:
Interrupt
The CPU issues commands to the I/O module then proceeds with its normal work until
interrupted by I/O device on completion of its work.
For input, the device interrupts the CPU when new data has arrived and is ready to be retrieved
by the system processor. The actual actions to perform depend on whether the device uses I/O
ports, memory mapping.
For output, the device delivers an interrupt either when it is ready to accept new data or to
acknowledge a successful data transfer. Memory-mapped and DMA-capable devices usually
generate interrupts to tell the system they are done with the buffer.
Although Interrupt relieves the CPU of having to wait for the devices, but it is still inefficient in
data transfer of large amount because the CPU has to transfer the data word by word between I/O
module and memory.
The main limitation of programmed I/O and interrupt driven I/O is given below:
Programmed I/O
Each instructions selects one I/O device (by number) and transfers a single character (byte)
Example: microprocessor controlled video terminal.
Four registers: input status and character, output status and character.
Interrupt-driven I/O
Primary disadvantage of programmed I/O is that CPU spends most of its time in a tight loop
waiting for the device to become ready. This is called busy waiting.
With interrupt-driven I/O, the CPU starts the device and tells it to generate an interrupt when it is
finished.
Done by setting interrupt-enable bit in status register.
Still requires an interrupt for every character read or written.
Interrupting a running process is an expensive business (requires saving context).
Requires extra hardware (DMA controller chip).
All these limitation can be overcome by the Introduction of DMA (Direct Memory Access)
To write block of 32 bytes from memory address 100 to device 4
1. CPU writes 32, 100, 4 into the first three DMA registers (memory address, count, device
number)
2. CPU puts code for WRITE (say 1) into fourth (direction) DMA register, which signals DMA
controller to begin operation
3. Controller reads (via bus request as CPU would) byte 100 from memory
4. Controller makes I/O request to write to device 4
5. Controller increments m.
discuss the drawbacks of programmed and interrupt driven io and des.pdfinfo998421
discuss the drawbacks of programmed and interrupt driven i/o and describe in general the
functionality of the DNA
Solution
Programmed I/O
Programmed I/O (PIO) refers to data transfers initiated by a CPU under driver software control
to access registers or memory on a device.
The CPU issues a command then waits for I/O operations to be complete. As the CPU is faster
than the I/O module, the problem with programmed I/O is that the CPU has to wait a long time
for the I/O module of concern to be ready for either reception or transmission of data. The CPU,
while waiting, must repeatedly check the status of the I/O module, and this process is known as
Polling. As a result, the level of the performance of the entire system is severely degraded.
Programmed I/O basically works in these ways:
Interrupt
The CPU issues commands to the I/O module then proceeds with its normal work until
interrupted by I/O device on completion of its work.
For input, the device interrupts the CPU when new data has arrived and is ready to be retrieved
by the system processor. The actual actions to perform depend on whether the device uses I/O
ports, memory mapping.
For output, the device delivers an interrupt either when it is ready to accept new data or to
acknowledge a successful data transfer. Memory-mapped and DMA-capable devices usually
generate interrupts to tell the system they are done with the buffer.
Although Interrupt relieves the CPU of having to wait for the devices, but it is still inefficient in
data transfer of large amount because the CPU has to transfer the data word by word between I/O
module and memory.
The main limitation of programmed I/O and interrupt driven I/O is given below:
Programmed I/O
Each instructions selects one I/O device (by number) and transfers a single character (byte)
Example: microprocessor controlled video terminal.
Four registers: input status and character, output status and character.
Interrupt-driven I/O
Primary disadvantage of programmed I/O is that CPU spends most of its time in a tight loop
waiting for the device to become ready. This is called busy waiting.
With interrupt-driven I/O, the CPU starts the device and tells it to generate an interrupt when it is
finished.
Done by setting interrupt-enable bit in status register.
Still requires an interrupt for every character read or written.
Interrupting a running process is an expensive business (requires saving context).
Requires extra hardware (DMA controller chip).
All these limitation can be overcome by the Introduction of DMA (Direct Memory Access)
To write block of 32 bytes from memory address 100 to device 4
1. CPU writes 32, 100, 4 into the first three DMA registers (memory address, count, device
number)
2. CPU puts code for WRITE (say 1) into fourth (direction) DMA register, which signals DMA
controller to begin operation
3. Controller reads (via bus request as CPU would) byte 100 from memory
4. Controller makes I/O request to write to device 4
5. Controller increments m.
List of different types of InputOutput An input device that can .pdfanitasahani11
List of different types of Input/Output :
An input device that can be used to feed the computer system for processing.
some are :
Output Device:
Output Device is used to dispaly the result processed by computer.
Common Output devices include:
Programmed I/O v/s Interrupts I/O.
Programmed I/O:Programmed Input/Output is used to move data between devices in a computer
in which all data must pass through the processor.operation of the programmed I/O can be
summaries as follow:
Advantages:
Disadvantages :
Interrupts I/O:
It is an alternative scheme for dealing with I/O is the interrupt-driven method. Here the CPU
works on its given tasks continuously. When an input is available, such as when someone types a
key on the keyboard, then the CPU is interrupted from its work to take care of the input data.
Advantage: It is fast and efficient.
Disavantage: It can be tricky to write if you are using a low level language.
Thanks
Solution
List of different types of Input/Output :
An input device that can be used to feed the computer system for processing.
some are :
Output Device:
Output Device is used to dispaly the result processed by computer.
Common Output devices include:
Programmed I/O v/s Interrupts I/O.
Programmed I/O:Programmed Input/Output is used to move data between devices in a computer
in which all data must pass through the processor.operation of the programmed I/O can be
summaries as follow:
Advantages:
Disadvantages :
Interrupts I/O:
It is an alternative scheme for dealing with I/O is the interrupt-driven method. Here the CPU
works on its given tasks continuously. When an input is available, such as when someone types a
key on the keyboard, then the CPU is interrupted from its work to take care of the input data.
Advantage: It is fast and efficient.
Disavantage: It can be tricky to write if you are using a low level language.
Thanks.
You can think of H as being heat energy added ( + ), or heat removed.pdfrdtraders2007
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids.
Solution
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids..
More Related Content
Similar to Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
List of different types of InputOutput An input device that can .pdfanitasahani11
List of different types of Input/Output :
An input device that can be used to feed the computer system for processing.
some are :
Output Device:
Output Device is used to dispaly the result processed by computer.
Common Output devices include:
Programmed I/O v/s Interrupts I/O.
Programmed I/O:Programmed Input/Output is used to move data between devices in a computer
in which all data must pass through the processor.operation of the programmed I/O can be
summaries as follow:
Advantages:
Disadvantages :
Interrupts I/O:
It is an alternative scheme for dealing with I/O is the interrupt-driven method. Here the CPU
works on its given tasks continuously. When an input is available, such as when someone types a
key on the keyboard, then the CPU is interrupted from its work to take care of the input data.
Advantage: It is fast and efficient.
Disavantage: It can be tricky to write if you are using a low level language.
Thanks
Solution
List of different types of Input/Output :
An input device that can be used to feed the computer system for processing.
some are :
Output Device:
Output Device is used to dispaly the result processed by computer.
Common Output devices include:
Programmed I/O v/s Interrupts I/O.
Programmed I/O:Programmed Input/Output is used to move data between devices in a computer
in which all data must pass through the processor.operation of the programmed I/O can be
summaries as follow:
Advantages:
Disadvantages :
Interrupts I/O:
It is an alternative scheme for dealing with I/O is the interrupt-driven method. Here the CPU
works on its given tasks continuously. When an input is available, such as when someone types a
key on the keyboard, then the CPU is interrupted from its work to take care of the input data.
Advantage: It is fast and efficient.
Disavantage: It can be tricky to write if you are using a low level language.
Thanks.
You can think of H as being heat energy added ( + ), or heat removed.pdfrdtraders2007
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids.
Solution
You can think of H as being heat energy added ( + ), or heat removed ( - ) .
Entropy refers to the degree of disorder or randomness. Gases are more disordered (more
entropy) than liquids, and liquids are more disordered (more entropy) than solids. Solids have the
least entropy.
1. Sublimation is a change from solid directly to a gas. Heat energy has to be added for this
process to occur, so H is +. Gases are more disordered, so S is + also.
2. Freezing is a change from liquid to a solid. Heat energy has to be removed, so H is - . Solids
have less entropy so S is - .
3. Condensation is a change from a gas to a liquid. Heat energy has to be removed, so H is - .
Liquid entropy is lower, so S is - .
4. Deposition is a change from a gas directly to a solid. Heat energy must be removed, so H is -
.
S is - also.
5. Boiling is a change from liquid to a gas. Heat energy must be added, so H is +. S is + since
gases have higher entropy.
6. Melting is a change from a solid to a liquid. Heat energy must be added , so H is + . S is +
since liquids have more disorder than solids..
There are many other contributing factors to the norms of culture th.pdfrdtraders2007
There are many other contributing factors to the norms of culture that assert the statement
Solution
There are many other contributing factors to the norms of culture that assert the statement.
Thermal dimorphism is the capacity to form different structures at d.pdfrdtraders2007
Thermal dimorphism is the capacity to form different structures at different temperatures. For
example, some fungi exhibit thermal dimorphism. They exist as molds when outside the human
body and as yeasts when they are in the human body. For example Penicillium marneffei grows
at room temperature as a mold and, it grows as yeast at body temperature.
The morphologic shift between hyphae or molds and yeast is the significant step for the
virulence, pathogenesis, and lifecycle of the dimorphic fungi. In the soil, the thermally dimorphic
fungi grow at 22–25°C as mycelia that produce infectious spores. Following soil disturbance,
aerosolized spores inhaled into the lungs of a mammalian host at 37°C convert to yeast to cause
pneumonia and various disorders.
Solution
Thermal dimorphism is the capacity to form different structures at different temperatures. For
example, some fungi exhibit thermal dimorphism. They exist as molds when outside the human
body and as yeasts when they are in the human body. For example Penicillium marneffei grows
at room temperature as a mold and, it grows as yeast at body temperature.
The morphologic shift between hyphae or molds and yeast is the significant step for the
virulence, pathogenesis, and lifecycle of the dimorphic fungi. In the soil, the thermally dimorphic
fungi grow at 22–25°C as mycelia that produce infectious spores. Following soil disturbance,
aerosolized spores inhaled into the lungs of a mammalian host at 37°C convert to yeast to cause
pneumonia and various disorders..
The prime factor of 210=2357 Anyways, numbers can only be divid.pdfrdtraders2007
The prime factor of 210=2*3*5*7
Anyways, numbers can only be divided by their prime factors or combinations of their prime
factors and it is divisible by all of them
Now let n = n_1 * n_2 * ... * n_k
Then n * n=n^2 =( n_1 * n_2 * ... * n_k) *( n_1 * n_2 * ... * n_k) are all the prime numbers that
divide n^2 and no other prime number can divide them (or it would be in that multiplication).
Because 210 is a multiplication of prime factors (2*3*5*7) that divides n^2, then 210 must be in
that multiplication. Hence 210 divides n.
Solution
The prime factor of 210=2*3*5*7
Anyways, numbers can only be divided by their prime factors or combinations of their prime
factors and it is divisible by all of them
Now let n = n_1 * n_2 * ... * n_k
Then n * n=n^2 =( n_1 * n_2 * ... * n_k) *( n_1 * n_2 * ... * n_k) are all the prime numbers that
divide n^2 and no other prime number can divide them (or it would be in that multiplication).
Because 210 is a multiplication of prime factors (2*3*5*7) that divides n^2, then 210 must be in
that multiplication. Hence 210 divides n..
The OSI Reference Model layers, in order from top to bottomD. Appl.pdfrdtraders2007
The OSI Reference Model layers, in order from top to bottom
D. Application, Presentation, Session, Transport, Network, Data Link, Physical
1. Application Layer
topmost layer of the OSI reference model, is the application layer. This layer directly support
user applications, like software for file transfers, database access, and e-mail. It serves as a
window through which application processes can access network services.
2.Presentation Layer
It defines the format used to exchange data among networked computers. It is a network\'s
translator. When dissimilar systems want to communicate, certain translation and byte reordering
is done. It translates data from the format from the application layer into a recognized format. At
the receiving computer, this layer translates intermediary format into format that can be useful to
that computer\'s application layer.
3. Session Layer
It allows two applications on different computers to open, use, and close a connection called a
session. It performs name-recognition and other functions, such as security, that are needed to
allow two applications to communicate over the network.
4. Transport Layer
It provides an additional connection level beneath the session layer. It ensures that packets are
delivered error free, in sequence, and without losses or duplications. At the sending computer,
this layer repackages messages, dividing long messages into several packets and collecting small
packets together in one package. T
5. Network Layer
It is responsible for addressing messages and translating logical addresses and names into
physical addresses. This layer also determines the route from the source to the destination
computer. It determines which path the data should take based on network conditions
6. Data-Link Layer
It sends data frames from the network layer to the physical layer. It controls the electrical
impulses that enter and leave the network cable. On the receiving end, the data-link layer
packages raw bits from the physical layer into data frames.
7. Physical Layer
This layer transmits the unstructured, raw bit stream over a physical medium (such as the
network cable). The physical layer is totally hardware-oriented and deals with all aspects of
establishing and maintaining a physical link between communicating computers. The physical
layer also carries the signals that transmit data generated by each of the higher layers.
Solution
The OSI Reference Model layers, in order from top to bottom
D. Application, Presentation, Session, Transport, Network, Data Link, Physical
1. Application Layer
topmost layer of the OSI reference model, is the application layer. This layer directly support
user applications, like software for file transfers, database access, and e-mail. It serves as a
window through which application processes can access network services.
2.Presentation Layer
It defines the format used to exchange data among networked computers. It is a network\'s
translator. When dissimilar systems want .
Question not visible. Please update the question and then i can answ.pdfrdtraders2007
Question not visible. Please update the question and then i can answer it
Solution
Question not visible. Please update the question and then i can answer it.
Please find the required program along with the comments against eac.pdfrdtraders2007
Please find the required program along with the comments against each line, also find the output
at last :
#include
#include
#include
#include
using namespace std;
void listCodonPositions(string dna, string codon){
vector positions; // holds all the positions that codon occurs within dna
size_t pos = dna.find(codon, 0); // finds the first occurance of codon
if(pos != string::npos) //if no codon is found
cout << pos << \" \" << flush;
else
cout << \"No occurance\" << flush;
while(pos != string::npos) //iterate till no occurance is found in a dna
{
pos = dna.find(codon,pos+1); //find next occurance
if(pos != string::npos) //if no codon is found
cout << pos << \" \" << flush;
}
cout << endl;
}
int main()
{
string humanDNA =
\"CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCA
GCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGA
CCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTT
CCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTG
TCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAGCTGAGCACTGGAGTGGAG
TTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATG\";
string mouseDNA =
\"CGCAATTTTTACTTAATTCTTTTTCTTTTAATTCATATATTTTTAATATGTTTACTAT
TAATGGTTATCATTCACCATTTAACTATTTGTTATTTTGACGTCATTTTTTTCTATTTC
CTCTTTTTTCAATTCATGTTTATTTTCTGTATTTTTGTTAAGTTTTCACAAGTCTAATA
TAATTGTCCTTTGAGAGGTTATTTGGTCTATATTTTTTTTTCTTCATCTGTATTTTTAT
GATTTCATTTAATTGATTTTCATTGACAGGGTTCTGCTGTGTTCTGGATTGTATTTTTC
TTGTGGAGAGGAACTATTTCTTGAGTGGGATGTACCTTTGTTCTTG\";
string unknownDNA =
\"CGCATTTTTGCCGGTTTTCCTTTGCTGTTTATTCATTTATTTTAAACGATATTTATAT
CATCGGGTTTCATTCACTATTTTTCTTTTCGATAAATTTTTGTCAGCATTTTCTTTTAC
CTCTTCTTTCTGTTTATGTTAATTTTCTGTTTCTTAACCCAGTCTTCTCGATTCTTATCT
ACCGGACCTATTATAGGTCACAGGGTCTTGATGCTTTGGTTTTCATCTGCAAGAGTCT
GACTTCCTGCTAATGCTGTTCTGTGTCAGGGTGCATCTGAGCACTGATGTGGAGTTTT
CTTGTGGATATGAGCCATTCATAGTGTGGGATGTGCCATAGTTCATG\";
string codon;
cout << \"Enter codon : \" << endl;
cin >> codon;
char exit[] = \"*\";
while(strcmp(codon.c_str(),exit)!=0){
cout << \"Occurances in humanDNA : \"<< endl;
listCodonPositions(humanDNA,codon);
cout << \"Occurances in mouseDNA : \"<< endl;
listCodonPositions(mouseDNA,codon);
cout << \"Occurances in unknownDNA : \"<< endl;
listCodonPositions(unknownDNA,codon);
cout << \"Enter codon : \" << endl;
cin >> codon;
}
}
--------------------------------------------------------------------------------
OUTPUT :
Enter codon :
AAA
Occurances in humanDNA :
3 43
Occurances in mouseDNA :
No occurance
Occurances in unknownDNA :
43 91
Enter codon :
TGC
Occurances in humanDNA :
8 22 31 52 95 141 208 224 248 258 266 310
Occurances in mouseDNA :
269
Occurances in unknownDNA :
8 22 208 224 242 248 266 326
Enter codon :
*
Solution
Please find the required program along with the comments against each line, also find the output
at last :
#include
#include
#include
#include
using namespace std;
void listCodonPositions(string dna, string codon){
vector positions; // holds all the positions that codon occurs within dna
size_t pos = dna.find(codon, 0); // finds the first oc.
Order the steps of the viral life cycle.1. viral entry into host.pdfrdtraders2007
Order the steps of the viral life cycle.
1. viral entry into host
2. disassembly of virus
3. replication of virus
4. transcription of virus
5. assembly of new viral units
6. release of new virus
Order these human vaccines by year of introduction from earliest to most recent.
1. Smallpox - 1796
2. plague - 1890
3. tetanus - 1930
4. polio - 1955
5. rubella - 1963
Question 10.
Gamma rays and X rays are ionizing radiations
Question 13.
The disadvantages of intravenous injection for drug administration are:
Risk of overdose
Risk of infection
Solution
Order the steps of the viral life cycle.
1. viral entry into host
2. disassembly of virus
3. replication of virus
4. transcription of virus
5. assembly of new viral units
6. release of new virus
Order these human vaccines by year of introduction from earliest to most recent.
1. Smallpox - 1796
2. plague - 1890
3. tetanus - 1930
4. polio - 1955
5. rubella - 1963
Question 10.
Gamma rays and X rays are ionizing radiations
Question 13.
The disadvantages of intravenous injection for drug administration are:
Risk of overdose
Risk of infection.
Listing of the type of alleles present in an organisms cellGenotyp.pdfrdtraders2007
Listing of the type of alleles present in an organisms cell
Genotype
The allele for polydactylism (extra finger or toe) is expressed to different digrees in different
individuals that have it
Variable expressivity
Height in humans is determined by the interaction of genes on different loci
Polygenic inheritance
Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB
Codominance
All the genes in a cell of organism
Genome
Solution
Listing of the type of alleles present in an organisms cell
Genotype
The allele for polydactylism (extra finger or toe) is expressed to different digrees in different
individuals that have it
Variable expressivity
Height in humans is determined by the interaction of genes on different loci
Polygenic inheritance
Individuals that are heterozygous for alleles for A antigen and B antigen have blood type AB
Codominance
All the genes in a cell of organism
Genome.
An Operating System (OS) is an interface between a computer user and.pdfrdtraders2007
An Operating System (OS) is an interface between a computer user and computer hardware. An
operating system is a software which performs all the basic tasks like file management, memory
management, process management, handling input and output.
The kernel is a used for operating system need to be protected from user programs to maintain
the proper operation of the computer system .The kernel is a computer program that constitutes
the central core of a computer\'s operating system. It has complete control over everything that
occurs in the system.As such, it is the first program loaded on startup, and then manages the
remainder of the startup, as well as input/output requests from software, translating them into
data processing instructions for the central processing unit.
kernel is usually loaded into a protected area of memory, which prevents it from being
overwritten by other, less frequently used parts of the operating system or by applications. The
kernel performs its tasks, such as executing processes and handling interrupts, in kernel space,
whereas everything a user normally does, such as writing text in a text editor or running
programs in a GUI, is done in user space. This separation prevents user data and kernel data from
interfering with each other and thereby diminishing performance or causing the system to
become unstable.
Solution
An Operating System (OS) is an interface between a computer user and computer hardware. An
operating system is a software which performs all the basic tasks like file management, memory
management, process management, handling input and output.
The kernel is a used for operating system need to be protected from user programs to maintain
the proper operation of the computer system .The kernel is a computer program that constitutes
the central core of a computer\'s operating system. It has complete control over everything that
occurs in the system.As such, it is the first program loaded on startup, and then manages the
remainder of the startup, as well as input/output requests from software, translating them into
data processing instructions for the central processing unit.
kernel is usually loaded into a protected area of memory, which prevents it from being
overwritten by other, less frequently used parts of the operating system or by applications. The
kernel performs its tasks, such as executing processes and handling interrupts, in kernel space,
whereas everything a user normally does, such as writing text in a text editor or running
programs in a GUI, is done in user space. This separation prevents user data and kernel data from
interfering with each other and thereby diminishing performance or causing the system to
become unstable..
Internal Evidence General Ledger Files canceled Payrolled
Checks Payroll time records Receiving Reports Minutes of the Board of
Directors Cancelled Notes Payable
External Evidence Vendors Invoices Bank Statements
Purchase Requisitions Remittance Advices Signed Leased Agreements
Duplicate Copies of bills of Lading Notes Receivable
External Evidence are more reliable than the internal evidences because External evidences
are the evidences which we gets from the third party there is no involvement of the
management or employee of the organisations. Internal Evidences are prepared internally
within the organisation and the chances of manipulation in internal evidences are more than
the external evidences.
Solution
Internal Evidence General Ledger Files canceled Payrolled
Checks Payroll time records Receiving Reports Minutes of the Board of
Directors Cancelled Notes Payable
External Evidence Vendors Invoices Bank Statements
Purchase Requisitions Remittance Advices Signed Leased Agreements
Duplicate Copies of bills of Lading Notes Receivable
External Evidence are more reliable than the internal evidences because External evidences
are the evidences which we gets from the third party there is no involvement of the
management or employee of the organisations. Internal Evidences are prepared internally
within the organisation and the chances of manipulation in internal evidences are more than
the external evidences..
In reaction # 3 either the cis or trans diol may .pdfrdtraders2007
In reaction # 3 either the cis or trans diol may be used as a reactant. These isomers
are rapidly interconverted under the rearrangement conditions, indicating that the initial water
loss is reversible; a result confirmed by isotopic oxygen exchange. The clear preference for a
methylene group shift versus a methyl group shift may reflect inherent migratory aptitudes, or
possibly group configurations in the 3º-carbocation intermediate. In the conformation shown
here both methyl and methylene groups may shift, or an epoxide ring may be formed reversibly.
An alternative chair-like conformation having an equatorial methyl group should be more stable,
but would not be suitable for a methyl shift. The predominant ring contraction is therefore
understandable. Reaction # 4 is an unusual case in which a strained ring contracts to an even
smaller ring. Phenyl groups generally have a high migratory aptitude, so the failure to obtain 2,2-
diphenylcyclobutanone as a product might seem surprising. However, the carbocation resulting
from a phenyl shift would be just as strained as its precursor; whereas the shift of a ring
methylene group generates an unstrained cation stabilized by phenyl and oxygen substituents.
Conjugative stabilization of the phenyl ketone and absence of sp2 hybridized carbon atoms in the
small ring may also contribute to the stability of the observed product. Finally, reaction # 5
clearly shows the influence of reaction conditions on product composition, but explaining the
manner in which different conditions perturb the outcome is challenging. Treatment with cold
sulfuric acid should produce the more stable diphenyl 3º-carbocation, and a methyl group shift
would then lead to the observed product. The action of a Lewis acid in acetic anhydride, on the
other hand, may selectively acetylate the less hindered dimethyl carbinol. In this event the
acetate becomes the favored leaving group (presumably coordinated with acid), followed by a
1,2-phenyl shift. It is reported that the symmetrically substituted isomeric diol (drawn in the
shaded box) rearranges exclusively by a methyl shift, but the configuration of the starting
material was not stated (two diastereomers are possible). Because of the influence of other
factors (above), it has not been possible to determine an unambiguous migratory order for
substituents in the pinacol rearrangement. However, some general trends are discernible.
Benzopinacol, (C6H5)2C(OH)C(OH)(C6H5)2, undergoes rapid rearrangement to
(C6H5)3CCOC6H5 under much milder conditions than required for pinacol. Indeed, it is often
the case that phenyl or other aromatic substituents adjacent to a forming carbocation will
facilitate that ionization in the course of their migration to the cationic site. In non-aromatic
compounds of the type (CH3)2C(OH)C(OH)RCH3, migration of R increases in the manner R =
CH3 < R = C2H5 << R = (CH3)3C. Since the shifting alkyl group must carry part of the overall
positive charge, alkyl substit.
Intermolecular forces exist between molecules and.pdfrdtraders2007
Intermolecular forces exist between molecules and influence the physical
properties. We can think of H2O in its three forms, ice, water and steam. ... However, the
physical properties of H2O are very different in the three states.
Solution
Intermolecular forces exist between molecules and influence the physical
properties. We can think of H2O in its three forms, ice, water and steam. ... However, the
physical properties of H2O are very different in the three states..
elemental form of sodium and hydrogen is very rea.pdfrdtraders2007
elemental form of sodium and hydrogen is very reactive ...that\'s why it is not
advisable to use them in their elemental form
Solution
elemental form of sodium and hydrogen is very reactive ...that\'s why it is not
advisable to use them in their elemental form.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
The Roman Empire A Historical Colossus.pdfkaushalkr1407
The Roman Empire, a vast and enduring power, stands as one of history's most remarkable civilizations, leaving an indelible imprint on the world. It emerged from the Roman Republic, transitioning into an imperial powerhouse under the leadership of Augustus Caesar in 27 BCE. This transformation marked the beginning of an era defined by unprecedented territorial expansion, architectural marvels, and profound cultural influence.
The empire's roots lie in the city of Rome, founded, according to legend, by Romulus in 753 BCE. Over centuries, Rome evolved from a small settlement to a formidable republic, characterized by a complex political system with elected officials and checks on power. However, internal strife, class conflicts, and military ambitions paved the way for the end of the Republic. Julius Caesar’s dictatorship and subsequent assassination in 44 BCE created a power vacuum, leading to a civil war. Octavian, later Augustus, emerged victorious, heralding the Roman Empire’s birth.
Under Augustus, the empire experienced the Pax Romana, a 200-year period of relative peace and stability. Augustus reformed the military, established efficient administrative systems, and initiated grand construction projects. The empire's borders expanded, encompassing territories from Britain to Egypt and from Spain to the Euphrates. Roman legions, renowned for their discipline and engineering prowess, secured and maintained these vast territories, building roads, fortifications, and cities that facilitated control and integration.
The Roman Empire’s society was hierarchical, with a rigid class system. At the top were the patricians, wealthy elites who held significant political power. Below them were the plebeians, free citizens with limited political influence, and the vast numbers of slaves who formed the backbone of the economy. The family unit was central, governed by the paterfamilias, the male head who held absolute authority.
Culturally, the Romans were eclectic, absorbing and adapting elements from the civilizations they encountered, particularly the Greeks. Roman art, literature, and philosophy reflected this synthesis, creating a rich cultural tapestry. Latin, the Roman language, became the lingua franca of the Western world, influencing numerous modern languages.
Roman architecture and engineering achievements were monumental. They perfected the arch, vault, and dome, constructing enduring structures like the Colosseum, Pantheon, and aqueducts. These engineering marvels not only showcased Roman ingenuity but also served practical purposes, from public entertainment to water supply.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Instructions for Submissions thorugh G- Classroom.pptxJheel Barad
This presentation provides a briefing on how to upload submissions and documents in Google Classroom. It was prepared as part of an orientation for new Sainik School in-service teacher trainees. As a training officer, my goal is to ensure that you are comfortable and proficient with this essential tool for managing assignments and fostering student engagement.
Palestine last event orientationfvgnh .pptxRaedMohamed3
An EFL lesson about the current events in Palestine. It is intended to be for intermediate students who wish to increase their listening skills through a short lesson in power point.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Synthetic Fiber Construction in lab .pptxPavel ( NSTU)
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
Synchronous IO CPU waits till the IO proceeds.Asynchronous IO.pdf
1. Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an interrupt signal on
the bus when it requires CPU’s attention.
Programmed I/O :
* It is used only in low end microcomputers.
* It has only single output and single input instruction.
* In this procees each instructions selects one I/O device and transfers a single character (byte).
Working:
I/O operation is requested by CPU.
Operation is performed by I/O module.
Status bits is being set by I/O module
Status bits are checked periodically by CPU.
CPU is not directly informed by I/O module.
CPU is not interrupted by I/O module.
CPU may wait or come back after some time.
Advantages :
It is easy to program and understand.
Disadvantages :
It has single input and single output instruction.
CPU spends most of its time in a tight loop waiting for the device to become ready.(Busy
Waiting)
2. Interrupt-driven I/O
Advantages :
Fast and efficient
Disadvantages :
* Interrupting a running process is an expensive business (requires saving context).
* Requires extra hardware (DMA controller chip).
Working :
CPU is interupted bye the I/O module.
Data is requested by CPU.
The data is trasferres by I/O module.
DMA ensures that CPU grants I/O module authority to read from or write to memory without
involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Solution
Synchronous I/O : CPU waits till the I/O proceeds.
Asynchronous I/O : It executes cuncurrently with CPU execution.
Special Instruction I/O : They uses the CPU instructions for controlling the I/O devices.
Memory-mapped I/O : They share the same address space with the memory. Devices are
connected directly to the main memory so that they can transfer block of data
Direct memory access (DMA) : It ensures that CPU grants I/O module authority to read from or
write to memory without involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
Polling I/O : It periodically checks the status of the device to check if the device performs any
further I/O operation.
Interrupt I/O : It works on interrupt signal where a device controller puts an interrupt signal on
the bus when it requires CPU’s attention.
Programmed I/O :
3. * It is used only in low end microcomputers.
* It has only single output and single input instruction.
* In this procees each instructions selects one I/O device and transfers a single character (byte).
Working:
I/O operation is requested by CPU.
Operation is performed by I/O module.
Status bits is being set by I/O module
Status bits are checked periodically by CPU.
CPU is not directly informed by I/O module.
CPU is not interrupted by I/O module.
CPU may wait or come back after some time.
Advantages :
It is easy to program and understand.
Disadvantages :
It has single input and single output instruction.
CPU spends most of its time in a tight loop waiting for the device to become ready.(Busy
Waiting)
Interrupt-driven I/O
Advantages :
Fast and efficient
Disadvantages :
* Interrupting a running process is an expensive business (requires saving context).
* Requires extra hardware (DMA controller chip).
Working :
CPU is interupted bye the I/O module.
Data is requested by CPU.
The data is trasferres by I/O module.
DMA ensures that CPU grants I/O module authority to read from or write to memory without
involvement. This module is responsible for
exchanging data between I/O device and main memory. It uses the hardware DMAC for data
transfers.
