The document summarizes key concepts related to the central dogma of biology. It describes how genetic information flows from DNA to RNA to proteins. DNA is transcribed into messenger RNA (mRNA) by RNA polymerase. mRNA is then translated into proteins by ribosomes using transfer RNA (tRNA) and the genetic code found in mRNA codons. The central dogma involves several key molecular processes including transcription, translation, DNA replication, and mutations.
12. A way to think about
this flow of information
DNA à RNA à Protein
13.
14. Bread Pudding
2 cups whole milk (or 2 cups half & half)
1/4 cup butter
2/3 cup brown sugar (light or dark, depending on taste preference)
3 eggs
2 teaspoons cinnamon
1/4 teaspoon ground nutmeg
1 teaspoon vanilla extract
3 cups bread, torn into small pieces (french bread works best)
1/2 cup raisins (optional)
1. In medium saucepan, over medium heat, heat milk (or half & half)
just until film forms over top. Combine butter and milk, stirring until
butter is melted. Cool to lukewarm.
2. Combine sugar, eggs, cinnamon, nutmeg, and vanilla. Beat with an
electric mixer at medium speed for 1 minute. Slowly add milk mixture.
3. Place bread in a lightly greased 1 1/2 quart casserole.
4. Sprinkle with raisins if desired. Pour batter on top of bread.
5. Bake at 350 degrees F for 45 to 50 minutes or until set. Serve warm.
15.
16. Making Stuff from Instructions
Instructions Printed Final
Template à Instructions à Product
17. Making Stuff from Instructions
Instructions Printed Final
Template à Instructions à Product
DNA à RNA à Protein
34. Reading Frame
[A] way of breaking a sequence of nucleotides
in DNA or RNA into three letter codons which
can be translated in amino acids.
There are 3 possible reading frames in an mRNA
strand: each reading frame corresponding to
starting at a different alignment.
http://en.wikipedia.org/
wiki/Reading_frame
62. Class Activity
DNA: 7 people
RNA polymerase: 1 person
mRNA: 7 people
tRNA: 3 people
Ribosome: 1 person
Amino Acids: 3 people
63. Mutations
…changes in a genomic sequence: the DNA
sequence of a cell's genome or the DNA or RNA
sequence of a virus.
Mutations are caused by radiation, viruses,
transposons and mutagenic chemicals, as well
as errors that occur during meiosis or DNA
replication.
http://en.wikipedia.org/
wiki/Mutation
64. Some Mutations
are like copying errors.
are like copying errors.
are like copying errors.
are like copying errors.
are like capying errors.
are like capying errers.
are like capying errers.
are like capying errers.
68. Kinds of Mutations
Substatution
exchange of a single nucleotide fur another
Insaertion
addition of one or moare extra nucleotides
Dletion
removal of one or mre nucleotides
77. Frameshift Mutation
[A] genetic mutation caused by insertions
or deletions of a number of nucleotides that
is not evenly divisible by three from a DNA
sequence. Due to the triplet nature of gene
expression by codons, the insertion or
deletion can change the reading frame (the
grouping of the codons), resulting in a
completely different translation from the
original.
http://en.wikipedia.org/wiki/Frameshift_mutation
78. A genetic mutation caused by
insertions or deletions of a
number of nucleotides that is
not evenly divisible by three
from a DNA sequence.
79. e neticmu tationca usedby
insertionsor deletionsof anu
mberof nucleotidesth atis
notev enlydi visibleby threefr
oma DNAse quence.
83. What kind of mutation is this?
• • •GCAACUGAUGCCAGCUCGGUCAAUAG
• • •GCAACUGAUGCCAGUCGGUCAAUAGC
84. What kind of mutation is this?
• • •GCAACUGAUGCCAGCUCGGUCAAUAG
[
[
[
[
[
[
Met Pro Ala Arg Ser Ile
• • •GCAACUGAUGCCAGUCGGUCAAUAGC
[
[
[
[
[
[
Met Pro Val Gly Pro stop
85. What kind of mutation is this?
• • •GCAACUGAUGCCAGCUCGGUCAAUAG
• • •GCAACUGAUGCCGGCUCGGUCAAUAG
86. What kind of mutation is this?
• • •GCAACUGAUGCCAGCUCGGUCAAUAG
[
[
[
[
[
[
Met Pro Ala Arg Ser Ile
• • •GCAACUGAUGCCGGCUCGGUCAAUAG
[
[
[
[
[
[
Met Pro Ala Arg Ser Ile
87. What kind of mutation is this?
• • •GCAACUGAUGCCAGCUCGGUCAAUAG
• • •GCAACUGAUGCCAACUCGGUCAAUAG
88. What kind of mutation is this?
• • •GCAACUGAUGCCAGCUCGGUCAAUAG
[
[
[
[
[
[
Met Pro Ala Arg Ser Ile
• • •GCAACUGAUGCCAACUCGGUCAAUAG
[
[
[
[
[
[
Met Pro Thr Arg Ser Ile
89. Bread Pudding
2 cups whole milk (or 2 cups half & half)
1/4 cup butter
2/3 cup brown sugar (light or dark, depending on taste preference)
3 eggs
2 teaspoons cinnamon
1/4 teaspoon ground nutmeg
1 teaspoon orange extract
3 cups bread, torn into small pieces (french bread works best)
1/2 cup raisins (optional)
1. In medium saucepan, over medium heat, heat milk (or half & half) just until film forms
over top. Combine butter and milk, stirring until butter is melted. Cool to lukewarm.
2. Combine sugar, eggs, cinnamon, nutmeg, and vanilla. Beat with an electric mixer at
93. in a long DNA sequence
AGGTCAGGCTTGCACTACTGCCGTCTATCG
ATCGCAACTGATGCCAGCTCGGTCAATAG
GCTGAACTGTTCAAGGCTCAGTCGAGTAC
• • •CCTACTGGGTGCCAAGGGTCATGATGA
• • •TTGAAACTGGTGCCAAGGGTCATGAUG