This document provides a summary of a training seminar on the use of molecular markers in apple and peach breeding. The one-day seminar will cover topics including sampling procedures, utilizing markers for parental selection and hybrid selection in various breeding programs, markers available for different traits, and cost comparisons. Speakers will discuss examples from breeding programs at IRTA, Agroscope, FEM, and INRA. The afternoon will focus on the FruitBreedomics molecular breeding services and interface. The seminar aims to demonstrate how molecular markers can help breeders in tasks such as selecting for disease resistance, fruit quality traits, and verifying pedigrees.

1. Welcome to the
Training Seminar on:
MAB in apple and peach, and
FruitBreedomics Breeding Interface
Comacchio, 19th June 2015

2. Program of the day
Time Subject Speaker(s)
08:30 Short introduction on molecular markers for breeders A. Patocchi (Agroscope)
08:45 Sampling procedures. Hands on experience and practical
details
I.Baumgartner (Agroscope)
09:00 Utilization of molecular markers for parental selection:
Example on ASF-IRTA breeding program
P. Arus (IRTA)
09:30 Utilization for hybrids selection. Examples on apple
Pyramiding scab and mildew resistance in the Agroscope
breeding program
I.Baumgartner (Agroscope)
Selecting seedlings with good texture in the FEM
breeding program
F. Costa (FEM)
10:30 Utilization for hybrids selection. Examples on peach
Selecting for acidity and flat shape M.J. Aranzana (IRTA)
Selecting for diseases and insects resistances T. Pascal (INRA)
11:30 Coffee break
12:00 For what traits do we have markers available? A. Patocchi (Agroscope) /
M.J. Aranzana (IRTA)
12:15 Comparing costs I. Batlle (IRTA)
12:30 Lunch
13:30 FruitBreedomics MAB Services
Introduction F. Laurens (INRA)
Vegepolys F. Laurens (INRA)
FEM Platform F. Costa (FEM)
IRTA P. Arus (IRTA)
14:00 FruitBreedomics Breeding Interface N. Nazzicari (PTP)
15:00 Return to Bologna
16:00 Arrival to Bologna

3. Short introduction to molecular
markers for breeding
Andrea Patocchi (Agroscope)

4. Content
• What is a molecular marker?
• Three examples of molecular markers
• Few examples of application of molecular
markers
• Take-home messages

5. What is a molecular marker?
Molecular markers associated
to a gene are naturally
occurring DNA fragments that
are close to specific genes
In general, the DNA sequence
of the gene of interest it is not
known, while the sequence of
the marker associated to it is
known
Using methods of the molecular
biology (polymerase chain
reaction; PCR) the DNA
fragment associated to the
gene (the marker) is multiplied,
and made visible
chromosome
DNA
cell
marker for
gene 1
gene 1
Adapted from:
http://biointeraction.blogspot.ch/2010/09/dna-
and-chromosome.html

6. In breeding molecular markers are
used to make predictions
Kind of predictions:
Is a specific marker (allele) present, with a determinate probability,
is also the gene (allele) of interest present
The closer (the more associated) the molecular marker and the gene
of interest are, the higher will be the probability of a correct
prediction
The “perfect” marker is a marker developed within the sequence of
the gene
The distance of a marker and the gene of interest (or between two
markers) is expressed in centimorgan (cM):
1cM = 1 wrong prediction in 100 cases
The most used application of markers in breeding is the
Marker Assisted Selection (MAS)
Marker 1 for
gene 1
Gene 1
Marker 2 for
gene 1
«perfect»
marker for
gene 1

7. Three types of molecular markers
The most used molecular markers in marker assisted
selection are:
• Sequence Characterized Amplified Regions (SCARs)
• Simple Sequence Repeats (SSRs, or microsatellites)
• Single Nucleotide Polymorphism (SNP)

8. Characteristics of SCAR, SSR & SNP markers
SCAR: have in general only two alleles; alleles show presence/absence
polymorphism or differs greatly by size
SSR: co-dominant, have often > 10 alleles; the alleles show differences of the
length of the repeated sequence (e.g. CTT);
allele 1 …ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTT]GATCAAATTACCCGTAGATA… CTT X7
allele 2 …ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTTCTT]GATCACATTACCCGTAGATA… CTT X8
allele 3 …ATGCTTATCGG[CTTCTTCTTCTTCTTCTTCTTCTTCTTCTT]GATCACATTACCCGTAGATA… CTT X10
SNP: co-dominant, have in general only two alleles; their sequence differ only by a
single nucleotide (null allele also possible)
allele 1 …ATGCTTATCGGGATCAAATTACCCGTAGATA…
allele 2 …ATGCTTATCGGGATCACATTACCCGTAGATA…
Present/absence of a specific band,
only one allele is amplified,
dominant marker
Co-dominant SCAR marker: it
allows to distinguish between
homo- and heterozygous plants

9. Examples of applications (1)
Verification of pedigrees
• Allele 159bp of SSR marker
CH-Vf1 is associated to Vf
• From Florina to F2 26829-2-2
the pedigree is ok BUT
• F2 26829-2-2 looks not to be a
product of a sib cross (allele
137bp (*) is not present in
Mf821 or Rome Beauty)
10basesladder
RomeBeauty
M.floribunda821(Vf)
F226829-2-2(Vf)
GoldenDelicious
PRI14-126(Vf)
Starking
PRI612-1(Vf)
Johnatan
Florina(Vf)
10basesladder
Vf allele
outbreeder
Adapted from Vinatzer et al. 2004

10. Examples of applications (2)
…in a cross between two
genotypes heterozygous for Vf
• Allele 159bp of SSR marker
CH-Vf1 is associated to Vf
• Three progeny plants are
outbreeders (probably from
the same father)
Identification of homozygous genotypes…
outbreeders
Allele 159bp
Associated to Vf scab resistance
Adapted from Vinatzer et al. 2004

11. Examples of applications (3)
…in a cross between two
genotypes heterozygous for Rvi2
and Rvi6, respectively
Without molecular markers this
work can only be done if virulent
isolates to both R-genes are
available, BUT is extremely time
consuming!
Identification of pyramids of two R-genes (Rvi2&6)
Rvi2 rvi2
Rvi6 Rvi2/Rvi6 rvi2/Rvi6
rvi6 Rvi2/rvi6 rvi2/rvi6
M P1 P2 S1 S2 S3 S4 S5
Increasingsizeofthebands
Rvi2 marker
Rvi6 marker

12. Examples of applications (4)
e.g. peach:
• peach/necatrine phenotype;
• yellow/white flesh
• Flat/round fruit shape
Early selection for traits that cannot be assessed at
seedling stage (fruit traits)

13. Take-home messages
• Molecular markers are very useful tools for breeding
• Molecular markers allows to make predictions that cannot be
done without them (e.g. pyramids of R-genes,…)
• They allows to save money by an early identification of progeny
plants having a desired combination of traits

14. Thank you for your attention