Prostate cancer (PCa) is an internationally important health problem of the man, particularly in developed countries. The aim of this exploratory study was to evaluate whether significant changes in the levels of zinc (Zn) and some other trace elements of prostatic fluid exist in the malignantly transformed prostate. Methods: Prostatic fluid levels of Br, Fe, Rb, Sr, and Zn were prospectively evaluated in 24 patients with PCa and 38 healthy male inhabitants. Measurements were performed using 109Cd radionuclide-induced energy dispersive X-ray fluorescent microanalysis. Prostatic fluid samples were divided into two portions. One was used for morphological study while the other was intended for trace element analysis.
Study of Glutathione Peroxidase GPX Activity Among Betel Quid Chewers of Indi...ijtsrd
"Introduction Betel quid BQ chewing, a habit practiced in Eastern and North Eastern part of India, has known to be associated with cancer of the oral or buccal cavity. BQ is also one of the common mood elevating substances among Indian population. The BQ is a mixture of areca nut Areca catechu , catechu Acacia catechu and slaked lime calcium oxide and calcium hydroxide wrapped in a betel leaf Piper betel .BQ products have been classified by the International Agency for Research on Cancer IARC as group I human carcinogens . Glutathione peroxidise GPx , one of the major enzymatic antioxidant defence system, responsible for scavenging free radicals. Antioxidant enzymes catalyze decomposition of ROS. Overall balance between production and removal of ROS may be more important in various cancers including OSCC Oral squamous cell carcinoma or oral cancer. Methods In this study subjects were screened from Department of Oral and Maxillofacial surgery andE.N.T. of Ramakrishna Mission Seva Pratishthan Hospital RKMSP , Kolkata and different areas of West Bengal and North Eastern states of India. Quantitative in vitro determination of glutathione peroxidase activities in whole blood were estimated manually with 0.05 ml whole blood. The samples were assayed by UV Visible Spectrophotometer SPECORD 50 PLUS at a wavelength of 340nm. Results Most of the subjects had betel quid chewing habit. Glutathione peroxidase values are higher in healthy control than Cancer cases and Pre cancer with betel quid chewing habit, which is statistically significant. Conclusion Reactive oxygen species are generated due to slaked lime, one of the important constituents of betel quid which can modulate the oral pathology and promote carcinogenesis. Aniket Adhikari | Madhusnata De ""Study of Glutathione Peroxidase (GPX) Activity Among Betel Quid Chewers of Indian Population"" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-3 , April 2019, URL: https://www.ijtsrd.com/papers/ijtsrd21619.pdf
Paper URL: https://www.ijtsrd.com/biological-science/biochemistry/21619/study-of-glutathione-peroxidase-gpx-activity-among-betel-quid-chewers-of-indian-population/aniket-adhikari"
ABSTRACT- The study was conducted to assess DNA damage in peripheral blood lymphocytes of cancer patients put on radiotherapy, medical workers occupationally exposed to ionizing radiations and control group of normal healthy individuals. The blood samples were collected from 20 cancer patients undergoing radiotherapy in Government Rajindra hospital, Patiala, 16 medical workers from Radiology and Radiotherapy department of Government Rajindra hospital, Mata Kaushalya hospital, T.B. hospital, Patiala and 10 normal healthy individuals from Punjabi University, Patiala, India. The DNA damage was evaluated by using alkaline COMET assay, the damage was assessed from two COMET parameters i.e. mean COMET tail length and frequency of cells showing migration. It was found that all the cancer patients undergoing radiotherapy as well as the medical workers, who were occupationally exposed to ionizing radiations for variable period of time showed DNA damage, whereas none of the control subjects showed any damage. The comparison of DNA damage between the cancer patients and medical workers revealed highly significant differences. On the basis of results obtained, it could be said that the exposure to acute high doses of radiations cause greater DNA damage in comparison to chronic low doses of radiations.
Key-words- Single cell gel electrophoresis, Micronuclei, Thermoluminescent dosimeter, Aberration
Study of Glutathione Peroxidase GPX Activity Among Betel Quid Chewers of Indi...ijtsrd
"Introduction Betel quid BQ chewing, a habit practiced in Eastern and North Eastern part of India, has known to be associated with cancer of the oral or buccal cavity. BQ is also one of the common mood elevating substances among Indian population. The BQ is a mixture of areca nut Areca catechu , catechu Acacia catechu and slaked lime calcium oxide and calcium hydroxide wrapped in a betel leaf Piper betel .BQ products have been classified by the International Agency for Research on Cancer IARC as group I human carcinogens . Glutathione peroxidise GPx , one of the major enzymatic antioxidant defence system, responsible for scavenging free radicals. Antioxidant enzymes catalyze decomposition of ROS. Overall balance between production and removal of ROS may be more important in various cancers including OSCC Oral squamous cell carcinoma or oral cancer. Methods In this study subjects were screened from Department of Oral and Maxillofacial surgery andE.N.T. of Ramakrishna Mission Seva Pratishthan Hospital RKMSP , Kolkata and different areas of West Bengal and North Eastern states of India. Quantitative in vitro determination of glutathione peroxidase activities in whole blood were estimated manually with 0.05 ml whole blood. The samples were assayed by UV Visible Spectrophotometer SPECORD 50 PLUS at a wavelength of 340nm. Results Most of the subjects had betel quid chewing habit. Glutathione peroxidase values are higher in healthy control than Cancer cases and Pre cancer with betel quid chewing habit, which is statistically significant. Conclusion Reactive oxygen species are generated due to slaked lime, one of the important constituents of betel quid which can modulate the oral pathology and promote carcinogenesis. Aniket Adhikari | Madhusnata De ""Study of Glutathione Peroxidase (GPX) Activity Among Betel Quid Chewers of Indian Population"" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-3 , April 2019, URL: https://www.ijtsrd.com/papers/ijtsrd21619.pdf
Paper URL: https://www.ijtsrd.com/biological-science/biochemistry/21619/study-of-glutathione-peroxidase-gpx-activity-among-betel-quid-chewers-of-indian-population/aniket-adhikari"
ABSTRACT- The study was conducted to assess DNA damage in peripheral blood lymphocytes of cancer patients put on radiotherapy, medical workers occupationally exposed to ionizing radiations and control group of normal healthy individuals. The blood samples were collected from 20 cancer patients undergoing radiotherapy in Government Rajindra hospital, Patiala, 16 medical workers from Radiology and Radiotherapy department of Government Rajindra hospital, Mata Kaushalya hospital, T.B. hospital, Patiala and 10 normal healthy individuals from Punjabi University, Patiala, India. The DNA damage was evaluated by using alkaline COMET assay, the damage was assessed from two COMET parameters i.e. mean COMET tail length and frequency of cells showing migration. It was found that all the cancer patients undergoing radiotherapy as well as the medical workers, who were occupationally exposed to ionizing radiations for variable period of time showed DNA damage, whereas none of the control subjects showed any damage. The comparison of DNA damage between the cancer patients and medical workers revealed highly significant differences. On the basis of results obtained, it could be said that the exposure to acute high doses of radiations cause greater DNA damage in comparison to chronic low doses of radiations.
Key-words- Single cell gel electrophoresis, Micronuclei, Thermoluminescent dosimeter, Aberration
Why Y Chromosome Markers are an Ever Expanding Essential Tool in Sexual Assau...Thermo Fisher Scientific
Why Y Chromosome Markers are an Ever Expanding Essential Tool in Sexual Assault Investigations
Jack Ballantyne, Erin Hanson
National Center for Forensic Science, UCF
Sexual Assault by the numbers*:
60% of sexual assaults are not reported to the police.
97% of rapists never spend a day in jail.
There are an average of 237,868 victims of rape and sexual assault each year.
Every 2 minutes, another American is sexually assaulted.
1 out of every 5 American women have been the victim of an attempted or completed rape in her lifetime.
9 out of 10 rape victims are female.
*Source: Rape, Abuse & Incest National Network (RAINN)
In the US, an estimated 19.3% of women and 1.7% of men have been raped during their lifetimes**
**-CDC Sept 2014
NCFS Evaluation of Quantifiler® Trio / Yfiler® Plus:
Can we improve our analysis of extended interval post coital samples
using the integrated/modular Quantifiler® Trio/Yfiler® Plus system?
Conclusions:
Quantitation System
• Excellent correlation between male quantitation and profile recovery
• Negative quant (threshold based) means negative/unusable Yfiler® Plus kit
• Observed autosomal/Y results consistent with expected based upon quant and F/M ratio
Yfiler® Plus kit
• Sensitive chemistry
• If >100 pg male, most full profiles
• Results obtained with high quantities of background female DNA (up to mg)
• Many ‘Usable profiles’ F/M ranging from 333:1-100,000:1
• Y-STR profiles using YFP can be obtained at least up to 9 days after intercourse
The Effect of Gamma Irradiation on the Radiofrequency Dielectric Dispersion P...theijes
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
A Systematic Review of the Zinc Concentrations in the Prostate Fluid of Norma...asclepiuspdfs
Background: Prostate cancer (PCa) is the most commonly occurring neoplasm in males in many countries and the fourth most commonly occurring cancer overall. Various studies indicate some discrepancies regarding zinc (Zn) levels in prostatic fluid of normal and cancerous glands. Materials and Methods: The present systematic analysis included 25 studies on Zn levels in expressed prostatic fluid (EPF), all of which were published in the years from 1961 to 2018 and selected by searching the databases Scopus, PubMed, MEDLINE, ELSEVIER-EMBASE, Cochrane Library, and the Web of Science. The articles were analyzed, and “Median of Means” and “Range of Means” were used to examine heterogeneity of Zn concentrations in two groups of subjects – apparently healthy men “N” and patients with PCa “C.” Moreover, using the ratios of prostatic fluid Zn in “C” group to prostatic fluid Zn in “N” group (ZnC/ZnN) obtained (or calculated by us) in the reviewed studies, “Median of Means” and “Range of Means” for these ratios were found. The objective analysis was performed on data from the 25 studies, with total 85 subjects in “C” group and more than 900 subjects in “N” group. Results: The range of means of Zn concentration reported in the literature for normal EPF varies widely from 47.1 mg/L to 825 mg/L with a median of means 501 mg/L. The range of means of Zn concentration for EPF of untreated cancerous prostate varies also widely from 34.7 mg/L to 722 mg/L, but median of means is lower – 65.4 mg/L. Thus, the obtained median of means for Zn concentration in normal human prostatic fluid is at least one order of magnitude higher than median of mean values of the element content in EPF of cancerous prostate. In other words, the analysis of 25 studies with discordant data regarding prostatic fluid concentration of Zn demonstrated that there is a significantly diminished concentration of Zn in EPF of PCa patients compared to controls. Conclusions: There is a significant relationship between lowered Zn concentrations in the prostatic fluid and PCa, but because of small sample size and high data heterogeneity, we recommend other primary studies.
A Systematic Review of the Cobalt Content of the Normal Human Prostate Glandasclepiuspdfs
Background: The prostate gland is subject to various disorders. The etiology and pathogenesis of these diseases remain not well understood. Moreover, despite technological advancements, the differential diagnosis of prostate disorders has become progressively more complex and controversial. It was suggested that the cobalt (Co) level in prostatic tissue plays an important role in prostatic carcinogenesis and its measurement may be useful as a cancer biomarker. These suggestions promoted more detailed studies of the Co content in the prostatic tissue of healthy subjects. Materials and Methods: The present study evaluated by systematic analysis the published data for Co content analyzed in prostatic tissue of “normal” glands. This evaluation reviewed 1949 studies, all of which were published in the years from 1921 to 2020 and were located by searching the databases Scopus, PubMed, MEDLINE, ELSEVIER-EMBASE, Cochrane Library, and the Web of Science. The articles were analyzed and “Median of Means” and “Range of Means” were used to examine heterogeneity of the measured Co content in prostates of apparently healthy men. The objective analysis was performed on data from the 23 studies, which included 1207 subjects. Results: It was found that the range of means of prostatic Co content reported in the literature for “normal” gland varies widely from 0.0035 mg/kg to 0.11 mg/kg with median of means 0.0077 mg/kg on a wet mass basis and the level of intraprostatic metal increases with age in adults. Conclusions: Because of small sample size and high data heterogeneity, we recommend other primary studies be performed.
Development and Commercialisation of a Molecular Diagnostic CompanyMalavikaSankararaman
Development and commercialisation of a spin-out molecular diagnostics approach to detect different grades of Prostate Cancer using Fourier Transform Infrared Spectroscopy
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...daranisaha
Liquid Chromatography Tandem Mass Spectrometry
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...eshaasini
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...semualkaira
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...semualkaira
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...semualkaira
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...JohnJulie1
Liquid Chromatography Tandem Mass Spectrometry
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...EditorSara
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...NainaAnon
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation
Why Y Chromosome Markers are an Ever Expanding Essential Tool in Sexual Assau...Thermo Fisher Scientific
Why Y Chromosome Markers are an Ever Expanding Essential Tool in Sexual Assault Investigations
Jack Ballantyne, Erin Hanson
National Center for Forensic Science, UCF
Sexual Assault by the numbers*:
60% of sexual assaults are not reported to the police.
97% of rapists never spend a day in jail.
There are an average of 237,868 victims of rape and sexual assault each year.
Every 2 minutes, another American is sexually assaulted.
1 out of every 5 American women have been the victim of an attempted or completed rape in her lifetime.
9 out of 10 rape victims are female.
*Source: Rape, Abuse & Incest National Network (RAINN)
In the US, an estimated 19.3% of women and 1.7% of men have been raped during their lifetimes**
**-CDC Sept 2014
NCFS Evaluation of Quantifiler® Trio / Yfiler® Plus:
Can we improve our analysis of extended interval post coital samples
using the integrated/modular Quantifiler® Trio/Yfiler® Plus system?
Conclusions:
Quantitation System
• Excellent correlation between male quantitation and profile recovery
• Negative quant (threshold based) means negative/unusable Yfiler® Plus kit
• Observed autosomal/Y results consistent with expected based upon quant and F/M ratio
Yfiler® Plus kit
• Sensitive chemistry
• If >100 pg male, most full profiles
• Results obtained with high quantities of background female DNA (up to mg)
• Many ‘Usable profiles’ F/M ranging from 333:1-100,000:1
• Y-STR profiles using YFP can be obtained at least up to 9 days after intercourse
The Effect of Gamma Irradiation on the Radiofrequency Dielectric Dispersion P...theijes
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
A Systematic Review of the Zinc Concentrations in the Prostate Fluid of Norma...asclepiuspdfs
Background: Prostate cancer (PCa) is the most commonly occurring neoplasm in males in many countries and the fourth most commonly occurring cancer overall. Various studies indicate some discrepancies regarding zinc (Zn) levels in prostatic fluid of normal and cancerous glands. Materials and Methods: The present systematic analysis included 25 studies on Zn levels in expressed prostatic fluid (EPF), all of which were published in the years from 1961 to 2018 and selected by searching the databases Scopus, PubMed, MEDLINE, ELSEVIER-EMBASE, Cochrane Library, and the Web of Science. The articles were analyzed, and “Median of Means” and “Range of Means” were used to examine heterogeneity of Zn concentrations in two groups of subjects – apparently healthy men “N” and patients with PCa “C.” Moreover, using the ratios of prostatic fluid Zn in “C” group to prostatic fluid Zn in “N” group (ZnC/ZnN) obtained (or calculated by us) in the reviewed studies, “Median of Means” and “Range of Means” for these ratios were found. The objective analysis was performed on data from the 25 studies, with total 85 subjects in “C” group and more than 900 subjects in “N” group. Results: The range of means of Zn concentration reported in the literature for normal EPF varies widely from 47.1 mg/L to 825 mg/L with a median of means 501 mg/L. The range of means of Zn concentration for EPF of untreated cancerous prostate varies also widely from 34.7 mg/L to 722 mg/L, but median of means is lower – 65.4 mg/L. Thus, the obtained median of means for Zn concentration in normal human prostatic fluid is at least one order of magnitude higher than median of mean values of the element content in EPF of cancerous prostate. In other words, the analysis of 25 studies with discordant data regarding prostatic fluid concentration of Zn demonstrated that there is a significantly diminished concentration of Zn in EPF of PCa patients compared to controls. Conclusions: There is a significant relationship between lowered Zn concentrations in the prostatic fluid and PCa, but because of small sample size and high data heterogeneity, we recommend other primary studies.
A Systematic Review of the Cobalt Content of the Normal Human Prostate Glandasclepiuspdfs
Background: The prostate gland is subject to various disorders. The etiology and pathogenesis of these diseases remain not well understood. Moreover, despite technological advancements, the differential diagnosis of prostate disorders has become progressively more complex and controversial. It was suggested that the cobalt (Co) level in prostatic tissue plays an important role in prostatic carcinogenesis and its measurement may be useful as a cancer biomarker. These suggestions promoted more detailed studies of the Co content in the prostatic tissue of healthy subjects. Materials and Methods: The present study evaluated by systematic analysis the published data for Co content analyzed in prostatic tissue of “normal” glands. This evaluation reviewed 1949 studies, all of which were published in the years from 1921 to 2020 and were located by searching the databases Scopus, PubMed, MEDLINE, ELSEVIER-EMBASE, Cochrane Library, and the Web of Science. The articles were analyzed and “Median of Means” and “Range of Means” were used to examine heterogeneity of the measured Co content in prostates of apparently healthy men. The objective analysis was performed on data from the 23 studies, which included 1207 subjects. Results: It was found that the range of means of prostatic Co content reported in the literature for “normal” gland varies widely from 0.0035 mg/kg to 0.11 mg/kg with median of means 0.0077 mg/kg on a wet mass basis and the level of intraprostatic metal increases with age in adults. Conclusions: Because of small sample size and high data heterogeneity, we recommend other primary studies be performed.
Development and Commercialisation of a Molecular Diagnostic CompanyMalavikaSankararaman
Development and commercialisation of a spin-out molecular diagnostics approach to detect different grades of Prostate Cancer using Fourier Transform Infrared Spectroscopy
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...daranisaha
Liquid Chromatography Tandem Mass Spectrometry
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...eshaasini
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...semualkaira
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...semualkaira
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...semualkaira
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...JohnJulie1
Liquid Chromatography Tandem Mass Spectrometry
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...EditorSara
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...NainaAnon
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation
Combined Analysis of Micro RNA and Proteomic Profiles and Interactions in Pat...EditorSara
The Liquid Mass System(LMS) includes an Easy nLC1000 (Thermo Fisher) coupled ultra-high resolution mass spectrometer Orbitrap Fusion Lumos (Thermo Fisher) with a Thermo Fisher electrospray source. Each injection is sent to a preset column (Acclaim PepMap C18, 100 μm x 2 cm, Thermo Scientific) for adsorption at a flow rate of 3 L/min. The sample is then sent to the analyzer column (Acclaim PepMap C18, 75 μm x 15 cm, Thermo Scientific) for separation.
Red Blood Cell Lipids, Serum Trace Elements and Immunological Markers in Pros...ijtsrd
Aim In this study, the red cell lipids, serum trace elements and immunological markers in prostatic disease patients attending the Nephrology Department of Abia state University Teaching Hospital Aba were evaluated.METHODOLOGY A total of one hundred and ten 110 adult males aged 40 80years comprising of 60 prostatic disease patients and fifty 50 normal subjects were recruited. The prostatic disease patients comprised of thirty 30 prostatitis, twenty 20 benign prostatic hyperplasia BPH and ten 10 prostate cancer patients. Red cell lipids, trace elements and immunological markers were determined on blood samples collected from the subjects between January 2017 and December 2020.RESULTS Results obtained following analysis indicated a significant increase in red cell total cholesterol, red cell LDL cholesterol, red cell Triglyceride and red cell phospholipids P 0.05 compared to control subjects whereas red cell HDL cholesterol were significantly decreased compared to control subjects P 0.05 serum trace elements copper were significantly decreased in prostatitis and BPH compared to control subjects P 0.05 but no significant decrease in prostate cancer patients compared to control subjects P 0.05 . Serum iron and lead showed no significant difference in prostatic patients compared to control subjects. Serum manganese levels showed significant increase in BPH patients compared to control subjects P 0.05 whereas prostatitis and prostate cancer patients showed no significant decrease P 0.05 compared to control subjects. Globulin concentrations of prostatatic patients did not show significant increase in prostatic disease patients compared to control subjects P 0.05 .CONCLUSION Lipids serves as a promoter of peroxidation, oxidative stress and oxidative damage which has been implicated in many diseases and immunological markers is an evidence of inflammation which is evidence and risk factors in development of prostatic diseases. Agbugba. N. Agnes | Ohaeri. O. Christopher | Ijioma. N. Solomon | R. T. Uroko | Onyeabo Chimaroke | Achi. K. Ngozi | Nwaokorie Ernest A. "Red Blood Cell Lipids, Serum Trace Elements and Immunological Markers in Prostatic Disease Patients: An Investigative Study" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-6 | Issue-2 , February 2022, URL: https://www.ijtsrd.com/papers/ijtsrd49441.pdf Paper URL: https://www.ijtsrd.com/biological-science/biochemistry/49441/red-blood-cell-lipids-serum-trace-elements-and-immunological-markers-in-prostatic-disease-patients-an-investigative-study/agbugba-n-agnes
своевременная диагностика и терапия данного заболевания до сих пор являются нерешенной клинической задачей. По данным на 2011 г., заболе-
ваемость раком простаты в России составила 10,7% (40 тыс. первичных случаев) мужского населения, причем в 60% случаев заболевание диа-
гностировали на поздней (III–IV) стадии, когда неизбежен процесс активного роста и распространения метастазов. Методы анатомической
визуализации при диагностике данного заболевания имеют низкую чувствительность и специфичность. Методы метаболической визуализации,
использующие в качестве маркера простатспецифический антиген (ПСА), также малоэффективны. В качестве маркера для диагностики и
лечения метастатического рака простаты предлагается рассматривать простатспецифический мембранный антиген (ПСМА). За рубежом
проходят клинические испытания наиболее перспективные диагностические радиофармпрепараты на основе малых пептидных молекул, моди-
фицированных мочевиной, которые отличаются наибольшим сродством к ПСМА. Отличительной особенностью этих соединений является их
благоприятная фармакокинетика, высокое и длительное накопление в опухоли и метастазах, быстрое выведение из организма.
Ключевые слова: метастатический рак предстательной железы, простатспецифический мембранный антиген, радиофармпрепараты.
(Для цитирования: Власова О.П., Герман К.Э., Крылов В.В., Петриев В.М., Эпштейн Н.Б. Новые радиофармпрепараты для диагности-
ки и терапии метастатического рака предстательной железы на основе ингибиторов простатспецифического мембранного антигена.
Вестник РАМН. 2015; 70 (3): 360–365. Doi: 10.15690/vramn.v70i3.1334)
Convalescent Plasma and COVID-19: Ancient Therapy Re-emergedasclepiuspdfs
Convalescent plasma has again re-emerged as a therapy during coronavirus disease (COVID-19) outbreaks currently use as a prophylactic or an interventional treatment in infected patients. Convalescent plasma has been used in the 20th century confronting different infectious diseases where there was no other therapy available. Conceivably, this convalescent plasma therapy tends to be proving a game-changing treatment in some COVID-19 patients and could support treatment, in addition to the current interventions before other developed therapies are available for the population.
The Negative Clinical Consequences Due to the Lack of the Elaboration of a Sc...asclepiuspdfs
Until a few years ago, the immune system was considered as responsible for the only defense against microbial infections and other external agents. On the contrary, the immune cells have been proven to be linked not only through cell-cell contact but also by releasing proteins capable of influencing the immune-inflammatory response, the so-called cytokines or interleukins. Moreover, the cytokines have appeared to play not only immune activities but also metabolic and systemic effects influencing the overall biological systems, including the nervous, the endocrine, and the cardiovascular systems, by representing the main endogenous molecules responsible for the maintenance of the unity of the biological life. Therefore, only the systematic clinical consideration of cytokine effects may allow the generation of real future holistic medicine.
The great benefit of blood/blood constitutes therapy is the ability to provide transfusion support for patients with many unique hematologic conditions. For some patients, such as patients with sickle cell disease, thalassemia major, immune hemolytic anemia, anemia of kidney disease, and aplastic anemia may need for this consolidation extends throughout their life. By knowing the alteration mechanisms of these conditions, we can appreciate the stationary, urgency, and the value of the transfused red blood cell (RBC).
Decreasing or Increasing Role of Autologous Stem Cell Transplantation in Mult...asclepiuspdfs
During the past four decades, autologous stem cell transplantation (ASCT) has been the first choice and the standard option for the treatment of newly diagnosed patients with multiple myeloma. The introduction of new agents such as thalidomide, lenalidomide, and bortezomib has led to a clear improvement in basic approach and those agents became the standard of care in the induction phase; however, they were not able to play the role of ASCT in term of progression-free survival and overall survival. Debate continues about the best induction, consolidation, and maintenance taking into account the toxicities of these new agents. The new monoclonal antibody (anti CD38) starts to take its place in the induction setting and it seems to be a promising agent in the high-risk group. Until recently, ASCT is the standard treatment for newly diagnosed patients.
Comparison of the Hypocalcemic Effects of Erythropoietin and U-74389Gasclepiuspdfs
Aim: This study calculated the effects on serum calcium (Ca) levels, after treatment with either of two drugs: The erythropoietin (Epo) and the antioxidant lazaroid (L) drug U-74389G. The calculation was based on the results of two preliminary studies, each one of which estimated the certain influence, after the respective drug usage in an induced ischemia-reperfusion animal experiment. Materials and Methods: The two main experimental endpoints at which the serum Ca levels were evaluated were the 60th reperfusion min (for the Groups A, C, and E) and the 120th reperfusion min (for the Groups B, D, and F). Especially, the Groups A and B were processed without drugs, Groups C and D after Epo administration, whereas Groups E and F after the L administration. Results: The first preliminary study of Epo presented a non-significant hypocalcemic effect by 0.34% ± 0.68% (P = 0.6095). However, the second preliminary study of U-74389G presented a non-significant hypercalcemic effect by 0.14% ± 0.66% (P = 0.8245). These two studies were coevaluated since they came from the same experimental setting. The outcome of the coevaluation was that L is 2.3623042-fold (2.3482723–2.3764196) more hypercalcemic than Epo (P = 0.0000). Conclusions: The antioxidant capacities of U-74389G ascribe 2.3623042-fold more hypercalcemic effects than Epo (P = 0.0000).
The term refractory anemia (RA) may be confusing to those who are not hematologists. RA should be well defined because it means more than what it says. RA is defined as anemia that is not responsive to therapy except transfusion.[1] The term RA is used to rule out those types of anemia with a known cause such as anemia of systemic diseases (liver and kidney) and anemia of inflammation even though they are considered refractory to therapy.[2] RA with cellular or hypercellular bone marrow was formerly used to exclude aplastic anemia.
Management of Immunogenic Heparin-induced Thrombocytopeniaasclepiuspdfs
Immunogenic heparin-induced thrombocytopenia (HIT) is an immune response to heparin associated with significant morbidity and mortality in hospitalized patients if unidentified as soon as possible, due to thromboembolic complications involving both arterial and venous systems. Early diagnoses based on a comprehensive interpretation of clinical and laboratory information improve clinical outcomes. Management principles of strongly suspected HIT should not be delayed for laboratory result confirmation. Treatment strategies have been introduced including new, safe, and effective agents. This review summarizes the clinical therapeutic options for HIT addressing the use of parenteral direct thrombin inhibitors and indirect factor Xa inhibitors as well as the potential non-Vitamin K antagonist oral anticoagulants.
73-year-old woman without any pertinent history was admitted to the hospital due to remittent fever with erythema. She showed itching and linearly arranged erythema on the chest, back, and abdomen [Figure 1a and b]. As she had been taking daily cefditoren pivoxil for the 4 days before her admission, she was diagnosed as having drug-related scratch dermatitis, and the antibiotic treatment was stopped. Her fever remained. Laboratory data showed elevated levels of white blood cells (14,800/μl, normal range 4000–7000) and liver enzymes such as aspartate aminotransferase (AST) 138 IU/L (normal range 5–40), alanine aminotransferase 97 IU/L (normal range 5–35), and ferritin (17469.5 ng/mL, normal range 5–152).
Bone Marrow Histology is a Pathognomonic Clue to Each of the JAK2V617F, MPL,5...asclepiuspdfs
According to the World Health Organization and Clinical Laboratory Molecular and Pathological criteria bone marrow pathology in JAK2V617F mutated trilinear myeloproliferative neoplasm (MPN) patients essential thrombocythemia (ET) and polycythemia vera are indistinguishably featured by clustered medium to large pleomorphic megakaryocytes and increased cellularity (60–90%) due to increased erythropoiesis and megakaryopoiesis. MPL515 mutated ET is the second distinct clonal MPN characterized by thrombocythemia in a normocellular bone marrow showing clustered increased large to giant mature megakaryocytes with staghorn-like hyperlobulated nuclei. Calreticulin (CALR) mutated hypercellular thrombocythemia associated with prefibrotic megakaryocytic, granulocytic myeloproliferation (MGM) recently became the third distinct MPN featured by dense clusters of immature megakaryocytes with cloud-like nuclei. Bone marrow pathology in newly diagnosed MPN patients appears to be a pathognomonic clue for diagnostic differentiation between JAK2V617F mutated trilinear MPN, MPL515 normocellular thrombocythemia, and CALR thrombocythemia with MGM characteristics followed by secondary reticulin fibrosis. Their natural histories clearly differ featured by an increase of erythro/granulopoiesis and cellularity in JAK2V617F, decrease of erythropoiesis and cellularity in MPL515 and increase of dual megakaryo/granulopoiesis and cellularity in CALR mutated MPN.
Helicobacter pylori Frequency in Polycythemia Vera Patients without Dyspeptic...asclepiuspdfs
Introduction: In polycythemia vera (PV) patients, peptic ulcer and gastroduodenal erosions are more common than the general population, but there are insufficient data on the frequency of Helicobacter pylori (HP) and its role in etiopathogenesis. In this study, we aimed to compare the prevalence of HP infection in PV patients without dyspeptic complaints with a healthy control group without dyspeptic complaints. Materials and Methods: Fifty patients with PV without dyspeptic complaints and 50 controls without dyspeptic complaints were enrolled in this study after informed consent obtained. Stool samples of selected patients were analyzed using HP stool antigen test (True Line®). Results: There was surprisingly striking difference between HP prevalence in PV patients without dyspeptic complaints and asymptomatic healthy controls (64% vs. 2%) (P < 0.05). There was no significant relationship found between HP presence and age, gender, treatment modalities, complete blood count, positivity of JAK2 V617F, serum erythropoietin level, and splenomegaly in PV patients (P > 0.05). Conclusion: As the susceptibility of HP infections in PV patients are higher, it is recommended to have close surveillance of these patients by screening HP presence. In addition, when HP positivity is determined, the eradication of HP is essential to prevent possible future gastrointestinal lesions in patients with PV.
Lymphoma of the Tonsil in a Developing Communityasclepiuspdfs
The lymphoma of the tonsil is a rarity. Single case reports have appeared in countries as disparate as China, Greece, India, Japan, and Turkey. Therefore, this paper presents cases found in Nigeria among the Ibo ethnic group. The epidemiological comparisons are deemed to be worthy of documentation such as age ranges and sides of involvement.
Should Metformin Be Continued after Hospital Admission in Patients with Coron...asclepiuspdfs
Background: In most patients with diabetes, guidelines recommend discontinuation of oral anti-diabetic agents. Preliminary data suggest that pre-admission metformin use may have a mortality benefit in patients with coronavirus disease (COVID)-19 admitted to the hospital. Objective: The objective of the study was to review the impact of metformin on morbidity and mortality among hospitalized patients with COVID-19. Methods: Review of English literature by PUBMED search until November 10, 2020. Search terms included diabetes, COVID-19, metformin, retrospective studies, meta-analyses, pertinent reviews, pre-print articles, and consensus guidelines are reviewed.
Clinical Significance of Hypocalcemia in COVID-19asclepiuspdfs
Background: Preliminary data suggest that hypocalcemia is common among patients with COVID-19 admitted to the hospital. Objective: The objective of the study was to examine the clinical significance of hypocalcemia in the setting of COVID-19. Methods: Literature search (PubMed) until August 5, 2020. Search terms include hypocalcemia, COVID-19, mortality, and complications. Retrospective studies are reviewed due to a lack of randomized trials. Results: Prevalence of hypocalcemia among hospitalized patients with COVID-19 ranges from 62% to 78%, depending on the definition of hypocalcemia and patients’ characteristics. In most cases, hypocalcemia is mild to moderate biochemically. Hypocalcemia is a risk factor for hospitalization of patients with COVID-19. In already hospitalized patients, hypocalcemia is significantly associated with increase severity of COVID-19 and its complications, including multiorgan failure, acute respiratory distress syndrome, and death. Hypocalcemia is significantly correlated with inflammatory markers of COVID-19. Causes of hypocalcemia in COVID-19 patients are unclear, but Vitamin D deficiency may be a contributing factor. Conclusion: Hypocalcemia is common in hospitalized patients with COVID-19 and carries unfavorable outcomes. Further studies are needed to examine the causes of hypocalcemia in COVID-19 and to see whether normalization of circulating calcium levels improves prognosis.
Excess of Maternal Transmission of Type 2 Diabetes: Is there a Role of Bioche...asclepiuspdfs
Objective: An excess of maternal transmission of Type 2 diabetes (T2D) has been reported in some populations but not confirmed in other studies. Mitochondrial inheritance has been proposed to explain such excess. In the present paper, we have considered the presence of T2D in the mother and/or in the father in relation to the risk of T2D and to age at onset of the disease in the offspring. The distribution of two genetic polymorphisms involved in glucose metabolism in relation to the presence of T2D in the mother has been also considered. Materials and Methods: Two hundred and seventy-nine participants with T2D were studied in the population of Penne, a small rural town in the eastern side of central Italy. Adenosine deaminase locus 1 (ADA1) and phosphoglucomutase locus 1 (PGM1) phenotypes were determined by starch gel electrophoresis. Statistical analyses were carried out using commercial software (SPSS). Results: The proportion of patients from T2D mothers is much greater as compared to the proportion of the patients from T2D fathers (P < 0.0001). Age at onset of the disease in patients in whom one or both parents are T2D is lower as compared to other patients. The distribution of ADA1 and PGM1 phenotypes in participants with T2D depends on the presence of diabetes in the mother. Conclusions: About the transmission of T2D, our data confirm the high proportion of maternal T2D and show the role of two common biochemical polymorphisms involved in glucose metabolism.
The Effect of Demographic Data and Hemoglobin A 1c on Treatment Outcomes in P...asclepiuspdfs
Objective: Diabetes mellitus, the most common cause of non-traumatic foot amputations, is a life-threatening condition due to its high mortality and morbidity. In our study, we retrospectively evaluated our patients with diabetic foot syndrome in our clinic. Materials and Methods: The demographic data, duration of diabetes, Wagner classification, haemoglobin A 1c (HbA1c) levels, white blood cell, C-reactive protein sedimentation levels, hospital stay, and treatment results were evaluated retrospectively in 14 patients with diabetic foot between January 2017 and December 2018. Results: The mean age of the patients was 62.43 ± 7.7 years. Of the 14 patients, 3 were females and 11 were males. All 14 patients were type 2 diabetes mellitus. When diabetic foot Wagner classification was performed, 6 patients were evaluated as Wagner 2, five patients were Wagner 3, and three patients were evaluated as Wagner 4. Nine patients had complete amputation and 3 had vascular surgery. Conclusion: Although the level of HbA1c is below the target level, the risk of diabetic foot is increased when there is no adequate diabetes mellitus foot training. Inadequate diabetic patient education and hospitalization of patients after infection progress the amputation rate.
Self-efficacy Impact Adherence in Diabetes Mellitusasclepiuspdfs
The aim of the paper is to explore how self-efficacy (SE) is associated with adherence among adults with diabetes mellitus (DM). Methods: The search of electronic databases identified 564 records from 2007 to 2017 on SE and adherence from different perspectives and its effect on adults with DM. Discussions: SE increases the confidence in adults in their self-care behaviors. Non-adherence continues to be a significant barrier to SE. SE and adherence should be informed by an understanding of theoretical frameworks and the individual characteristics. Conclusion: Adherence is likely among adults with better SE to empower them to make valid decisions about their health. Interventions to improve SE should be tailored based on different types of non-adherence such as intentional and unintentional non-adherence. Implications: An intercollaborative professional practice approach is crucial to improve SE and adherence for sound judgment and valid decision-making.
Uncoiling the Tightening Obesity Spiralasclepiuspdfs
While an underweight prevalence was once more than twice that of obesity, now more people are obese than underweight. Obesity is one of the leading causes of preventable death in the world. There are an estimated 2,100,000,000 obese people worldwide and that number is forecast to grow to 51% of the world’s population by 2030. Escalating obesity-related disease costs threaten to bankrupt the world’s health-care systems.
Prevalence of Chronic Kidney disease in Patients with Metabolic Syndrome in S...asclepiuspdfs
Background and Objective: Chronic kidney disease (CKD) which is an increasingly important clinical and public health issue is associated with cardiovascular disease. Epidemiologic studies have also linked metabolic syndrome (MetS) with an increased risk of incident CKD. Therefore, the present study was designed retrospectively to find the prevalence and potential risk factors of CKD in patients with MetS in Saudi Arabia.
Management Of Hypoglycemia In Patients With Type 2 Diabetesasclepiuspdfs
Hypoglycemia is the rate-limiting step of intensive management in patients with diabetes. Lowering one’s A1C to a prescribed target is expected to mitigate one’s risk of developing long- and short-term diabetes-related complications. Several of the less expensive and commonly prescribed glucose lowering agents favored by practitioners result in weight gain, hypoglycemia, and even an increased risk of cardiovascular (CV) mortality. Although achieving a targeted A1C of <7 % is the standard of care, clinicians often fail to evaluate patients for glycemic variability which can increase oxidative stress driving long-term diabetes-related complications including CV death. The use of concentrated insulins and glucagon-like peptide-1 receptor agonists separately or in combination with each other reduces glycemic variability and one’s risk of hypoglycemia. Pharmaceutical agents which allow patients to safely achieve their targeted A1C without weight gain and hypoglycemia should be preferred in patients with type 2 diabetes.
Predictive and Preventive Care: Metabolic Diseasesasclepiuspdfs
South Asians have a very high incidence of ischemic heart disease and stroke. In addition, they also have a very high incidence of metabolic diseases such as prehypertension, hypertension, visceral obesity, metabolic syndrome, prediabetes, type-2 diabetes, and its clinical complications. Currently, there are over 75 million diabetic subjects in India and an equal number of prediabetics. Republic of China has taken over India as the diabetes capital of the world, with over 115 million diabetics. Modern medicine is disease focused and has failed to address the prevention of these chronic diseases. According to the reports from the United Nations (Millennium Development Goals [MDGs], the World Health Organization, Global Health Initiatives, and the non-communicable disease risk task force), obesity has increased by 2-fold and type-2 diabetes by 4-fold worldwide. Experts in this field predict that chances of meeting the MDGs set by the UN members of reducing the incidence of these diseases at 2025 to the level of 2020 are very little. Western medicine has failed to reduce or reverse the trend in the incidence of these diseases. We feel that an integrated approach to health care may be a better option, to reduce the disease burden in developing and resource-poor countries. Having said that, one cannot prevent something that one is not aware of, as such it is the need of the hour for us, to develop a robust predictive and preventive health-care platform. In an earlier article, we presented our views on reducing or reversing cardiometabolic diseases. There is great enthusiasm among the health-care providers and professional bodies that integration of emerging technologies will help develop personalized, precision medicine, as well as reduce the cost of health-care worldwide.
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
Prix Galien International 2024 Forum ProgramLevi Shapiro
June 20, 2024, Prix Galien International and Jerusalem Ethics Forum in ROME. Detailed agenda including panels:
- ADVANCES IN CARDIOLOGY: A NEW PARADIGM IS COMING
- WOMEN’S HEALTH: FERTILITY PRESERVATION
- WHAT’S NEW IN THE TREATMENT OF INFECTIOUS,
ONCOLOGICAL AND INFLAMMATORY SKIN DISEASES?
- ARTIFICIAL INTELLIGENCE AND ETHICS
- GENE THERAPY
- BEYOND BORDERS: GLOBAL INITIATIVES FOR DEMOCRATIZING LIFE SCIENCE TECHNOLOGIES AND PROMOTING ACCESS TO HEALTHCARE
- ETHICAL CHALLENGES IN LIFE SCIENCES
- Prix Galien International Awards Ceremony
Anti ulcer drugs and their Advance pharmacology ||
Anti-ulcer drugs are medications used to prevent and treat ulcers in the stomach and upper part of the small intestine (duodenal ulcers). These ulcers are often caused by an imbalance between stomach acid and the mucosal lining, which protects the stomach lining.
||Scope: Overview of various classes of anti-ulcer drugs, their mechanisms of action, indications, side effects, and clinical considerations.
Ethanol (CH3CH2OH), or beverage alcohol, is a two-carbon alcohol
that is rapidly distributed in the body and brain. Ethanol alters many
neurochemical systems and has rewarding and addictive properties. It
is the oldest recreational drug and likely contributes to more morbidity,
mortality, and public health costs than all illicit drugs combined. The
5th edition of the Diagnostic and Statistical Manual of Mental Disorders
(DSM-5) integrates alcohol abuse and alcohol dependence into a single
disorder called alcohol use disorder (AUD), with mild, moderate,
and severe subclassifications (American Psychiatric Association, 2013).
In the DSM-5, all types of substance abuse and dependence have been
combined into a single substance use disorder (SUD) on a continuum
from mild to severe. A diagnosis of AUD requires that at least two of
the 11 DSM-5 behaviors be present within a 12-month period (mild
AUD: 2–3 criteria; moderate AUD: 4–5 criteria; severe AUD: 6–11 criteria).
The four main behavioral effects of AUD are impaired control over
drinking, negative social consequences, risky use, and altered physiological
effects (tolerance, withdrawal). This chapter presents an overview
of the prevalence and harmful consequences of AUD in the U.S.,
the systemic nature of the disease, neurocircuitry and stages of AUD,
comorbidities, fetal alcohol spectrum disorders, genetic risk factors, and
pharmacotherapies for AUD.
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...VarunMahajani
Disruption of blood supply to lung alveoli due to blockage of one or more pulmonary blood vessels is called as Pulmonary thromboembolism. In this presentation we will discuss its causes, types and its management in depth.
Lung Cancer: Artificial Intelligence, Synergetics, Complex System Analysis, S...Oleg Kshivets
RESULTS: Overall life span (LS) was 2252.1±1742.5 days and cumulative 5-year survival (5YS) reached 73.2%, 10 years – 64.8%, 20 years – 42.5%. 513 LCP lived more than 5 years (LS=3124.6±1525.6 days), 148 LCP – more than 10 years (LS=5054.4±1504.1 days).199 LCP died because of LC (LS=562.7±374.5 days). 5YS of LCP after bi/lobectomies was significantly superior in comparison with LCP after pneumonectomies (78.1% vs.63.7%, P=0.00001 by log-rank test). AT significantly improved 5YS (66.3% vs. 34.8%) (P=0.00000 by log-rank test) only for LCP with N1-2. Cox modeling displayed that 5YS of LCP significantly depended on: phase transition (PT) early-invasive LC in terms of synergetics, PT N0—N12, cell ratio factors (ratio between cancer cells- CC and blood cells subpopulations), G1-3, histology, glucose, AT, blood cell circuit, prothrombin index, heparin tolerance, recalcification time (P=0.000-0.038). Neural networks, genetic algorithm selection and bootstrap simulation revealed relationships between 5YS and PT early-invasive LC (rank=1), PT N0—N12 (rank=2), thrombocytes/CC (3), erythrocytes/CC (4), eosinophils/CC (5), healthy cells/CC (6), lymphocytes/CC (7), segmented neutrophils/CC (8), stick neutrophils/CC (9), monocytes/CC (10); leucocytes/CC (11). Correct prediction of 5YS was 100% by neural networks computing (area under ROC curve=1.0; error=0.0).
CONCLUSIONS: 5YS of LCP after radical procedures significantly depended on: 1) PT early-invasive cancer; 2) PT N0--N12; 3) cell ratio factors; 4) blood cell circuit; 5) biochemical factors; 6) hemostasis system; 7) AT; 8) LC characteristics; 9) LC cell dynamics; 10) surgery type: lobectomy/pneumonectomy; 11) anthropometric data. Optimal diagnosis and treatment strategies for LC are: 1) screening and early detection of LC; 2) availability of experienced thoracic surgeons because of complexity of radical procedures; 3) aggressive en block surgery and adequate lymph node dissection for completeness; 4) precise prediction; 5) adjuvant chemoimmunoradiotherapy for LCP with unfavorable prognosis.
2. Zaichick and Zaichick: Trace elements in prostatic fluid of normal and cancerous prostate
49 Journal of Clinical Research in Oncology • Vol 1 • Issue 1 • 2018
In our previous studies, significant involvement of Zn
and some trace element in the function of prostate was
observed.[17-27]
Moreover, it was found that intracellular Zn
and Ca excess is one of the main factors in the etiology of
PCa.[28,29]
One of the main functions of the prostate gland
is a production of prostatic fluid[30]
with an extremely high
concentration of Zn and some other chemical elements. The
first finding of the remarkable high level of Zn concentration
in human expressed prostatic fluid (EPF) was reported at the
beginning of the 1960s.[31]
Analyzing EPF expressed from
prostate of 8 apparently healthy men aged 25–55 years it
was found that Zn concentration varied in the range from
300 to 730 mg/L. After this finding, several investigators
have suggested that the measurement of Zn level in EPF may
be useful as a marker of prostate secretory function.[32,33]
It
promoted a more detailed study of Zn concentration in EPF
of healthy subjects and those with different prostate diseases,
including PCa.[33,34]
A detailed review of these studies,
reflecting the contradictions within accumulated data, was
given in our earlier publication.[34]
In the present study, it was supposed by us that apart from
Zn the levels of some other trace elements in EPF have to
reflect a functional disintegration of the prostate. Thus, this
work had four aims. The first one was to present the design
of the method and apparatus for microanalysis of Br, Fe,
Rb, Sr, and Zn in the EPF samples using energy dispersive
X-ray fluorescence (EDXRF) with radionuclide source
109
Cd. The second aim was to assess the Br, Fe, Rb, Sr, and
Zn concentration in the EPF samples received from patients
with normal and cancerous prostate gland. The third aim was
to evaluate the quality of the obtained results and to compare
the obtained results with published data. The last aim was
to compare the concentration of Br, Fe, Rb, Sr, and Zn and
intercorrelations of these trace elements in EPF samples of
normal and cancerous prostate gland.
MATERIALS AND METHODS
Specimens of EPF were obtained from 38 men with
apparently normal prostates (mean age ± standard deviation
- 59 ± 11 years and range 41–82 years) and from 24 patients
with PCa (mean age 65 ± 10 years and range 47–77 years)
by qualified urologists in the Urological Department of
the Medical Radiological Research Center using standard
rectal massage procedure. In all cases, the diagnosis has
been confirmed by clinical examination and in cases of
PCa additionally by morphological results obtained during
studies of biopsy and resected materials. Subjects were
asked to abstain from sexual intercourse for 3 days preceding
the procedure. Specimens of EPF were obtained in sterile
containers which were appropriately labeled. Twice 20 μL
of fluid were taken by micropipette from every specimen for
trace element analysis, while the rest of the fluid was used for
cytological and bacteriological investigations. The chosen
20 μL of the EPF was dropped on 11.3 mm diameter disk
made of thin, ash-free filter papers fixed on the Scotch tape
pieces and dried in an desiccator at room temperature. Then,
the dried sample was covered with 4 µm Dacron film and
centrally pulled onto a Plexiglas cylindrical frame [Figure 1].
To determine concentration of the elements by comparison
with a known standard, aliquots of solutions of commercial,
chemically pure compounds were used for device
calibration.[35]
The standard samples for calibration were
prepared in the same way as the samples of prostate fluid.
Since there was no available liquid certified reference
material (CRM), 10 sub-samples of the powdery CRM IAEA
H-4 (animal muscle) were analyzed to estimate the precision
and accuracy of results. Every CRM sub-sample weighing
about 3 mg was applied to the piece of Scotch tape serving
as an adhesive fixing backing. An acrylic stencil made in the
form of a thin-walled cylinder with 11.3 mm inner diameter
was used to apply the sub-sample to the Scotch tape. The
polished-end acrylic pestle which is a constituent of the
stencil set was used for uniform distribution of the sub-
sample within the Scorch surface restricted by stencil inner
diameter. When the sub-sample was slightly pressed to the
Scotch adhesive sample, the stencil was removed. Then, the
sub-sample was covered with 4 µm Dacron film. Before the
sample was applied, pieces of Scotch tape and Dacron film
were weighed using analytical balance. Those were again
weighed together with the sample inside to determine the
sub-sample mass precisely.
The facility for radionuclide-induced EDXRF included an
annular109
Cd source with an activity of 2.56 GBq, Si(Li)
detector with electric cooler and portable multi-channel
analyzer combined with a PC. Its resolution was 270 eV at
the 6.4 keV line. The facility functioned as follows. Photons
with a 22.1 keV 109
Cd energy are sent to the surface of a
Figure 1: The dried samples of prostate fluid on filter paper
disks fixed on the Scotch tape pieces centrally pulled onto a
Plexiglas cylindrical frame
3. Zaichick and Zaichick: Trace elements in prostatic fluid of normal and cancerous prostate
Journal of Clinical Research in Oncology • Vol 1 • Issue 1 • 2018 50
specimen analyzed inducing the fluorescence Kα
X-rays
of trace elements. The fluorescence irradiation got to the
detector through a 10 mm diameter collimator to be recorded.
The duration of the Zn concentration measurement was
10 min. The duration of the Zn concentration measurement
together with Br, Fe, Rb, and Sr was 60 min. The intensity
of Kα
-line of Br, Fe, Rb, Sr, and Zn for EPF samples and
standards was estimated on the calculation basis of the total
area of the corresponding photopeak in the spectra.
All EPF samples for EDXRF were prepared in duplicate and
mean values of trace element contents were used in the final
calculation. Using the Microsoft Office Excel programs, the
summary of statistics, arithmetic mean, standard deviation,
standard error of mean (SΕΜ), minimum and maximum
values, median, and percentiles with 0.025 and 0.975 levels
was calculated for trace element concentrations in EPF of
the normal and cancerous prostate. The difference in the
results between two groups of samples (normal prostate and
PCa) was evaluated by the parametric Student’s t-test and
non-parametric Wilcoxon-Mann–Whitney U-test. For the
estimation of the Pearson correlation coefficient between
different pairs of the trace element concentration in the
prostate fluid of health men and patients with PCa, the
Microsoft Office Excel program was also used.
RESULTS
Table 1 depicts our data for 5 trace elements in 10 sub-
samples of CRM IAEA H-4 (animal muscle) and the certified
values of this material.
Table 2 presents certain statistical parameters (arithmetic
mean, standard deviation, SΕΜ, minimal and maximal
values, median, and percentiles with 0.025 and 0.975 levels)
of the Br, Fe, Rb, Sr, and Zn concentrations in EPF of normal
and cancerous prostate.
The comparison of our results with published data for Br,
Fe, Rb, Sr, and Zn concentrations in EPF of the normal and
cancerous prostate[33,34,36-38]
is shown in Table 3.
The ratios of means and the differences between mean values
of Br, Fe, Rb, Sr, and Zn concentrations in EPF of the normal
and cancerous prostate are presented in Table 4.
Table 5 contains the results of inter-element correlation
calculations (values of r - coefficient of correlation) including
all trace elements identified in this work.
DISCUSSION
Good agreement of the Fe, Zn, Br, Rb, and Sr contents
analyzed by 109
Cd radionuclide-induced EDXRF with the
certified data of CRM IAEA H-4 [Table 2] indicates an
acceptable accuracy of the results obtained in the study of
trace elements of the prostate fluid presented in Tables 2-5.
The mean values and all selected statistical parameters were
calculated for 5 trace elements (Br, Fe, Rb, Sr, and Zn) of
trace element concentrations [Table 2]. The concentrations of
Br, Fe, Rb, Sr, and Zn were measured in all or a major portion
of EPF samples of normal and cancerous prostate.
The mean of Zn concentration obtained for normal prostate
fluid, as shown in Table 3, agrees well with a median of
means cited by other researches.[32,36-38]
The mean of Rb
concentration obtained for EPF agrees well with our data
reported 37 years ago.[33]
No published data referring to Br,
Fe, and Sr concentrations in normal EPF were found.
In the EPF samples of cancerous prostate our results were
comparable with published data for Zn concentrations
[Table 3]. No published data referring to Br, Fe, Rb, and Sr
concentrations in EPF samples obtained from patients with
PCa were found.
A number of values for Zn concentrations in normal EPF
were not expressed on a wet mass basis in the cited literature.
Therefore, we calculated these values using the published
data for water content in EPF - 93.2%.[39]
From Table 4, it is observed that in EPF of the cancerous
prostate the concentrations of Rb and Zn are almost 2
(P 0.00019) and 10 (P 0.000001) times, respectively,
lower than in EPS of normal prostate.
Interelement correlations between trace elements are
significantly altered in EPF of the cancerous prostate as
compared to their relationships in EPF of normal prostate
Table 1: EDXRF data of Br, Fe, Rb, Sr, and Zn
contents in the IAEA H‑4 (animal muscle) reference
material compared to certified values (mg/kg, dry
mass basis)
Element Certified values This work
results
Mean 95% confidence
interval
Type Mean±SD
Fe 49 47–51 C 48±9
Zn 86 83–90 C 90±5
Br 4.1 3.5–4.7 C 5.0±1.2
Rb 18 17–20 C 22±4
Sr 0.1 ‑ N 1
Mean: Arithmetical mean, SD: Standard deviation, C: Certified
values, N: Non‑certified values. EDXRF: Energy dispersive X‑ray
fluorescence, Zn: Zinc
4. Zaichick and Zaichick: Trace elements in prostatic fluid of normal and cancerous prostate
51 Journal of Clinical Research in Oncology • Vol 1 • Issue 1 • 2018
[Table 5]. In EPF of cancerous prostates, some significant
correlations between trace elements found in the EPF
of the control group are no longer evident, but other
correlations arise. For example, in the healthy prostate of
Table 2: Some basic statistical parameters of Br, Fe, Rb, Sr, and Zn concentration (mg/L) in prostate fluid of
health men and patients with PCa
Condition Element Mean SD SEM Min Max Median Per. 0.025 Per. 0.975
Norm Br 2.86 2.93 0.59 0.490 8.53 1.20 0.496 8.53
41–82 years Fe 8.30 7.62 1.42 1.27 39.8 7.33 1.29 23.5
n=38 Rb 1.16 0.52 0.10 0.376 2.45 1.03 0.422 2.38
Sr 1.27 0.84 0.17 0.400 3.44 1.18 0.400 3.22
Zn 598 207 34 253 948 560 278 942
PCa Br 4.51 7.19 2.27 0.697 24.3 2.08 0.704 20.4
47–77 years Fe 21.7 28.8 8.7 7.70 107 13.9 7.70 86.8
n=24 Rb 0.53 0.38 0.11 0.013 1.39 0.422 0.024 1.26
Sr 1.70 2.15 0.76 0.230 6.83 0.872 0.275 5.95
Zn 62.0 98.3 20.1 2.82 371 21.6 3.43 358
M: Arithmetic mean, SD: Standard deviation, SEM: Standard error of mean, Min: Minimum value, Max: Maximum value,
Per.: 0.025: Percentile with 0.025 level, Per: 0.975: Percentile with 0.975 level, DL: Detection limit, PCa: Prostate cancer, Zn: Zinc
Table 3: Median, minimum and maximum value of means of Br, Fe, Rb, Sr, and Zn concentration
(mg/L) in the prostate fluid of health men and patients with PCa according to data from the literature
Condition El Published data [Reference] This workresults
Median of
means (n)*
Minimum of means Mean or
Mean±SD, (n)**
Maximum of means
Mean±SD, (n)**
Mean±SD
Norm Br ‑ ‑ ‑ 2.86±2.93
Fe ‑ ‑ ‑ 8.30±7.62
Rb 2.26 (1) 1.11±0.57 (15) [33] 2.35±1.85 (11) [33] 1.16±0.52
Sr ‑ ‑ ‑ 1.27±0.84
Zn 453 (19) 47.1(‑) [36] 5185±3737 (10) [37] 598±207
PCa Br ‑ ‑ ‑ 4.51±7.19
Fe ‑ ‑ ‑ 21.7±28.8
Rb 1.11 (1) 1.11±0.57 (15) [33] 1.11±0.57 (15) [33] 0.53±0.38
Sr ‑ ‑ ‑ 1.70±2.15
Zn 65.4 (6) 34.7±34.6 (13) [34] 722 (3) [38] 62.0±98.3
El: Element, M: Arithmetic mean, SD: Standard deviation, n*: Number of all references, n**: Number of samples, PCa: Prostate cancer,
Zn: Zinc
Table 4: Comparison of mean values (Mean±SEM) of Br, Fe, Rb, Sr, and Zn concentration (mg/L) in prostate
fluid of health men and patients with PCa
Element Norm and PCa groups Ratios
Norm PCa Student’s t‑test P≤ U‑test* P PCa to Norm
Br 2.86±0.59 4.51±2.27 0.498 0.05 1.58
Fe 8.30±1.42 21.7±8.7 0.157 0.05 2.61
Rb 1.16±0.10 0.53±0.11 0.00019 0.01 0.46
Sr 1.27±0.17 1.70±0.76 0.598 0.05 1.34
Zn 598±34 62.0±20.1 0.000001 0.01 0.104
M: Arithmetic mean, SEM: Standard error of mean, *Wilcoxon‑Mann–Whitney U‑test, Bold: Significant difference (P≤0.05), PCa: Prostate
cancer, Zn: Zinc
5. Zaichick and Zaichick: Trace elements in prostatic fluid of normal and cancerous prostate
Journal of Clinical Research in Oncology • Vol 1 • Issue 1 • 2018 52
men, Zn concentration in EPF has significant (P 0.01)
inverse correlation with Br [Table 5]. Thus, if we accept
the relationships of trace element concentrations in EPF of
males in the control group as a norm, we have to conclude
that with a malignant transformation the relationships
between trace elements in EPF significantly changed.
No published data referring to correlations between trace
elements concentrations in EPF of the normal and cancerous
prostate were found.
The range of means of Zn concentration reported in the
literature for normal EPF (from 47.1 to 5185 mg/L)
and EPF of untreated cancerous prostate (from 34.7 to
722 mg/L) varies widely [Table 3]. This can be explained
by a dependence of Zn content on many factors, including
age, ethnicity, mass of the gland, the cancer stage, and
others. Not all these factors were strictly controlled in
cited studies. Another and, in our opinion, leading cause of
interobserver variability was insufficient quality control of
results in these studies. In many reported that papers EPF
samples were dried at high temperature or acid digestion.
There is evidence that by use of these methods some
quantities of trace elements, including Zn, are lost as a
result of this treatment.[40-42]
Characteristically, elevated or deficient levels of trace
elements and electrolytes observed in EPF of the cancerous
prostate are discussed in terms of their potential role in
the initiation, promotion, or inhibition of PCa. In our
opinion, abnormal levels of many trace elements in EPF of
cancerous prostate could be the consequence of malignant
transformation. Compared to other fluids of the human
body, the prostate secretion has higher levels of Zn and
some other trace elements. These data suggest that these
elements could be involved in the functional features of
the prostate. Malignant transformation is accompanied by a
loss of tissue-specific functional features, which leads to a
significant reduction in the contents of elements associated
with functional characteristics of the human EPF (Zn and,
probably, and Rb).
Our findings show that the concentration of Rb and Zn is
significantly lower in EPF of the cancerous prostate as
compared to their concentrations in EPF of normal prostate
[Table 4]. Thus, it is plausible to assume that levels of
these trace elements in EPF can be used as tumor markers.
However, this subjects needs in additional studies.
This study has several limitations. First, analytical techniques
employed in this study measure only five trace element
(Br, Fe, Rb, Sr, and Zn) concentrations in EPF. Future studies
should be directed toward using other analytical methods
which will extend the list of chemical elements investigated
in EPF of the normal and cancerous prostate. Second, the
sample size of PCa group was relatively small. It was not
allow us to carry out the investigations of trace element
contents in PCa group using differentials such as histological
types of tumors, stage of disease, and dietary habits of healthy
persons and patients with PCa. Despite these limitations,
this study provides evidence on cancer-specific Rb and Zn
level alteration in EPF and shows the necessity the need to
continue chemical element research of EPF in norm and
prostatic diseases.
CONCLUSIONS
In this work, trace elemental measurements were carried
out in the EPF samples of the normal and malignant
prostate using non-destructive instrumental EDXRF micro
method developed by us. It was shown that this method
is an adequate analytical tool for the non-destructive
determination of Br, Fe, Rb, Sr, and Zn concentration in
the EPF samples of human prostate. It was observed that
in the EPF of cancerous prostate contents of Zn and Rb
Table 5: Intercorrelations of pairs of the trace element concentration in the prostate fluid of health men and
patients with PCa (r ‑ coefficient of correlation)
Tissue Element Br Fe Rb Sr Zn
Norm Br 1.0 0.714c
0.178 0.172 −0.535c
41–82 years Fe 0.714c
1.0 0.148 0.410b
−0.241
n=38 Rb 0.178 0.148 1.0 −0.131 −0.097
Sr 0.172 0.410b
−0.131 1.0 0.069
Zn −0.535c
−0.241 −0.097 0.069 1.0
PCa Br 1.0 0.856b
−0.472 0.962c
0.291
47–77 years Fe 0.856b
1.0 0.684a
0.921c
0.314
n=24 Rb −0.472 0.684a
1.0 −0.503 −0.091
Sr 0.962c
0.921c
−0.503 1.0 0.387
Zn 0.291 0.314 −0.091 0.387 1.0
Statistically significant values with: a
P≤0.05, b
P≤0.01, c
P≤0.001. PCa: Prostate cancer
6. Zaichick and Zaichick: Trace elements in prostatic fluid of normal and cancerous prostate
53 Journal of Clinical Research in Oncology • Vol 1 • Issue 1 • 2018
significantly decrease in comparison with those in the
EPF of normal prostate. In our opinion, the decrease
in levels of Zn and Rb in the EPF of cancerous prostate
might demonstrate involvement of these trace elements in
etiology and pathogenesis of malignant prostate tumors. It
was supposed that the changes of Zn and Rb levels in the
EPF samples can be used as tumor markers.
ACKNOWLEDGMENTS
WearegratefultoDrTatyanaSviridova,MedicalRadiological
Research Center, Obninsk for supplying EPF samples.
REFERENCES
1. Kumar RJ, Barqawi AB, Crawford ED. Epidemiology of
Prostate Cancer. Colorado, USA: Business Briefing, US
Oncology Review; 2004. p. 1-6.
2. Maddams J, Brewster D, GavinA, Steward J, Elliott J, Utley M,
et al. Cancer prevalence in the United Kingdom: Estimates for
2008. Br J Cancer 2009;101:541-7.
3. Lutz JM, Francisci S, Mugno E, Usel M, Pompe-Kirn V,
Coebergh JW, et al. Cancer prevalence in central Europe: The
EUROPREVAL study. Ann Oncol 2003;14:313-22.
4. Möller T, Anderson H, Aareleid T, Hakulinen T, Storm H,
Tryggvadottir L, et al. Cancer prevalence in Northern Europe:
The EUROPREVAL study. Ann Oncol 2003;14:946-57.
5. DeAngelis R, Grande E, Inghelmann R, Francisci S, Micheli A,
Baili P, et al. Cancer prevalence estimates in Italy from 1970 to
2010. Tumori 2007;93:392-7.
6. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2017. CA
Cancer J Clin 2017;67:7-30.
7. Rebbeck TR, Haas GP. Temporal trends and racial
disparities in global prostate cancer prevalence. Can J Urol
2014;21:7496-506.
8. Qi D, Wu C, Liu F, Gu K, Shi Z, Lin X, et al. Trends of prostate
cancer incidence and mortality in Shanghai, China from 1973
to 2009. Prostate 2015;75:1662-8.
9. Welch HG, Albertsen PC. Prostate cancer diagnosis and
treatment after the introduction of prostate-specific antigen
screening: 1986-2005. J Natl Cancer Inst 2009;101:1325-9.
10. Aune D, Navarro Rosenblatt DA, Chan DS, Vieira AR,
Vieira R, Greenwood DC, et al. Dairy products, calcium, and
prostate cancer risk: A systematic review and meta-analysis of
cohort studies. Am J Clin Nutr 2015;101:87-117.
11. Gallus S, Foschi R, Negri E, Talamini R, Franceschi S,
Montella M, et al. Dietary zinc and prostate cancer risk:
A case-control study from italy. Eur Urol 2007;52:1052-6.
12. Park SY, Wilkens LR, Morris JS, Henderson BE, Kolonel LN.
Serum zinc and prostate cancer risk in a nested case-control
study: The multiethnic cohort. Prostate 2013;73:261-6.
13. Zaichick V, Zaichick S. Dietary intake of minerals and
prostate cancer: Insights into problem based on the chemical
element contents in the prostate gland. J Aging Res Clin Pract
2015;4:164-71.
14. Zaichick V. Medical elementology as a new scientific
discipline. J Radioanal Nucl Chem 2006;269:303-9.
15. Beyersmann D, Hartwig A. Carcinogenic metal compounds:
Recent insight into molecular and cellular mechanisms. Arch
Toxicol 2008;82:493-512.
16. Martinez-Zamudio R, Ha HC. Environmental epigenetics in
metal exposure. Epigenetics 2011;6:820-7.
17. ZaichickV. INAAand EDXRF applications in the age dynamics
assessment of Zn content and distribution in the normal human
prostate. J Radioanal Nucl Chem 2004;262:229-34.
18. Zaichick V, Zaichick S. The effect of age on Br, Ca, Cl, K, Mg,
Mn, and Na mass fraction in pediatric and young adult prostate
glands investigated by neutron activation analysis. Appl Radiat
Isot 2013;82:145-51.
19. Zaichick V, Zaichick S. INAA application in the assessment
of Ag, Co, Cr, Fe, Hg, Rb, Sb, Sc, Se, and Zn mass fraction
in pediatric and young adult prostate glands. J Radioanal Nucl
Chem 2013;298:1559-66.
20. Zaichick V, Zaichick S. NAA-SLR and ICP-AES application
in the assessment of mass fraction of 19 chemical elements in
pediatric and young adult prostate glands. Biol Trace Elem Res
2013;156:357-66.
21. Zaichick V, Zaichick S. Use of neutron activation analysis
and inductively coupled plasma mass spectrometry for the
determination of trace elements in pediatric and young adult
prostate. Am J Anal Chem 2013;4:696-706.
22. Zaichick V, Zaichick S. Relations of bromine, iron, rubidium,
strontium, and zinc content to morphometric parameters in
pediatric and nonhyperplastic young adult prostate glands. Biol
Trace Elem Res 2014;157:195-204.
23. Zaichick V, Zaichick S. Relations of the neutron activation
analysis data to morphometric parameters in pediatric and
nonhyperplastic young adult prostate glands. Adv Biomed Sci
Eng 2014;1:26-42.
24. Zaichick V, Zaichick S. Relations of the al, B, Ba, Br, Ca, Cl,
Cu, Fe, K, Li, Mg, Mn, Na, P, S, Si, Sr, and Zn mass fractions
to morphometric parameters in pediatric and nonhyperplastic
young adult prostate glands. Biometals 2014;27:333-48.
25. Zaichick V, Zaichick S. The distribution of 54 trace elements
including zinc in pediatric and nonhyperplastic young adult
prostate gland tissues. J Clin Lab Invest Updat 2014;2:1-15.
26. Zaichick V, Zaichick S. Androgen-dependent chemical
elements of prostate gland.Androl Gynecol: Curr Res 2014;2:2.
27. Zaichick V, Zaichick S. Differences and relationships between
morphometric parameters and zinc content in nonhyperplastic
and hyperplastic prostate glands. Br J Med Med Res
2015;8:692-706.
28. Zaichick V, Zaichick S, Wynchank S. Intracellular zinc excess
as one of the main factors in the etiology of prostate cancer.
J Anal Oncol 2016;5:124-31.
29. Zaichick V, Zaichick S, Rossmann M. Intracellular calcium
excess as one of the main factors in the etiology of prostate
cancer. AIMS Mol Sci 2016;3:635-47.
30. Zaichick V. The prostatic urethra as a venturi effect urine-jet
pump to drain prostatic fluid. Med Hypotheses 2014;83:65-8.
31. Mackenzie AR, Hall T, Whitmore WF Jr. Zinc content
of expressed human prostate fluid. Nature (London)
1962;193:72-3.
32. Marmar JL, Katz S, Praiss DE, De Benedictis TJ. Values for
zinc in whole semen, fraction of split ejaculate and expressed
prostatic fluid. Urology 1980;16:478-80.
33. Zaichick V, Tsyb A, Dunchik VN, Sviridova TV. Method
for Diagnostics of Prostate Diseases., Russia: Certificate of
7. Zaichick and Zaichick: Trace elements in prostatic fluid of normal and cancerous prostate
Journal of Clinical Research in Oncology • Vol 1 • Issue 1 • 2018 54
Invention No 997281; 1981.
34. Zaichick V, Sviridova T, Zaichick S. Zinc concentration in
human prostatic fluid: Normal, chronic prostatitis, adenoma,
and cancer. Int Urol Nephrol 1996;28:687-94.
35. Zaichick V. Applications of synthetic reference materials in the
medical radiological research centre. Fresenius J Anal Chem
1995;352:219-23.
36. Burgos MN. Biochemical and functional properties related to
sperm metabolism and fertility. In: Brandes D, editor. Male
Accessory Sex Organs. New York: Academic Press; 1974.
p. 151-60.
37. Gómes Y, Arocha F, Espinoza F, Fernandez D, Vásquez A,
Granadillo V. Zinc levels in prostatic fluid of patients with
prostate pathologies. Invest Clin 2007;48:287-94.
38. Kavanagh JP, Darby C. The interrelationships between acid
phosphatase, aminopeptidase, diamine oxidase, citric acid,
β-glucuronidase, pH and zinc in human prostate fluid. Int J
Androl 1982;5:503-12.
39. Huggins C, Scott W., Heinen JH. Chemical composition of
human semen and of the secretion of the prostate and seminal
vesicles. Am J Physiol 1942;136:467-73.
40. Zaichick V. Sampling, sample storage and preparation of
biomaterials for INAA in clinical medicine, occupational and
environmental health. In: Harmonization of Health-Related
Environmental Measurements Using Nuclear and Isotopic
Techniques. Vienna: IAEA; 1997. p. 123-33.
41. ZaichickV, Zaichick S.A search for losses of chemical elements
during freeze-drying of biological materials. J Radioanal Nucl
Chem 1997;218:249-53.
42. Zaichick V. Losses of chemical elements in biological samples
under the dry aching process. Trace Elem Med 2004;5:17-22.
How to cite this article: Zaichick V, Zaichick S. Trace
Elements of Expressed Prostate Secretions as a Source
for Biomarkers of Prostate Cancer. Journal of Clinical
Research in Oncology2018;1(1):48-54.