The remarkable success of M. tuberculosis as a pathogen is largely due to its ability to persist within the host for long periods. To develop the effective intervention strategies, understanding the biology of persistence is highly required. Accumulating evidences showed oxygen deprivation (hypoxia) as a potential stimulus for triggering the transition of M. tuberculosis to a non-replicating persistent state analogous to latency in vivo. To date, in vitro hypoxia experimental models used the laboratory adapted isolate H37Rv and very little is known about the behavior of clinical isolates that are involved during disease outbreaks. Hence, we compared the transcription profiles of H37Rv and two south Indian clinical isolates (S7 and S10) under hypoxia to find differences in gene expression pattern.

1. Variable transcriptional adaptation between the laboratory (H37Rv) and
clinical strains (S7 and S10) of Mycobacterium tuberculosis under hypoxia
Santhi Devasundaram, Alamelu Raja ⁎
Department of Immunology, National Institute for Research in Tuberculosis (ICMR) (Formerly Tuberculosis Research Centre), No.1, Mayor Sathiyamoorthy Road, Chetpet, Chennai 600 031, India
a b s t r a c ta r t i c l e i n f o
Article history:
Received 29 August 2015
Received in revised form 12 November 2015
Accepted 7 January 2016
Available online 11 January 2016
Tuberculosis continues to be a major public health problem in many parts of the world, despite intensified efforts
taken to control the disease. The remarkable success of M. tuberculosis as a pathogen is largely due to its ability to
persist within the host for long periods. To develop the effective intervention strategies, understanding the biol-
ogy of persistence is highly required. Accumulating evidences showed oxygen deprivation (hypoxia) as a poten-
tial stimulus for triggering the transition of M. tuberculosis to a non-replicating persistent state analogous to
latency in vivo. To date, in vitro hypoxia experimental models used the laboratory adapted isolate H37Rv and
very little is known about the behavior of clinical isolates that are involved during disease outbreaks. Hence,
we compared the transcription profiles of H37Rv and two south Indian clinical isolates (S7 and S10) under hyp-
oxia to find differences in gene expression pattern. The main objective of this current work is to find “differential-
ly regulated genes” (genes that are down regulated in H37Rv but upregulated in both the clinical isolates) under
hypoxia. Microarray results showed, a total of 502 genes were down regulated in H37Rv under hypoxia and 10
out of 502 genes were upregulated in both the clinical isolates. Thus, giving less importance to down regulated
genes based on H37Rv model strain might exclude the true representative gene candidates in clinical isolates.
Our study suggests the use of most prevalent clinical isolates for in vitro experimental model to minimize the
variation in understanding the adaptation mechanisms of the strains.
© 2016 Elsevier B.V. All rights reserved.
Keywords:
Hypoxia
Clinical strains
Transcriptional adaptation
Microarray
Real-time PCR
1. Introduction
After more than one century, the disease has not yet been eradicated
and in 2013 an estimated 9 million people developed tuberculosis (TB)
and 1.5 million died from the disease (WHO, 2014). Efforts are to be
accelerated to combat TB deaths which are unacceptably high beyond
it could be prevented. The success of Mycobacterium tuberculosis
(M. tuberculosis) is due to its ability to reside in the host in a non-
replicating state called “dormancy”, a condition characterized by
low metabolic activity that renders the bacteria resistant to killing
by the host immune response and antibiotics (Fattorini et al., 2013).
In an attempt to understand this dormant state at the genomic level,
studies have been performed to explore the altered metabolism of
M. tuberculosis grown under defined conditions to mimic their intracel-
lular niche during granuloma formation. Mimicking conditions are
thought to reflect the environment inside the granuloma in vitro. This
includes hypoxia, starvation, macrophages, and murine infection and
each system mimic some of, but not the entire, clinical niche within
the host. Of these, hypoxic condition (depletion of oxygen which pre-
vents aerobic respiration by the obligate aerobe,) is best studied and
considered to be a prime factor for inhibition of M. tuberculosis growth
(Rustad et al., 2009; Fang et al., 2012). The most frequently used
experimental model for hypoxia-induced M. tuberculosis dormancy is
the defined headspace model of non-replicating persistence (NRP)
(Wayne and Hayes, 1996) and is adapted for the present study.
M. tuberculosis presents a very limited genetic variation. However,
high degree of phenotypic variability, differences in clinical outcome
and epidemiological behavior among M. tuberculosis isolates are report-
ed. Number of studies reported variation in the virulence of different
strains of M. tuberculosis (Manabe et al., 2003, Palanisamy et al., 2009,
Mehaffy et al., 2010, Sohn et al., 2009). Host and bacterial factors play
an important role in this variability (Tsolaki et al., 2005, Reed et al.,
2004). H37Rv, the first strain isolated in 1905 (Betts et al., 2000), is
the first strain of M. tuberculosis species for which the whole genome se-
quence is available (Cole et al., 1998). H37Rv is the widely used labora-
tory model strain, but might not represent the actual virulence of
naturally occurring strains of TB outbreaks. Thus, it is highly important
to study the most prevalent clinical strains of M. tuberculosis to elucidate
the real mechanism of virulence as well to test the vaccine efficacy. With
this goal, we have selected two south India prevalent clinical isolates, S7
and S10 along with H37Rv to study transcriptional changes in the gene
level under in vitro hypoxia experimental model.
Infection, Genetics and Evolution 40 (2016) 21–28
⁎ Corresponding author at: National Institute for Research in Tuberculosis (ICMR)
(Formerly Tuberculosis Research Centre), No.1, Sathiyamoorthy Road, Chetpet, Chennai
600 031, India.
E-mail address: alameluraja@gmail.com (A. Raja).
http://dx.doi.org/10.1016/j.meegid.2016.01.007
1567-1348/© 2016 Elsevier B.V. All rights reserved.
Contents lists available at ScienceDirect
Infection, Genetics and Evolution
journal homepage: www.elsevier.com/locate/meegid

2. These two south Indian prevalent strains, S7 and S10, were first
identified based on restriction fragment length polymorphism (RFLP)
of various M. tuberculosis strains isolated from the BCG trial area,
Tiruvallur district, south India (Das et al., 1995). Their results showed
that most (38–40%) of the isolated clinical isolates of M. tuberculosis
from this area harbored IS6110 single copy in their genome. Distinct im-
mune responses were observed, in human donors, with the sonicate an-
tigens of these two strains. S7 induced Th-2 response and the strain S10
induced potent T-cell proliferation and IFN-γ secretion (Th-1 response)
despite having similar IS6110 copy number at the same locus Rajavelu
and Das (2005)). These factors attracted us to select S7 and S10 clinical
isolates to study gene regulation mechanism under depleted oxygen
condition.
Evaluating the transcriptional response of M. tuberculosis under
different stress conditions has been the subject of intensive research
and this will likely lead to improve drug and vaccine design (Talaat
et al., 2004). Vaccine based studies are majorly targeted on the
genes or proteins that are upregulated (over-expressed) during
in vitro stress conditions (Kim et al., 2008, Aagaard et al., 2011) or
within the host or during in vitro infection of human cell lines like
macrophages (Triccas and Gicquel, 2000). In particular, these reports
were based on laboratory adapted strains such as H37Rv or Erdman
strains as a model organism. Genes that are down regulated (repressed)
in these strains during in vitro stress experiments are often given less
importance for the TB vaccine or drug development. But, expression
levels of those down regulated genes in clinical strains are highly un-
known under given stress conditions. Thus, we analyzed the expression
levels of down regulated genes from H37Rv under hypoxia in clinical
isolates to highlight the need of studying more prevalent clinical
isolates for in vitro experiments to gain insight into the best vaccine can-
didates. This approach would minimize the exclusion of probable true
representative genes and would help to reduce variations in vaccine
formulations.
Our earlier microarray data included only 134 upregulated genes
that were common between all 3 strains used under hypoxia. The
DosR–DosS, the two components regulatory system plays a pivotal
role in mediating the adaptive response to hypoxia. Overexpression
of some of the DosR regulon genes like 3128c, Rv1997, Rv2004c,
Rv2005c, Rv2007c, Rv3127c and dosS genes like Rv3132c and
Rv2025c indicated that the oxygen depletion was faithfully achieved
in our culture methods (Devasundaram et al., 2015). In addition to
this, the microarray data were also analyzed for “differentially regulated
genes” that is genes that were down regulated in H37Rv laboratory
strain, but upregulated in both clinical isolates under hypoxia is
presented here and the term “differentially regulated genes” is used
elsewhere in the text to represent genes down regulated in H37Rv but
upregulated in both clinical isolates.
2. Methods
2.1. Aerobic and anaerobic culture methods
Stocks of the M. tuberculosis laboratory strain H37Rv (ATCC 27294),
obtained from Colorado State university, USA and clinical strains S7 and
S10 were obtained during the Model Dots study conducted at the BGC
trial area of Tiruvallur District (Das et al., 1995). H37Rv, clinical isolates
S7 and S10 were grown in Middlebrook 7H9 media supplemented
with 2% (v/v) glycerol, 10% albumin–dextrose–catalase (ADC) and
0.05% (v/v) Tween 80 at 37 °C, 200 rpm for 25 to 30 days to obtain
aerobic cultures.
To obtain anaerobic cultures (NRP-2) Wayne's method was
followed as described (Wayne and Hayes, 1996). Briefly, a laboratory
strain H37Rv and clinical isolates S7 and S10 were inoculated in
screw capped test tubes (20 × 125 mm, with a total fluid capacity
of 25.5 ml) containing supplemented Middlebrook 7H9 (MB7H9).
For uniform dispersion of cultures and to control the rate of O2
depletion stirring was done with 8-mm Teflon-coated magnetic
stirring bars in the tubes (120 rpm) and incubated at 37 °C. Oxygen
depletion in the cultures was assessed by adding a sterile solution
of methylene blue in the medium at final dye concentrations of
1.5 μg ml−1
. Reduction and decolorization of this dye served as a
visual indication of oxygen depletion. Methylene blue decolorization
starts, in M. tuberculosis in vitro cultures, when the dissolved oxygen
concentration is below 3% (Leistikow et al., 2010). The cells were
pelleted from triplicate cultures, by centrifugation at 2000 g for 5 min
and frozen on dry ice.
2.2. Isolation of RNA from aerobic and anaerobic cultures of H37Rv, S7
and S10
Cell pellets (107
bacterial cells) were suspended in 1 ml TRIzol re-
agent (Sigma Aldrich, USA) and transferred to 2-ml screw cap tubes
containing 0.5 ml of 0.1 mm diameter zirconia/silica beads (BioSpec
Products, USA). Three 30-s pulses in a bead beater disrupted the cells.
Cell debris was separated by centrifugation for 1 min at 16,000 g. The
supernatant was transferred to 2-ml micro centrifuge tube containing
300 μl chloroform: isoamyl alcohol (24:1), inverted rapidly for 15 s,
and incubated 2 min at room temperature. Samples were centrifuged
for 5 min and the aqueous phase was precipitated using 2.5 volume
of isopropanol and 1/10th volume of 3 M sodium acetate. Samples
were incubated 10 min at room temperature and centrifuged for
15 min at 4 °C. The RNA pellets were washed with 1 ml 75% ethanol,
centrifuged 5 min, air dried and resuspended with RNase free water.
Final purification of RNA and DNase treatment to remove residual
DNA was carried out by RNeasy columns (Qiagen,USA). RNA quality
was assessed by measuring the ratio of absorbance of total RNA at
260/280 and 260/230 nm.
2.3. cDNA synthesis, cRNA labeling and microarray hybridization
For cDNA synthesis, 2 μg of RNA from each sample was incubated
with WT (Whole Transcript) primers according to manufacturer in-
struction (Low Input Quick Amp Labeling WT kit, Agilent Technologies,
USA) for 10 min at 65 °C, cooled on ice, combined with 5X standard buff-
er, 0.1 M dithiothreitol (DTT), 10 mM deoxynucleotide triphosphate
(dNTP) and RNase block mix to the final volume of 4.7 μl. This mixture
was incubated for 2 h at 40 °C.
Fluorescently labeled cRNA, transcribed from cDNA, by T7 polymer-
ase transcription master mix (Low Input Quick Amp Labeling WT kit,
Agilent Technologies, USA) containing 5× transcription buffer, 0.1 M
DTT, nucleotide triphosphate (NTP), T7 polymerase and labeled with
Cy3-CTP (aerobic cultures of H37Rv, S7, S10) or Cy5-CTP (anaerobic cul-
tures of H37Rv, S7, S10) and incubated for 2 h at 40 °C. Purification of
cRNAs was carried by Qiagen's RNeasy mini kit. An aliquot of 1 μl of
purified cRNA was used to determine the yield and specific activity
with a Nanodrop ND-1000 UV–Vis Spectrophotomer. The specific activ-
ity (pmol Cy3 or Cy5 per μg cRNA) was obtained by following calcula-
tion: specific activity = (concentration of Cy3/Cy5)/((concentration of
cRNA) ∗ 1000) = pmol Cy3/Cy5 per μg cRNA. Samples with yield of
b0.825 μg and specific activity i.e. b15 pmol Cy3/Cy5 per μg cRNA
were only selected for competitive hybridization. Labeled cRNA was
also checked on 1% agarose gel and scanned using the Typhoon 9210
scanner (GE Life Sciences).
A 60mer oligonucleotide based custom array chip was used from
Agilent Technologies in 8x15K format. 300 ng of Cy5 labeled cRNA
from anaerobic cultures of H37Rv, S7 and S10 was hybridized against
300 ng Cy3 labeled cRNA from aerobic cultures of H37Rv, S7 and S10.
Hybridization was done for 17 h, 10 rpm at 65 °C. Following image
analysis, feature extraction was performed using Feature extraction
tool version 9.5.3.1 (Agilent Technologies, USA).
22 S. Devasundaram, A. Raja / Infection, Genetics and Evolution 40 (2016) 21–28

3. 2.4. Microarray data analysis
Microarray data analysis was performed by R-Bioconductor LIMMA
package. The background-corrected raw intensity values were used for
analysis. LOWESS algorithm was used to normalize the data and fold
change (Fc) was calculated based on the ratio of Cy5/Cy3 (anaerobic/
aerobic) intensities. For statistical analysis, Student's t-test against
zero was performed using Benjamini Hochberg multiple testing correc-
tion. Hierarchical cluster was done by Mev4.1 using Pearson correlation
method. The data were clustered by averaged linkage. Adjusted p value
cut-off of 0.05 and fold change of ≥1.5 was used for identifying differen-
tially regulated genes. Gene expression data are deposited into the GEO
database (GEO accession no: GSE55863).
2.5. Quantitative real-time reverse transcription RT-PCR (qRT-PCR) and
normalization
A 2 μg of the isolated total RNA from H37Rv, S7 and S10 grown
under aerobic and anaerobic culture conditions were reverse-tran-
scribed by a genetically engineered, highly thermostable version of
Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT),
supplied with High Capacity cDNA synthesis kit (Applied Biosystems,
USA). For qRT-PCR 20 ng of synthesized cDNA was taken per 20 μl reac-
tions. qRT-PCRs were performed in triplicate using a Dynamo™
SYBRgreen 2× mix kit (Finnzymes, Finland). PCR conditions: initial de-
naturation 95 °C for 15 min, 40 cycles of 95 °C (30 s), 60 °C (30 s), and
72 °C (1 min). Real-time PCR quantitations were performed in ABI
Prism 7000 sequence detection system and analyzed with SDS 2.1 soft-
ware (Applied Biosystems, USA).
For each RNA sample, the control transcript (16 s rRNA) and target
RNAs were reverse-transcribed together in one reaction and the
resulting cDNAs were quantified by real-time PCR. The target cDNA
was normalized internally to the cDNA levels of 16 s rRNA in the same
sample and expressed as (target mRNA)/(16 s rRNA mRNA).
3. Results
3.1. Growth pattern and culture conditions
Oxygen sufficient (aerobic) cultures are depicted as “Rv” for H37Rv,
“S7” and “S10” for clinical isolates in the text. Oxygen depleted (anaer-
obic) cultures are denoted as “RvD”, “S7D” and “S10D” for H37Rv, S7
and S10 strains respectively and “D” indicates dormancy. The growth
rate was higher in aerobic cultures where bacilli entered into log
phase on day 9 and growth was stabilized on day 18 (considered as a
stationary phase entry). But in anaerobic cultures stationary phase
were reached on or after day 14 but log phase was attained at day 9 sim-
ilar to aerobic cultures. There were no significant differences found in
growth pattern between these 3 strains (Fig.1a). Many researchers
followed methylene blue decolorization as a sole indicator to confirm
oxygen depletion during in vitro dormancy experiment; hence the
same was followed in our study (Fang et al., 2013; Rex et al., 2013;
Sohaskey, 2008). Gradual decolorization of methylene blue was ob-
served, with all 3 strains, during the incubation at 120 rpm, 37 °C and
complete decolorization was observed by day 25. No decolorization of
methylene blue dye in the “blank” tube was observed, as no inoculum
was introduced and it remained in the same color till 25 to 30 days
(Supplementary Fig. 1) (Devasundaram et al., 2015). Growth kinetics
and methylene blue decolorization pattern were in agreement with
the in vitro Wayne's model (Wayne and Hayes, 1996).
After methylene blue decolorization, pellets were collected from
triplicate cultures of H37Rv, S7 and S10 for RNA isolation. The isolated
RNA, which showed the ratio of ≥2 at A260/280 showed no DNA contam-
ination and was only included for microarray and qRT-PCR experiments.
Further, the integrity of RNA was also determined on a MOPS-
formaldehyde denaturing agarose gel (data not given).
3.2. Genes that are repressed in H37Rv but expressed in clinical strains S7
and S10
To identify the “differentially regulated genes”, a threshold value of
1.5 fold change was assigned for each gene rather than the individual
expression values. Based on the mean expression value of triplicate mi-
croarray experiments, about 502 genes were repressed in H37Rv, 453
and 1463 genes were upregulated in S7 and S10 respectively under hyp-
oxia when compared to aerobic growth (GEO accession no: GSE55863).
This was represented by the Venn diagram in Fig 1b.
To identify “differentially regulated genes”, the expression levels of
these 502 repressed genes of H37Rv were compared with S7 and S10
over-expressed genes. A total of 10 genes was found in common as
over-expressed in both the clinical isolates but repressed in H37Rv
under hypoxia. These sets of genes were termed as “differentially
regulated genes” and followed throughout the text. These are Rv0812,
Rv1463, Rv1544, Rv1582c, Rv1601, Rv2035, Rv2045c, Rv2430c,
Rv2483c and Rv3538, their fold expression cluster is given Fig 2
Table.1. These genes are predicted to be involved in intermediary
metabolism (Rv0812, Rv1544 and Rv2483c), energy metabolism
(Rv1544), cell envelope synthesis (Rv2483c), fatty acid synthesis
Fig. 1. Growth curves and Venn diagram of altered transcriptional pattern for M. tuberculosis H37Rv, S7 and S10 under aerobic and anaerobic cultures. a) Aerobic and anaerobic cultures of
all three strains were obtained by growing at 37 °C at 200 rpm and 120 rpm respectively. Mean optical density (OD) values with standard error at 600 nm are shown. The OD values were
similar between H37Rv and S10 whereas S7 strain had less OD value, but the pattern of growth was same for all 3 strains. Growth is expressed as log of turbidity (A600). b) Graphical
representation by Venn diagram of the overlap of “differentially regulated genes” identified between H37Rv and in both the clinical isolates S7 and S10 under hypoxia. Total of 502
down regulated genes predicted by microarray in H37Rv was compared with upregulated genes of S7 and S10. The aerobic cultures of 3 strains were denoted as Rv (H37Rv), S7 and
S10 and for anaerobic cultures it was denoted as RvD (H37Rv), S7D (for S7) and S10D (for S10).
23S. Devasundaram, A. Raja / Infection, Genetics and Evolution 40 (2016) 21–28

4. (Rv2045c), amino acid biosynthesis (Rv0812, Rv1601), co-factor syn-
thesis (Rv1463) and hypothetical protein (Rv2035).
The comparison of 502 repressed genes from H37Rv with any one of
the clinical isolates led to the prediction of 8 genes (Rv1421, Rv1830,
Rv2501c, Rv2764, Rv3275c, Rv3283, Rv3556c and Rv3843c) that are
expressed in S7 clinical strain and repressed in H37Rv under hypoxia
(RvD vs S7D) (Fig 3, Supplementary Table 1). Interestingly, 128 genes
were predicted as repressed in H37Rv but expressed in S10 under
hypoxia (RvD vs S10D) (Fig.4. and Supplementary Table 2).
3.3. Real-time PCR
The expression levels of 10 “differentially regulated genes” predicted
by microarray as down regulated in H37Rv and upregulated in both the
clinical isolates were also verified by qRT-PCR. Triplicate qRT-PCR reac-
tion was carried out with 10 genes specific primers in triplicates for all 3
strains in both aerobic and aerobic growth conditions. qRT-PCR results
showed that these 10 genes were repressed in H37Rv but their expres-
sion was observed in both the clinical isolates (Fig. 5) in agreement
to microarray results. qRT-PCR data is presented as fold difference of
expression in all three strains relative to their control cultures i.e. aero-
bic cultures. Gene specific primer sequences are given in the Table.2.
The expression of a mycobacterial ribosomal protein coding gene
(16srRNA), MTB000019, was shown to be consistent throughout differ-
ent phases of M. tuberculosis growth in vitro (Banaiee et al., 2006). Thus,
16srRNA was taken as the normalizing internal control gene for all
samples.
Fold changes were calculated by taking average CT (threshold cycle)
values from triplicate qRT-PCR reaction. The predicted fold change for
the gene Rv0812 in H37Rv was higher (−4.46) than the values obtain-
ed by the microarray (−0.28). The expression values predicted by qRT-
PCR for other genes did not vary significantly from the microarray re-
sults. Collectively, expression analysis of these 10 genes by qRT-PCR
also confirms that they are differentially regulated between H37Rv
and in clinical isolates S7 and S10.
4. Discussion
Despite the different environment (acidic environment, low oxygen,
and nutritional deficiency) within the host, M. tuberculosis has the
ability to infect and persist for longer periods without causing active
TB disease (Fontan et al., 2008). This non-symptomatic infection state
is known as latent TB and represents the future reservoir for active TB
disease (Kasprowicz et al., 2011). Adaptation to hypoxia environment
is a critical part of the ability of M. tuberculosis to persist within the
host (Muttucumaru et al., 2004).
Table 1
Genes that are repressed in H37Rv but expressed in both clinical isolates under hypoxia.
S. No Rv No Gene name Fold change in
H37Rv
Fold change
in S7
Fold change
in S10
Predicted function
1 Rv1463 −0.25 −1.02 3.63 3.50 2.48 2.28 Probable conserved ATP-binding protein ABC transporter
2 Rv1601 −0.27 −1.46 2.05 2.12 3.40 2.81 Probable imidazole glycerol-phosphate dehydratase HisB
3 Rv0812 pabC −0.28 −4.46 1.68 2.45 2.85 2.95 Probable amino acid aminotransferase
4 Rv1544 −0.21 −1.18 1.59 1.25 2.10 1.2 Possible ketoacyl reductase
5 Rv1582c −0.35 −1.04 1.67 1.57 2.30 1.97 Probable PhiRv1 phage protein
6 Rv2483c plsC −0.16 −1.22 1.61 1.60 2.28 1.78 Possible transmembrane phospholipid biosynthesis bifunctional enzyme PlsC
7 Rv2035 −0.43 −0.99 2.18 1.49 1.86 1.14 Conserved hypothetical protein
8 Rv2430c PPE41 −0.37 −0.91 2.15 2.76 1.54 3.04 PPE family protein PPE41
9 Rv2045c lipT −0.29 −1.56 1.59 1.47 1.55 2.61 Carboxylesterase LipT
10 Rv3538 hsd4B −0.50 −0.80 1.64 1.77 1.67 1.14 Possible 2-enoyl acyl-CoA hydratase
Microarray experiments, from 3 mycobacterial strains (H37Rv, S7 and S10) which were grown under hypoxia, predicted 10 genes with differential expression between H37Rv laboratory
strain and 2 clinical isolates S7 and S10. These set of genes were predicted to be down regulated in H37Rv strain but upregulated in both the clinical isolates under hypoxia. Average gene
expression levels from triplicate cultures from both microarray (numbers in bold) and qRT-PCR, are given in this table. qRT-PCR results were also in agreement with microarray results.
Fig. 2. Heat map describing the differences in the transcriptional signature between H37Rv and clinical isolates S7 and S10 under hypoxia. Hierarchical clustering of “differentially
regulated genes” that is, genes repressed in H37Rv and expressed in both the clinical isolates S7 and S10 under hypoxia is given based on triplicate microarray experiments. Anaerobic
cultures of H37Rv, S7 and S10 are depicted as RvD, S7D and S10D respectively in the given image and triplicates are denoted as 1, 2 and 3. Expression ratios were log 2-transformed,
and displayed according to the color code at the top of the figure. Each row is labeled with their corresponding gene names. Green bars represents down regulated genes and red
represents upregulated genes.
24 S. Devasundaram, A. Raja / Infection, Genetics and Evolution 40 (2016) 21–28

5. Adaptation of M. tuberculosis to varying environmental conditions
during the course of infection is likely mediated by differential gene
expression (Timm et al., 2003). Many researchers followed micro-
array and RT-PCR to analyze the transcriptional response of
M. tuberculosis during in vitro dormancy experimental models that
mimic the conditions encountered by the bacteria within the host
(Geiman et al., 2006; Rehren et al., 2007; Voskuil et al., 2011; Wei
et al., 2013). It is also predicted that genes/proteins that are over-
expressed in M. tuberculosis during in vitro stress are likely to be impor-
tant for intracellular survival and can be targeted for drug and vaccine
development (Betts, 2002; Kendall et al., 2004).
The majority of the in vitro hypoxia experiments used the laboratory
strain H37Rv (Fisher et al., 2002, Bacon et al., 2004, Boshoff and Barry
2005, Gengenbacher et al., 2010) and over-expressed genes during hyp-
oxia are considered as potential drug and vaccine targets (Talaat et al.,
2004). Often, less importance is given for the down regulated genes
(predicted from H37Rv) despite the lack of information on their expres-
sion levels in clinical strains under the similar stimuli. The unique
feature of our work is, we used 2 prevalent clinical isolates (S7 and
S10) from TB endemic regions like India and showed 10 genes that
were predicted as down regulated in H37Rv during hypoxia are actually
over-expressed in both clinical strains under similar stimuli (hypoxia).
This highlights the need of using the most prevalent clinical strains of
M. tuberculosis during in vitro stress experiments.
The expression of hypoxia associated genes like DosS-DosR regulon
genes demonstrate the faithful achievement of our in vitro hypoxia ex-
periments. We have already reported the microarray analysis of 134
over-expressed genes that are common in all 3 strains (H37Rv, S7 and
S10) during hypoxia (Devasundaram et al., 2015). The current analysis
focuses mainly on the set of genes that are predicted as down regulated
in the laboratory strain H37Rv but over-expressed in clinical isolates
(S7 and S10).
Fig. 3. Heat map describing the differences in the transcriptional signature only between
H37Rv and S7 under hypoxia. Hypoxia related genes that are repressed in H37Rv and
expressed only in S7 clinical isolate (H37Rv anaerobic vs S7 anaerobic) under hypoxia is
given. Anaerobic cultures of H37Rv, S7 are depicted as RvD and S7D respectively in the
given image. These results are based on triplicate microarray experiments with 1.5 fold
change. Green bars represent down regulated genes and red represents upregulated
genes and their corresponding values are given above the cluster image. Rows are
labeled with gene names.
Fig. 4. Heat map describing the differences in the transcriptional signature only between
H37Rv and S10 under hypoxia. Hypoxia repressed genes in H37Rv and expressed only
in S10 clinical isolate (H37Rv anaerobic vs S10 anaerobic) under hypoxia are given.
Anaerobic cultures of H37Rv and S10 are depicted as RvD and S10D respectively in the
given image. These results are based on triplicate microarray experiments with 1.5 fold
change. Green bars represent down regulated genes and red represents upregulated
genes and their corresponding values are given above the cluster image. Rows are
labeled with gene names.
25S. Devasundaram, A. Raja / Infection, Genetics and Evolution 40 (2016) 21–28

6. Dormancy associated genes of M. tuberculosis might serve as poten-
tial immunogens that can be targeted for vaccine development
(Andersen, 2007). Evidently, 2 genes (Rv2660, Rv2659) that were pre-
dicted to be expressed by microarray during in vitro non-replicating
persistence model induced higher CD4+
T-cell response in human
donors (Govender et al., 2010). Expression of all resuscitation-
promoting factors (rpf) genes from M. tuberculosis during various
in vitro stress experiments were shown by RT-PCR (Gupta et al.,
2010). Later, the strong cellular immune response in human donors
was identified against all rpf genes and proposed as potential vaccine
targets (Commandeur et al., 2011). Collectively, these reports support
the transcriptional analysis by microarray and RT-PCR is also a potential
tool to identify novel drug and vaccine targets. We followed the same
technique for transcriptional analysis specifically in clinical isolates;
hence genes that are predicted from our results would be beneficial
for anti-TB vaccine development.
Phage particles help M. tuberculosis to adapt to environmental fluc-
tuations and predicted to be involved in bacterial virulence. Out of 10
genes that are reported as down regulated in H37Rv but over-
expressed in both the clinical isolates, Rv1582c is a probable PhiRv1
phage protein. Rv1582 is present in RD3 region of M. tuberculosis but ab-
sent in BCG (Brosch et al., 2002). A recent report explicitly analyzed
most of the available gene expression data on mycobacterial phage
proteins under various stresses like, nutrient starvation, macrophage
infection and oxygen depletion. Almost the majority of the phage
genes were reported during various stress experiments except
Rv1582c (Fan et al., 2015). Notably, these studies used the laboratory
strain H37Rv for their in vitro experiments. This indicates that in vitro
results based on the laboratory strains might exclude the probable rep-
resentative genes involved in clinical isolates during adaptation mecha-
nism. We have also carried an independent microarray analysis (data
not shown) on genes that are expressed only in S7 and S10 (unique
genes) during hypoxia. This showed the phage protein Rv1576c and
Rv2653c was expressed in S7 and S10 respectively during hypoxia. Sur-
prisingly, these phage genes were also not reported by any of the stress
experiments analyzed by Fan et al., (2015). This further supports our
hypothesis that transcription variations exhibited between the strains
hence the use of clinical isolates would minimize these variations.
With agreement to our results, Rv1463 (ABC transporter ATP-
binding protein) was down regulated under hypoxia in H37Rv
(Sherman et al., 2001). But, our microarray analysis showed the over-
expression of Rv1463 in both the clinical isolates (S7 and S10) which
were also confirmed by RT-PCR. Collectively, these observations alarm
the variations existing between the laboratory and clinical strains of
M. tuberculosis. Hence, for a specialized study like anti-TB drug/vaccine
development, inclusion of clinical isolates would bring more specific
gene targets when compared to the laboratory strain.
Non-homologous proteins (unrelated to human proteins) are
majorly targeted for the drug development against infectious disease.
The probable amino acid aminotransferase, Rv0812 was predicted to
be a unique enzyme in M. tuberculosis by protein interaction network
analysis (Kushwaha and Shakya, 2010). Rv0812 expression was also ob-
served during lung infection by M. tuberculosis in mice (Dubnau et al.,
2005). Our results bring the first insight on Rv0812 expression under
hypoxia especially in clinical isolates of M. tuberculosis and marking
this gene as a potential drug/vaccine target.
Proline–glutamic acid/proline–proline–glutamic acid (PE/PPE) pro-
teins are exclusively present in pathogenic mycobacteria and constitute
10% coding regions of M. tuberculosis genome. PE/PPE proteins role in
mycobacterial virulence is yet to be determined (Kunnath-Velayudhan
and Porcelli, 2013). PE/PPE proteins are closely associated with ESAT-6
(esx) and modulate host immune response (Sampson, 2011). A strong
B cell response by PPE41 (Rv2430c) was observed in TB patients
(Choudhary et al., 2003) but its expression under hypoxia in clinical iso-
lates of M. tuberculosis were first reported by our results. To our knowl-
edge, we also bring the first insight on expression of another PE/PPE
family of gene Rv3538, a double hotdog enzyme, under hypoxia in clin-
ical isolates of M. tuberculosis.
The data presented here show the existence of variations between
laboratory and clinical strains of M. tuberculosis in terms of gene expres-
sion under hypoxia. An understanding of this variation opens the path
to identify a set of genes which have altered expressions (that is,
down regulated in H37Rv but over-expressed in clinical isolates).
Gene expression analysis in other clinically relevant M. tuberculosis
Fig 5. QRT-PCR validation of microarray results for genes repressed in H37Rv and expressed in S7 and S10. Quantitative RT-PCR was used to confirm the “differentially regulated genes”
that are predicted by microarray result. Expression of these genes under anaerobic cultures (RvD, S7D and S10D) was compared to their respective aerobic cultures (Rv, S7 and S10). Genes
that were repressed in H37Rv were upregulated in clinical isolates under hypoxia. Data are mean with SEM calculated from three independent biological samples analyzed.
Table 2
Primers used in real-time RT-PCR with SYBR green probes.
S. No Rv number Primer name Sequence 5′ - 3′ Template size
1 Rv1463 Rv1463-F agaactgctcaagcccaaga 174
RV1463-R cgtattccgggtggatgtag
2 Rc1601 Rv1601-F tgttccgttctacgaccaca 169
Rv1601-R gatgcccctcttgtcaccta
3 Rv0812 Rv0812-F ttttvgagavavtgvtggtg 200
Rv0812-R accgcgactgtagatcaagc
4 Rv1544 Rv1544-F agtcgtcctcaatgctctgg 151
Rv1544-R ggctttggtagccgaataca
5 Rv1582c Rv1582c-F ggagcgactatacagcgaatc 201
Rv1582c-R agatttcgggtacgccttct
6 Rv2483c Rv2483c-F tgaccgacctggaagaaatc 200
Rv2483c-R ctcgaacttgttggtgagca
7 Rv2035 Rv2035-F atctggccaagaccagtgag 172
Rv2035-R tcggtatagcggcgtaggta
8 Rv2045c Rv2045c-F acgaaccgatggttgaagag 129
Rv2045c-R agctaaaggcgaagtcacca
9 Rv2430c Rv2430c-F gtccagtggtgatgcagttg 132
Rv2430c-R cgtgatgtgcccattcatag
10 Rv3538 Rv3538-F acctatgggatgacctgcaa 136
Rv3538-R cgtccttccacacgttgac
11 16srRNA 16srRNA-F cagctcgtgtcgtgagatgt 148
16srRNA-R aaggggcatgatgacttgac
Primers sequences, specific for 10 differentially expressed genes (down regulated in
H37Rv strain but upregulated in both the clinical isolates S7 and S10 under hypoxia),
used for qPCR experiment to validate microarray results is given here. Primers name
with F indicate forward primer and with R denote reverse primer. 16srRNA was used as
normalizing control.
26 S. Devasundaram, A. Raja / Infection, Genetics and Evolution 40 (2016) 21–28

7. strains during in vitro stress experiments could bring highly relevant
representative genes that can be targeted for the design of anti-
tuberculosis drugs and vaccine.
Ethical Statement/Conflict of Interest Statement
The author declares no conflict of interest
Acknowledgments
We thank the Indian Council of Medical Research for the Senior
Research Fellowship awarded to Santhi Devasundaram. We also
acknowledge Prof. Paturu Kondaiah, MRDG Department, IISc, Bangalore
for providing microarray and qPCR facility to carry this work and for
helpful discussions. We would also like to thank Imran Khan and Neeraj
Kumar for their help during microarray and RT-PCR experiments.
Appendix A. Supplementary data
Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.meegid.2016.01.007.
References
Aagaard, C., Hoang, T., Dietrich, J., Cardona, P.J., Izzo, A., Dolganov, G., Schoolnik, G.K.,
Cassidy, J.P., Billeskov, R., Andersen, P., 2011. A multistage tuberculosis vaccine that
confers efficient protection pre- and post-exposure. Nat. Med. 17, 189–194.
Andersen, P., 2007. Vaccine strategies against latent tuberculosis infection. Trends
Microbiol. 15 (1), 7–13.
Bacon, J., James, B.W., Wernisch, L., Williams, A., Morley, K.A., et al., 2004. The influence of
reduced oxygen availability on pathogenicity and gene expression in Mycobacterium
tuberculosis. Tuberculosis (Edinb) 84, 205–217.
Banaiee, N., Jacobs Jr., W.R., Ernst, J.D., 2006. Regulation of Mycobacterium tuberculosis
whiB3 in the mouse lung and macrophages. Infect. Immun. 74 (11), 6449–6457.
Betts, J.C., 2002. Transcriptomics and proteomics: tools for the identification of novel drug
targets and vaccine candidates for tuberculosis. IUBMB life 53 (4–5), 239–242.
Betts, J.C., Dodson, P., Quan, S., Lewis, A.P., Thomas, P.J., et al., 2000. Comparison of the
proteome of Mycobacterium tuberculosis strain H37Rv with clinical isolate CDC
1551. Microbiology 146 (Pt 12), 3205–3216.
Boshoff, H.I., Barry 3rd, C.E., 2005. Tuberculosis — metabolism and respiration in the
absence of growth. Nat. Rev. Microbiol. 3, 70–80.
Brosch, R., Gordon, S.V., Marmiesse, M., Brodin, P., Buchrieser, C., Eiglmeier, K., Garnier, T.,
Gutierrez, C., Hewinson, G., Kremer, K., Parsons, L.M., Pym, A.S., Samper, S., van
Soolingen, D., Cole, S.T., 2002. A new evolutionary scenario for the Mycobacterium
tuberculosis complex. Proc. Natl. Acad. Sci. U. S. A. 99 (6), 3684–3689.
Choudhary, R.K., Mukhopadhyay, S., Chakhaiyar, P., Sharma, N., Murthy, K.J., Katoch, V.M.,
Hasnain, S.E., 2003. PPE antigen Rv2430c of Mycobacterium tuberculosis induces a
strong B-cell response. Infect. Immun. 71 (11), 6338–6343.
Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S.V., Eiglmeier,
K., Gas, S., Barry 3rd, C.E., Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth,
T., Connor, R., Davies, R., Devlin, K., Feltwell, T., Gentles, S., Hamlin, N., Holroyd, S.,
Hornsby, T., Jagels, K., Krogh, A., McLean, J., Moule, S., Murphy, L., Oliver, K.,
Osborne, J., Quail, M.A., Rajandream, M.A., Rogers, J., Rutter, S., Seeger, K., Skelton, J.,
Squares, R., Squares, S., Sulston, J.E., Taylor, K., Whitehead, S., Barrell, B.G., 1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome
sequence. Nature 393 (6685), 537–544.
Commandeur, S., van Meijgaarden, K.E., Lin, M.Y., Franken, K.L., Friggen, A.H., Drijfhout,
J.W., et al., 2011. Identification of human T-cell responses to Mycobacterium tuberculosis
resuscitation-promoting factors in long-term latently infected individuals. Clin. Vaccine
Immunol. 18 (4), 676–683.
Das, S., Paramasivan, C.N., Lowrie, D.B., Prabhakar, R., Narayanan, P.R., 1995. IS6110 re-
striction fragment length polymorphism typing of clin-ical isolates of Mycobacterium
tuberculosis from patients with pulmonary tuberculosis in Madras, south India. Tuber.
Lung Dis. 76, 550–554.
Devasundaram, S., Khan, I., Kumar, N., Das, S., Raja, A., 2015. The influence of reduced
oxygen availability on gene expression in laboratory (H37Rv) and clinical strains
(S7 and S10) of Mycobacterium tuberculosis. J. Biotechnol. 210, 70–80.
Dubnau, E., Chan, J., Mohan, V.P., Smith, I., 2005. Responses of Mycobacterium tuberculosis
to growth in the mouse lung. Infect. Immun. 73 (6), 3754–3757. http://dx.doi.org/10.
1128/IAI.73.6.3754-3757.2005.
Fan, X., Abd Alla, A.A., Xie, J., 2015. Distribution and function of prophage phiRv1 and
phiRv2 among Mycobacterium tuberculosis complex. J. Biomol. Struct. Dyn. 1-6.
Fang, X., Wallqvist, A., Reifman, J., 2012. Modeling phenotypic metabolic adaptations of
Mycobacterium tuberculosis H37Rv under hypoxia. PLoS Comput. Biol. 8, e1002688.
Fang, H., Yu, D., Hong, Y., Zhou, X., Li, C., Sun, B., 2013. The LuxR family regulator Rv0195
modulates Mycobacterium tuberculosis dormancy and virulence. Tuberculosis 93 (4),
425–431.
Fattorini, L., Piccaro, G., Mustazzolu, A., Giannoni, F., 2013. Targeting dormant bacilli to
fight tuberculosis. Mediterranean J. Hematol. Infect. Dis. 5 (1), e2013072. http://dx.
doi.org/10.4084/MJHID.2013.072.
Fisher, M.A., Plikaytis, B.B., Shinnick, T.M., 2002. Microarray analysis of the Mycobacterium
tuberculosis transcriptional response to the acidic conditions found in phagosomes.
J. Bacteriol. 184 (14), 4025–4032.
Fontan, P., Aris, V., Ghanny, S., Soteropoulos, P., Smith, I., 2008. Global transcriptional pro-
file of Mycobacterium tuberculosis during THP-1 human macrophage infection. Infect.
Immun. 76 (2), 717–725.
Geiman, D.E., Raghunand, T.R., Agarwal, N., Bishai, W.R., 2006. Differential gene expres-
sion in response to exposure to antimycobacterial agents and other stress conditions
among seven Mycobacterium tuberculosis whiB-like genes. Antimicrob. Agents
Chemother. 50 (8), 2836–2841.
Gengenbacher, M., Rao, S.P., Pethe, K., Dick, T., 2010. Nutrient-starved, non-replicating
Mycobacterium tuberculosis requires respiration, ATP synthase and isocitrate lyase
for maintenance of ATP homeostasis and viability. Microbiology 156 (Pt 1), 81–87.
Govender, L., Abel, B., Hughes, E.J., Scriba, T.J., Kagina, B.M., de Kock, M., Walzl, G., Black, G.,
Rosenkrands, I., Hussey, G.D., Mahomed, H., Andersen, P., Hanekom, W.A., 2010.
Higher human CD4 T cell response to novel Mycobacterium tuberculosis latency asso-
ciated antigens Rv2660 and Rv2659 in latent infection compared with tuberculosis
disease. Vaccine 29 (1), 51–57.
Gupta, R.K., Srivastava, B.S., Srivastava, R., 2010. Comparative expression analysis of
rpf-like genes of Mycobacterium tuberculosis H37Rv under different physiological
stress and growth conditions. Microbiology 156 (Pt 9), 2714–2722.
Kasprowicz, V.O., Churchyard, G., Lawn, S.D., Squire, S.B., Lalvani, A., 2011. Diagnosing
latent tuberculosis in high-risk individuals: rising to the challenge in high-burden
areas. J. Infect Dis. 204 (Suppl. 4), S1168–S1178.
Kendall, S.L., Rison, S.C., Movahedzadeh, F., Frita, R., Stoker, N.G., 2004. What do microarrays
really tell us about M. tuberculosis? Trends Microbiol. 12 (12), 537–544.
Kim, S.Y., Lee, B.S., Shin, S.J., Kim, H.J., Park, J.K., 2008. Differentially expressed genes in
Mycobacterium tuberculosis H37Rv under mild acidic and hypoxic conditions.
J. Med. Microbiol. 57, 1473–1480.
Kunnath-Velayudhan, S., Porcelli, S.A., 2013. Recent advances in defining the immuno-
proteome of Mycobacterium tuberculosis. Front. Immunol. 4, 335.
Kushwaha, S.K., Shakya, M., 2010. Protein interaction network analysis—approach for
potential drug target identification in Mycobacterium tuberculosis. J. Theor. Biol. 262
(2), 284–294.
Leistikow, R.L., Morton, R.A., Bartek, I.L., Frimpong, I., Wagner, K., Voskuil, M.I., 2010.
The Mycobacterium tuberculosis DosR regulon assists in metabolic homeostasis
and enables rapid recovery from nonrespiring dormancy. J. Bacteriol. 192 (6),
1662–1670.
Manabe, Y.C., Dannenberg Jr., A.M., Tyagi, S.K., Hatem, C.L., Yoder, M., Woolwine, S.C.,
Zook, B.C., Pitt, M.L., Bishai, W.R., 2003. Different strains of Mycobacterium tuberculosis
cause various spectrums of disease in the rabbit model of tuberculosis. Infect. Immun.
71 (10), 6004–6011.
Mehaffy, C., Hess, A., Prenni, J.E., Mathema, B., Kreiswirth, B., Dobos, K.M., 2010. Descrip-
tive proteomic analysis shows protein variability between closely related clinical
isolates of Mycobacterium tuberculosis. Proteomics 10 (10), 1966–1984.
Muttucumaru, D.G., Roberts, G., Hinds, J., Stabler, R.A., Parish, T., 2004. Gene expression
profile of Mycobacterium tuberculosis in a non-replicating state. Tuberculosis 84
(3–4), 239–246.
Palanisamy, G.S., DuTeau, N., Eisenach, K.D., Cave, D.M., Theus, S.A., Kreiswirth, B.N.,
Basaraba, R.J., Orme, I.M., 2009. Clinical strains of Mycobacterium tuberculosis display
a wide range of virulence in guinea pigs. Tuberculosis 89 (3), 203–209.
Rajavelu, P., Das, S.D., 2005. Th2-type immune response observed in healthy individuals
to sonicate antigen prepared from the most prevalent Mycobacterium tuberculosis
strain with single copy of IS6110. FEMS Immunol. Med. Microbiol. 45, 95–102.
Reed, M.B., Domenech, P., Manca, C., Su, H., Barczak, A.K., et al., 2004. A glycolipid of
hypervirulent tuberculosis strains that inhibits the innate immune response. Nature
431, 84–87.
Rehren, G., Walters, S., Fontan, P., Smith, I., Zarraga, A.M., 2007. Differential gene expres-
sion between Mycobacterium bovis and Mycobacterium tuberculosis. Tuberculosis 87
(4), 347–359.
Rex, K., Kurthkoti, K., Varshney, U., 2013. Hypersensitivity of hypoxia grown Mycobacterium
smegmatis to DNA damaging agents: implications of the DNA repair deficiencies in
attenuation of mycobacteria. Mech. Ageing Dev. 134 (10), 516–522.
Rustad, T.R., Sherrid, A.M., Minch, K.J., Sherman, D.R., 2009. Hypoxia: a window into
Mycobacterium tuberculosis latency. Cell. Microbiol. 11, 1151–1159.
Sampson, S.L., 2011. Mycobacterial PE/PPE proteins at the host–pathogen interface. Clin.
Dev. Immunol. 497203.
Sherman, D.R., Voskuil, M., Schnappinger, D., Liao, R., Harrell, M.I., et al., 2001. Regulation
of the Mycobacterium tuberculosis hypoxic response gene encoding alpha-crystallin.
Proc. Natl. Acad. Sci. U. S. A. 98, 7534–7539.
Sohaskey, C.D., 2008. Nitrate enhances the survival of Mycobacterium tuberculosis during
inhibition of respiration. J. Bacteriol. 190 (8), 2981–2986.
Sohn, H., Lee, K.S., Kim, S.Y., Shin, D.M., Shin, S.J., et al., 2009. Induction of cell death in
human macrophages by a highly virulent Korean isolate of Mycobacterium tuberculosis
and the virulent strain H37Rv. Scand. J. Immunol. 69, 43–50.
Talaat, A.M., Lyons, R., Howard, S.T., Johnston, S.A., 2004. The temporal expression profile
of Mycobacterium tuberculosis infection in mice. Proc. Natl. Acad. Sci. U. S. A. 101 (13),
4602–4607.
Timm, J., Post, F.A., Bekker, L.G., Walther, G.B., Wainwright, H.C., Manganelli, R., Chan,
W.T., Tsenova, L., Gold, B., Smith, I., Kaplan, G., McKinney, J.D., 2003. Differential ex-
pression of iron-, carbon-, and oxygen-responsive mycobacterial genes in the lungs
of chronically infected mice and tuberculosis patients. Proc. Natl. Acad. Sci. U. S. A.
100 (24), 14321–14326.
27S. Devasundaram, A. Raja / Infection, Genetics and Evolution 40 (2016) 21–28

8. Triccas, J.A., Gicquel, B., 2000. Life on the inside: probing Mycobacterium tuberculosis gene
expression during infection. Immunol. Cell Biol. 78, 311–317.
Tsolaki, A.G., Gagneux, S., Pym, A.S., Goguet de la Salmoniere, Y.O., Kreiswirth, B.N., et al.,
2005. Genomic deletions classify the Beijing/W strains as a distinct genetic lineage of
Mycobacterium tuberculosis. J. Clin. Microbiol. 43, 3185–3191.
Voskuil, M.I., Bartek, I.L., Visconti, K., Schoolnik, G.K., 2011. The response of
Mycobacterium tuberculosis to reactive oxygen and nitrogen species. Front.
Microbiol. 2, 105.
Wayne, L.G., Hayes, L.G., 1996. An in vitro model for sequential study of shiftdown of
Mycobacterium tuberculosis through two stages of nonreplicating persistence. Infect.
Immun. 64, 2062–2069.
Wei, J., Guo, N., Liang, J., Yuan, P., Shi, Q., Tang, X., et al., 2013. DNA microarray gene
expression profile of Mycobacterium tuberculosis when exposed to osthole. Polish.
J. Microbiol. 62 (1), 23–30.
WHO, 2014. http://apps.who.int/iris/bitstream/10665/137094/1/9789241564809_eng.
pdf?ua=1.
28 S. Devasundaram, A. Raja / Infection, Genetics and Evolution 40 (2016) 21–28