This document provides an overview of animal breeding and genetics concepts. It discusses what animal breeding is, defines a breed, and covers the two fundamental questions faced by animal breeders: what is the best animal and how do you breed animals to improve future generations. Key methods discussed include selection, mating, identification, recording, and estimating breeding values. A brief history of animal breeding is also provided.

1. .

2. -
University of Gondar
Institute of Biotechnology
Department of Agricultural Biotechnology
Course tile : Animal Breeding
Course code : Biot 3096
Credit Hours : (2) or Course ECTS: 3
Beneficiaries : 3rd Year Biotechnology Surdents
Instructor : Yizengaw M. (M.Sc.,Animal Breeding and Genetics )

3. CHAPTER ONE: INTRODUCTION
1.1. General overview
 What is animal breeding?
 It is scientific application of genetic principles to the improvement of
livestock populations.
 What is a Breed ?
a stock of animals or plants within a species having a distinctive
appearance and typically having been developed by deliberate selection.
 Breeding use the principles of genetics to improve livestock.
 It studies how genes function, inherited and interact.
 There are two fundamental questions faced by animal breeder.
(1) What is the best animal and
(2) How do you breed animals so that their descendants will be if not ‘best, at least
better than to days animals?

4. What is the best animal?
 Is the best dairy cow the one that gives
the most milk,
with the best feet,
udders support or
that combines performance in these traits in some optimal way
 Best is relative term, there is no best animal in all situations.
 The kinds of animals that work best in one environment may be
quite different from the optimal animals under another
environment.
 The definition of best animals can change with time.

5. Methods to select best animal
Identify traits of importance example
 Reproductive trait, e.g. Litter size, conception rate, calving
interval
 Production trait; e.g. milk yield, growth rate, feed
efficiency,
 traits for disease resistance,
 heat tolerance
Understanding of how traits interact with a production system
(physical environment, management, costs)
Breeders place in the structure of the industry

6. How do you breed animals so that their descendants will be if not
‘best’, at least better than to days animals?
• The Purpose of animal breeding is not to genetically improving
individual animal but to improve animal population (to improve
future generations of populations).
• From a breeding stand point breeders want to kwon not only the
most desirable phenotypes,but the most desirable genotype as well.
• That is because livestock genotype provides the genetic
background for its phenotype.
P = G+E
Generally, an animal’s phenotype is determined by its genotype and
the environment in which it is working

7. Cont---
• To improve animal population breeders use two tools
Selection
 mating both involve decision making
 In selection breeders decide
which individual become parents,
how many offspring they may produce and
how long they remain in the breeding population
 In mating breeders decide which of the males selected will be
bred to which of the females selected

8. Cont…
 Successful animal breeding requires the collection and storage of
data on individually identified animals;
 And complete pedigree information about the sire and dam of each
animal.
 Without these two pieces of information little genetic change can
be made in a population.
 Animal identification is important today for the ability to monitor
animal movement for human health safety purposes.
 Animal recording and registrations are expensive programs to
run, but are necessary to improve the breed or population.

9. Con…
• Ideally, all animals within a herd should be recorded without any
selection on which animals would be recorded.
• Animal breeders analyze the data to estimate the breeding values
of individual animals in a population using statistical linear
models.
• Animals are ranked on the basis of the estimated breeding values
(EBV), and the better animals are mated together, and the rest are
culled (i.e. not allowed to mate)
• Animals are usually evaluated for several traits and these are
weighted by their relative economic values allowing for the
heritability of each trait.

10. HISTORY OF ANIMAL BREEDING
Till 500 A.D. when the fall of Roman Empire began animal breeding was at its
esteem.
With the fall of Roman Empire for about 1000 years called Dark and Middle Ages,
animal husbandry was at a still.
From 1700 A.D., again there was an improvement. The beginning of modern animal
breeding is to be found mainly in England and Europe
The British Royalty encouraged horse breeding especially for race horses.
The Earls and Dukes imported bulls from Holland and bred their native stocks.
Dutch cattle were introduced into Herefordshire that laid the foundation of the
present Hereford cattle.
By crossing the native and Dutch cattle and subsequent inbreeding, the British cattle
were improved far beyond the best.

11. Cont….
Robert Bakewell (1760), popularly known as the Founder
of Animal Breeding, worked on Thorough bred
horse, Shorthorn cattle and Leicester sheep in
his farm at Dishley, England and became
successful in animal breeding.
He developed certain theories, tested them with
experiment and laid down the following principles:
(i) Like begets like – this has led to development of
pedigree breeding.
(ii) Selected males if they transmitted desirable traits
– this led to the development of progeny testing.

12. Cont…
(iii) Bred the best to best irrespective of genetic
relationship. This has led to the development of
inbreeding and pure breeding stock.
The greatest contribution of Robert Bakewell to breeding methods
was that he appreciated inbreeding as the most effective tool to
produce refinement in the breed.
2. Spallanzani (1780) for the first time successfully
demonstrated AI in dog.
3. Hunter (1799) successfully produced pregnancy in
women through AI.
Added for development of AH and further “Purebred
Breed Association”.

13. Cont…
Formation of Breed Association
Breed Registration & introduction of herd book:
First herd book was “An introduction to the general Stud
Book” for Thorough bred horse was started in the
year 1791.
The second herd book was Shorthorn herd book published in
1822.
6. Introduction of pure breeding in India : 1950 – 1964
7. Cross Breeding was the major policy with pure
breeding in original tract 1964 – 1997.

14. Main objectives of Animal Breeding:
improved growth rate,
increased production of milk, meat, egg, wool, etc.,
superior quality of milk, meat, eggs, wool, etc.,
improved resistance to various diseases,
increased productive life, and
increased or, at least, acceptable reproduction rate

15. CHAPTER TWO:
Principles of Mendelian Inheritance

33. Testing for genetic abnormalities
Genetic Testing
Predictive testing-- Tells an animal if it carries a mutation that will
cause, or put it at higher risk for, a disease later in life.
Newborn screening-- Detects common disorders in newborns,
where immediate treatment can prevent dangerous symptoms
Carrier testing-- Tells an animal whether or not it carries a
mutation that could be passed on to his offspring. One can be a
carrier, but not be at risk for a disease (as in recessive genes)

34. Molecular Techniques of Genetic
testing

36. aaaccatctaggctatattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga
gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg
gggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagctagtg
atgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatcgatctatcggatct
atctactagagctactacgatcagggactactacgagcatcgactacgaggcttctagaggctatattctaggcta
ctacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcaa
aggtttttttttttcagctagctggggggggggggatcgggtgtgtcgatgtgtgagcaaaatattagcaacccccc
ccccattactgatgtcattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga
gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg
gggggggacacagcgatctaatataaatctgatgatcaaaggtttttttttttcagctagcttacgatcgatctacgta
gctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaa
aaaaacgtgagctagtgatgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcgg
atatcgatctagatatcgatctatcggatctatctactagagctactacgatcagggatatcgatctatcggatctatc
tactagagctactacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggcta
tattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacgagcatcgactacgag
gcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtggggggggacacag
cgatctaatataaacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagct
agtgatgggtgatgtcagtgtagtcgtagtcgtacgatcagggatatcgatctatcggatctatctactagagctac
tacgatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggctatattcggatgatc
tatctactagagctgatctatctactagagctgtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatc
Normal
Examples of Mutations in the DNA Sequence…

37. Gaaccatctaggctatattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga
gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg
gggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagctagtg
atgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatcgatctatcggatct
atctactagagctactacgatcagggactactacgagcatcgactacgaggcttctagaggctatattctaggcta
ctacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcaa
aggtttttttttttcagctagctggggggggggggatcgggtgtgtcgatgtgtgagcaaaatattagcaacccccc
ccccattactgatgtcattcggatatcgatctatcggatctatctactagagctactacgatcagggactactacga
gcatcgactacgaggcttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtg
gggggggacacagcgatctaatataaatctgataatcaaaggtttttttttttcagctagcttacgatcgatctacgta
gctacgagatcgtgtgtggggggggacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaa
aaaaacgtgagctagtgatgggtgatgtcagtgtagtcgtagtcgtgtgataaaaaaccatctaggctatattcgg
atatcgatctagatatcgatctatcggatctatctactagagctactacgatcagggatatcgatctatcggatctatc
tactagagctactacgatcaggg ggatctatctactagagctactacgatcaggatctaggct
ttcggatatcgatctatcggatctatctactagagctactacgatcagggactactacgagcatcgactacgaggc
ttctagaggctatattctaggctactacgatcgatctacgtagctacgagatcgtgtgtggggggggacacagcg
atctaatataaacacagcgatctaatataaatctgatgatcgatcgacataaaaaaaaaaaaaaacgtgagctagt
gatgggtgatgtcagtgtagtcttggAcgtacgatcagggatatcgatctatcggatctatctactagagctactac
gatcagggatatcgatctatcggatctatctactagagctactacgatcaggatctaggctatattcggatgatctat
ctactagagctgatctatctactagagctgtcgtagtcgtgtgataaaaaaccatctaggctatattcggatatc
Single base pair mutation
Examples of Mutations in the DNA Sequence…
(Sickle cell anemia)

38. CHAPTER THREE : POPULATION GENETICS
• Population genetics is a field of inquiry in which genetics as
related to a group or population is considered in contrast to the
genetics of individuals.
• Genetic improvement of a population results from underlying
changes in gene frequency
And changes in the way in which the mating system in the
population permits the genes to unite as the zygotes are produced.

39. 3.1 Allele and Genotype Frequencies
• Gene Frequency: The frequency of a gene means the degree to
which it is rare or abundant.
• More precisely, the frequency of a gene is the proportion of the
loci of a given allelic series occupied by a particular gene.
• The frequency of a gene (allelic frequency) is designated by the
letter p & q.
 


 



loci
a
loci
A
loci
a
loci
a
loci
A
loci
A
p
"
"
"
"
"
"
=
q
&
"
"
"
"
"
"

40. Cont…
Frequency of allele A = number of copies of A alleles in a
population /Total number of copies of gene in a population
• Consider the case of coat colour in Shorthorn cattle, on the basis of
a single locus where RR animal is red, an Rr animal is roam, & an
rr animal is white.
• In a herd of 100 Shorthorn there are 47 red, 44 roam, and 9 white
animals.
• There are 200 loci in this population, and 138 of the 200 loci are
occupied by the R gene (two in each of the 47 red animals plus one
in each of the roam animals).
• Thus calculate the gene frequency?

41. Cont…
• Phenotype and Genotype
R
p
x x
 
 
2 47 44
200
2 9 44
200
0 31
= 0.69 &
r
q = .
Phenotypes Genotypes
M
MN
N
M M
M N
N N

42. ALLELE & GENOTYPE FREQUENCIES IN SURVEY OF
CATTLE POPULATION
Phenotype Genotype # M alleles # N alleles
298 M 298 MM 596 0
489 MN 489 MN 489 489
213 N 213 NN 0 426
Total
1000
1000 1085 915

43. Cont…
Genotype frequency is relative proportion of genotype:
Proportion of MM genotype = 298/1000 = 0.298
Proportion of MN genotype = 489/1000 = 0.489
Proportion of NN genotype = 213/1000 = 0.213
Total = 1.000
The allele frequency of the M allele is the relative proportion of the
allele:
Proportion of M allele =1085/2000=0.5425
Proportion of N allele = 915/2000 =0.4575
Total=1.000
• If we let p = the allele frequency of M and q= the allele frequency
of N, then q = 1-p.

44. 3.3. The hardy-Weinberg principles
• In a large population mating randomly with no selection, mutation,
or migration:
• The frequency of each allele tends to remain constant from
generation to generation.
• The H-W formula permits an indirect estimation of gene
frequencies when we are working with populations in which the
organism is diploid, reproduction is sexual, generations are non-
overlapping,
The genes under consideration has two alleles, the allele frequencies
are identical in males and females, mating is random, mutation can
be ignored, migration is negligible,

45. H-W ASSUMPTIONS
Hardy-Weinberg law lays the foundation for the study of
population genetics.
It gives a mathematical approach for genetics and evolution.
1) Mating is random (with respect to the locus).
2) The population is infinitely large.
3) Genes are not added from outside the population (no gene flow
or migration).
4) Genes do not change from one allelic state to another (no
mutation).
5) All individuals have equal probabilities of survival and
reproduction (no selection).

46. Cont…
• In a population satisfying the H-W-Law the proportion of the
different types of gametes produced in a population is directly
proportional to their respective gene frequencies.
P + q =1
Both gene and genotype frequencies in a population remain constant generation
after generation when the population is large; mating is at random and in the
absence of selection, mutation and migration.

47. Cont…
• When the gene frequency remains constant generations after
generations,
• The population is in genetic equilibrium or H-W equilibrium non-
evolutionary model.
• When the population is in genetic equilibrium, the rate of evolution
is zero.
• That is, when a population obeys, hardy-Weinberg law the
population will not undergo evolution.
• So evolution occurs only when Hardy-Weinberg equilibrium is
altered.

48. Cont…
• The Hardy-Weinberg law is represented by a simple formula
For 2 alleles (A1 and A2) of one gene
p = f(A) Frequency of 'A1' gene
q = f(a) Frequency of 'A2' gene
– Then the next generation will have:
• The frequency of homozygotes is equal to the gene
frequency squared
p =Frequency of dominant gene
q =Frequency of recessive gene
p2 =Frequency of dominant homozygote
2pq =Frequency of heterozygote
q2 =Frequency of recessive homozygote

49. Cont…
– The frequency of the A1A1 genotype = p2
– The frequency of the A2A2 genotype = q2
–The frequency of heterozygote’s is equal to twice the product of the
two gene frequencies
– The frequency of the A1A2 genotype = 2pq
For a dimorphic gene the Hardy-Weinberg equation is based on the
binomial distribution:
p2 + 2pq + q2 = 1
p + q =1

50. Gamete (allele) Frequencies:
Freq(A) = p
Freq(a) = q
 p + q = 1
Genotype Frequencies of 3 Possible Zygotes:
AA Aa aa
Freq (AA) = pA x pA = pA
2
Freq (Aa) = (pA x qa) + (qa x pA) = 2pAqa
Freq (aa) = qa x qa = qa
2
 p2 + 2pq + q2 = 1

51. GENOTYPE VERSUS GENE FREQUENCIES
q2 (aa)
p2 (AA)
2pq (Aa)

52. General Rule for Estimating Allele Frequencies from Genotype
Frequencies:
Genotypes: AA Aa aa
Frequency: p2 2pq q2
 Frequency of the A allele:
p = p2 + ½ (2pq)
 Frequency of the a allele:
q = q2 + ½ (2pq)

53. Example
• You have sampled a population in which you know that the percentage of the
homozygous recessive genotype (aa) is 49%. Then how much frequency of the
"A" allele?
• The allele y occurs with a frequency of 0.6 in a population of clams. the
frequency of genotypes, Yy, is ?
• In a different population of sheep, 240 sheep are homozygous BB, 380 are
hybrid Bb, and 230 are homozygous bb. The allele frequency of B is?

54. 3.4 Changes in gene frequency
Genetic variation describes naturally occurring genetic differences
among individuals of the same species.
• This variation permits flexibility and survival of a population in
the face of changing environmental circumstances.
• Consequently, genetic variation is often considered an advantage,
as it is a form of preparation for the unexpected.

55. Forces that Change Gene Frequency
• Mutation
• Migration
• Selection
• Genetic drift

56. Mutation
• Change in the base sequence
• Some mutations occur at regular frequency
• Mutation rate is low and regular change due to mutations is
very small
• By chance, some mutations end up making a difference in
livestock (dwarfism in beef cattle in the 1950s)

57. Types and rates of mutations
•Mutations are caused by physical changes to the hereditary material
• Because DNA is a long sequence of base pairs organized into
physically unlinked chromosomes, there are many possible ways it
can change.
1. Point mutations that change only a single letter and lead to so-
called ‘single nucleotide polymorphisms’ in populations,
2. Insertions and deletions of various sizes (also called ‘indels’ if it is
difficult to decide which of the two actually happened; these can also
lead to ‘copy number variants’),
3. Transpositions that move a sequence from one position to another,
and can thereby cause mutations at the boundaries,

58. Cont…
4. Inversions of various sizes that change the orientation of a stretch
of DNA,
5. Chromosome mutations that affect long enough pieces of DNA
lead to the loss or duplication of a whole chromosome (also known
as non-disjunctions)
6. Changes in the ploidy level, where a whole copy of the genome is
either gained or lost.

59. Migration
• Importing new genes into a population
–Purchasing new sire
–Opening up breed to new animals
–Importing European breeds of cattle
• Very powerful force for changing gene frequency

60. Cont…
•What effect does migration have on relative allele frequencies?
•If the migrating individuals stay and mate with the destination
individuals, they can provide a sudden influx of alleles.
•After mating is established between the migrating and destination
individuals,
•The migrating individuals will contribute gametes carrying alleles
that can alter the existing proportion of alleles in the destination
population.
•Although it can occur in cyclical patterns migration when used in a
population genetics refers to the movement of individuals into or out
of a defined population

61. Genetic Drift
• Change in gene frequency due to chance
• Each sperm and egg contains random sample of genes from parent
• Sample may be above or below average
• Some offspring better than average of parents
• Some offspring worse than average of parents

62. Selection
• Choosing best young animals to be parents
• Eliminating inferior parents from population
• Progress is gradual but steady
• Should select on a balance of characteristics

63. Quiz 1. Answer the following question
• 1. Assume 100 cats (200 alleles) with alleles B and b. B allele is
dominant and results in black coloring. 16 of the cats are white
(genotype bb). If you assume HWE, what are the allele (B,b) and
genotype (BB, Bb, bb) frequencies?
2. Assume that a population of 50 individuals has the following
numbers of genotypes for a gene with two alleles, B and b: BB =
30, Bb = 10, and bb = 10. Calculate the frequencies of the two
alleles in the population’s gene pool.
3. Write the assumption of hardy Weinberg principle?

64. CHAPTER FOUR BASIC TOOLS AND PRINCIPLES IN
ANIMAL BREEDING
• 4.1. Selection
• Selection is the core force which decides certain preferred parents
in a population to contribute more offspring in the next generation
than others do.
• Selection does not create new genes, but by permitting animals
possessing certain genes to leave more offspring it increases the
frequency of the more desirable alleles.
•In nature, the animals best adapted to their environment survive and
produce the largest number of offspring.
•This is natural selection, or survival of the fittest, acting upon the
variations produced by mutation and recombination’s of genetic
factors

65. 4.1.1. Types of selection
1. Individual selection: is selection on the basis of individual’s own
performance.
•It is the simplest method by which an animal breeder can think of
improving his herd.
•Selection on the basis of individual merit is strictly phenotypic.
•When individual’s own performance is being considered this is
termed, mass selection( is based on ranking the animals on their own
performance. )
•Mass selection can be very powerful for highly heritable traits which
are expressed early in life for both the sexes.

66. Cont…
• Under these conditions, progeny testing is not likely to be useful.
• The progress due to selection depends upon the h2 of that trait and
the generation interval of species.
• Low h2 with longer generation interval and late maturity, which
are associated with our animals are the main drawback to the
livestock improvement.
 Individual selection has the following shortcomings
1. Several important traits, including milk production in dairy cattle,
maternal abilities in cows, ewes, and sows, and egg production in
poultry, are expressed only by females.

67. Cont…
• Thus, selection of breeding males cannot be based on their own
performance.
2. Performance records for milk and egg production and other
maternal qualities are available only after sexual maturity is
reached.
3. In case in which h2 is low, individual merit is a poor indicator of
BV.
4. The easy appraisal of appearance (or type) often tempts the breeder
to over emphasize this evaluation in selection

68. 2. Pedigree selection
• When the selection is made as per the performance of the
ancestors, the selection is termed Pedigree selection.
• Pedigree is a record which gives full information on the ancestors
of the individual and also of his collateral relatives.
• The pedigree of an animal is a record of the animals which are
related to him.
• We pay attention to the pedigree b/c we do not have adequate
information on the merit of the individual.
• In some instances, some selections may need to be made before the
individual expresses the trait(s), such as feed lot gain and feed
efficiency.

69. Cont…
• In other instances the trait may be sex-limited in its expression,
such as milk yield and egg production and selection males prior to
progeny test must rely on pedigree information.
• Examples of pedigree selection are choosing young dairy bulls
from high producing cows or choosing cockerels from hens with
good egg yield.
• In pedigree selection, more stress should be given to the merit of
the most recent ancestors than the distantly related high producers
• Consideration of both the individual’s production record and
pedigree is more powerful in selection than the pedigree alone

70. Cont…
• Pedigree selection is not sufficiently accurate to permit rapid
genetic improvement
• But it does provide a useful method when the animals are selected
at young age and their own type and conformation is not known.
• If the individual’s phenotype is known with precision, little is
gained by attention to the pedigree.
• 3. Family selection: means the choosing of animals on the
performance of their close contemporary relatives or collateral
relatives who are not related directly either as ancestor or as their
progeny.

71. Cont…
• They are individual’s brothers, sisters, cousins, uncles, aunts, etc.
• Family selection is of great use in the development of swine and
poultry where the family size is large
• But it has limited application in cattle and sheep, b/c family size is
small.
• Generally half-sib and full-sib families are most common in animal
populations.

72. Cont…
• An individual receives no genes from collateral relatives, but their
average performance is an indication of the genes transmitted to
each family member by one or more common ancestors.
• Thus family selection can be represented as a part of pedigree
selection.
• 4. Progeny selection: The final basis for selection is the
performance of the subject’s progeny.
• The clear picture regarding the genetic make-up or genotype of an
animal is obtained by the performance of its offspring.

73. Cont…
• Traits that can be measured in only one sex, such as milk
production in cows and egg production in hens are evaluated most
effectively by the progeny tests.
• Progeny tests can be of immense value in measuring characteristics
which can not be determined in the living individual (e.g. carcass
quality in cattle).
• For traits of low h2 progeny testing is the most valuable method.
• While conducting a progeny test, it is very important to test a
random sample of the progeny.
• It is also important that the females to which a male is mated should
be a non-selected group

74. Cont…
• It is always possible that the offspring of a sire through outstanding
females in the herd will be superior.
• Such practice would be misleading in comparing males by progeny
test.
• The accuracy of progeny testing can be seriously influenced
particularly in small herds
• where each progeny group is tested on a different farm or under a
different set of environmental conditions.
• Care should be taken to bring the progeny group together at a
young age for testing at a central test station.

75. Cont…
• The other is to have the individual members of each progeny group
scattered widely over the different farm,
• So each sire has an equal opportunity to have his offspring
exposed to both good and poor environmental conditions.
• Each sire tested should have large number of offspring to promote
the accuracy of progeny testing.
• . The number of offspring required for the correct progeny test
depends on the h2 of the traits
• When the trait is highly heritable, fewer offspring are required and
greater numbers are needed for lowly heritable

76. Cont…
Thus, for traits having extremely low h2 and for traits expressed
only in one sex (e.g. milk production and egg production);
• an appreciable increase in progeny testing can be achieved by
having as many as 30 offspring tested per sire.
• Therefore an optimum allotment of females for testing young sires
• And for mating to males which have already passed a satisfactory
progeny test is essential to achieve maximum genetic progress.

77. Limitation of progeny test
• Though the progeny test is an asset in appraising individual’s BV
accurately.
• its limitation is in the time and expense required to prove an animal
on a progeny test.
• Progeny testing can be most effective when it is incorporated into a
systematic, well planned programme.
• Such a program assures a steady supply of tested males to replace
those which are lost due to reasons of infertility and old age.
If the performance is really operating effectively, the incoming
males at each stage should be superior genetically to earlier males
at that comparable stage.

78. 4.1.2. Effectiveness of selection
• The initial task is to obtain an accurate estimate of the additive BVs
of the animals available for selection.
• The BVs of the individuals are predicted from available
information, such as their own performance and their relative’s
performance.
• The effectiveness or rate of improvement in performance from
selection during a generation is dependent on 3 primary factors:
 Accuracy of selection
 Intensity of selection
 Generation interval

79. Accuracy of Selection
• Accuracy in selection means how closely the individual’s real BV
agrees with what we think it is, when we do the selection.
• More precisely, accuracy in selection means the correlation b/n
true BV and estimated BV.
• The correlation coefficient measures the association b/n two
variables.
• If they are closely related, the value for one variable can be
accurately predicted from the second variable.
• The accuracy of the prediction of one variable from another varies
directly with the magnitude of the correlation coefficient b/n them

80. Cont…
• The accuracy of selection for a trait is tied directly to its h2.
• If h2 is high, selection for a trait will permit an accurate sorting of
BVs.
• If h2 is low, then many errors will be made when trying to select
the best breeding animals from their own performance.
• When the accuracy of selection on individuality is too low to make
reasonable genetic improvement, it can be enhanced .

81. Estimating Breeding value… =
Phenotypic variation P= A+ NA+E
VP =VG +VE + VExG
• NA VE ==
VVG= Total genetic variance
VA= Additive genetic variance
VD= dominant variance
VI= interaction genetic variance
E Total Phenotypic variation
VP = VA + VD + VI + VE + VGE

82. Con..
Breeding Value Dominance Environment
=

83. 2. Intensity of selection
 The intensity of selection is measured by the magnitude of the
selection differential (R = h2 S).
 The proportion of the population which must be saved for
reproduction places an upper limit on the size of the selection
differential
•It is largely determined by the reproductive rate of each species.
•The use of AI and frozen semen increases the selection intensity
which can be exercised in the choice of males.
•The percentage of the population which must be saved is dependent
on whether or not a population is expanding, remaining constant,
or decreasing in size

84. 3. Generation interval (GI)
• GI is the average age of the parents when their offspring are born.
This of course varies with species.
• Some practical values for generation interval are given
Classes of
livestock
Average generation interval
Male Females
A* B**
Beef 3 8 4.5
Cattle 3 8 4.5
Sheep 2 4 4.0
Swine 1.5 3 1.5
•A* Mass selection: Males used early and replaced after 2 breeding season
•B** Males to be used 3 breeding seasons after progeny test is complete

85. Cont….
•Management practices that allow for early breeding of individuals
can reduce generation interval.
•For example, when beef heifers are bred to calve first at three years,
the female generation interval can be reduced approximately one year.
•On the other hand certain breeding practices such as progeny testing
extend the generation interval, and this should be reckoned with in
assessing the total merit of such a selection system.

86. 4.1.3. Different methods of selection
 1. Tandem method selection is practiced for only one character at
a time until a satisfactory level is reached,
then a second character is considered, later a third and so on.
 The efficiency of this method depends on the genetic correlations
among the traits.
 If there are strong positive genetic correlations among the traits,
then selection for one trait would improve the correlated traits.
 Negative correlations, b/n the traits, the subsequent selection for a
second trait would nullify the progress made in the first selection

87. 2. Independent culling method
• With independent culling method, selection may be practiced for
two or more traits simultaneously.
• For each characteristic, a culling level is established below which
all individuals are culled, without any regard to their merit for
other traits.
• This is one of the major disadvantages of this method; the
superiority for one trait does not have an opportunity to offset lack
of merit in any other trait.

88. 3. Selection index method Cont…
The principles of this method in which the animal is scored for its
merit in each of the traits included in the selection and the addition
of these scores will give a total score for the traits.
 Then the animals with the highest total score are retained from
breeding purposes and the poorest will be the culled.
 The selection index is found to be more efficient than either of the
two methods.
 If selection index is correctly constructed, this method is most
advantageous method of selection, b/c, it would allow the high
superiority in one trait to patch up slight deficiencies in the other.

89. CHAPTER FIVE : RELATIONSHIP AND SYSTEMS OF
MATING
• The principles of mating the animals is to evolve outstanding and
improved types of animals which can render better service to man.
• The art of mating the animals implies the proper application of
principles of heredity for the animal improvement.
• Systems of mating can be classified into in-breeding and out-
breeding,
• Depending on the genetic relationship of the individuals or on
phenotypic resemblance of the individuals in order to obtain better
type of animals in the next generation.

90. Mating Systems
• Inbreeding
• Linebreeding
• Linecrossing
• Crossbreeding

91. 5.1. Inbreeding
• Inbreeding is a mating system in which individuals mated are
more closely related than the average of their breed or population.
• It means the mating of males and females which are related.
• Animals deemed to be related only when they have one or more
ancestors in common in the first 4 - 6 generations.
• The intensity of inbreeding depends on the degree of relationship.
• Close inbreeding denotes mating of closely related individuals like
Dam to Son or Sire to Daughter or Full Brother to Full Sister

92. Coefficient of Inbreeding (IC)
• Is a measure of probable increase in homozygousity or decrease in
heterozygosity of inbred animals as compared with non-inbred animals
of the same population.
• Is expressed as a percentage value.
• A low inbreeding coefficient means a low level of inbreeding.
• In most beef cattle breed societies, the vast majority of animals have an
inbreeding coefficient of less than 10%, inbreeding coefficients over
30% are unusual, and over 40% are rare.
• The general formula for an inbreeding coefficient is as follows:
FX =∑[(1/2)n+1(1+FA)]

93. Cont…
• where
FX = inbreeding coefficient of individual X,
∑ = summation sign, indicating that the values in the brackets are
to be added together,
n = number of segregations (arrows) between the sire and dam in
each separate path through the common ancestor,
and
FA = inbreeding coefficient of the common ancestor in each
separate ancestry path.

94. Example

95. Example 2

96. Advantages and disadvantages Inbreeding
 Advantages
increased uniformity
increased prepotency (ability to pass on traits to offspring)
“fixing” of desired traits and breed type
 Disadvantages
lower fertility
lower “vigor”
birth defects
smaller size
fewer offspring
slower growth
higher offspring mortality
shorter lifespan
increase in genetic diseases
reduced “genetic potential”
(ability to improve a trait)

97. Mating Systems
•Inbreeding
Heterosis, also called hybrid vigour, the increase in such
characteristics as size, growth rate, fertility, and yield of a hybrid
organism over those of its parents.
–Inbreeding depression
is the reduced biological fitness in a given population as a result of
inbreeding, or breeding of related individuals.
•causes decline in performance due to increase in frequency
of recessive homozygotes
•most decline in reproduction and livability

98. Mating Systems
•Linebreeding
• Mating animals that are more distantly related
• Can be traced back to 1 common ancestor
• Examples
– Cousins
– Grandparents to grand offspring
– Half-brother to half-sister
• Increases genetic purity
• Several generations results in desirable and undesirable
genes to become grouped together with greater
frequency—making culling easier

99. Example
The offspring in the second generation have received 50% of their genetic inheritance from the sire A because he appears
twice in their pedigree. They have received only 25% of their genetic inheritance from each of the females B and C.
2nd Generation
½ A ¼ B ¼ C
2nd Mating
1/2A1/2 B x 1/2A/2C
1st Generation
½ A ½ B ½ A ½ C
1st Mating
A x B A x C

100. Mating Systems
•Linecrossing
• Mating animals from two different lines of
breeding within a breed
• Purpose is to bring together desirable traits
from different lines
• Experience is the best guide to use when line
crossing
–Causes some increase in performance (less than what is seen
with crossbreeding)

101. Crossbreeding
–Mating of individuals from different breeds
• Most intensive
• Animals are very closely related and can be traced
back to more than 1 common ancestor
• Examples:
– Sire to daughter
– Son to dam
– Brother to sister
–Benefits
–the increase in growth, size, fecundity, function, yield, or other characters in
hybrids over those of the parents.
•heterosis – advantage of crossbred individual compared to the average of the
component purebreds
•breed complementarity – using benefits from breeds while hiding the flaws

102. Example
The offspring of the 2nd generation have received 75% of their genetic make-up from the sire A because he appears closer in
the pedigree to the offspring than he does in linebreeding. They have received only 25% of their genetic inheritance from
the female B.
2nd Generation
3/4A 1/4B
2nd Mating
A 1/2A 1/2B
1st Generation
½ A ½ B
1st Mating
A (Male) B (Female)

103. 5.2. Out breeding
This is a breeding system, wherein animals less related than the
average of the population to which they belong, are mated.
•For all practical purposes, a mating can be considered out breeding,
if the individuals involved, do not have a common ancestor in the
preceding first 4 to 6 generations.
•Out bred animals are less likely to breed true than are inbred
animals.

104. Forms of out breeding
• Out crossing
• is the practice of introducing unrelated genetic material into a
breeding line.
• It increases genetic diversity, thus reducing the probability of an
individual being subject to disease or genetic abnormalities.
• This system is often resorted to by breeders of pure bred livestock.
• The breeder practices, line breeding for several generations to
concentrate on good characteristics from chosen ancestors.
• In this breeding process, sometimes, the breeder finds that some
undesirable characters also get fixed.

105. Top crossing
•This is another form of out crossing, though rare, different families
within a pure breed are combined.
•For instance, in India, one has imported in the recent past large
number of HF, Jersey and Brown Swiss bulls and strains of those
breeds are being developed.
•In course of time, one may want to improve the genotype of these
exotic breeds by importing bulls from their original nature home
tract.
•When such imported animals will be bred to the already imported
ones, then this is called top-crossing.

106. Grading up
• Is the gradual changing of a breed by continued crossing with
another from generation to generation.
• This system has been use all over the world to ´upgrade´ one breed
and converts it to another.
• Most breed societies with open herd/flock books would accept four
or five top-crosses of this kind to consider the upgraded animal
purebred.
• After four crosses the animal would be 93.8% pure.
• This is the most common method by which several improved dairy
farms have been established.

107. Example
3rd Generation
½A3 ¼A2 1/8A1 1/8G 87.5% Purebred, 12.5% Grade
3rd Mating
A3 x ½ A2 ¼ A1 ¼ G
2nd Generation
½ A2 ¼ A1 ¼ G 75% Purebred, 25% Grade
2nd Mating
A2 x ½ A1 ½ G
1st Generation
1/2A11/2G 50% Pure 50% Grade
1st Mating
A1 x G

108. Cross-breeding
•Cross-breeding is a system of mating in which two distinct different
breeds are involved. If a Jersey is bred to an Arsi it is called cross-
breeding.
•In Africa, the exotic breeds (HF, Jersey, Brown Swiss etc.) are
utilized in crossing the indigenous breeds of cows.
•Cross-breeding leads to the production of half-breeds in the F1, i.e.,
animals with half inheritance from each of the two parent breeds.
•This is very effective in bringing about genetic potential in a very
short period.
•The F1 also exhibits „Hybrid vigor“! Subsequently, breeding
programmes with these half-breeds are designated by different names
based on the methods followed.

109. Inter se mating
• Inter se mating
• In this kind of breeding system, the F1 females are mated with F1
males of the same breed.
• Inter se mating can also be at any other inheritance level.
• The half-bred population can also be mated to one of the parental
breeds and the offspring produced will have - the inheritance of one
bred and inheritance of the other breed.
• When these are bred among themselves, a second generation ¾ to
¼ is produced

110. Criss-crossing (two breed rotational system)
• the F1 is mated to A and B alternatively
• This system refers to the use of two breeds and alternation of each
of the two breeds on the cross-bred.
• For instance, if Jersey is used on Arsi the F1 will be half Jersey
and half Arsi.
• If on those half female population, Jersey bulls are used, it will
produce ¾ Jersey and ¼ Arsi offspring.
• When to this population of females, if Arsi bulls are used, a
population of 5/8 Arsi and 3/8 Jersey offspring will be produced.
This offspring bred to Jersey will produce 11/16 Jersey and 5/16
Arsi. This offspring then bred to Arsi will produce 11/32 Jersey
and 21/32 Arsi.

111. Triple crossing (three breed rotational system)
• This is more or less similar to criss-crossing, but here, three breeds
are involved.
• Say breed A and B to produce offspring of 1/2A and 1/2B.
• This population will be bred to C to produce 1/2C, 1/4A, and
1/4B. Now this in turn will be bred to A to produce 3/8A, 1/8B,
and 1/4C and so on.
• The use of cross-breeding technique for increasing productivity in
cows is utilized in tropical countries to lift up the production
potential, b/c of low genetic potential of native breeds.
• But, we cannot forget the desired qualities of local breeds like,
resistance to many diseases, adaptability tropical climate and
general thriftiness under inferior feeding and management
conditions.

112. CHAPTER SIX: ANIMAL EVALUATION AND BREEDING
VALUE
• The performance of an animal is the result of
the heredity of the individual
 the cumulative impact of environmental circumstances from
fertilization until the time of measurement or observation
 A major concern in measuring performance has been that of
 insuring that the phenotypic expression of the animals
or offspring of animals being compared are secured under
comparable conditions.

113. Cont…
•Ideally, every animal in breeding unit should be tested to provide
a solid basis for both production culling and
for the choice of breeding stock.
•Performance and progeny testing programs must balance
consideration of the accuracy of the test, the score of the testing, and
the probable increase in generation length.

114. 6.1. Special versus Field Evaluation
•Special control of conditions at the testing stations would increase
the accuracy of the results by measurably reducing environmental
effects.
Station test Field test
1. small (limited) no. of progeny of a sire
could be tested.
2. the expense is so great that sufficient
males can rarely be progeny tested.
3. measurements can be made that can’t be
obtained in field test, e.g. feed intake
4.standardized conditions of environmental
as well as managemental conditions
increase the accuracy of the test
1. great no. of progeny of a sire could
be tested
2. requires low expense in comparison
to station test
3. Great influence of environmental
factors affects the traits.
As a result of this the accuracy is of the
test is greatly influenced

115. Performance testing
•Involves recording the performance of the animal under study and
making decisions in the light of those data.
•The usefulness of performance testing depends upon the degree to
which superiority of an individual compared with its contemporaries.
•The performance test seeks to be a guide to the BV of the individual
•and this can only be assessed if individuals are compared with
others treated in the same way at the same time.
•The degree to which there is equal treatment will determine the
validity of the testing

116. Cont…
•If the bulls came from mothers of different ages/parities then this
might influence post-weaning performance.
•Testing at special centers is easier than on-farm testing, but more
costly.
The difficulty with on-farm testing might be obtaining enough
animals to test at the same time.

117. Progeny testing
•Progeny represents a sample of the genes of their father (and mother),
these will give a reasonable idea of superiority of that sire.
•Progeny testing is time consuming and increases the generation
interval.
•For example a dairy bull will be about six years of age before he has
sufficient progeny lactating to allow any estimate of his breeding
worth for milking traits.
•For this reason performance testing is generally preferable but it
obviously cannot be undertaken for milk yield in bulls.
•Usually progeny testing is undertaken for traits that have a low h2 and
for which performance results are thus a prior guide.

118. Cont…
•It is also used for traits expressed only in one sex (e.g. milk
production) and those expressed only after death (e.g. carcass
composition).
• Effective progeny test require:
1) As many sires on test as possible (5 - 10 minimum).
2) The random mating of dams to ensure that certain sire is not mated
simply to very good or very poor dams and that sires get similar
numbers of young/old mates.
3) As many progeny per sire are produced as possible (10 minimum).
4) Progeny must be unselected during the test.
5) Progeny must be treated in the same way or comparisons made
within herd/flock and year/season groupings.

119. 6.2. Heritability
•Heritability is the fraction of the observed phenotypic variance
which results from differences in heredity.
 Heritability for livestock production traits are generally <0.5
 Heritability for the same traits can different if animals are
producing in different environment
 Heritability can change overtime (as genetic variance changes in
response to selection).
 Estimation of heritability keeps many livestock geneticists in job
 h2=VG/VP

120. Heritability is of two types
• Narrow sense (h2)
2
2
2
2
2
2
2
2
e
i
d
a
i
d
a
H




 







2
2
2
2
2
2
e
i
d
a
a
h









Broad sense (H2):

121. Cont…
Theoretically, h2 can range from 0 to 1, but these extreme values
are rarely encountered in practice.
A particular h2 value is descriptive of a trait in a particular
population at a given time.
Since H2 accounts the total genetic variation, i.e. + (can be
inherited) + (can’t be inherited)
Therefore, H2 does not reflect the relationship b/n the performance
of animals & their potential parents.
From a selection perspective, therefore, H2 is not a very helpful
measure

122. Heritability value
Level of heritability Heritability
value
examples
Lowly heritable traits h2 < 0.2 Traits related to fertility
(reproduction) & survival
ability
Moderately heritable
traits
0.2 < h2 < 0.4 Production traits (like milk
production, growth rate, etc.)
Highly heritable traits h2 > 0.4 Carcass traits, traits related to
skeletal dimensions (like
structural size & mature body
weight)

123. Importance of Heritability
1. h2 & Selection
- h2 is very important in selection
G = h2 ( ) where
G is expected genetic change
h2 is heritability of the trait
( ) is selection differential (= the difference b/n the mean of the
selected parents & the mean of the population).
2. h2 & Prediction
- h2 plays an important role in the prediction of BVs & Progeny
differences .
s
p p

s
p p


124. 3. Heritability and Management
•Heritability indicates the extent to which differences in animal
performance for a trait are determined by genotypes as opposed to
environmental effects.
•For highly heritable traits, differences in BVs (breeding value) of
animals have large effects on performance, and differences in
environments are less important.
•Just the opposite is true for lowly heritable traits b/c selection is less
effective for lowly heritable traits,
•we do not try to change these traits genetically through selection, but
rather to improve performance through management.

125. Cont…
•Growth traits, for example, tend to be quite heritable such traits are
easy to improve through selection.
•Fertility traits are usually lowly heritable.
•We should therefore put less emphasis on genetically improving
fertility traits instead we will manage for good fertility by providing
good nutrition.
•Traits with h2 near zero are barely heritable, & traits with h2 near one
are extremely heritable.

126. Narrow sense h2
:
• It is a measure of the strength of the relationship between
performance (phenotypic values) and additive genetic values for a
trait in a population.
If h2 of a trait is
High Low
- Performance is, on average, a good
indicator of add. Genetic value
- animals with high performance
themselves tend to produce higher
performing offspring; & animals with
low performance tend to produce low
performing offspring
- performance records of parents show
little about progeny performance
- an animal’s own performance is not
likely to be a good indicator of its
add. Genetic value
- the offspring of high performing
parents will probably not perform
much differently than the offspring
of low performing parents

127. 6.3. Repeatability
Is a measure of the strength (consistency, reliability) of the
relationship b/n repeated records (repeated phenotypic values) for
a trait in a population
Is a measure of the strength (consistency, reliability) of the
relationship b/n single performance records (phenotypic values)
and PA (producing abilities) for a trait in a population
Estimates refer to the expression of the same trait, such as milk
production, egg production, etc., at different times in the life of the
same individual

128. Cont…
If R of a trait is
High Low
- the 1st record on an animal is, on
average, a good indicator of the
animal’s 2nd record
- a single record of performance on an
individual is, on average, a good
indicator of the individual’s PA
- the 1st record is typically not a good
indicator of the 2nd record
- a single record of performance on an
individual tells us very little about the
individual’s PA
Degree of repeatability R – value
Lowly repeatable traits R < 0.2
Moderately repeatable traits 0.2 < R < 0.4
Highly repeatable traits R > 0.4
R near 1 indicates that a trait is extremely repeatable & R near 0
indicates that a trait is hardly repeatable

129. CHAPTER SEVEN. BIOTECHNOLOGY AVAILABLE IN
ANIMAL BREEDING
•7.1. Reproductive physiology
•One of the challenges for genetic improvement is to increase
reproduction rates.
•Several reproduction techniques are available.
•The commonest of these are artificial insemination (AI), embryo
transfer and associated technologies.
•Measurement of progesterone in milk or blood which is a widely
used technique for monitoring ovarian function and for pregnancy
tests is also an important technology for managing the reproductive
function of the animal.

130. 7.1.1. Artificial insemination (AI)
• Place semen into the uterus by some other method other than
physical sexual contact
• Artificial insemination involves placing semen collected from a
male in the female reproductive tract using equipment designed for
the purpose.
• AI is a key management tool for producers that allow them to have
greater choices in selecting beneficial traits for improved genetic
performance.
• Progress in semen collection and dilution, and cryopreservation
techniques now enables a single bull to be used simultaneously in
several countries for up to 100,000 inseminations a year

131. Cont…
• Very small number of top bulls can be used to serve a large cattle
population.
• In addition, each bull is able to produce a large number of
daughters in a given time thus enhancing the efficiency of progeny
testing of bulls.
• The high intensity and accuracy of selection arising from AI can
lead to a four-fold increase in the rate of genetic improvement in
dairy cattle relative to that from natural mating.
• A wider and rapid use of selected males through AI will accelerate
the rate of genetic improvement.

132. Cont…
• AI can reduce transmission of venereal diseases in a population.
• Facilitate more accurate recording of pedigree and minimize the
cost of introducing improved stock.
• Success of AI technology depends on accurate heat detection and
timely insemination.
• The former requires a certain level of experience among farmers
while the latter is dependent on good infrastructure, including
transport network, and availability of reliable means of transport.

133. Objectives of Artificial Insemination
• Genetic improvement of livestock
• Disease control mechanism
• Possible to increase fertility
• Decrease breeding expense
• 7.1.2 Advantages and Disadvantages of AI:
Artificial insemination (A.I.) is deposition of semen into the female
genital tract by means of instruments.
Insemination
of the Cow

134. 7.2.1 ADVANTAGES OF ARTIFICIAL INSEMINATION
. There are several advantages by artificial insemination over natural
mating or servicing.
• There is no need of maintenance of breeding bull for a herd; hence
the cost of maintenance of breeding bull is saved.
• It prevents the spread of certain diseases and sterility due to genital
diseases.Eg: contagious abortion, vibriosis.
• By regular examination of semen after collection and frequent
checking on fertility make early detection of interior males and
better breeding efficiency is ensured.
• The progeny testing can be done at an early age.

135. Cont…
The semen of a desired size can be used
even after the death of that particular sire.
The semen collected can be taken to
the urban areas or rural areas for
insemination.
It makes possible the mating of animals
with great differences in size without
injury to either of the animal.
It is helpful to inseminate the animals
that are refuse to stands or accept the
male at the time of oestrum.
.

136. Cont…
• Artificial Insemination in the Sow
It helps in maintaining the accurate
breeding and cawing records
It increases the rate of conception.
It helps in better record keeping.
Old, heavy and injured sires can be used.

137. 7.1.2.2. Disadvantages of A.I:
• Requires well-trained operations and special equipment.
• Requires more time than natural services.
• Necessitates the knowledge of the structure and function of
reproduction on the part of operator.
• Improper cleaning of instruments and in sanitary conditions may
lead to lower fertility.
• If the bull is not properly tested, the spreading of genital diseases
will be increased.
• Market for bulls will be reduced, while that for superior bull is
increased.

138. Embryo transfer (ET)
 Embryo transfer*
 embryo is collected from a donor female and
 transferred into a recipient female where the embryo
completes its development.
an embryo from a super
ovulated female animal is transferred to the
uterus of a recipient female animal.
In both senses also called embryo transplant.
• There are two procedures presently available for production of
embryos from donor females.
• 1. super ovulation, followed by AI and then flushing of the uterus
to gather the embryos.

139. Cont…
• 2. In vitro fertilization (IVF) consists of recovery of eggs from the
ovaries of the female then maturing and fertilizing them outside the
body.
• IVF facilitates recovery of a large number of embryos from a
single female at a reduced cost.
Benefit of Embryo transfer
• Produce several progeny from a female and many offspring from
one male.
• Increasing the reproductive rate of selected females.
• Risk of importing diseases is avoided

140. Cont…
• Facilitates rapid expansion of rare but economically important
genetic stocks;
•
• Limitations of embryo transfer
Decreases genetic diversity
Decreased diversity often leads to mutations
Expensive and time consuming procedure

141. 7.1.3. Embryo sexing and cloning
• Sexing of embryos before transfer and implanting has great
potential for the livestock industry.
• Manipulating the sex of offspring has been a dream of the cattle
industry for decades.
• A number of approaches to the sexing of semen have been
attempted, and several have been reported as successful.
• Although embryo sexing may not have dramatic effects on rates of
genetic gain it can considerably increase efficiency

142. METHODS OF EMBRYO SEXING
 Non invasive Methods--
 Immunological assay of HY antigen
 Quantification of X-linked enzyme
 Differential growth of male & female
embryo
Invasive Methods--
 Cytogenetic analysis
--observing Barr bodies
--chromosome analysis
 Y-specific DNA probe
 Y-specific DNA primer & PCR

143. EMBRYO SEXING TECHNIQUE

144. Cont…

145. USES OF EMBRYO SEXING
 Altering the male & female sex ratio in farm animals
 Increase in milk & meat production
 Control of incidence of free martinism
 Getting quality bulls for Physical therapy programs
 Conservation of rare breeds of farm animals

146. Multiple ovulation embryo transfer and open nucleus breeding
system
• Multiple ovulation embryo transfer (MOET) is a composite
technology
 Includes
•super ovulation,
• fertilization, and
• embryo recovery,
•short-term in vitro culture of embryos,
• embryo freezing and embryo transfer.
• Benefits from MOET include

147. Benefits from MOET include
• Increasing the number of offspring produced by valuable females,
• increasing the population base of rare or endangered breeds or
species, ex situ preservation of endangered populations.
• Progeny testing of females and increasing rates of genetic
improvement in breeding programmes.

148. ONBS
 is to set an elite herd (or a few elite herds) of males and females
and carry out intensive selection and testing within herd/s
selecting males and females at an early age using family
information
 The Open Nucleus Breeding System (ONBS) concept is based on
a scheme with a nucleus herd/flock established under controlled
conditions to facilitate selection.
 The nucleus is established from the "best" animals obtained by
screening the base (farmers') population for outstanding females.
 If ET is possible, the elite female herd is used through MOET with
superior sires to produce embryos which are carried by recipient
females from the base population.

149. Cont…
• An elite group of males with high breeding values for the specific
trait is selected and used in the base population for genetic
improvement through natural service or AI.
• MOET improves the rate of progress substantially, it is possible to
operate an ONBS without ET technology,
• Especially in species, such as small ruminants, with high
reproductive rates.

150. Cont…

151. Advantages of ONBS
• Provides opportunity to record information on more traits than is
possible in a decentralized progeny testing scheme
• Improve a stabilized crossbred population.
• Increases the selection intensity.

152. Indicator traits
• Indicator traits are characteristics which are genetically correlated
to traits of economic importance and are easier to measure than the
latter.
• Traits such as testicular size in rams or bulls or FSH in ewe lambs
have potential as indirect predictors of fertility.
• Indicator traits can improve genetic response by increasing
accuracy of selection and reducing generation interval.
• The value of an indicator trait will depend largely on the
magnitude of co-heritability and the genetic correlation between
the two traits.

153. Cont…
• Packed cell volume. the percentage of the volume of whole, un
clotted blood occupied by the erythrocytes.
• Packed cell volume (PCV), an indication of the extent of anaemia,
is widely used as an indicator trait for pathological conditions
associated with anaemia.
• PCV is currently used at ILRAD and ILCA (International
Livestock Centre for Africa) as an indicator of the effect of
trypanosomiasis.
• At ILCA as an indicator of effect of the endoparasite
Haemonchus contortu and an indicator of resistance to the
parasite.

154. Transgenic animals
• A transgenic animal is an animal whose hereditary DNA has been
augmented by addition of DNA from a source other than parental
germplasm through recombinant DNA techniques.
• Transfer of genes or gene constructs allows for the manipulation
of individual genes rather than entire genomes.
• Successful production of transgenic livestock has been reported
for pigs, sheep, rabbits and cattle.
• The majority of gene transfer studies in livestock have, however,
been carried out in the pig.
• Although transgenic cattle and sheep have been successfully
produced, the procedure is still inefficient in these species.

155. Cont…
• Transgenesis offers considerable opportunity for advances in
medicine and agriculture.
• In livestock, the ability to insert new genes for such economically
important characteristics as fecundity.
• Produces resistance to or tolerance of other environmental
stresses would represent a major breakthrough in the breeding of
commercially superior stock.
• Transgenic technology could provide is in the production of
medically important proteins such as insulin and clotting factors in
the milk of domestic livestock.

156. Cont…
• Important contribution of transgenic technology is in the area of
basic research to study the role of genes in the control of
physiological processes.
• The understanding of the molecular control of life processes has
important implications for both medicine and agriculture.

157. Conservation of animal genetic resources
• Developing and utilizing a genetic resource is considered the most
rational conservation strategy.
• Ex-situ approaches include: maintenance of small populations in
domestic animal zoos; cryopreservation of semen (and ova);
cryopreservation of embryos; .
• Cryopreservation of gametes, embryos or DNA segments can be
quite an effective and safe approach for breeds or strains whose
populations are too small to be conserved by any other means.
• In cattle, the transfer of frozen-thawed embryos is now a
commercial practice and embryo survival rate after thawing can be
as high as 80% with a pregnancy rate of about 50%.

158. Cont…
• Cryopreservation of oocytes followed by successful fertilisation
and live births has been achieved in the mouse.
• Cryopreserved bovine oocytes have been successfully matured
and fertilized in vitro and zygotes developed to blastocyst stage.
• Development in genetic engineering, cryobiology, cell biology and
embryology will provide techniques that may enhance our ability
to preserve germplasm in vitro.
• Conservation of indigenous animal genetic resources should be
one of the priority livestock development activities for developing
countries

159. Cont…
• Technology for cryopreservation of semen and embryo is
sufficiently developed to be applied in developing countries.
• What is missing is financial support to implement conservation
programmes

160. •