More Related Content Similar to Weiland Meyer - Algae, Protists & Fungi Plenary Similar to Weiland Meyer - Algae, Protists & Fungi Plenary (20) More from Consortium for the Barcode of Life (CBOL) More from Consortium for the Barcode of Life (CBOL) (20) Weiland Meyer - Algae, Protists & Fungi Plenary1. An update on DNA barcoding of human pathogenic fungi Meyer, W 1 , Serena, C 1 , Firacative, C 1 , Kröger, B 1 , Arabatzis, M 2 , Robert, V 3 , de Hoog, S 3 , Balajee, A 4 , Velegrak, A 2 1 Molecular Mycology Research Laboratory, Sydney Medical School – Westmead, University of Sydney, Westmead Millennium Institute, Westmead Hospital, Westmead, NSW, Australia 2 Medical School, University of Athens, Athens, Greece 3 CBS-Fungal Biodiversity Center, 3508 AD Utrecht, The Netherlands 4 Mycotic Diseases Branch, Centers for Disease Control and Prevention, Atlanta, GA, USA E-mail: w.meyer@usyd.edu.au © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 4. COX1 Alternative loci: ITS1/2 region D1/D2 LSU rDNA gene Histone spacer TUB ACT Elongation Factor AFTOL genes: RNA polymerase genes RPB1 RPB2 A DNA Barcode for fungi? © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 does not work for many fungi used since the 1990’s 5. LSU data show coinciding similarities among species! ACT1 data resolved all investigated species! LSU, COX1, RPB1 and RPB2, ACT1 © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 6. The International Sub-commission on Fungal Barcoding has proposed the ITS region as the prime fungal barcode or the default region for species identification ( http://www.allfungi.com/its-barcode.php ). Fungal specific primers: SR6R: 5’ AAGTATAAGTCGTAACAAGG 3’ LR1: 5’ GGTTGGTTTCTTTCCT 3’ [Vilgalys & Hesters (1990) J. of Bacteriol. 20: 4238-4246] © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 9. 3573 5667 1 23 10 13.1.2009 3863 Fungal Barcodes 4.8.2010 6047 Fungal Barcodes 13.4.2011 7813 Fungal Barcodes 29.11.2011 9274 Fungal Barcodes © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 10. If medical fungi are blasted: e.g. Candida albicans no results !!!!!! www.boldsystems.org ITS1/2 region © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 13. New Quality controlled ITS sequence database at the Molecular Mycology Research Laboratory at: http://www.mycologylab.org/BioloMICSID.aspx 1 2 3 4 5 6 7 8 © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 18. Major outcomes of the first meeting of the working group: TIMM5 2-5.10.2011 Valencia, Spain University of Aix Marseille University of Sydney CBS Institute Pasteur Paris Others Joined ITS Database for Human/Animal Pathogenic Fungi BOLD Genbank Incorporating Sequence & MALDI-TOF MS data Next Meeting at 18 Th ISHAM Congress 11-15.6.2012 in Berlin German © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 19. Sequence based ID currently based on a cut-off point of 98-99% similarity with the type culture of the species in question. However, population based studies showed that the sequences variation in clinical samples is much higher as those type culture dependent cut-off values. © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 20. Molecular species borders currently undefined! Currently type culture based cut off point: 99% Carolina Serena/Wieland Meyer Type Culture Based Cut-Off Point: 98-99% Clinical sample based cut-off value: 91.5% similarity © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 21. ITS works well ITS not variable enough ITS variable within species Sybren de Hoog © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 Raises the question: Is the ITS region the best barcode for fungi? 23. Should we continue with the genes that we are currently using ? Robert et al. 2011 © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 For fungal ID most likely a combination of genes is needed 28. Application of DNA barcoding Longitudinal studies of Airway Colonization in Cystic Fibrosis patients and influence on disease progression microbiome studies via next-generation sequencing of sequential sputum samples © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 29. Acknowledgements Molecular Mycology Research Laboratory, University of Sydney, Sydney Medical School – Westmead Hospital Carolina Firacative, Benjamin Kröger, Carolina Serena, Heide-Marie Daniel, Krystyna Maszewska, Matthew Huynh, Clement Kin Ming Tsui, Nathalie van de Wiele, Sharon Chen, Wieland Meyer Centre for Infectious Disease and Microbiology, Westmead Hospital Fanrong Kong, Ying Sun, Catriona Halliday, Xianyu Zeng, Guy Porter, Ok-Cha Lee, Tania Sorrell CBS-Fungal Biodiversity Center, Utrecht, The Netherlands BioAware, Hannut, Belgium Vincent Robert Mycology Reference Laboratory, Department of Microbiology, Medical School, University of Athens, Athens, Greece Aristea Velegraki, Michael Arabatzis NIH, NCBI, Genbank, Bethesda MD, USA Conrad Schoch, John Spouge LifeTech , USA Elena Bolchacova # 352303 to WM APP1031952 Funding: EC- FP7-228310; Sloan Foundation to VR © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 Editor's Notes A huge amount of ITS sequences are available in the public database GenBank. But the inaccuracy of GenBank ITS is a known problem, with many sequences containing mistakes as a result of experimental errors, misidentification or exchange of cultures and a limited taxonomic coverage.