SlideShare a Scribd company logo
1 of 24
2006-2007Regents Biology
Genetic Engineering
Biotechnology
Regents Biology
We have been manipulating DNA
for generations!
 Artificial breeding
 creating new breeds of animals & new
crop plants to improve our food
Regents Biology
Animal breeding
Regents Biology
Breeding food plants
 “Descendants” of the wild mustard
 the “Cabbage family”
Regents Biology
Breeding food plants
Evolution of modern corn (right) from
ancestral teosinte (left).
Regents Biology
A Brave New World
Regents Biology
The code is universal
 Since all living
organisms…
 use the same DNA
 use the same code
book
 read their genes
the same way
Regents Biology
TACGCACATTTACGTACGCGGATGCCGCGACTATGATC
ACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACT
CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC
GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA
CTAGCTACTGACTCATGATCCAGATCACTGAAACCCTA
GATCGGGTACCTATTACAGTACGATCATCCGATCAGAT
CATGCTAGTACATCGATCGATACTGCTACTGATCTAGC
TCAATCAAACTCTTTTTGCATCATGATACTAGACTAGC
TGACTGATCATGACTCTGATCCCGTAGATCGGGTACCT
ATTACAGTACGATCATCCGATCAGATCATGCTAGTACA
TCGATCGATACTGCTACTGATCTAGCTCAATCAAACTC
TTTTTGCATCATGATACTAGACTAGCTGACTGATCATG
ACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGA
TCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome
3.2 billion bases
Regents Biology
Can we mix genes from one creature
to another?
YES!
Regents Biology
Mixing genes for medicine…
 Allowing organisms to produce new
proteins
 bacteria producing human insulin
 bacteria producing human growth hormone
Regents Biology
How do we do mix genes?
 Genetic engineering
 find gene
 cut DNA in both organisms
 paste gene from one creature into other
creature’s DNA
 insert new chromosome into organism
 organism copies new gene as if it were its
own
 organism reads gene as if it were its own
 organism produces NEW protein:
Remember: we all use the same genetic code!
Regents Biology
Cutting DNA
 DNA “scissors”
 enzymes that cut DNA
 restriction enzymes
 used by bacteria to cut up DNA of
attacking viruses
 EcoRI, HindIII, BamHI
 cut DNA at specific sites
 enzymes look for specific base sequences
GTAACGAATTCACGCTT
CATTGCTTAAGTGCGAA
GTAACG|AATTCACGCTT
CATTGCTTAA|GTGCGAA
Regents Biology
Restriction enzymes
 Cut DNA at specific sites
 leave “sticky ends”
GTAACG AATTCACGCTT
CATTGCTTAA GTGCGAA
GTAACGAATTCACGCTT
CATTGCTTAAGTGCGAA
restriction enzyme cut site
restriction enzyme cut site
Regents Biology
Sticky ends
 Cut other DNA with same enzymes
 leave “sticky ends” on both
 can glue DNA together at “sticky ends”
GTAACG AATTCACGCTT
CATTGCTTAA GTGCGAA
gene
you want
GGACCTG AATTCCGGATA
CCTGGACTTAA GGCCTAT
chromosome
want to add
gene to
GGACCTG AATTCACGCTT
CCTGGACTTAA GTGCGAA
combined
DNA
Regents Biology
Sticky ends help glue genes together
TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT
AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA
gene you want cut sitescut sites
AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT
TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA
chromosome want to add gene tocut sites
AATTCTACGAATGGTTACATCGCCG
GATGCTTACCAATGTAGCGGCTTAA isolated gene
sticky ends
chromosome with new gene added
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC
CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
sticky ends stick together
DNA ligase joins the strands Recombinant DNA molecule
Regents Biology
Why mix genes together?
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC
CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
 Gene produces protein in different
organism or different individual
aa aaaa aa aa aa aa aa aa aa
“new” protein from organism ex: human insulin from bacteria
human insulin gene in bacteria
bacteria human insulin
How can
bacteria read
human DNA?
Regents Biology
Uses of genetic engineering
 Genetically modified organisms (GMO)
 enabling plants to produce new proteins
 Protect crops from insects: BT corn
 corn produces a bacterial toxin that kills corn
borer (caterpillar pest of corn)
 Extend growing season: fishberries
 strawberries with an anti-freezing gene from
flounder
 Improve quality of food: golden rice
 rice producing vitamin A
improves nutritional value
Regents Biology
Bacteria
 Bacteria are great!
 one-celled organisms
 reproduce by mitosis
 easy to grow, fast to grow
 generation every ~20 minutes
Regents Biology
Bacterial DNA
 Single circular chromosome
 only one copy = haploid
 no nucleus
 Other DNA = plasmids!
bacteria
chromosome
plasmids
Regents Biology
There’s more…
 Plasmids
 small extra circles of DNA
 carry extra genes that bacteria can use
 can be swapped between bacteria
 bacterial sex!!
 rapid evolution = antibiotic resistance
 can be picked up
from environment
Regents Biology
How can plasmids help us?
 A way to get genes into bacteria easily
 insert new gene into plasmid
 insert plasmid into bacteria = vector
 bacteria now expresses new gene
 bacteria make new protein
+
transformed
bacteriagene from
other organism
plasmid
cut DNA
recombinant
plasmid
vector
glue DNA
Regents Biology
Grow bacteria…make more
grow
bacteria
harvest (purify)
protein
transformed
bacteria
plasmid
gene from
other organism
+
recombinant
plasmid
vector
Regents Biology
Applications of biotechnology
2006-2007Regents Biology
I’m a very special pig!
Got any Questions?

More Related Content

What's hot

Oyster Hemocytes - NSA 2009
Oyster Hemocytes - NSA 2009Oyster Hemocytes - NSA 2009
Oyster Hemocytes - NSA 2009
sr320
 
P glo bacterial
P glo bacterialP glo bacterial
P glo bacterial
José Cruz
 
Sigma xi 2014 for slides
Sigma xi 2014 for slidesSigma xi 2014 for slides
Sigma xi 2014 for slides
alanjacobsacks
 
Maxwell 16 Interactive Compressed
Maxwell 16  Interactive  CompressedMaxwell 16  Interactive  Compressed
Maxwell 16 Interactive Compressed
shirleyferris
 
Maxwell 16 Interactive Compressed
Maxwell 16 Interactive CompressedMaxwell 16 Interactive Compressed
Maxwell 16 Interactive Compressed
ryanvogt
 
Molmed testing
Molmed testingMolmed testing
Molmed testing
Isaac
 

What's hot (20)

Oyster Hemocytes - NSA 2009
Oyster Hemocytes - NSA 2009Oyster Hemocytes - NSA 2009
Oyster Hemocytes - NSA 2009
 
Antibody Structure
Antibody StructureAntibody Structure
Antibody Structure
 
Paragraph 7 rise
Paragraph 7 riseParagraph 7 rise
Paragraph 7 rise
 
Sofia 19.06.2011 bio math
Sofia 19.06.2011   bio mathSofia 19.06.2011   bio math
Sofia 19.06.2011 bio math
 
Poster
PosterPoster
Poster
 
P glo bacterial
P glo bacterialP glo bacterial
P glo bacterial
 
Sigma xi 2014 for slides
Sigma xi 2014 for slidesSigma xi 2014 for slides
Sigma xi 2014 for slides
 
PhD Abstract
PhD AbstractPhD Abstract
PhD Abstract
 
Plegable christian
Plegable christianPlegable christian
Plegable christian
 
Maxwell 16 Interactive Compressed
Maxwell 16  Interactive  CompressedMaxwell 16  Interactive  Compressed
Maxwell 16 Interactive Compressed
 
Maxwell 16 Interactive Compressed
Maxwell 16 Interactive CompressedMaxwell 16 Interactive Compressed
Maxwell 16 Interactive Compressed
 
Genemutationsppt 111110091801-phpapp01
Genemutationsppt 111110091801-phpapp01Genemutationsppt 111110091801-phpapp01
Genemutationsppt 111110091801-phpapp01
 
IGEM poster
IGEM posterIGEM poster
IGEM poster
 
GKA deel 2 college 2
GKA deel 2 college 2GKA deel 2 college 2
GKA deel 2 college 2
 
Molmed testing
Molmed testingMolmed testing
Molmed testing
 
Grant Proposal 2006
Grant Proposal 2006Grant Proposal 2006
Grant Proposal 2006
 
Anti 17 beta-testosterone polyclonal antibody
Anti 17 beta-testosterone polyclonal antibodyAnti 17 beta-testosterone polyclonal antibody
Anti 17 beta-testosterone polyclonal antibody
 
Zymoseptoria Community meeting Kiel 2017 - Daniel Croll
Zymoseptoria Community meeting Kiel 2017 - Daniel CrollZymoseptoria Community meeting Kiel 2017 - Daniel Croll
Zymoseptoria Community meeting Kiel 2017 - Daniel Croll
 
Transgenic animals
Transgenic animalsTransgenic animals
Transgenic animals
 
Transcription in eukaryotes
Transcription in eukaryotesTranscription in eukaryotes
Transcription in eukaryotes
 

Viewers also liked

Viewers also liked (16)

Stem cells kl
Stem cells klStem cells kl
Stem cells kl
 
12.1 notes dna the genetic material
12.1 notes  dna the genetic material12.1 notes  dna the genetic material
12.1 notes dna the genetic material
 
12.3 dna, rna, and protein
12.3  dna, rna, and protein12.3  dna, rna, and protein
12.3 dna, rna, and protein
 
11.1 Basic Patterns of Inheritance
11.1 Basic Patterns of Inheritance11.1 Basic Patterns of Inheritance
11.1 Basic Patterns of Inheritance
 
11.2 & 11.3 Complex Patterns of Inheritance
11.2 & 11.3 Complex Patterns of Inheritance11.2 & 11.3 Complex Patterns of Inheritance
11.2 & 11.3 Complex Patterns of Inheritance
 
Isolating Chromosomes
Isolating ChromosomesIsolating Chromosomes
Isolating Chromosomes
 
10.1 Meiosis 2014
10.1   Meiosis 201410.1   Meiosis 2014
10.1 Meiosis 2014
 
10.2 classical genetics ppt
10.2 classical genetics ppt10.2 classical genetics ppt
10.2 classical genetics ppt
 
19 lecture viruses
19 lecture viruses19 lecture viruses
19 lecture viruses
 
Enz Kinetics
Enz  KineticsEnz  Kinetics
Enz Kinetics
 
Antidepressants
AntidepressantsAntidepressants
Antidepressants
 
DNA Extraction
DNA ExtractionDNA Extraction
DNA Extraction
 
Introduction to biotechnology
Introduction to biotechnologyIntroduction to biotechnology
Introduction to biotechnology
 
Biotechnology
BiotechnologyBiotechnology
Biotechnology
 
Pedigree charts
Pedigree chartsPedigree charts
Pedigree charts
 
Biotechnology: Process and Application
Biotechnology: Process and ApplicationBiotechnology: Process and Application
Biotechnology: Process and Application
 

Similar to Biotechnology Notes

65 biotechnology2008 1
65 biotechnology2008 165 biotechnology2008 1
65 biotechnology2008 1
sbarkanic
 
Lab2_3_Lecture_DNA_PCR (3).pptx
Lab2_3_Lecture_DNA_PCR (3).pptxLab2_3_Lecture_DNA_PCR (3).pptx
Lab2_3_Lecture_DNA_PCR (3).pptx
karlos64
 
Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5
Osama Barayan
 

Similar to Biotechnology Notes (20)

geneticenginieering.ppt
geneticenginieering.pptgeneticenginieering.ppt
geneticenginieering.ppt
 
geneticengineering.ppt mmmmmmmmmmmmmmmmmmmmmmmmmmmmm
geneticengineering.ppt mmmmmmmmmmmmmmmmmmmmmmmmmmmmmgeneticengineering.ppt mmmmmmmmmmmmmmmmmmmmmmmmmmmmm
geneticengineering.ppt mmmmmmmmmmmmmmmmmmmmmmmmmmmmm
 
geneticengineering.ppt
geneticengineering.pptgeneticengineering.ppt
geneticengineering.ppt
 
65 biotechnology2008 1
65 biotechnology2008 165 biotechnology2008 1
65 biotechnology2008 1
 
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®
Perennial Ryegrass (Lolium perenne L.) Improvement Through Cisgenics®
 
DNA, RNA, and Proteins
DNA, RNA, and ProteinsDNA, RNA, and Proteins
DNA, RNA, and Proteins
 
12.3 dna, rna, and protein
12.3  dna, rna, and protein12.3  dna, rna, and protein
12.3 dna, rna, and protein
 
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
Comparing bacterial isolates - T.Seemann - IMB winter school 2016 - fri 8 jul...
 
ELS - M9 L3 L4 print.pdf
ELS - M9 L3 L4 print.pdfELS - M9 L3 L4 print.pdf
ELS - M9 L3 L4 print.pdf
 
Coding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS eraCoding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS era
 
Central dogma
Central dogmaCentral dogma
Central dogma
 
Lab2_3_Lecture_DNA_PCR (3).pptx
Lab2_3_Lecture_DNA_PCR (3).pptxLab2_3_Lecture_DNA_PCR (3).pptx
Lab2_3_Lecture_DNA_PCR (3).pptx
 
introduction to metagenomics
introduction to metagenomicsintroduction to metagenomics
introduction to metagenomics
 
A Genome Sequence Analysis System Built with Hypertable
A Genome Sequence Analysis System Built with HypertableA Genome Sequence Analysis System Built with Hypertable
A Genome Sequence Analysis System Built with Hypertable
 
Genomics. Shaping the future from the past.
Genomics. Shaping the future from the past.Genomics. Shaping the future from the past.
Genomics. Shaping the future from the past.
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5Practical 7 dna, rna and the flow of genetic information5
Practical 7 dna, rna and the flow of genetic information5
 
Gene cloning
Gene cloningGene cloning
Gene cloning
 
A Genome Sequence Analysis System Built With Hypertable
A Genome Sequence Analysis System Built With HypertableA Genome Sequence Analysis System Built With Hypertable
A Genome Sequence Analysis System Built With Hypertable
 
Computational approaches to study Genetics
Computational approaches to study GeneticsComputational approaches to study Genetics
Computational approaches to study Genetics
 

More from kathy_lambert

8.3 cellular respiration 2014
8.3 cellular respiration 20148.3 cellular respiration 2014
8.3 cellular respiration 2014
kathy_lambert
 

More from kathy_lambert (17)

Unit 3 ch 7.3 cell organelles
Unit 3  ch 7.3 cell organellesUnit 3  ch 7.3 cell organelles
Unit 3 ch 7.3 cell organelles
 
7.1 cell discovery and theory
7.1 cell discovery and theory 7.1 cell discovery and theory
7.1 cell discovery and theory
 
6.4 organic compounds notes(teacher)for slideshare
6.4 organic compounds notes(teacher)for slideshare6.4 organic compounds notes(teacher)for slideshare
6.4 organic compounds notes(teacher)for slideshare
 
6.3 Acids and Bases
6.3 Acids and Bases6.3 Acids and Bases
6.3 Acids and Bases
 
6.3 Water and Solutions
6.3 Water and Solutions6.3 Water and Solutions
6.3 Water and Solutions
 
6.2 Chemical Reactions
6.2 Chemical Reactions6.2 Chemical Reactions
6.2 Chemical Reactions
 
Biochemistry--6.1 Basic Chemistry
Biochemistry--6.1 Basic ChemistryBiochemistry--6.1 Basic Chemistry
Biochemistry--6.1 Basic Chemistry
 
17.3 Domains and Kingdoms
17.3 Domains and Kingdoms17.3 Domains and Kingdoms
17.3 Domains and Kingdoms
 
17.2 Modern Classification
17.2 Modern Classification17.2 Modern Classification
17.2 Modern Classification
 
17.1 The History of Classification
17.1 The History of Classification17.1 The History of Classification
17.1 The History of Classification
 
Chapter 15.3 shaping evolutionary theory
Chapter 15.3 shaping evolutionary theoryChapter 15.3 shaping evolutionary theory
Chapter 15.3 shaping evolutionary theory
 
Chapter 15.2 evidence of evolution
Chapter 15.2 evidence of evolutionChapter 15.2 evidence of evolution
Chapter 15.2 evidence of evolution
 
Chapter 15.1 Darwin's Theory of Natural Selection
Chapter 15.1 Darwin's Theory of Natural SelectionChapter 15.1 Darwin's Theory of Natural Selection
Chapter 15.1 Darwin's Theory of Natural Selection
 
Unit 7 History of Life Notes
Unit 7 History of Life NotesUnit 7 History of Life Notes
Unit 7 History of Life Notes
 
12.2 replication of dna
12.2 replication of dna12.2 replication of dna
12.2 replication of dna
 
Cell cycle and mitosis 2014
Cell cycle and mitosis 2014Cell cycle and mitosis 2014
Cell cycle and mitosis 2014
 
8.3 cellular respiration 2014
8.3 cellular respiration 20148.3 cellular respiration 2014
8.3 cellular respiration 2014
 

Recently uploaded

Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
ZurliaSoop
 
Spellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please PractiseSpellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please Practise
AnaAcapella
 
The basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptxThe basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptx
heathfieldcps1
 

Recently uploaded (20)

Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
Python Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxPython Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docx
 
FSB Advising Checklist - Orientation 2024
FSB Advising Checklist - Orientation 2024FSB Advising Checklist - Orientation 2024
FSB Advising Checklist - Orientation 2024
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
 
REMIFENTANIL: An Ultra short acting opioid.pptx
REMIFENTANIL: An Ultra short acting opioid.pptxREMIFENTANIL: An Ultra short acting opioid.pptx
REMIFENTANIL: An Ultra short acting opioid.pptx
 
Jamworks pilot and AI at Jisc (20/03/2024)
Jamworks pilot and AI at Jisc (20/03/2024)Jamworks pilot and AI at Jisc (20/03/2024)
Jamworks pilot and AI at Jisc (20/03/2024)
 
Wellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxWellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptx
 
Understanding Accommodations and Modifications
Understanding  Accommodations and ModificationsUnderstanding  Accommodations and Modifications
Understanding Accommodations and Modifications
 
How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17
 
How to setup Pycharm environment for Odoo 17.pptx
How to setup Pycharm environment for Odoo 17.pptxHow to setup Pycharm environment for Odoo 17.pptx
How to setup Pycharm environment for Odoo 17.pptx
 
Spellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please PractiseSpellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please Practise
 
The basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptxThe basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptx
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptx
 
How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17
 
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptxHMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
 
Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptx
 
Graduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - EnglishGraduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - English
 
Spatium Project Simulation student brief
Spatium Project Simulation student briefSpatium Project Simulation student brief
Spatium Project Simulation student brief
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 

Biotechnology Notes

Editor's Notes

  1. Strong evidence for a single origin in evolutionary theory.
  2. For example, a transgenic rice plant has been developed that produces yellow grains containing beta-carotene. Humans use beta-carotene to make vitamin A. Currently, 70% of children under the age of 5 in Southeast Asia are deficient in vitamin A, leading to vision impairment and increased disease rates.
  3. Mini-chromosomes