forensic molecular biology

1. molecular biology
1 of 4
Forensic molecular biology
 DNA technology has many practical uses. Because every individual has a unique DNA
sequence, DNA samples can be used for identification. The legal system is now using DNA
evidence to determine guilt or innocence. The most frequent use of DNA evidence is
actually in cases of unknown or disputed paternity. Identity can also be established in other
ways. Just a casual glance reveals major differences among people. Geneticists refer to
this outward appearance as the phenotype.
 Most physical differences between people are due to complex interactions of several
genes during development. Some are obvious at a glance; others require close
observation. Fingerprints are the classic example of a phenotype used in law enforcement.
They are due to variations in the pattern of dermal ridges, small skin elevations on our
fingers. Fingerprint patterns depend on more than one gene (i.e., they are multigenic ). This
creates the huge genetic diversity underlying this phenotype. Although you might expect
the fingerprints of identical twins to be the same, they are not identical. Minor variations in
fingerprint patterns occur as a result of environmental factors affecting development.
 Retinal scans provide a more high-tech form of unique identification. These take
advantage of the unique pattern of blood vessels on the retina at the back of the eyes.
Scanning typically takes about a minute, because several scans are needed. The subject
must place the eye close to the scanner, keep the head still, and focus on a rotating green
light. Infrared light is used for scanning because blood vessels on the retina absorb this
better than the surrounding tissues. A computer algorithm is then used to convert the scan
into digital data. There is about 10-fold more information in a retinal scan than in a
fingerprint.
 Moving to the molecular level, another set of identifying features are the proteins and
polysaccharides made by all cells. Good examples of individual differences that involve
proteins are the various blood types found in human populations. But for ultimate
identification at the molecular level, we must examine the genes themselves to determine
the genotype. This is what is meant by DNA typing or DNA fingerprinting.
 Except identical twins, no two individuals have identical genotypes. Because of this
uniqueness or individuality, the DNA profile or characteristic pattern of nucleotide
distribution is used as a powerful basis of identification of individuals in a population.
 DNA profiling: is the application of DNA for diagnostic purposes whereby the profile of
DNA from the sample of interest is compared with the pattern from another sample of
known characteristics.
 Used in the health care and judiciary systems, among others. In the health care system, it
is used for diagnosis of hereditary diseases to predict the chance of an individual inheriting
a disease from afflicted parent(s). It can also be used to detect the predisposition of an
individual to cancer, or chromosomal aberrations. In the judicial system, forensic experts
use DNA profiling to identify suspects in criminal cases, especially where body fluids (e.g.,
in rape, murder) and other particles like hair and skin samples can be retrieved.
 Forensic experts can use minute specimens that contain DNA to associate a person with a
crime. DNA profiling is also used in disputed family relations (e.g., paternity suits) and in
immigration cases (e.g., where a child is seeking citizenship based on family relationships;
the profile of the applicant and the established citizen are compared for determination of
family ties).

2. molecular biology
2 of 4
 DNA may be obtained from any body part including fluids in which cells are likely to be
found (blood, saliva, urine). Both nuclear and mitochondrial DNA are used. A
mitochondrion contains 5 to 10 mtDNA molecules. A cell can have hundreds to thousands
of mitochondria. Because of this high copy number, mtDNA more than nuclear DNA is the
most likely to be recovered from an ancient specimen of biological stains. Being
cytoplasmic in origin, mtDNA can be inherited maternally (i.e., a woman, her children,
mother, maternal grandmother, and so on have identical mtDNA sequences). Mitochondrial
DNA is therefore important in solving cases involving biological relationships, provided
there is an unbroken female line. Even though the DNA in a species is stable, it is not
static. Mutations occur to alter the topology of the genome. If they occur in the non-coding
sequences, they may remain undetected and with no consequence to the individual. Such
neutral mutations are responsible for the differences between individual genomes.
 METHODS OF ANALYSIS
Both the RFLP and PCR techniques can be used for DNA profiling. Classical DNA profiling
entails the use of variable number tandem repeats (VNTRs).
o Variable number tandem repeats (VNTRs).
Markers like blood groups are ineffective because too many individuals fall into the four
categories (A, B, AB, O). The most variable regions of the genome occur in clusters of
sequences called minisatellites.
Minisatellites consist of 2 to 100 nucleotides in length. These sequences characteristically are
tandemly repeated DNA sequences that occur between two restriction enzyme sites. An
example is GGATGGATGGATGGATGGAT, which is four tandem repeats of the basic
sequence GGAT. The complementary strand will have CCTA. The unit or basic sequence
typically comprises 14 to 100 nucleotides. Furthermore, the number of repeats in a cluster at
each locus is about 2 to over 100. The repeated nucleotide patterns are called variable
number tandem repeats (VNTRs).
VNTRs were discovered by Alec Jeffreys and his colleagues while studying the gene
encoding myoglobulin (the red oxygen-binding protein in muscles). The number of pattern
repeats at a given locus is variable. Furthermore, each variation constitutes a VNTR allele.
The VNTR region is a polymorphic locus. Dozens of alleles have been identified at many loci
and, consequently, heterozygosity is common regarding VNTRs. In an extended family, one
pattern may be repeated 10 times at a specific locus in the DNA of one individual, 15 times in
a sibling, and 50 times in an uncle. It is possible that, for the same locus, two individuals in a
population can have an identical number of repeats.
Consequently, in the application of VNTRs in forensics, the probability of matching
repeats at five (instead of one) loci is used to increase the odds dramatically. For example, if
the frequency of a VNTR locus is calculated to be 1 in 525 and the frequency at a different
locus (two) is 1 in 80, then the frequency of the two different loci occurring simultaneously is 1
in 42,000. If two additional loci (three, four) are included with frequencies of 1 in 75 and 1 in
128, respectively, the combined frequency of these four loci becomes 1 in over 400 million!
The odds against matching the number of repeats at five loci are most astonishing.
To apply the technique of RFLP, restriction enzymes with recognition sequences
flanking VNTRs are used to digest the DNA extracted from the specimens.The digest is
electrophoresed, Southern blotted, and visualized as is done in standard RFLP protocols .
Because of the individual enormous variation in the VNTR pattern from this source, each
person’s pattern theoretically is unique. The pattern is the same for an individual, irrespective

3. molecular biology
3 of 4
of the tissue from which DNA is obtained. This analysis requires only a small amount of
specimen (e.g., less than 60 μl of blood). In using DNA fingerprinting to decide a case, the
argument that is made is that these VNTRs are randomly distributed across the population
such that the odds against matching five or more loci through chance occurrence alone is
astronomical. But what are high enough odds to help decide a case? In other words, what is
the chance that a particular VNTR pattern is unique enough to be derived from this source
alone in a given population? This chance depends on the frequency of the allele in question in
other populations (ethnic groups). In a highly diverse population like the United States,
questions are often raised about the reference population used to calculate the gene
frequencies. To remove ethnic biases, certain ceiling standards are proposed. Databases of
sample genetic readings should be taken from 100 people each from a variety of races and
categories.
Matches at any locus that spreads across 5 percent (or less) of the general population
would become the ceilings or standards for comparison. A large collection of population data
on VNTR frequency in unrelated individuals from numerous human races and ethnic groups is
available. DNA evidence is widely accepted as valid by most courts. However, defense
attorneys often attempt to discredit such evidence based on improper procedures used to
collect, handle, and process crime scene specimens. A classic example of the use of DNA in
forensics was the high-profile murder trial of O. J. Simpson. Defense attorneys, dubbed the
“Dream Team,” successfully defended the suspect in spite of mounting genetic evidence, citing
police misconduct in evidence gathering and processing.
In the 1994 U.S. World Trade Center bombing incident, investigators successfully linked
a suspect to the crime by DNA evidence obtained from saliva deposited on an envelope while
being sealed by the suspect. Body fluids frequently contain cells from which DNA can be
readily extracted. Researchers from the University of Minnesota at Duluth isolated DNA from
the lung tissue of a 1,000- year-old mummy of the Chiribaya Indian extraction. They found an
exact match of the DNA of the tuberculosis bacterium, conclusively exonerating Christopher
Columbus of the charge by some that his crew was the source of the “White Plague” in the
New World. In 1992, the former Mayor of Detroit, Coleman Young, settled a paternity suit and
agreed to pay child support when DNA evidence proved he was the father of a child in a
disputed suit. DNA evidence has been used by the Armed Forces Institute of Pathology in
Gathersburg, Maryland, to identify a number of Vietnam War MIAs. The Innocence Project
founded by Barry Scheck, a member of the O. J. Simpson legal team, is devoted to using DNA
evidence to exonerate prisoners who have been wrongfully convicted of murder or rape.
The steps involved in DNA fingerprinting are as follows:
 The DNA is cut with a restriction enzyme.
 The DNA fragments are separated according their length or molecular weight by gel
electrophoresis.
 The fragments are visualized by Southern blotting. After transfer of the separated
fragments from the gel to nylon paper a radioactively labeled DNA probe is added. The
probe will bind to those DNA fragments whose DNA sequences are complementary to
the probe.
 An autoradiograph is made by covering the blot with radiation-sensitive film. This will
show the location of those DNA fragments that reacted with the radioactive probe.
PCR-BASED DNA PROFILING
Modern DNA profiling is PCR-based and uses short tandem repeats (STRs), which are the
short (two to four) VNTRs. STR loci have fewer alleles than VNTRs. PCR data are less

4. molecular biology
4 of 4
compelling in criminal cases, except for excluding a suspect from the pool. However, a
variation introduced in 1999 in Britain uses 10 STR loci. This guarantees that the odds of
someone sharing the same results are less than one in a billion. In the United States, the FBI
used 13 STR loci to raise the odds of two unrelated individuals having the same profile to one
in a million billion.
Because PCR is used, DNA profiling is very sensitive and enables results to be
obtained with hairs and other specimens that contain trace amounts of DNA. The results are
unambiguous, and a match between DNA profiles is usually accepted as evidence in a trial.
The current methodology, called CODIS (Combined DNA Index System), makes use of 12
STRs with sufficient variability to give only a one in 1015 chance that two individuals, other
than identical twins, have the same profile. As the world population is around 6 × 109, the
statistical likelihood of two individuals on the planet sharing the same profile is so low as to be
considered implausible when DNA evidence is presented in a court of law. Each STR is typed
by PCRs with primers that are fluorescently labeled and which anneal either side of the
variable repeat region. The alleles present at the STR are then typed by determining the sizes
of the amplicons by capillary gel electrophoresis. Two or more STRs can be typed together in
a multiplex PCR if their product sizes do not overlap, or if the individual primer pairs are
labeled with different fluorescent markers, enabling the products to be distinguished in the
capillary gel
SELECTED APPLICATIONS OF DNA PROFILING
DNA profiling works best if suspects are not closely related. The probability of identical alleles
among sibs is 25 percent for each locus. If four loci are used in an investigation, the probability
of encountering identical alleles between two sibs is at least 0.4 percent. using this technique
to resolve cases involving members from the same family is more difficult.
Mitochondrial DNA (mtDNA) is also used in DNA profiling. It is valuable in cases involving
archeological and anthropological materials. MtDNA is maternally inherited. Consequently,
two individuals who are not related through links in an uninterrupted maternal lineage will most
likely differ in one or more mtDNA sequences. Sequence data offer the most specific identity of
individuals. The U.S. Armed Forces Pathology laboratory uses this technique to identify the
remains of soldiers. DNA profiling was used to conclusively identify the remains of Czar
Nicholas Romanov II, his wife, and their five children, who were executed during the
Bolshevick Revolution of 1918. The investigation was a three-prong approach, using DNA
extracted from bone fragments. The first analysis was performed to determine the sex of the
individuals, the second established family relationships, and the third, involving mtDNA, was
used to trace the maternal relationship. The last analysis included samples from HMH Prince
Philip, son of a daughter of the Czarina’s sisters, to provide an unbroken maternal link.