Hello everyone, I am Dr. Ujwalkumar Trivedi, Head of Biotechnology Department at Marwadi University Rajkot. I teach Molecular Biology to the students of M.Sc. Microbiology and Biotechnology. This presentation talks about the process of transcription in prokaryotes with an elaborative view on prokaryotic promoters, sigma factors and structure of RNA Polymerase. The later part of the presentation describes the process of initiation, elongation and termination of transcription.

1. Presented by
Dr. Ujwalkumar Trivedi
Assistant Professor
Department of Microbiology
Marwadi University
Rajkot (Gujarat)

2.  Definition: Producing/Synthesizing RNA
molecules on DNA Template.
 RNA is single stranded
 RNA has Uracil not Thymine
 RNA can acquire secondary
structure
 RNA can have catalytic activity
 RNA is unstable at alkaline pH

4. RNA copies can be made from the same gene in a relatively short time, with
the synthesis of additional RNA molecules being started before the previous
RNA molecules are completed. When RNA polymerase molecules follow hard
on each other’s heels in this way, each moving at about 50 nucleotides per
second, over a thousand transcripts can be synthesized in an hour from a
single gene.

6. Rate of polymerization 50nts/sec

7. Holoenzyme = Core enzyme + Sigma Factor

8.  5 subunits, 449 kd (~1/2 size of DNA pol III)
 Core enzyme
◦ 2  subunits---hold enzyme together
◦ --- links nucleotides together
◦ ’---binds templates
 ---recognition
 Holoenzyme= Core + sigma
 Starts at a promoter sequence, ends at
termination signal
 Proceeds in 5’ to 3’ direction
 Forms a temporary DNA:RNA hybrid
 Has complete processivity
 Requires sigma factor for promoter recognition

9.  Template strand
 Coding strand
 Promoters
◦ Binding sites for RNA pol on template strand
◦ ~40 bp of specific sequences with a specific order
and distance between them.
 Core promoter elements for E. coli
◦ -10 box (Pribnow box)
◦ -35 box
 Numbers refer to distance from transcription
start site

10. 5’–TCAGCTCGCTGCTAATGGCC–3’
3’–AGTCGAGCGACGATTACCGG–5’
5’–UCAGCUCGCUGCUAAUGGCC–3’
Sense (+) strand
DNA coding strand
Non-template strand
DNA template strand
antisense (-) strand
RNA transcript
transcription

11.  Pribnow box located at –10 (6-7bp)
 -35 sequence ~(6bp)
 Consensus sequences: Strongest
promoters match consensus
◦ Up mutation: mutation that makes promoter
more like consensus
◦ Down Mutation: virtually any mutation that alters
a match with the consensus
Consensus sequences

13.  Essential for recognition of promoter
 Stimulates transcription
 Combines with holoenzyme
◦ “open hand” conformation
◦ Positions enzyme over promoter
 Does NOT stimulate elongation
 Falls off after 4-9 nt incorporated
 “Hand” closes

14.  Variation in promoter sequence affects
strength of promoter
 Sigmas also show variability
 Much less conserved than other RNA pol
subunits
 Several variants within a single cell. EX:
◦ E. coli has 7 sigmas
◦ B. subtilis has 10 sigmas
 Different  respond to different promoters

15.  Sigma70 (-35)TTGACA (-10)TATAAT
◦ Primary sigma factor, or housekeeping sigma factor.
 Sigma54 (-35)CTGGCAC (-10)TTGCA
◦ alternative sigma factor involved in transcribing
nitrogen-regulated genes (among others).
 Sigma32 (-35)TNNCNCNCTTGAA
(-10) CCCATNT
◦ heat shock factor involved in activation of genes
after heat shock.
 POINT: gives E. coli flexibility in responding to
different conditions

16.  Template recognition
◦ RNA pol binds to DNA
◦ DNA unwound
 Initiation
 Elongation
◦ RNA pol moves and
synthesizes RNA
◦ Unwound region moves
 Termination
◦ RNA pol reaches end
◦ RNA pol and RNA released
◦ DNA duplex reforms

17.  Steps
◦ Formation of closed promoter (binary) complex
◦ Formation of open promoter complex
◦ Ternary complex (RNA, DNA, and enzyme), abortive
initiation
◦ Promoter clearance (elongation ternary complex)
 First rNT becomes unpaired
 Polymerase loses sigma
 NusA binds
◦ Ribonucleotides added to 3’ end

18.  Holoenzyme
 Core + 
 Closed (Promoter)
Binary Complex
 Open binary complex
 Ternary complex
 Promoter clearance

19.  Occurs after 4- 10 nt are added
 First rnt becomes unpaired from antisense
(template) strand.DNA strands re-anneal
 Polymerase loses sigma, sigma recycled
◦ Result “Closed hand” surrounds DNA
 NusA binds to core polymerase
 As each nt added to 3’, another is melted
from 5’, allowing DNA to re-anneal.
 RNA pol/NusA complex stays on until
termination. Rate=20-50nt/second.

20.  Occurs at specific sites on template strand
called Terminators
 Two types of termination
◦ Intrinsic terminators
◦ Rho () dependent treminators
 Sequences required for termination are in
transcript
 Variation in efficiencies.

21.  DNA template contains inverted repeats (G-C
rich)
◦ Can form hairpins
 6 to 8 A sequence on the DNA template that
codes for U
 Consequences of poly-U:poly-A stretch?
Coding strand

22. UUUUU
 RNA pol passes over
inverted repeats
 Hairpins begin to form
in the transcript
 Poly-U:poly-A stretch
melts
 RNA pol and transcript
fall off

23.  rho factor is ATP dependent
helicase
 catalyses unwinding of RNA: DNA
hybrid

24.  rho factor is
ATP dependent
helicase
 catalyzes
unwinding of
RNA: DNA
hybrid
 50~90
nucleotides/sec

25. hexamer
 Rho binds to
transcript at 
loading site (up
stream of terminator)
 Hairpin forms, pol
stalls
 Rho helicase releases
transcript and causes
termination

26. Thank You
Kindly Reach us at:
Marwadi University
Rajkot-Morbi Highway Road, Gauridad, Rajkot, Gujarat 360003
Website: https://www.marwadieducation.edu.in/