1. ANNE CATHRYN COX
December 11, 2016
HEPATOCYTE NUCLEAR FACTOR
4 ALPHA (HNF4A) EXPRESSION
INCREASES IN BURMESE PYTHON
LIVER 1 DAY AFTER FEEDING
THE PYTHON PROJECT, FALL 2016

2. 1
1. ABSTRACT
Over 1 in 5 adults in the US has metabolic
syndrome (MetS), which is a collection of
symptoms including some or all of the
following: obesity, high fasting plasma
glucose, high blood pressure, high
triglyceride levels, and low HDL cholesterol
levels (Beltrán-Sánchez, Harhay, Harhay, &
McElligott, 2013). Although this syndrome is
well studied, there is still much to learn about
how humans process fat in the liver. The
Burmese python has several key
physiological processes that make it such a
pertinent animal for research on human
disease involving the metabolism of
cholesterol and other fats, including MetS,
pathological cardiac hypertrophy, and
hepatic steatosis (fatty liver disease). One of
these processes is the rapid metabolism of
serum fatty acids post-meal. To explore this
process, hepatocyte nuclear factor 4 alpha
(HNF4A) expression in python liver tissue
was tested using real-time PCR. HNF4A has
two separate functions important to bile acid
homeostasis in hepatocytes in humans: (1) to
upregulate the transcription of transport
proteins (largely NCTP) moving recycled
bile acid into hepatic cells while
downregulating transport proteins which
move bile acids from hepatic cells into the
canaliculus, and (2) to increase binding of
HNF1A to its promoter thereby increasing
the transcription of CYP7A1 and the
downstream synthesis of bile acids. This
research found that expression of HNF4A
mRNA doubles from the fasted tissue at 1
day-post-fed (DPF), and then returns to
normal by 3 DPF, suggesting that the python
uses similar pathways of bile-acid
sequestration in hepatocytes as humans.
2. INTRODUCTION
Over 1 in 5 adults in the US has metabolic
syndrome (MetS), which is a collection of
symptoms including some or all of the
following: obesity, high fasting plasma
glucose, high blood pressure, high
triglyceride levels, and low HDL cholesterol
levels (Beltrán-Sánchez, Harhay, Harhay, &
McElligott, 2013). Although this syndrome is
well studied, there is still much to learn about
how humans process fat in the liver. Model
organisms are important in research to help
improve our understanding of biological
systems similar to humans in order to better
address complex problems in medicine.
Some of the more common model organisms
in scientific research (especially pertaining to
human disease) are mice or rats. Although
mice and lab rats have beneficial aspects for
being a model organism in a laboratory (e.g.
mammalian, rapid lifecycle, etc), there are
sometimes advantages to using other model
organisms, like the Burmese python (Python
bivittatus). The Burmese python has several
key physiological processes that make it such
a pertinent animal for research on human
disease involving the metabolism of
cholesterol and other fats, including MetS,
pathological cardiac hypertrophy, and
hepatic steatosis (fatty liver disease). The
python’s digestive organs, including the
heart, all grow in mass rapidly after
consuming a meal (Secor, 2008). This organ
growth is physiological and not pathological,
and is attributed to a few select fatty acids
present in the python’s serum that are not
originally from the meal (Riquelme et al.,
2011; Secor, 2008). Key insights from
research on the Burmese python are already
yielding new human implications for treating
cardiac regression in cancer patients and
cardiac hypertrophy (Riquelme et al., 2011).
However, it is not well understood where
these key fatty acids come from in the python
serum, and how the python processes the
large amount of fat in its postprandial system
and serum. In order to address this,
researchers from the Python Project under the
lab of Dr. Leslie Leinwand are looking into
specific genes that are known in humans to

3. 2
play a role in either the synthesis or transport
of bile acids, which emulsify fats in the
digestive system and allow them to be
processed. By unlocking the key to how
pythons process such large amounts of fat
and remain healthy, human conditions such
as metabolic syndrome can be looked at from
another, perhaps more enlightening angle
than previous research.
Hepatocyte nuclear factor 4 alpha (HNF4A)
is one of several transcription factors that
heavilyregulate genes involving the transport
of bile acids around the digestive system,
largely from the liver where they are
synthesized through the bile duct to the
intestines to digest fats, and then back to the
liver from the intestines. By focusing on a
transcription factor for many transport
proteins instead of one specific transport
protein, expression levels can potentially be
implied for many genes and not just one. In
knockout studies with mice, adult male mice
had decreased levels of mRNA for NCTP
(Sodium Taurocholrate Cotransporting
Polypeptide) among others when HNF4A
was rendered nonfunctional in the liver (Lu,
Gonzalez, & Klaassen, 2010). NCTP,
expressed less in the absence of HNF4A, is a
transport pump and is the primary way in
which bile acids recycle from the ileum and
colon back into the hepatocyte for reuse.
HNF4A has been shown to increase NCTP in
other studies as well (Dietrich et al., 2007;
Hayhurst, Lee, Lambert, Ward, & Gonzalez,
2001). In another knockout study, the serum
chemistry of wild-type vs HNF4A-null mice
was analyzed (Hayhurst et al., 2001). This
study found that in addition to having
decreased NCTP levels by western blot,
HNF4A null mice had increased levels of
ALT, triglycerides, total cholesterol, HDL
cholesterol, and bile acids in their serum
(Hayhurst et al., 2001). This leads to the
conclusion that HNF4A must be important to
getting bile acids out of an organism’s serum
and into its hepatocytes for use in the liver.
Another important function of HNF4A is to
help hepatocyte nuclear factor 1 alpha
(HNF1A), another important hepatic
transcription factor, to bind its promoters on
several other hepatic genes in liver cell nuclei
(Eeckhoute, Formstecher, & Laine, 2004).
When it does this, the genes which are
activated by HNF1A, such as Cholesterol 7-
Alpha-Hydroxylase (CYP7A1) are also
upregulated. CYP7A1 plays a vital role and
is the rate determining step in the conversion
of cholesterol into bile acids. Because of
HNF4A’s varying functions in bile acid
synthesis and export, it may hold key insights
into fat digestion in the Burmese python.
The main function of HNF4A is to participate
as a transcription factor for select hepatic
genes. HNF4a directly upregulates some
hepatic genes, and (likely indirectly)
downregulates other genes. In a knockout
study with mice, the following genes were
found to be upregulated by HNF4A: NTCP,
OATP1A1, OATP2B1, OAT2, OATP1B2,
OCT1, NPT1, SLC26A1, SVCT1, UGT2A3,
UGT2B1, UGT3A1, UGT3A2, UGT1A5,
UGT1A9, SULT1A1, SULT1B1, SULT5A1,
MRP6, MATE1, GSTM4, GSTM6, and
BCRP (Lu et al., 2010). In the same study, the
knockout mice were found to have higher
levels of mRNA for the following genes,
indicating that they are downregulated by
HNF4A: OATP1A4, OCTN2, UGT1A1,
SULT1E1, SULT2A2, GSTA4, GSTM1-
M3, MDR1A, MRP3, and MRP4 (Lu et al.,
2010). Several trends emerge from these
groups of upregulated and downregulated
proteins that are worth exploring. First,
NTCP, SLCs and OATP1s are all
upregulated by HNF4A, and all of these
proteins serve as bile acid uptake (influx)
proteins for hepatocytes (i.e. they take
recycled bile acids back into the liver cells)
(Halilbasic, Claudel, & Trauner, 2013).
Additionally, MDRs such as MRP2, MDR1,
and BCRP are all downregulated by HNF4A,
and these proteins serve as canalicular

4. 3
exporters (i.e. they move bile acids from the
liver cell to the canaliculis for export)
(Halilbasic et al., 2013). MRP3 and MRP4
were also downregulated by HNF4A, and
these proteins are basolateral transporters
(i.e. take bile acids out of ileocytes and
colonocytes , where they are then brought
back to the hepatocytes through the
enterohepatic cycle (Thomas, Pellicciari,
Pruzanski, Auwerx, & Schoonjans, 2008).
These data in conjunction show that an
increase in expression of HNF4A would
cause a sequestration of available bile acids
in the enterohepatic cycle into the
hepatocytes, and additionally, a shutting off
of secondary pathways of bile acid export
from the digestive system. This sequestration
could be useful in the case of a python having
a large meal, because it would initially
require a large amount of conjugated bile
acids in the hepatocytes to be able to flow all
at once in a concentrated fasion into the
canaliculus and help to digest the meal.
An additional function of HNF4A is to assist
in the binding of HNF1A to its promoters,
causing an upregulation in genes controlled
by HNF1A as a transcription factor
(Eeckhoute et al., 2004). HNF1A is known to
bind near CYP7A1 and trans activate the
CYP7A1 gene in humans, but not in rats
(Chen, Cooper, & Levy-Wilson, 1999).
Additionally, HNF1A’s stimulatory effect on
the expression of CYP7A1 has been observed
to be curbed by the expression of PPARα and
LXRα, both of which are known to inhibit
CYP7A1 (Gbaguidi & Agellon, 2004;
Halilbasic et al., 2013). It is possible that
HNF1A also stimulates the production of
CYP7A1 in pythons. If this is the case, an
upregulation in HNF4A leading to an
increase in HNF1A could potentiallyincrease
bile acid synthesis from cholesterol inside
hepatocytes. This function makes sense with
the upregulation of NCTP by HNF4A that
brings back bile acids from the enterohepatic
cycle into the liver cells, because helping in
bile acid synthesis through HNF1A would
also increase the amount of bile acids in the
liver cells waiting to be transported across the
membrane to the canaliculus. Both of
HNF4A’s functions serve to sequester bile
acids in hepatocytes, perhaps in preparation
for the digestion of a large meal or in
preparation of removing a large amount of fat
from the serum of the python. Additionally,
the sequestration of bile acids in hepatocytes
may be the reason that a python’s organs
grow in mass after feeding, but before lipids
are present in the serum (Riquelme et al.,
2011; Secor, 2008).
By illuminating the function and expression
of HNF4A in the liver, answers about how
the Burmese python digests meals and
increases the mass of its digestive organs in a
physiological and not a pathological way
may also be illuminated. By continuing to
piece together how the lipid homeostatic
system functions in python, it is expected that
continued developments in human lipid
homeostasis will also be made. The
possibility of using python mechanisms for
curbing pathological heart growth, cardiac
regression, fatty liver disease, and even
metabolic syndrome is real and has been
demonstrated to work in the heart (Riquelme
et al., 2011). Moving forward, genes like
HNF4A will be analyzed in order to try and
replicate this success in the liver. HNF4A has
two separate functions important to bile acid
homeostasis in hepatocytes in humans: (1) to
upregulate the transcription of transport
proteins moving recycled bile acid into
hepatic cells while downregulating transport
proteins which move bile acids from hepatic
cells into the canaliculus, and (2) to increase
binding of HNF1A to its promoter thereby
increasing the transcription of CYP7A1 and
the downstream synthesis of bile acids. Both
of these functions act to sequester bile acids
in hepatocytes. Since HNF4A is highly
conserved among organisms, it is expected
that expression in the post-prandial python of

5. 4
HNF4A will increase dramatically
immediately after the python is fed and
continue to be upregulated at 1 day post fed
(DPF), in order to sequester bile acids in
hepatocytes and prepare for the digestion of
the meal. This hypothesis will be tested with
real-time PCR using primers validated both
in-silico and in-vitro with BLAST and
conventional PCR.
3. METHODS
The gene of interest, HNF4A, was chosen
based on research from prior semesters in the
python project, indicating that it would be an
interesting gene to study, providing new
insights into previous research. Additionally,
it was chosen due to the known functions of
HNF4A in humans and mice in bile acid
transport and synthesis in the liver.
First, primers for HNF4A to be used in qPCR
were designed by finding the corresponding
gene sequence in the gallus gallus genome.
This sequence was BLASTed against the
python molorus bivitattus whole genome
shotgun (WGS) database from NCBI. This
was done because the python genome is not
annotated, and existing transcriptomes are
unreliable when translated in silico. After
alignments in contigs from the python WGS
were identified, the contigs were mapped
back to the gallus gallus transcript to find the
correct order. The newly assembled putative
python transcript was then validated by
translation to ensure there was an open
reading frame with no stop codons, and then
BLASTed by protein to ensure the correct
protein was returned by the database.
Once the python sequence was validated in
silico, primers were chosen using Primer3
and specifying a length of 18-25 base pairs,
melt temperature of 60 °C, GC clamp
avoidance, and GC content of 40-60%.
Additionally, the primers with the lowest
self-complementarity were chosen to
increase PCR efficiency.
The primers obtained from Primer3 were
then validated in silico by primer BLAST
against all mRNA in the NCBI database to
ensure that only the intended product would
be amplified. Only HNF4A was returned by
this BLAST, in different species, indicating
that the gene is highly conserved.
The primers used produce a product with a
length of 122 base pairs, and are shown in the
following table. They were ordered from
Invitrogen.
Forward
primer
5’ GAGATGCTGCTTGGAGGTTC 3’
Reverse
primer
5’ TCTGAGGAGGCATTGTGTTG 3’
After primers were designed, RNA from
several timepoints after eating was isolated.
Pythons were cared for under 12 hour light
cycle conditions, and an animal euthanization
protocol was approved by the University of
Colorado, Boulder IACUC. The pythons
were fed rats equaling 25% of the python
body weight every 14 days. Two pythons
from each timepoint after feeding were used
(Fasted, 1 day post fed (DPF), 3 DPF, and 10
DPF). 30 mg of liver tissue from each of the
two snakes for each time point were
homogenized (60 mg total per time point
sample). The sex of the 1 DPF and 10 DPF
pythons were male, and the fasted and 3 DPF
pythons were unknown.
The RNA was isolated from the tissue
samples using TRI Reagent (Sigma Aldrich,
St. Louis, MO), according to manufacturer
instructions. Briefly, pooled tissue samples
were homogenized for 20-30 seconds in 1mL
TRI Reagent. Following incubation at room
temperature, RNA, DNA, and protein were
separated using 200μL of chloroform.
Samples were centrifuged and clear
supernatant containing RNA was removed.

6. 5
RNA was precipitated and purified using
decreasing concentrations of ethanol. Pellets
were suspended in 50μL of RNase-free
water.
The resulting RNA concentration was
measured using a spectrophotometer, so that
mass of RNA used in subsequent steps could
be normalized to the concentration of a
particular sample.
After RNA was isolated, cDNA was
synthesized according to manufacturer
instructions of the SuperScript III
(Invitrogen). The only exceptions made to
this protocol were that 2000 ng of RNA were
used in a 20 μL total reaction volume,
yielding a 100 ng/μL cDNA solution.
Additionally, the HNF4A specific primers
enumerated earlier in this section were used
to synthesize gene-specific cDNA, so that the
ribosomal RNA would not be made into
cDNA, and all cDNA obtained would be
gene specific. It was assumed that 100% of
the HNF4A mRNA from the RNA samples
was converted to cDNA for the purposes of
this experiment. The lyophilized primers
were resuspended to a concentration of 100
μM, then diluted to a working concentration
of 12.5 μM.
After cDNA was synthesized, qPCR was
performed using the cDNA. In order to
produce a standard curve for interpolating
starting concentrations of the unknown
timepoints, serial dilutions of cDNA were
made. First, 5 μL of each of the Fasted, 1
DPF, 3 DPF, and 10 DPF timepoints were
combined into a pooled sample to minimize
sample-to sample errors (all time points had
the same concentration of cDNA). Then, this
pooled sample (100 ng/μL) was diluted 1:10
four times, producing the following dilution
concentrations for the standard curve: 10
ng/μL, 1 ng/μL, 0.1 ng/μL, 0.01 ng/μL, and
then pure deionized reverse-osmosis water
was used as the no template control (NTC).
For the unknown cDNA, the stock cDNA
synthesized to be 100 ng/μL for each time
point was diluted to a working concentration
of 1 ng/μL. To set up the qPCR 96-well plate,
4 μL of each of the dilutions were loaded into
wells in triplicate. Similarly, 4 μL of each
unknown (Fasted, 1 DPF, 3 DPF, and 10
DPF) were loaded in triplicate. Then, 16 μL
of SYBR Select master mix (used according
to manufacturer (ThermoFisher Scientific)
instructions) including the HNF4A specific
primers was added to all of the wells, both
standards (including the NTC) and
unknowns.
The plates were then run through qPCR in the
BioRad CFX 96 Real-Time Thermocyler,
and the gene expression data was obtained
and analyzed through the native software to
the instrument (CFX Manager). For data
analysis, the starting concentration of the
triplicates for each time point were averaged
and then normalized to the fasted sample to
obtain the fold change in mRNA expression
at the four time points.
In order to validate that the product obtained
in the qPCR reactions was the intended
amplification product of 122 base pairs from
the in-silico validation of the HNF4A
specific primers, the products of the qPCR
reaction from the most amplified wells (1
DPF) and the NTC wells were then loaded
and run on a 1% agarose gel with ethidium
bromide. 6 μL of 6X DNA loading dye was
loaded into the qPCR well to be loaded on the
gel, and then 15 μL from the mixed well was
loaded into the well of the gel. The products
were loaded with a 1kb DNA ladder in which
the lowest 2 bands show 100 and 200 base
pair product size.
4. RESULTS
By performing the protocol enumerated in
the previous section, the following data were
obtained. The real time PCR plate was set up

7. 6
3 different times using the same samples. The
first time the plate was run, a doubling of
expression at 1 day post fed was observed
with very little technical error. The second
and third time that the plates were run, the
fasted and 3 day samples were much lower
with respect to the 1 DPF and 10 DPF
samples, possibly indicating degradation of
the samples or another error in keeping the
samples. Despite this incongruence, the
technical error in both the second and the
third plates was small, and the general trend
of HNF4A being upregulated at 1 DPF and
slightly at 10 DPF was conserved throughout
all trials.
FIGURE 1 AVERAGE FOLD CHANGE IN HNF4A MRNA
FROM 3 QPCR PLATES
FIGURE 2 FOLD CHANGE IN HNF4A MRNA PLATE 1
FIGURE 3 FOLD CHANGE IN HNF4A MRNA PLATE 2
FIGURE 4 FOLD CHANGE IN HNF4A MRNA PLATE 3
Additionally, the products from the second
plate qPCR reaction were run on a gel in
order to validate that only the intended
products were amplified, and this was the
case. Below, the gel shows two product bands
from the 3 DPF well of approximately the
correct product size, as well as no band for
the NTC well.

8. 7
Only one product was observed above the
threshold on the melt peaks for all three
plates, and the standard curves were used to
interpolate starting quantities of unknown
samples.
FIGURE 5 QPCR MELT PEAK PLATE 1
FIGURE 6 QPCR STANDARD CURVE PLATE 1
The standard curve for the first plate that was
run had the highest R2
value of the 3 plates
run. Additionally, it exhibited the least
“messy” melt peak.
FIGURE 7 QPCR MELT PEAK PLATE 2
FIGURE 8 QPCR STANDARD CURVE PLATE 2
FIGURE 9 QPCR MELT PEAK PLATE 3
FIGURE 10 QPCR STANDARD CURVE PLATE 3
5. DISCUSSION
Based on the data obtained by qPCR, the
Burmese python liver upregulates HNF4A 1
day after feeding. This supports the initial
hypothesis stated in the introduction that

9. 8
HNFA acts as an on/off switch for several
transport genes, which act in conjunction to
produce a build-up of bile acids in liver cells.
Because NCTP transports bile acid from
hepatic portal blood into liver cells, it follows
that NCTP would need to be upregulates
prior to digesting a meal. The python’s meal
stays in its digestive track relatively intact
until at least 3 DPF (Secor, 2008), so the
upregulation of NCTP by an increase in
expression of HNF4A would be in time for
aiding in emulsifying fats from the meal, but
it would also be in time to aid in the removal
of serum fatty acids from the post prandial
Burmese python (Riquelme et al., 2011).
DISCUSSION OF ERROR
Additionally, although cDNA is very stable,
it appears from the data that the samples
could have potentially degraded slightly over
time from when the first plate was loaded to
when the third qPCR plate was loaded. The
evidence of this is the standard curve
triplicates becoming more and more
separated despite similar technical error, the
melt peaks becoming messier, the expression
levels being inconsistent among trials despite
the same trends, and the cycle in which the
qPCR products amplified. For the first plate,
the highest concentration of product
amplified and crossed the threshold midway
through the amplification phase around 25
cycles and for the last plate, this was pushed
back to around 31 cycles. All of these
observations indicate that over time, the
integrity of the samples loaded into the qPCR
plates may have decreased due to cDNA
degradation or some other unknown factor.
This migration of amplification to later
cycles of amplification in the qPCR reaction
despite using the same samples and the same
prepared cDNA serial dilutions to produce
the standard curve is shown in the
amplification curves below.
FIGURE 11 PLATE 1 AMPLIFICATION CURVES OF
HNF4A IN QPCR REACTION
FIGURE 12 PLATE 2 AMPLIFICATION CURVE OF HNF4A
IN QPCR REACTION
FIGURE 13 PLATE 3 AMPLIFICATION CURVE OF HNF4A
IN QPCR REACTION
One of the only reasonable explanations for
this migration of amplification cycle over
time is there being less and less target present
for the primers to anneal to over time. Also,
the samples which already contained less
target (Fasted and 1 DPF) degraded faster

10. 9
than the high concentration samples (3 DPF
and 10 DPF).
Further experiments are necessary to confirm
the actual fold change of mRNA of HNF4A,
however, since all trials revealed the same
trend, conclusions based on the trend in
expression are still valid.
POSSIBLE FUTURE EXPERIMENTS
In subsequent experiments, the expression of
NCTP should be measured using the same
methodology used in this study. This would
provide insights into how important NCTP is
to bile acid homeostasis, especially the
recycling of used bile acids from hepatic
portal blood into hepatocytes for re-use in
digestion of fats. This study could also be
repeated with higher concentrations of cDNA
in the qPCR reactions in order to eliminate
some error based on possible degradation of
samples as discussed previously in the
Discussion section of this paper.
Additionally, other bile acid transporters
such as ASBT, OSTa/OSTb, and BSEP could
be explored. It is known that these genes play
a role in transporting bile acids into and out
of liver cells, ileocytes, and cholangiocytes.
Knowing the changes in expression for these
genes would then allow a more complete
picture of bile acid transport in the
postprandial Burmese python, allowing for
more insights into potential treatment targets
for humans with MetS.
Finally, HNF1A (hepatocyte nuclear factor 1
alpha) could be measured, to solidify the
relationship between HNF4A and HNF1A,
and to tie the bile acid synthesis story to the
bile acid transport story in the Burmese
Python, due to HNF4A helping to bind
HNF1A to its promoter sites in the nucleus,
and HNF1A regulating CYP7A1, which is
the rate determining protein in the conversion
of cholesterol to bile acid in human and
mouse models.
6. CONCLUSION
In summary, the following conclusions were
drawn from the work presented in this paper
stemming from qPCR analysis of HNF4A
mRNA expression levels in post prandial
Burmese Python liver tissue:
 HNF4A plays an important role in the
digestive physiology of the Burmese
python, and that role is similar to the
role that has been demonstrated in
humans.
 HNF4A is upregulated at 1 dpf, when
the highest concentration of lipids is
present in the burmese python serum,
and before the majorityof its meal has
been digested. It is likely that NCTP
is also upregulated at this time.
 It is possible that in the python,
HNF4A sequesters bile acids in the
hepatocytes in preparation of
releasing them to digest the meal.
This sequestration could explain the
liver hypertrophy seen early after the
snake has fed but before it has
digested its meal.
APPLICATIONS
The implications of the findings of this
research present many avenues for the
research of the treatment of symptoms
involved in MetS. Particularly in the case of
heart disease induced by high blood pressure
due to high concentrations of serum fats, this
research could prove useful. Since NCTP is
further correlated with the uptake of bile
acids, it could potentially be the target of a
new pharmaceutical which aims to turn on
the human body’s existing mechanisms for
removing fatty acids from serum.

11. BIBLIOGRAPHY
Battle, Michele A., Genevieve Konopka,
Fereshteh Parviz, Alexandra Lerch
Gaggl, Chuhu Yang, Frances M. Sladek,
and Stephen A. Duncan. “Hepatocyte
Nuclear Factor 4α Orchestrates
Expression of Cell Adhesion Proteins
during the Epithelial Transformation of
the Developing Liver.” Proceedings of
the National Academy of Sciences 103,
no. 22 (May 30, 2006): 8419–24.
doi:10.1073/pnas.0600246103.
Beltrán-Sánchez, Hiram, Michael O. Harhay,
Meera M. Harhay, and Sean McElligott.
“Prevalence and Trends of Metabolic
Syndrome in the Adult U.S. Population,
1999–2010.” Journal of the American
College of Cardiology 62, no. 8 (August
20, 2013): 697–703.
doi:10.1016/j.jacc.2013.05.064.
Bonzo, Jessica A., Christina H. Ferry,
Tsutomu Matsubara, Jung-Hwan Kim,
and Frank J. Gonzalez. “Suppression of
Hepatocyte Proliferation by Hepatocyte
Nuclear Factor 4α in Adult Mice.” The
Journal of Biological Chemistry 287,
no. 10 (March 2, 2012): 7345–56.
doi:10.1074/jbc.M111.334599.
Chen, Jean, Allen D. Cooper, and Beatriz
Levy-Wilson. “Hepatocyte Nuclear
Factor 1 Binds to and Transactivates the
Human but Not the Rat CYP7A1
Promoter.” Biochemical and
Biophysical Research Communications
260, no. 3 (July 1999): 829–34.
doi:10.1006/bbrc.1999.0980.
Dawson, Paul A., Tian Lan, and Anuradha
Rao. “Bile Acid Transporters.” Journal
of Lipid Research 50, no. 12 (December
2009): 2340–57.
doi:10.1194/jlr.R900012-JLR200.
Dietrich, Christoph G., Ina V. Martin, Anne
C. Porn, Sebastian Voigt, Carsten
Gartung, Christian Trautwein, and
Andreas Geier. “Fasting Induces
Basolateral Uptake Transporters of the
SLC Family in the Liver via HNF4alpha
and PGC1alpha.” American Journal of
Physiology. Gastrointestinal and Liver
Physiology 293, no. 3 (September
2007): G585-590.
doi:10.1152/ajpgi.00175.2007.
Eeckhoute, J., P. Formstecher, and B. Laine.
“Hepatocyte Nuclear Factor 4α
Enhances the Hepatocyte Nuclear
Factor 1α-Mediated Activation of
Transcription.” Nucleic Acids Research
32, no. 8 (2004): 2586–93.
doi:10.1093/nar/gkh581.
Ekholm, E., R. Nilsson, L. Groop, and C.
Pramfalk. “Alterations in Bile Acid
Synthesis in Carriers of Hepatocyte
Nuclear Factor 1α Mutations.” Journal
of Internal Medicine 274, no. 3
(September 1, 2013): 263–72.
doi:10.1111/joim.12082.
Gbaguidi, G. Franck, and Luis B. Agellon.
“The Inhibition of the Human
Cholesterol 7alpha-Hydroxylase Gene
(CYP7A1) Promoter by Fibrates in
Cultured Cells Is Mediated via the Liver
X Receptor Alpha and Peroxisome
Proliferator-Activated Receptor Alpha
Heterodimer.” Nucleic Acids Research
32, no. 3 (2004): 1113–21.
doi:10.1093/nar/gkh260.
Halilbasic, Emina, Thierry Claudel, and
Michael Trauner. “Bile Acid
Transporters and Regulatory Nuclear
Receptors in the Liver and beyond.”
Journal of Hepatology 58, no. 1
(January 2013): 155–68.
doi:10.1016/j.jhep.2012.08.002.
Hayhurst, Graham P., Ying-Hue Lee, Gilles
Lambert, Jerrold M. Ward, and Frank J.
Gonzalez. “Hepatocyte Nuclear Factor
4α (Nuclear Receptor 2A1) Is Essential
for Maintenance of Hepatic Gene
Expression and Lipid Homeostasis.”

12. 1
Molecular and Cellular Biology 21, no.
4 (February 2001): 1393–1403.
doi:10.1128/MCB.21.4.1393-
1403.2001.
“Hepatocyte Nuclear Factor 4 Alpha.”
Wikipedia, the Free Encyclopedia, May
20, 2016.
https://en.wikipedia.org/w/index.php?tit
le=Hepatocyte_nuclear_factor_4_alpha
&oldid=721177930.
Kazgan, Nevzat, Mallikarjuna R. Metukuri,
Aparna Purushotham, Jing Lu,
Anuradha Rao, Sangkyu Lee, Matthew
Pratt-Hyatt, et al. “Intestine-Specific
Deletion of Sirt1 in Mice Impairs
DCoH2–HNF1α–FXR Signaling and
Alters Systemic Bile Acid
Homeostasis.” Gastroenterology 146,
no. 4 (April 2014): 1006–16.
doi:10.1053/j.gastro.2013.12.029.
Lu, Hong, Frank J. Gonzalez, and Curtis
Klaassen. “Alterations in Hepatic
mRNA Expression of Phase II Enzymes
and Xenobiotic Transporters after
Targeted Disruption of Hepatocyte
Nuclear Factor 4 Alpha.” Toxicological
Sciences: An Official Journal of the
Society of Toxicology 118, no. 2
(December 2010): 380–90.
doi:10.1093/toxsci/kfq280.
Pauli-Magnus, Christiane, Bruno Stieger,
Yvonne Meier, Gerd A. Kullak-Ublick,
and Peter J. Meier. “Enterohepatic
Transport of Bile Salts and Genetics of
Cholestasis.” Journal of Hepatology 43,
no. 2 (August 2005): 342–57.
doi:10.1016/j.jhep.2005.03.017.
Purushotham, Aparna, Qing Xu, Jing Lu,
Julie F. Foley, Xingjian Yan, Dong-
Hyun Kim, Jongsook Kim Kemper, and
Xiaoling Li. “Hepatic Deletion of
SIRT1 Decreases HNF1α/FXR
Signaling and Induces Formation of
Cholesterol Gallstones in Mice.”
Molecular and Cellular Biology,
January 30, 2012, MCB.05988-11.
doi:10.1128/MCB.05988-11.
Riquelme, Cecilia A., Jason A. Magida,
Brooke C. Harrison, Christopher E.
Wall, Thomas G. Marr, Stephen M.
Secor, and Leslie A. Leinwand. “Fatty
Acids Identified in the Burmese Python
Promote Beneficial Cardiac Growth.”
Science (New York, N.Y.) 334, no. 6055
(October 28, 2011): 528–31.
doi:10.1126/science.1210558.
Secor, Stephen M. “Digestive Physiology of
the Burmese Python: Broad Regulation
of Integrated Performance.” Journal of
Experimental Biology 211, no. 24
(December 15, 2008): 3767–74.
doi:10.1242/jeb.023754.
Servitja, Joan-Marc, Miguel Pignatelli,
Miguel Angel Maestro, Carina
Cardalda, Sylvia F. Boj, Juanjo Lozano,
Enrique Blanco, et al. “Hnf1alpha
(MODY3) Controls Tissue-Specific
Transcriptional Programs and Exerts
Opposed Effects on Cell Growth in
Pancreatic Islets and Liver.” Molecular
and Cellular Biology 29, no. 11 (June
2009): 2945–59.
doi:10.1128/MCB.01389-08.
Thomas, Charles, Roberto Pellicciari, Mark
Pruzanski, Johan Auwerx, and Kristina
Schoonjans. “Targeting Bile-Acid
Signalling for Metabolic Diseases.”
Nature Reviews Drug Discovery 7, no. 8
(August 2008): 678–93.
doi:10.1038/nrd2619.
Yahoo, Neda, Behshad Pournasr, Jalal
Rostamzadeh, and Fardin Fathi. “Forced
Expression of Hnf4a Induces Hepatic
Gene Activation through Directed
Differentiation.” Biochemical and
Biophysical Research Communications
476, no. 4 (August 5, 2016): 313–18.
doi:10.1016/j.bbrc.2016.05.119.