GldK, GldL, GldM, and SprA are proteins required for the type IX secretion system (T9SS) in Flavobacterium johnsoniae. Deletion of these genes resulted in failure to secrete the cell surface motility adhesins SprB and RemA, loss of gliding motility, and resistance to phages that use SprB or RemA. The genes gldK, gldL, gldM, and gldN form an operon and the proteins localize to the cell envelope, suggesting they interact to form part of the T9SS. SprA is also required for secretion of SprB and RemA but may not be essential for
This document summarizes a study investigating the roles of the genes gldN and gldO in gliding motility in the bacterium Flavobacterium johnsoniae. The study found that:
1) A mutant lacking both gldN and gldO was completely nonmotile, indicating that at least one of the proteins is required for gliding.
2) The gldN mutant had some residual motility, suggesting gldO may partially compensate for the lack of gldN.
3) The gldN/gldO mutant was defective in localization of the motility protein SprB to the cell surface, suggesting GldN is involved in secretion of motility
This study aimed to determine if DNA transfer during bacterial conjugation requires extended F pili or can occur through direct cell surface contact. The researchers used a temperature-sensitive F plasmid traD mutant that accumulates stable mating pairs at the nonpermissive temperature. Treatment with SDS removed F pili from these pairs, yet DNA transfer still occurred upon shifting to the permissive temperature, demonstrating that the traD product acts after F pili are no longer required. Electron microscopy showed donor and recipient cells in direct wall-to-wall contact in accumulated mating pairs. Therefore, DNA transfer occurs through direct cell surface contact and does not necessarily require extended F pili.
An aminopeptidase P (PepP)-encoding gene has been cloned from Streptomyces lividans 66. The gene, pepP, was localized by deletion mapping and its nucleotide sequence was determined. The deduced amino acid sequence was found to display significant similarity to Escherichia coli PepP. The partially purified S. lividans enzyme had a 50-kDa subunit and was present as a homodimer, confirming that pepP encodes the observed intracellular PepP.
The study examines DNA double-strand break repair in Drosophila melanogaster mutants lacking both the Pif1 and Pol32 genes. PCR analysis confirms the generation of homozygous pif1 pol32 double mutant fly stocks, unlike in yeast where such double mutants are lethal. The pif1 pol32 double mutants are viable and fertile. Using a P-element excision assay to assess DNA repair, the study finds the double mutants exhibit significant defects in somatic repair of excised P-elements, compared to single mutants and wildtype flies.
1) The document describes an experiment using the Cleaved Amplified Polymorphic Sequence (CAPS) method to distinguish between the Arabidopsis gigantea mutant and wild type. Genomic DNA was extracted and amplified from samples, then subjected to restriction enzyme digestion.
2) Gel electrophoresis following restriction digestion showed one band for the gigantea mutant and multiple bands for the wild type, allowing identification. Phenotypic analysis over time was consistent with genetic findings, showing the gigantea mutant had larger leaves and delayed flowering compared to the wild type.
3) The CAPS method successfully distinguished the wild type plant from the gigantea Arabidopsis mutant. Genetic and phenotypic analysis identified Unknown 16 as the
EcoTILLING is a method for identifying natural mutations and polymorphisms in populations using TILLING techniques. It allows for the detection of point mutations and small insertions/deletions in DNA in a high-throughput but low-cost manner using gel electrophoresis. EcoTILLING has been used to identify allelic variants in genes related to powdery mildew resistance (mlo and Mla) in barley. It has also been applied to identify natural variation in 196 Arabidopsis ecotypes and 41 cottonwood trees. The method shows potential for discovering alleles relevant to salt tolerance in rice varieties and resistance to potato virus Y in pepper varieties.
This document summarizes research using a 3×P3-EGFP marker to facilitate screening for transgenic silkworm Bombyx mori. Key findings:
- The 3×P3-EGFP marker was expressed in B. mori embryonic stemmata, nervous system, and other tissues from day 5 of development, allowing transgenic screening starting at the embryonic stage.
- Injecting the piggyBac vector carrying the 3×P3-EGFP marker into the anterior egg pole led to higher expression frequency in stemmata compared to posterior injections.
- Co-injecting the helper plasmid with the marker vector increased expression frequency compared to the vector alone, indicating transposon-
This document summarizes a study investigating the roles of the genes gldN and gldO in gliding motility in the bacterium Flavobacterium johnsoniae. The study found that:
1) A mutant lacking both gldN and gldO was completely nonmotile, indicating that at least one of the proteins is required for gliding.
2) The gldN mutant had some residual motility, suggesting gldO may partially compensate for the lack of gldN.
3) The gldN/gldO mutant was defective in localization of the motility protein SprB to the cell surface, suggesting GldN is involved in secretion of motility
This study aimed to determine if DNA transfer during bacterial conjugation requires extended F pili or can occur through direct cell surface contact. The researchers used a temperature-sensitive F plasmid traD mutant that accumulates stable mating pairs at the nonpermissive temperature. Treatment with SDS removed F pili from these pairs, yet DNA transfer still occurred upon shifting to the permissive temperature, demonstrating that the traD product acts after F pili are no longer required. Electron microscopy showed donor and recipient cells in direct wall-to-wall contact in accumulated mating pairs. Therefore, DNA transfer occurs through direct cell surface contact and does not necessarily require extended F pili.
An aminopeptidase P (PepP)-encoding gene has been cloned from Streptomyces lividans 66. The gene, pepP, was localized by deletion mapping and its nucleotide sequence was determined. The deduced amino acid sequence was found to display significant similarity to Escherichia coli PepP. The partially purified S. lividans enzyme had a 50-kDa subunit and was present as a homodimer, confirming that pepP encodes the observed intracellular PepP.
The study examines DNA double-strand break repair in Drosophila melanogaster mutants lacking both the Pif1 and Pol32 genes. PCR analysis confirms the generation of homozygous pif1 pol32 double mutant fly stocks, unlike in yeast where such double mutants are lethal. The pif1 pol32 double mutants are viable and fertile. Using a P-element excision assay to assess DNA repair, the study finds the double mutants exhibit significant defects in somatic repair of excised P-elements, compared to single mutants and wildtype flies.
1) The document describes an experiment using the Cleaved Amplified Polymorphic Sequence (CAPS) method to distinguish between the Arabidopsis gigantea mutant and wild type. Genomic DNA was extracted and amplified from samples, then subjected to restriction enzyme digestion.
2) Gel electrophoresis following restriction digestion showed one band for the gigantea mutant and multiple bands for the wild type, allowing identification. Phenotypic analysis over time was consistent with genetic findings, showing the gigantea mutant had larger leaves and delayed flowering compared to the wild type.
3) The CAPS method successfully distinguished the wild type plant from the gigantea Arabidopsis mutant. Genetic and phenotypic analysis identified Unknown 16 as the
EcoTILLING is a method for identifying natural mutations and polymorphisms in populations using TILLING techniques. It allows for the detection of point mutations and small insertions/deletions in DNA in a high-throughput but low-cost manner using gel electrophoresis. EcoTILLING has been used to identify allelic variants in genes related to powdery mildew resistance (mlo and Mla) in barley. It has also been applied to identify natural variation in 196 Arabidopsis ecotypes and 41 cottonwood trees. The method shows potential for discovering alleles relevant to salt tolerance in rice varieties and resistance to potato virus Y in pepper varieties.
This document summarizes research using a 3×P3-EGFP marker to facilitate screening for transgenic silkworm Bombyx mori. Key findings:
- The 3×P3-EGFP marker was expressed in B. mori embryonic stemmata, nervous system, and other tissues from day 5 of development, allowing transgenic screening starting at the embryonic stage.
- Injecting the piggyBac vector carrying the 3×P3-EGFP marker into the anterior egg pole led to higher expression frequency in stemmata compared to posterior injections.
- Co-injecting the helper plasmid with the marker vector increased expression frequency compared to the vector alone, indicating transposon-
The document summarizes experiments conducted to isolate and analyze a gene called mrfA involved in aerial hyphae development in Monascus ruber. Key findings include:
1. M. ruber mutants with disrupted mrfA showed abnormal hyphae growth compared to the original strain.
2. TAIL-PCR and other techniques were used to isolate the mrfA gene sequence.
3. A knock-out vector was constructed and transformed into M. ruber, resulting in transformants that exhibited autolytic aerial hyphae.
This document describes a protocol for one-step targeted gene deletion in Candida albicans haploids. C. albicans is an important human fungal pathogen that was previously thought to exist only as a diploid. However, the discovery of viable haploid strains of C. albicans enables more efficient gene deletion through a single transformation step rather than the previous two-step process required in diploids. The protocol uses URA3 flipper cassettes containing flanking regions of homology to the target gene for deletion. Transformants are screened by colony PCR to identify those with correct gene deletion and assess ploidy. The protocol enables more rapid functional analysis of C. albicans genes.
Molecular Biology research evolves through the development of the technologies used for carrying them out. It is not possible to research on a large number of genes using traditional methods
Agrobacterium and plant viruses can be used as biological vectors for plant transformation. Agrobacterium mediates transformation via its tumor-inducing plasmid, using virulence genes to transfer T-DNA containing the gene of interest into the plant genome. Plant viruses can also act as gene vectors by engineering viral genomes to contain and deliver foreign genes. Retroviruses have been developed as viral vectors for animal gene transfer due to their ability to stably integrate into the host chromosome.
This document discusses various screening methods for recombinant clones, including:
1. Blue-white screening, which uses the enzyme beta-galactosidase and chromogenic substrate X-gal to detect recombinant clones. Colonies containing inserts will be colorless while those without will be blue.
2. Insertional inactivation of the cI gene or lacZ gene, where inserts disrupt gene function and allow detection of recombinant clones.
3. Use of antibiotic resistance genes, where recombinant vectors can be selected by ability to grow on antibiotic media.
4. Complementation of mutations, using auxotrophic host strains defective in a biosynthetic pathway gene and recombinant clones containing the gene to allow growth.
Marker free transgenic crops can be generated using several strategies to avoid issues with marker genes. Selectable marker genes allow selection of transformed cells but their products may be undesirable in food. Strategies include co-transformation using two plasmids without linking marker and trait genes, replacing selectable markers with screenable markers, and excising the selectable marker from the genome after selection using site-specific recombination, transposition, or homologous recombination. Case studies demonstrate applying these strategies successfully in tobacco and mustard to generate marker free transgenic plants.
Phage display technology allows the display of proteins or peptides on the outside of bacteriophages while encoding the corresponding gene on the inside. This allows for large libraries to be screened in vitro to select for interactions between the displayed molecules and a target. The most common phages used are filamentous phages like M13, which can be genetically manipulated to display proteins of interest. The technique involves inserting a gene into the phage coat protein gene, infecting bacteria to produce phage particles displaying the protein, and panning against a target to isolate interacting proteins.
This document describes a research project that aimed to sequence the aldolase B gene and discover new mutations that cause hereditary fructose intolerance (HFI). The researchers first attempted to amplify five fragments of the aldolase B gene via polymerase chain reaction (PCR) and analyze the results using gel electrophoresis. Fragment 5 was eventually successfully amplified from a plasmid, but fragments 2 and 4 could not be amplified from patient genomic DNA despite varying PCR conditions. Further optimization is still needed to amplify the fragments from genomic DNA and ultimately sequence the patient DNA to identify new mutations.
Restriction enzymes are endonucleases that cut DNA at specific recognition sequences. They break the covalent phosphodiester bonds between nucleotides within a DNA strand and the hydrogen bonds between the strands. Originally found in bacteria as a defense mechanism, over 3000 restriction enzymes are now known and commercially available. They are important tools for molecular biologists as they create "sticky ends" or overhangs on DNA fragments that allow them to be recombined through annealing of complementary sequences.
This document summarizes information about cytoplasmic genomes and their applications in plant breeding. It discusses how cytoplasmic DNA located in plastids and mitochondria can influence agronomic traits such as male sterility and disease resistance. Common techniques used in chloroplast transformation are also outlined, including vector design and selection markers. The advantages of chloroplast transformation over nuclear transformation are highlighted, such as high levels of transgene expression and gene containment due to maternal inheritance of plastids. Potential applications of chloroplast transformation include developing herbicide and insect/pathogen resistance in crops.
The advent of RNA interference in entomologyHummakhankhan
The document discusses the advent and applications of RNA interference (RNAi) in entomology. It describes how RNAi enables loss-of-function studies in non-model insects beyond Drosophila. It reviews different types of RNAi experiments in insects, including parental RNAi, embryonic RNAi, larval/nymphal RNAi, and regeneration-dependent RNAi. It also discusses how RNAi can be used to develop species-specific insecticides by targeting essential insect genes.
One of the first plasmids to be used in recombinant genetics was called pBR322. It is approximately 4300 bp in length and has two antibiotic resistance genes: Ap (Ampicillin) and Tc (Tetracycline). Bacteria cells that are successfully transformed with this plasmid are able to grow in the presence of both ampicillin and tetracycline antibiotics
1) The document analyzes microRNA expression in the dioecious plant Coccinia grandis to understand sex differentiation. Small RNA sequencing of male and female floral buds identified 142 microRNAs, including 41 differentially expressed between sexes.
2) Target prediction and expression analysis of microRNAs and their targets revealed roles for certain microRNAs in flower development and sexual dimorphism in C. grandis, including 8 conserved and 8 novel microRNAs linked to sex determination.
3) Reciprocal expression patterns of 16 microRNAs and their predicted targets across development of male and female buds provided evidence of microRNA regulation of genes important for sex differentiation in this species.
This document provides an overview of mutagenesis techniques including: types of mutagenesis like site-directed mutagenesis; applications in molecular biology research and protein engineering; methods for screening mutants like visual screening; and advantages and future prospects of mutation breeding like using TILLING to detect single nucleotide mutations.
This document discusses molecular markers and their use in plant breeding and genetics. It defines different types of markers, including morphological, biochemical, and molecular markers. Molecular markers are DNA sequences that can be easily detected and whose inheritance can be monitored. The document discusses different classes of molecular markers, including PCR-based techniques like RAPD, SSR, and AFLP, as well as applications like diversity analysis, genotyping, and linkage mapping. It also covers topics like genetic distance, linkage mapping, mapping populations, and scoring mapping populations to construct genetic maps.
1. The document discusses complementation testing in genetics, which involves crossing two mutant strains to determine if their mutations occurred in the same or different genes.
2. If the mutations are in the same gene, the hybrid will be mutant, but if in different genes, the hybrid will have a wild type phenotype due to complementation.
3. The results of complementation tests allow researchers to classify mutations into complementation groups based on whether they fail to complement (allelic) or complement (non-allelic).
This document discusses strategies for developing transgenic plants without selectable marker genes. It begins by defining transgenic plants and marker genes, which are commonly used but have limitations. Approaches described for producing marker-free transgenics include using screenable markers, co-transformation, site-specific recombination, multi-auto transformation vectors, intrachromosomal recombination, and transposon-based systems. The document provides examples of each method and concludes that continued research in this area will help address public concerns about marker genes in transgenic crops.
This case study describes the discovery of induced point mutations in maize genes using the TILLING technique. Researchers screened a population of 750 pollen-mutagenized maize plants for mutations in 11 genes. They detected 17 independent mutations in total, including an allelic series of 3 mutations in the DMT102 gene. No mutations were found in 5 other genes screened. The study demonstrates the ability of TILLING to discover mutations and further characterize gene function in crops like maize.
A complementation test (sometimes called a "cis-trans" test) can be used to test whether the mutations in two strains are in different genes. By taking an example of Benzer's work, complementation has been explained.
This document discusses multiple chromosome interchanges and their use in plant breeding. It begins by defining interchanges as structural changes where non-homologous chromosome segments are exchanged. Interchanges can cause changes in linkage and chromosome behavior. The document then provides examples of naturally occurring interchanges in various plant species like Oenothera lamarckiana. It describes how interchanges can lead to semisterility and discusses different gamete types produced. It focuses on complex interchange systems in Oenothera that maintain permanent hybridity through mechanisms like balanced lethals and gametic lethals. The document concludes by outlining Burnham's method for using multiple interchanges to produce homozygous inbred lines through gamete selection.
This document reports on a study examining the role of platelet-derived growth factor (PDGF) autocrine loops in human astrocytoma cells. The study shows that dominant-negative mutants of PDGF that disrupt PDGF ligand formation are able to revert the transformed phenotype of PDGF-transformed BALB/c 3T3 cells and two independent human astrocytoma cell lines. In contrast, the mutants did not alter the growth of cell lines transformed by other oncogenes or of other human cancer cell lines. These results support the view that PDGF autocrine loops contribute to the transformed phenotype of at least some human astrocytomas.
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE B.pdfamzonknr
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE
BACKGROUND CONTEXT Lab: Differential Expression Differential gene expression provides
the ability for a cell or organism to respond to a constantly changing external environment. The
specific constellation of proteins required for optimal function and growth varies with cellular
age and environmental context. Thus, protein production is carefully regulated by multiple
mechanisms that modulate both transcriptional and translational pathways. Control of
transcription initiation by RNA polymerase is a predominant mechanism for regulating
expression of specific proteins, presumably because it provides maximal conservation of energy
for the cell. We can often observe the consequence of differential transcription due to the
presence or absence of particular proteins or the growth in particular environments. Control can
also occur at translation; the mRNA is synthesized, but only in certain circumstances is it
translated. Control can also occur at the level of protein function; the protein is inactive, or
activity is not observed due to the lack of the substrate. In this lab we will observe differential
expression of two different genes encoded on plasmids. We will analyze transcriptional activity,
translational activity, and protein function. Plasmids are extra-chromosomal DNA. Bacteria often
have plasmids and will replicate the plasmid and pass it to daughter cells (vertical transmission)
and to neighboring cells (horizontal). Plasmids are a mechanism of gene diversity. In order to
stably retain the plasmid, there needs to be some type of metabolic reason for the bacteria to
maintain the plasmid. In other words, the plasmid confers an advantage. Plasmids contain: 1. Ori:
the plasmid may present is low or high copy number. 2. Lab generated plasmids typically also
contain a selectable marker (antibiotic resistance), 3. Additional gene for ease of visual screening
4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant.
The document summarizes experiments conducted to isolate and analyze a gene called mrfA involved in aerial hyphae development in Monascus ruber. Key findings include:
1. M. ruber mutants with disrupted mrfA showed abnormal hyphae growth compared to the original strain.
2. TAIL-PCR and other techniques were used to isolate the mrfA gene sequence.
3. A knock-out vector was constructed and transformed into M. ruber, resulting in transformants that exhibited autolytic aerial hyphae.
This document describes a protocol for one-step targeted gene deletion in Candida albicans haploids. C. albicans is an important human fungal pathogen that was previously thought to exist only as a diploid. However, the discovery of viable haploid strains of C. albicans enables more efficient gene deletion through a single transformation step rather than the previous two-step process required in diploids. The protocol uses URA3 flipper cassettes containing flanking regions of homology to the target gene for deletion. Transformants are screened by colony PCR to identify those with correct gene deletion and assess ploidy. The protocol enables more rapid functional analysis of C. albicans genes.
Molecular Biology research evolves through the development of the technologies used for carrying them out. It is not possible to research on a large number of genes using traditional methods
Agrobacterium and plant viruses can be used as biological vectors for plant transformation. Agrobacterium mediates transformation via its tumor-inducing plasmid, using virulence genes to transfer T-DNA containing the gene of interest into the plant genome. Plant viruses can also act as gene vectors by engineering viral genomes to contain and deliver foreign genes. Retroviruses have been developed as viral vectors for animal gene transfer due to their ability to stably integrate into the host chromosome.
This document discusses various screening methods for recombinant clones, including:
1. Blue-white screening, which uses the enzyme beta-galactosidase and chromogenic substrate X-gal to detect recombinant clones. Colonies containing inserts will be colorless while those without will be blue.
2. Insertional inactivation of the cI gene or lacZ gene, where inserts disrupt gene function and allow detection of recombinant clones.
3. Use of antibiotic resistance genes, where recombinant vectors can be selected by ability to grow on antibiotic media.
4. Complementation of mutations, using auxotrophic host strains defective in a biosynthetic pathway gene and recombinant clones containing the gene to allow growth.
Marker free transgenic crops can be generated using several strategies to avoid issues with marker genes. Selectable marker genes allow selection of transformed cells but their products may be undesirable in food. Strategies include co-transformation using two plasmids without linking marker and trait genes, replacing selectable markers with screenable markers, and excising the selectable marker from the genome after selection using site-specific recombination, transposition, or homologous recombination. Case studies demonstrate applying these strategies successfully in tobacco and mustard to generate marker free transgenic plants.
Phage display technology allows the display of proteins or peptides on the outside of bacteriophages while encoding the corresponding gene on the inside. This allows for large libraries to be screened in vitro to select for interactions between the displayed molecules and a target. The most common phages used are filamentous phages like M13, which can be genetically manipulated to display proteins of interest. The technique involves inserting a gene into the phage coat protein gene, infecting bacteria to produce phage particles displaying the protein, and panning against a target to isolate interacting proteins.
This document describes a research project that aimed to sequence the aldolase B gene and discover new mutations that cause hereditary fructose intolerance (HFI). The researchers first attempted to amplify five fragments of the aldolase B gene via polymerase chain reaction (PCR) and analyze the results using gel electrophoresis. Fragment 5 was eventually successfully amplified from a plasmid, but fragments 2 and 4 could not be amplified from patient genomic DNA despite varying PCR conditions. Further optimization is still needed to amplify the fragments from genomic DNA and ultimately sequence the patient DNA to identify new mutations.
Restriction enzymes are endonucleases that cut DNA at specific recognition sequences. They break the covalent phosphodiester bonds between nucleotides within a DNA strand and the hydrogen bonds between the strands. Originally found in bacteria as a defense mechanism, over 3000 restriction enzymes are now known and commercially available. They are important tools for molecular biologists as they create "sticky ends" or overhangs on DNA fragments that allow them to be recombined through annealing of complementary sequences.
This document summarizes information about cytoplasmic genomes and their applications in plant breeding. It discusses how cytoplasmic DNA located in plastids and mitochondria can influence agronomic traits such as male sterility and disease resistance. Common techniques used in chloroplast transformation are also outlined, including vector design and selection markers. The advantages of chloroplast transformation over nuclear transformation are highlighted, such as high levels of transgene expression and gene containment due to maternal inheritance of plastids. Potential applications of chloroplast transformation include developing herbicide and insect/pathogen resistance in crops.
The advent of RNA interference in entomologyHummakhankhan
The document discusses the advent and applications of RNA interference (RNAi) in entomology. It describes how RNAi enables loss-of-function studies in non-model insects beyond Drosophila. It reviews different types of RNAi experiments in insects, including parental RNAi, embryonic RNAi, larval/nymphal RNAi, and regeneration-dependent RNAi. It also discusses how RNAi can be used to develop species-specific insecticides by targeting essential insect genes.
One of the first plasmids to be used in recombinant genetics was called pBR322. It is approximately 4300 bp in length and has two antibiotic resistance genes: Ap (Ampicillin) and Tc (Tetracycline). Bacteria cells that are successfully transformed with this plasmid are able to grow in the presence of both ampicillin and tetracycline antibiotics
1) The document analyzes microRNA expression in the dioecious plant Coccinia grandis to understand sex differentiation. Small RNA sequencing of male and female floral buds identified 142 microRNAs, including 41 differentially expressed between sexes.
2) Target prediction and expression analysis of microRNAs and their targets revealed roles for certain microRNAs in flower development and sexual dimorphism in C. grandis, including 8 conserved and 8 novel microRNAs linked to sex determination.
3) Reciprocal expression patterns of 16 microRNAs and their predicted targets across development of male and female buds provided evidence of microRNA regulation of genes important for sex differentiation in this species.
This document provides an overview of mutagenesis techniques including: types of mutagenesis like site-directed mutagenesis; applications in molecular biology research and protein engineering; methods for screening mutants like visual screening; and advantages and future prospects of mutation breeding like using TILLING to detect single nucleotide mutations.
This document discusses molecular markers and their use in plant breeding and genetics. It defines different types of markers, including morphological, biochemical, and molecular markers. Molecular markers are DNA sequences that can be easily detected and whose inheritance can be monitored. The document discusses different classes of molecular markers, including PCR-based techniques like RAPD, SSR, and AFLP, as well as applications like diversity analysis, genotyping, and linkage mapping. It also covers topics like genetic distance, linkage mapping, mapping populations, and scoring mapping populations to construct genetic maps.
1. The document discusses complementation testing in genetics, which involves crossing two mutant strains to determine if their mutations occurred in the same or different genes.
2. If the mutations are in the same gene, the hybrid will be mutant, but if in different genes, the hybrid will have a wild type phenotype due to complementation.
3. The results of complementation tests allow researchers to classify mutations into complementation groups based on whether they fail to complement (allelic) or complement (non-allelic).
This document discusses strategies for developing transgenic plants without selectable marker genes. It begins by defining transgenic plants and marker genes, which are commonly used but have limitations. Approaches described for producing marker-free transgenics include using screenable markers, co-transformation, site-specific recombination, multi-auto transformation vectors, intrachromosomal recombination, and transposon-based systems. The document provides examples of each method and concludes that continued research in this area will help address public concerns about marker genes in transgenic crops.
This case study describes the discovery of induced point mutations in maize genes using the TILLING technique. Researchers screened a population of 750 pollen-mutagenized maize plants for mutations in 11 genes. They detected 17 independent mutations in total, including an allelic series of 3 mutations in the DMT102 gene. No mutations were found in 5 other genes screened. The study demonstrates the ability of TILLING to discover mutations and further characterize gene function in crops like maize.
A complementation test (sometimes called a "cis-trans" test) can be used to test whether the mutations in two strains are in different genes. By taking an example of Benzer's work, complementation has been explained.
This document discusses multiple chromosome interchanges and their use in plant breeding. It begins by defining interchanges as structural changes where non-homologous chromosome segments are exchanged. Interchanges can cause changes in linkage and chromosome behavior. The document then provides examples of naturally occurring interchanges in various plant species like Oenothera lamarckiana. It describes how interchanges can lead to semisterility and discusses different gamete types produced. It focuses on complex interchange systems in Oenothera that maintain permanent hybridity through mechanisms like balanced lethals and gametic lethals. The document concludes by outlining Burnham's method for using multiple interchanges to produce homozygous inbred lines through gamete selection.
This document reports on a study examining the role of platelet-derived growth factor (PDGF) autocrine loops in human astrocytoma cells. The study shows that dominant-negative mutants of PDGF that disrupt PDGF ligand formation are able to revert the transformed phenotype of PDGF-transformed BALB/c 3T3 cells and two independent human astrocytoma cell lines. In contrast, the mutants did not alter the growth of cell lines transformed by other oncogenes or of other human cancer cell lines. These results support the view that PDGF autocrine loops contribute to the transformed phenotype of at least some human astrocytomas.
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE B.pdfamzonknr
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE
BACKGROUND CONTEXT Lab: Differential Expression Differential gene expression provides
the ability for a cell or organism to respond to a constantly changing external environment. The
specific constellation of proteins required for optimal function and growth varies with cellular
age and environmental context. Thus, protein production is carefully regulated by multiple
mechanisms that modulate both transcriptional and translational pathways. Control of
transcription initiation by RNA polymerase is a predominant mechanism for regulating
expression of specific proteins, presumably because it provides maximal conservation of energy
for the cell. We can often observe the consequence of differential transcription due to the
presence or absence of particular proteins or the growth in particular environments. Control can
also occur at translation; the mRNA is synthesized, but only in certain circumstances is it
translated. Control can also occur at the level of protein function; the protein is inactive, or
activity is not observed due to the lack of the substrate. In this lab we will observe differential
expression of two different genes encoded on plasmids. We will analyze transcriptional activity,
translational activity, and protein function. Plasmids are extra-chromosomal DNA. Bacteria often
have plasmids and will replicate the plasmid and pass it to daughter cells (vertical transmission)
and to neighboring cells (horizontal). Plasmids are a mechanism of gene diversity. In order to
stably retain the plasmid, there needs to be some type of metabolic reason for the bacteria to
maintain the plasmid. In other words, the plasmid confers an advantage. Plasmids contain: 1. Ori:
the plasmid may present is low or high copy number. 2. Lab generated plasmids typically also
contain a selectable marker (antibiotic resistance), 3. Additional gene for ease of visual screening
4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant.
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE BAC.pdfamzonknr
ONLY THE LAST QUESTION IS THE POINT OF POST. THE OTHER PAGES ARE
BACKGROUND CONTEXT Lab: Differential Expression Differential gene expression provides
the ability for a cell or organism to respond to a constantly changing external environment. The
specific constellation of proteins required for optimal function and growth varies with cellular
age and environmental context. Thus, protein production is carefully regulated by multiple
mechanisms that modulate both transcriptional and translational pathways. Control of
transcription initiation by RNA polymerase is a predominant mechanism for regulating
expression of specific proteins, presumably because it provides maximal conservation of energy
for the cell. We can often observe the consequence of differential transcription due to the
presence or absence of particular proteins or the growth in particular environments. Control can
also occur at translation; the mRNA is synthesized, but only in certain circumstances is it
translated. Control can also occur at the level of protein function; the protein is inactive, or
activity is not observed due to the lack of the substrate. In this lab we will observe differential
expression of two different genes encoded on plasmids. We will analyze transcriptional activity,
translational activity, and protein function. Plasmids are extra-chromosomal DNA. Bacteria often
have plasmids and will replicate the plasmid and pass it to daughter cells (vertical transmission)
and to neighboring cells (horizontal). Plasmids are a mechanism of gene diversity. In order to
stably retain the plasmid, there needs to be some type of metabolic reason for the bacteria to
maintain the plasmid. In other words, the plasmid confers an advantage. Plasmids contain: 1. Ori:
the plasmid may present is low or high copy number. 2. Lab generated plasmids typically also
contain a selectable marker (antibiotic resistance), 3. Additional gene for ease of visual screening
4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant.
1) The document describes a study identifying new genes involved in gliding motility in Flavobacterium johnsoniae.
2) Transposon mutagenesis of an F. johnsoniae sprB mutant identified 8 mutants with increased phage resistance and reduced motility. 4 mutants had transposon insertions in remA, which encodes a cell surface protein with a lectin domain.
3) RemA was shown to localize to the cell surface and move rapidly along the cell surface, suggesting it acts as a mobile adhesin involved in gliding motility.
Lab: Differential Expression Differential gene expression provides the ability for a cell or
organism to respond to a constantly changing external environment. The specific constellation of
proteins required for optimal function and growth varies with cellular age and environmental
context. Thus, protein production is carefully regulated by multiple mechanisms that modulate
both transcriptional and translational pathways. Control of transcription initiation by RNA
polymerase is a predominant mechanism for regulating expression of specific proteins,
presumably because it provides maximal conservation of energy for the cell. We can often
observe the consequence of differential transcription due to the presence or absence of particular
proteins or the growth in particular environments. Control can also occur at translation; the
mRNA is synthesized, but only in certain circumstances is it translated. Control can also occur at
the level of protein function; the protein is inactive, or activity is not observed due to the lack of
the substrate. In this lab we will observe differential expression of two different genes encoded
on plasmids. We will analyze transcriptional activity, translational activity, and protein function.
Plasmids are extra-chromosomal DNA. Bacteria often have plasmids and will replicate the
plasmid and pass it to daughter cells (vertical transmission) and to neighboring cells (horizontal).
Plasmids are a mechanism of gene diversity. In order to stably retain the plasmid, there needs to
be some type of metabolic reason for the bacteria to maintain the plasmid. In other words, the
plasmid confers an advantage. Plasmids contain: 1. Ori: the plasmid may present is low or high
copy number. 2. Lab generated plasmids typically also contain a selectable marker (antibiotic
resistance), 3. Additional gene for ease of visual screening 4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant plasmids. The transformed cells containing the plasmid with the gene of interest ca.
Lab: Differential Expression Differential gene expression provides the ability for a cell or
organism to respond to a constantly changing external environment. The specific constellation of
proteins required for optimal function and growth varies with cellular age and environmental
context. Thus, protein production is carefully regulated by multiple mechanisms that modulate
both transcriptional and translational pathways. Control of transcription initiation by RNA
polymerase is a predominant mechanism for regulating expression of specific proteins,
presumably because it provides maximal conservation of energy for the cell. We can often
observe the consequence of differential transcription due to the presence or absence of particular
proteins or the growth in particular environments. Control can also occur at translation; the
mRNA is synthesized, but only in certain circumstances is it translated. Control can also occur at
the level of protein function; the protein is inactive, or activity is not observed due to the lack of
the substrate. In this lab we will observe differential expression of two different genes encoded
on plasmids. We will analyze transcriptional activity, translational activity, and protein function.
Plasmids are extra-chromosomal DNA. Bacteria often have plasmids and will replicate the
plasmid and pass it to daughter cells (vertical transmission) and to neighboring cells (horizontal).
Plasmids are a mechanism of gene diversity. In order to stably retain the plasmid, there needs to
be some type of metabolic reason for the bacteria to maintain the plasmid. In other words, the
plasmid confers an advantage. Plasmids contain: 1. Ori: the plasmid may present is low or high
copy number. 2. Lab generated plasmids typically also contain a selectable marker (antibiotic
resistance), 3. Additional gene for ease of visual screening 4. Multiple cloning site
pUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers.
The designation "pUC" is derived from the classical "p" prefix (denoting "plasmid") and the
abbreviation for the University of California, where early work on the plasmid series had been
conducted. It is a circular double stranded DNA and has 2686 base pairs. pUC19 is one of the
most widely used vector molecules as the recombinants, or the cells into which foreign DNA has
been introduced, can be easily distinguished from the non-recombinants based on color
differences of colonies on growth media. pUC18 is similar to pUC19, but the MCS region is
reversed. - pUC 19 has an origin of replication and is maintained at a high copy number. -
pUC19 encodes for an ampicillin resistance gene (amopR), via a -lactamase enzyme that
functions by degrading ampicillin and reducing its toxicity to the host. - It has an N-terminal
fragment of -galactosidase (lacZ) gene of E. coli which allows for visual screening of
recombinant plasmids. The transformed cells containing the plasmid with the gene of interest ca.
This document discusses the annotation of the Kif3C gene from the fruit fly Drosophila biarmipes using bioinformatics tools and comparisons to the gene in Drosophila melanogaster. The Kif3C gene was annotated from fosmid 66 of D. biarmipes and found to contain 5 exons between bases 17,150 and 23,800. The start and stop codons were identified as ATG and TAA, respectively. A comparison with the Kif3C gene in D. melanogaster found 34.4% identity between the sequences.
This document summarizes a research article published in The Journal of Immunology in 2008. The study found that:
1) FOXP3, a transcription factor important for regulatory T cells, interacts with the nuclear receptor RORα.
2) Full-length FOXP3, but not a shorter isoform lacking exon 2, is able to inhibit RORα's ability to activate transcription.
3) Mutation of an LxxLL motif in exon 2 abolished FOXP3's interaction with and repression of RORα. Expression of RORα leads to expression of Th17 cell-related genes, which full-length FOXP3, but not the shorter isoform, was able to inhibit
This study investigated the functional redundancy of the four aspartic proteinases (plasmepsins) found in the digestive vacuole of the malaria parasite Plasmodium falciparum. The researchers disrupted each of the plasmepsin genes (PfPM1, PfPM2, PfPM4, and PfHAP) through genetic engineering. They found that while disruption of PfPM1 and PfPM4 resulted in reduced parasite growth, none of the plasmepsins were essential for survival. This suggests the plasmepsins can compensate for each other, likely due to their structural and catalytic similarities. The study implies that effective antimalarial drugs will need to inhibit multiple plasmepsin family members.
MDM2 promotes the ubiquitination and degradation of FOXO transcription factors. The study found that MDM2 binds directly to FOXO1 and FOXO3A, promoting their ubiquitination and proteasome-mediated degradation. This degradation was dependent on FOXO phosphorylation by AKT and the E3 ligase activity of MDM2. Furthermore, activation of p53 led to increased MDM2 levels and degradation of endogenous FOXO3A. Therefore, MDM2 acts as an E3 ubiquitin ligase downstream of p53 to regulate FOXO protein stability.
Presentation1..gymno..non specific markers n microsatellites..by Nikita Patha...NIKITAPATHANIA
This document summarizes research on using various molecular markers to study genetic diversity in gymnosperms. It discusses the use of non-specific markers like AFLP, RAPD and SSR to study neutral DNA variations. Microsatellites are described as tandem repeats that are widely used in population genetics and evolutionary studies. Single-copy nuclear genes are proposed as ideal markers for resolving phylogenetic relationships. The document also covers techniques like inter-retrotransposon amplified polymorphism (IRAP) that analyze retrotransposon insertion polymorphisms, and expressed sequence tags (EST) to identify genes and study gene expression.
Applications and potential of genome editing tools in vegetable breedingNeha Verma
This document summarizes genome editing tools and their applications in vegetable breeding. It introduces three main genome editing tools - ZFN, TALENs, and CRISPR/Cas9 - and compares their features. It then discusses several case studies where these tools have been used in crops like tomato, potato, watermelon and cucumber to modify traits related to plant development, stress resistance, quality, and herbicide resistance. Specific examples include editing genes for fruit development, powdery mildew resistance, drought tolerance, and anthocyanin content. The document concludes by outlining the procedure for CRISPR/Cas9 genome editing and some regulatory considerations.
This document summarizes a study investigating the role of a Plasmodium falciparum S33 proline aminopeptidase (PfPAP) in changes to host red blood cell deformability. The key findings are:
1) PfPAP contains a predicted protein export element suggesting it is exported into infected red blood cells. In silico modeling and recombinant protein studies confirmed PfPAP is a proline aminopeptidase.
2) Genetic deletion of PfPAP in P. falciparum led to an increase in the deformability of infected red blood cells and reduced adherence of infected cells to the endothelial cell receptor CD36 under flow conditions.
3) These results suggest PfP
This document summarizes a study examining the role of protein arginine methyltransferases (PRMTs) in small nuclear ribonucleoprotein particle (snRNP) assembly in Drosophila melanogaster. The key findings are:
1) Both Dart5 (PRMT5 ortholog) and Dart7 (PRMT7 ortholog) are required for symmetric dimethylation of Sm proteins in Drosophila, as they are in humans.
2) Loss of Dart7 is lethal, whereas loss of Dart5 alone has little effect, and flies lacking Dart5 are viable.
3) Expression of a mutant form of SmD1 that cannot be symmetrically dimethylated does not affect viability or
Disrupted development and altered hormone signaling in male Padi2:Padi4 doubl...Cornell University
Background: Peptidylarginine deiminase enzymes (PADs) convert arginine residues to citrulline in a process called citrullination or deimination. Recently, two PADs, PAD2 and PAD4, have been linked to hormone signaling in vitro and the goal of this study was to test for links between PAD2/PAD4 and hormone signaling in vivo.
Methods: Preliminary analysis of Padi2 and Padi4 single knockout (SKO) mice did not find any overt reproductive defects and we predicted that this was likely due to genetic compensation. To test this hypothesis, we created a Padi2/Padi4 double knockout (DKO) mouse model and tested these mice for a range of reproductive defects. Results: Controlled breeding trials found that DKO breeding pairs, particularly males, appeared to take longer to have their first litter than wild-type FVB controls (WT), and that pups and DKO male weanlings weighed significantly less than their WT counterparts. Additionally, DKO males took significantly longer than WT males to reach puberty and had lower serum testosterone levels. Furthermore, DKO males had smaller testes than WT males with increased rates of germ cell apoptosis.
Conclusions: The Padi2/Padi4 DKO mouse model provides a new tool for investigating PAD function and outcomes from our studies provide the first in vivo evidence linking PADs with hormone signaling.
The document summarizes research analyzing the diversity of Rab small GTPases in the human parasite Trichomonas vaginalis. It finds that T. vaginalis has 292 Rab proteins, around 4 times more than humans. Most sequences contain functional prenylation motifs, but 107 lack conserved residues in GTP-binding domains. Phylogenetic analysis shows the Rab family expanded preferentially in a subgroup related to early endosomes in other organisms. Transcriptomic data indicates all 292 Rabs are expressed under tested conditions. The high and diverse Rab count may indicate a complex endomembrane system in T. vaginalis related to phagocytosis and endocytosis, important processes in its biology.
initiation of meiotic recombination conservation and specificities among euka...surehuasb
This document summarizes a seminar presentation on the initiation of meiotic recombination and conservation across eukaryotes. It introduces key concepts like Spo11 and double-strand breaks. It then discusses studies in organisms like mice, Arabidopsis, and rice on the different types of Spo11 and associated proteins. The document reviews methods to detect double-strand breaks and examines the control and regulation of break formation, including factors like chromosome structure and histone modifications. Finally, it presents two case studies on characterization of Spo11 in C. elegans and the synaptonemal complex protein ZYP1 in Arabidopsis and concludes with discussing open questions and future perspectives in the field.
On predicting mutation status from transcriptome sequencing dataShiraishi Yuichi
1. The document discusses predicting mutation status from transcriptome sequencing data using statistical machine learning methods.
2. It describes analyzing large cancer genomics datasets like TCGA to infer genomic changes in specific pathways from changes in the global transcriptome landscape.
3. Recent studies have used this approach to predict mutation status in pathways like Ras signaling and DNA damage repair by training machine learning models on relationships between mutations and gene expression changes.
RAPD is commonly used to genotype organisms but has disadvantages like poor reproducibility. Newer techniques like gene-targeted sequencing and rRNA intergenic spacer region sequencing appear more sensitive and reproducible. The document reports using RAPD to genotype 7 recent Mycoplasma gallisepticum isolates from house finches. Results showed the 7 isolates were similar to a known house finch strain, supporting the hypothesis that the outbreak was caused by a single strain introduction.
1. Published Ahead of Print 10 May 2013.
2013, 195(14):3201. DOI: 10.1128/JB.00333-13.J. Bacteriol.
Baaren and Mark J. McBride
Abhishek Shrivastava, Joseph J. Johnston, Jessica M. van
Adhesins SprB and RemA
of the Cell Surface Gliding Motility
GldM, and SprA Are Required for Secretion
Flavobacterium johnsoniae GldK, GldL,
http://jb.asm.org/content/195/14/3201
Updated information and services can be found at:
These include:
SUPPLEMENTAL MATERIAL Supplemental material
REFERENCES
http://jb.asm.org/content/195/14/3201#ref-list-1at:
This article cites 39 articles, 27 of which can be accessed free
CONTENT ALERTS
more»articles cite this article),
Receive: RSS Feeds, eTOCs, free email alerts (when new
http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders:
http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/DownloadedfromonNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
3. pCP1 and have copy numbers of approximately 10 in F. johnsoniae (21, 22,
24). Antibiotics were used at the following concentrations when needed:
ampicillin at 100 g/ml, cefoxitin at 100 g/ml, erythromycin at 100
g/ml, streptomycin at 100 g/ml, and tetracycline at 20 g/ml.
Deletion of gldK, gldL, gldM, and sprA. Unmarked deletions were
made as previously described (20). To make the gldL deletion, a 2.4-kbp
fragment downstream of gldL was amplified by PCR using Phusion DNA
polymerase (New England BioLabs, Ipswich, MA) and primers 1199 (in-
troducing an XbaI site) and 1200 (introducing a SalI site). The fragment
was digested with XbaI and SalI and ligated into pRR51 that had been
digested with the same enzymes, to generate pAB18. A 2.2-kbp fragment
spanning the upstream region of gldL was amplified by PCR with primers
TABLE 1 Strains and plasmids used in this study
F. johnsoniae strain or
plasmid Genotype and/or descriptiona
Reference(s)
or source
Strains
UW101 (ATCC 17061) Wild type 38, 39
UW102-57 Spontaneous gldK mutant 17, 26
UW102-141 Nitrosoguanidine-induced gldK mutant 17, 26
CJ1372 gldK::HimarEm1 (Emr
) 17
CJ1373 gldK::HimarEm1 (Emr
) 17
CJ1827 rpsL2 (Smr
); wild-type strain used in construction of deletion mutants 20
CJ1922 rpsL2 ⌬sprB (Smr
) 20
CJ1984 rpsL2 ⌬remA (Smr
) 4
CJ1985 rpsL2 ⌬sprB ⌬remA (Smr
) 4
CJ2083 rpsL2 remA::myc-tag-1 (Smr
) 4
CJ2090 rpsL2 ⌬(gldN gldO) (Smr
) 4
CJ2122 rpsL2 ⌬gldK (Smr
) This study
CJ2140 rpsL2 ⌬gldK in remA::myc-tag-1 background (Smr
) This study
CJ2157 rpsL2 ⌬gldL (Smr
) This study
CJ2262 rpsL2 ⌬gldM (Smr
) This study
CJ2263 rpsL2 ⌬gldM in remA::myc-tag-1 background (Smr
) This study
CJ2281 rpsL2 ⌬gldL in remA::myc-tag-1 background (Smr
) This study
CJ2089 rpsL2 ⌬(gldN gldO) remA::myc-tag-1 (Smr
) 4
CJ2302 rpsL2 ⌬sprA (Smr
) This study
CJ2317 rpsL2 ⌬sprA in remA::myc-tag-1 background (Smr
) This study
CJ2327 sprT disruption in remA::myc-tag-1 background (Emr
Smr
) This study
KDF001 sprT mutant (Emr
) 7
FJ149 sprE mutant (Emr
) 6
Plasmids
pET30a Protein expression vector; Kmr
Novagen
pCP23 E. coli-F. johnsoniae shuttle plasmid; Apr
(Tcr
) 22
pCP29 E. coli-F. johnsoniae shuttle plasmid; Apr
(Cfr
Emr
) 24
pRR51 rpsL-containing suicide vector; Apr
(Emr
) 20
pJVB4 1.3-kbp fragment of gldK amplified with primer pair 704/705 and ligated into EcoRI-, SalI-digested pET30a; Kmr
This study
pJVB2 0.6-kbp fragment of gldL amplified with primer pair 706/707 and ligated into EcoRI-, SalI-digested pET30a; Kmr
This study
pJVB6 1.3-kbp fragment of gldM amplified with primer pair 708/709 and ligated into EcoRI-, SalI-digested pET30a;
Kmr
This study
pAB18 2.4-kbp region downstream of gldL amplified with primers 1199 and 1200 and ligated into XbaI-, SalI-digested
pRR51; Apr
(Emr
)
This study
pAB19 Construct used to delete gldL; 2.2-kbp region upstream of gldL amplified with primer pair 1197/1198 and ligated
into BamHI-, XbaI-digested pAB18; Apr
(Emr
)
This study
pAB30 Construct used to delete sprA; 2.5 kbp upstream and 2.5 kbp downstream of sprA amplified using primer pairs
1333/1334 and 1335/1336, respectively, and ligated into BamHI-, SalI-digested pRR51; Apr
(Emr
)
This study
pJJ01 Construct used to delete gldK; 1.9-kbp region upstream and 1.9-kbp region downstream of gldK amplified using
primer pairs 1209/1210 and 1211/1212, respectively, and ligated into BamHI-, SphI-digested pRR51; Apr
(Emr
)
This study
pJJ02 Construct used to delete gldM; 2.6-kbp region upstream and 2.4-kbp region downstream of gldM amplified using
primer pairs 1237/1214 and 1215/1238, respectively, and ligated into BamHI-, SphI-digested pRR51; Apr
(Emr
)
This study
pTB99 pCP23 carrying gldK; Apr
(Tcr
) 17
pTB81a pCP23 carrying gldL; Apr
(Tcr
) 17
pTB94a pCP23 carrying gldM; Apr
(Tcr
) 17
pTB79 pCP23 carrying gldN; Apr
(Tcr
) 17
pKF002 pCP23 carrying sprT; Apr
(Tcr
) 7
pSN48 pCP23 carrying sprA; Apr
(Tcr
) 18
a
Antibiotic resistance phenotypes are as follows: ampicillin, Apr
; cefoxitin, Cfr
; erythromycin, Emr
; streptomycin, Smr
; tetracycline, Tcr
. Unless indicated otherwise, the antibiotic
resistance phenotypes are those expressed in E. coli. The antibiotic resistance phenotypes given in parentheses are those expressed in F. johnsoniae but not in E. coli.
Shrivastava et al.
3202 jb.asm.org Journal of Bacteriology
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
4. 1197 (introducing a BamHI site) and 1198 (introducing an XbaI site). The
fragment was digested with BamHI and XbaI and fused to the region
downstream of gldL by ligation with pAB18 that had been digested with
the same enzymes, to generate the deletion construct pAB19. Plasmid
pAB19 was introduced into streptomycin-resistant wild-type F. john-
soniae strain CJ1827 and remA::myc-tag-1 strain CJ2083 (4) by triparental
conjugation, and gldL deletion mutants were isolated as previously de-
scribed (20). Deletion of gldL was confirmed by PCR amplification using
primers 690 and 707, which flank the gldL coding sequence. gldK, gldM,
and sprA were deleted in wild-type CJ1827 and in remA::myc-tag-1 strain
CJ2083 by the same approach, using the primers listed in Table S1 in the
supplemental material and the plasmids listed in Table 1.
Transduction of the sprT mutation into CJ2083 (rpsL2 remA::myc-
tag-1). The sprT mutation in strain KDF001 was transduced into CJ2083
(rpsL2 remA::myc-tag-1) essentially as previously described (5), using
phage Cj54 and selecting for erythromycin resistance.
RT-PCR to characterize the operon comprised of gldK, gldL, gldM,
and gldN. RNA was extracted from wild-type F. johnsoniae UW101 cells as
described previously (16). Briefly, wild-type cells were grown in 25 ml of
MM overnight at 25°C without shaking. Cells were harvested by centrif-
ugation at 4,000 ϫ g for 10 min, and the pellet was suspended in 450 l of
MM. RNAProtect (Qiagen, Valencia, CA) was added, and pellet was col-
lected as described previously (16). RNA was extracted and purified by
using the RNeasy minikit (Qiagen) according to the manufacturer’s in-
structions, except that RNasin (Promega Corp., Madison, WI) and RQ1
RNase-free DNase (Promega) were used as described previously (16).
RNA concentrations (optical density at 260 nm [OD260]) and purity
(OD260/280) were determined by UV spectroscopy, and RNA integrity was
verified by visualizing the intensity of the 16S and 23S rRNA bands on a
1% agarose gel.
Reverse transcriptase PCR (RT-PCR) was used to determine the tran-
scriptional organization of gldK, gldL, gldM, and gldN. cDNA was gener-
ated by using the SuperScript first-strand synthesis kit for RT-PCR (In-
vitrogen Corp., Carlsbad, CA) according to the manufacturer’s
instruction. RNA was reverse transcribed by using gene-specific primer
695 essentially as described previously (16). For PCR, antisense primers
used to generate the cDNA were used in various combinations with sense
primers.
ExpressionofrecombinantGldK,GldL,andGldMforantibodypro-
duction. A 1,308-bp fragment of gldK was amplified by using Phusion
DNA polymerase and primers 705 (introducing a SalI site) and 704 (in-
troducing an EcoRI site). The product was digested with EcoRI and SalI
and inserted into pET30a (Novagen, Madison, WI) that had been digested
with the same enzymes, to generate pJVB4. A 607-bp fragment of gldL was
amplified by using primers 707 (introducing a SalI site) and 706 (intro-
ducing an EcoRI site), and the product was digested and inserted into
pET30a as described above, generating pJVB2. A 1,311-bp fragment of
gldM was amplified by using primer 709 (introducing a SalI site) and
primer 708. The PCR product was digested with SalI and EcoRI (which
cuts within gldM) and inserted into pET30a as described above, generat-
ing pJVB6. pJVB4, pJVB2, and pJVB6 encode proteins with amino-termi-
nal His-tagged peptides fused to the C-terminal 434, 174, and 426 amino
acids of GldK, GldL, and GldM, respectively.
pJVB4, pJVB2, and pJVB6 were introduced into Escherichia coli
Rosetta2(DE3) (Novagen), which produces seven rare tRNAs required for
efficient expression of F. johnsoniae proteins in E. coli (3, 18). Expression
was induced by addition of 1.0 mM IPTG (isopropyl--D-thiogalactopy-
ranoside) and incubation for 3 h at 37°C. Cells were collected by centrif-
ugation and disrupted by using a French pressure cell, and recombinant
proteins were purified by Ni affinity chromatography. Polyclonal anti-
bodies against recombinant GldK, GldL, and GldM were produced and
affinity purified using the recombinant proteins by Proteintech Group,
Inc. (Chicago, IL). Antibodies were also raised against recombinant GldN,
as previously described (5).
Detection and localization of GldK, GldL, and GldM. Wild-type and
mutant cells of F. johnsoniae were grown to mid-log phase in CYE me-
dium at 25°C. Cells were washed twice in sterile distilled water by centrif-
ugation at 4,000 ϫ g and were lysed by incubation for 5 min at 100°C in
SDS-PAGE loading buffer. Proteins (15 g per lane) were separated by
SDS-PAGE, and Western blotting was performed as described previously
(5). To determine protein localization, wild-type cells were grown to mid-
log phase in MM at 25°C with shaking. The cells were washed twice with
sterile distilled water, and EDTA-free Halt protease inhibitor cocktail was
added (Thermo Fisher Scientific, Rockford, IL). The cells were disrupted
by using a French pressure cell and fractionated into soluble inner mem-
brane (Sarkosyl-soluble) and outer membrane (Sarkosyl-insoluble) frac-
tions essentially as described previously (25). Proteins were separated by
SDS-PAGE, equal amounts of each fraction based on the starting material
were loaded per lane, and Western blotting was performed as described
previously (5).
Analysis of wild-type and mutant cells for production and secretion
of SprB and Myc-tagged RemA. Cells were grown to mid-exponential
phase in CYE medium at 25°C. Production of SprB and Myc-tagged
RemA was determined by Western blot analyses using antisera against
SprB and RemA, respectively, as previously described (4, 5). Secretion of
SprB was examined essentially as previously described (6). Briefly, cells
were grown overnight in MM at 25°C. Purified anti-SprB (1 l of a 1:10
dilution of a 300-mg/liter stock), 0.5-m-diameter protein G-coated
polystyrene spheres (1 l of a 0.1% stock preparation; Spherotech, Inc.,
Libertyville, IL), and bovine serum albumin (BSA) (1 l of a 1% solution)
were added to 7 l of cells (approximately 5 ϫ 108
cells per ml) in MM.
The cells were introduced into a tunnel slide (4) and examined by phase-
contrast microscopy at 25°C. Samples were examined 2 min after spotting,
and images were recorded for 30 s to determine the percentage of cells that
had anti-SprB-coated spheres attached to them. The major advantage of
this method is that proteins are detected on the surface of live cells that
have not been chemically or enzymatically altered. Surface-localized Myc-
tagged RemA was detected similarly, except that antisera against the Myc
tag (EQKLISEEDL; AbCam, Cambridge, MA) was used instead of anti-
SprB (4).
Microscopic observations of cell movement. Wild-type and mutant
cells were examined for movement over glass by phase-contrast micros-
copy. Cells were grown overnight in MM at 25°C without shaking, as
previously described (23). Simple tunnel slides were constructed by using
double-stick tape, glass microscope slides, and glass coverslips, as previ-
ously described (4). Cells in MM were introduced into the tunnel slides,
incubated for 5 min, and observed for motility by using an Olympus BH2
phase-contrast microscope with a heated stage at 25°C. Images were re-
corded with a Photometrics CoolSNAPcf
2
camera and analyzed by using
MetaMorph software (Molecular Devices, Downingtown, PA).
Measurements of bacteriophage sensitivity. The bacteriophages ac-
tive against F. johnsoniae that were used in this study were Cj1, Cj13,
2 864
Fjoh_1858gldOgldLFjoh_1852 gldM gldNgldK
FJ113CJ1300
CJ1373
CJ1304
pTB99
pTB81a
pTB94a
pTB79
gldK
gldL
gldM
gldN
CJ1372
FIG 1 Map of the gldKLMN region. Numbers below the map refer to kilobase
pairs of sequence. The sites of HimarEm insertions are indicated by triangles.
Orientations of HimarEm insertions are indicated by the direction in which the
triangles are pointing, with triangles pointing to the right having inverted
repeat 2 (IR2) on the right side. The regions of DNA carried by plasmids used
in this study are indicated beneath the map.
F. johnsoniae Motility and T9SS Proteins
July 2013 Volume 195 Number 14 jb.asm.org 3203
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
5. Cj23, Cj28, Cj29, Cj42, Cj48, and Cj54 (26–28). Sensitivity to
bacteriophages was determined essentially as previously described, by
spotting 5 l of phage lysates (109
PFU/ml) onto lawns of cells in CYE
overlay agar (5). The plates were incubated for 24 h at 25°C to observe
lysis.
Measurement of chitin utilization. The ability of F. johnsoniae to
utilize chitin was assayed as described previously (5). F. johnsoniae cells
were grown overnight in MM without shaking at 25°C. Two microliters of
cells was spotted onto MYA-chitin containing appropriate antibiotics,
and plates were incubated for 2.5 days.
Microscopic observations of cell attachment. Wild-type and mutant
cells of F. johnsoniae were examined for attachment to glass by using a
Petroff-Hausser counting chamber as previously described, with slight
modifications (5). Cells were grown overnight in MM without shaking at
25°C. The culture was diluted with an equal volume of fresh MM and
incubated at 25°C without shaking until a cell density equivalent to an
OD600 of 0.4 was reached. Cells (2.5 l) were added to a Petroff-Hausser
counting chamber, covered with a glass coverslip, and allowed to incubate
for 2 min at 25°C. The number of cells attached to 9 randomly selected
0.03-mm2
regions of the glass coverslip was determined.
RESULTS
gldK, gldL, gldM, and gldN form an operon. Previous results in-
dicated that gldL, gldM, and gldN are cotranscribed (17). The sit-
uation regarding gldK, which lies upstream of gldL, was less clear.
It was suggested that gldK was transcribed separately, but the gldK
transcript was not detected by Northern blot analysis, leaving the
operon structure uncertain. Complementation analyses used to
determine operon structure were also inconclusive, because mod-
erate overexpression of gldK and gldL together in wild-type cells
resulted in dramatic decreases in growth and motility, complicat-
ing analysis of polar effects of mutations (17). To understand the
importance of GldK, GldL, and GldM to gliding motility and pro-
tein secretion, we revisited the transcriptional organization of
these genes.
The ability of pTB99, which carries gldK, to complement vari-
ous gldK mutants was examined. Two of the mutants (UW102-57
and UW102-141) had single-base substitutions in gldK, whereas
the other two (CJ1372 and CJ1373) had HimarEm transposon
insertions in gldK. The sites of the mutations in UW102-57 and
UW102-141 were determined by amplification and sequencing.
UW102-57 had an “A”-to-“T” substitution at position 1054,
numbered from the A of the gldK start codon, and UW102-141
had a G-to-A substitution at position 1158, as previously reported
(17). The substitutions converted the codons for R352 and W386,
respectively, to stop codons. pTB99 restored motility to
UW102-57 and UW102-141 but failed to restore motility to either
of the gldK HimarEm mutants (Fig. 2). These results suggested
that the base substitution mutations resulted in nonpolar muta-
tions, whereas the HimarEm insertions may have exhibited polar
effects on downstream genes.
To explore the issue of polarity more directly, we examined the
levels of GldK, GldL, GldM, and GldN proteins in HimarEm-in-
duced GldK mutants. GldK, GldL, and GldM were overexpressed
in E. coli, and antisera were raised against each protein. These
proteins were each detected in cells of wild-type F. johnsoniae, but
they were absent from appropriate gld deletion mutants (Fig. 3).
Western blot analysis revealed that strains CJ1372 and CJ1373,
which have transposon insertions in gldK, not only lacked GldK
protein but also had little if any GldL, GldM, and GldN proteins
(Fig. 3 and data not shown). Similarly, strains with transposon
insertions in gldL produced little GldM or GldN, and strains with
transposon insertions in gldM were deficient in GldN (data not
shown). The results provide additional evidence of polarity of the
gldK mutations and suggest that gldK, gldL, gldM, and gldN may be
cotranscribed.
We recently developed a method to generate in-frame dele-
tions of F. johnsoniae genes (20). By using this method, strains
with deletions of gldK, gldL, and gldM were generated. In contrast
to the transposon mutants described above, CJ2122 (⌬gldK) pro-
duced GldL, GldM, and GldN, indicating that the mutation was
nonpolar and that the GldK protein was not required for produc-
tion of GldL, GldM, and GldN (Fig. 3). The gldK deletion mutant
produced wild-type levels of GldL and GldM (Fig. 3B and C) but
appeared to produce less GldN (Fig. 3D). Complementation of the
gldK deletion mutant with pTB99, which carries gldK, restored
FIG 2 Photomicrographs of F. johnsoniae colonies. Colonies were incubated
at 25°C on PY2 agar for 36 h. Photomicrographs were taken with a Photomet-
rics Cool-SNAPcf
2
camera mounted on an Olympus IMT-2 phase-contrast
microscope. (A) Wild-type F. johnsoniae UW101. (B) F. johnsoniae UW101
with pTB99, which carries gldK. (C) gldK point mutant strain UW102-141. (D)
UW102-141 complemented with pTB99. (E) gldK point mutant strain
UW102-57. (F) UW102-57 complemented with pTB99. (G) gldK Himar mu-
tant strain CJ1372. (H) CJ1372 with pTB99. (I) gldK Himar mutant strain
CJ1373. (J) CJ1373 with pTB99. The bar indicates 1 mm and applies to all
panels.
Shrivastava et al.
3204 jb.asm.org Journal of Bacteriology
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
6. GldK and GldN to wild-type levels. Restoration of GldN levels by
expression of GldK argues against a polar effect of the gldK dele-
tion mutation on expression of gldN. Analysis of CJ2157 (⌬gldL)
and CJ2262 (⌬gldM) gave similar results. CJ2157 failed to produce
GldL protein but produced GldM and GldN, and CJ2262 failed to
produce GldM protein but produced GldN (Fig. 3C and D). The
strains with deletions in gldL or gldM were similar to strains with
gldK deletions in that they appeared to have low levels of GldN
protein. One possible explanation for these results is that GldK,
GldL, GldM, and GldN may form a complex, and GldN may be
unstable in the absence of any of its partners. This may also explain
the low levels of GldL observed in CJ2262 (⌬gldM) cells (Fig. 3B)
and the reduced levels of GldK protein in strains with mutations in
gldL, gldM, and gldN (Fig. 3A).
The results presented above suggest that gldK, gldL, gldM, and
gldN form an operon. RT-PCR analysis confirmed the presence of
a transcript spanning gldK, gldL, gldM, and gldN (Fig. 4). A pre-
dicted Flavobacterium consensus promoter sequence (TANN
TTTG [29]) was identified 97 bp upstream of the gldK start codon,
and 5= rapid amplification of cDNA ends (RACE) analysis identi-
fied the start site of transcription 5 bp downstream of the final G of
this promoter sequence (17). An inverted repeat (AAAAAACTC
TTACTACCTTTGTAGTAAGAGTTTTTT), which may function
as a transcription terminator, was present 22 bp downstream of
the gldN stop codon. Genetic and molecular evidence previously
demonstrated that gldO, which lies downstream of the gldKLMN
operon and which is partially redundant with gldN, is transcribed
independently. Transposon insertions in gldN were not polar on
gldO, and the gldN mutants produced GldO protein (5).
GldK, GldL, and GldM are each required for gliding. As pre-
viously reported, transposon insertions in gldK, gldL, and gldM
result in a complete loss of motility (17). Given the concerns re-
garding polarity of these mutations, we analyzed the phenotypes
of the in-frame deletions to determine the roles of the individual
proteins. Cells with deletion mutations in gldK, gldL, or gldM were
completely nonmotile. They formed nonspreading colonies on
agar media (Fig. 5) and exhibited no cell movements in wet
mounts on glass (see Movies S1 to S3 in the supplemental mate-
A
kDa
Wildtype
∆gldK
95
72
GldK
43
56
gldKHimarmutant
∆gldK+pTB99
∆gldNO
∆gldM
∆gldL
∆gldL+pTB81a
∆gldM+pTB94
∆gldNO+pTB79
17
26
34
GldL
kDa
Wild-type
∆gldK
gldKHimarmutant
∆gldK+pTB99
∆gldNO
∆gldM
∆gldL
∆gldL+pTB81a
∆gldM+pTB94
∆gldNO+pTB79
95
72
43
56
GldM
kDa
Wild-type
∆gldK
gldKHimarmutant
∆gldK+pTB99
∆gldNO
∆gldM
∆gldL
∆gldL+pTB81a
∆gldM+pTB94
∆gldNO+pTB79
43
56
26
34
GldN
kDa
Wild-type
∆gldK
gldKHimarmutant
∆gldK+pTB99
∆gldNO
∆gldM
∆gldL
∆gldL+pTB81a
∆gldM+pTB94
∆gldNO+pTB79
B
C
D
FIG 3 Western blot immunodetection of GldK (A), GldL (B), GldM (C), and
GldN (D) in whole-cell extracts of wild-type, mutant, and complemented
strains of F. johnsoniae. The wild-type strain was CJ1827 (rpsL2), the gldK
Himar mutant was CJ1372, and the strains with deletions in gldK, gldL, gldM,
and gldNO were CJ2122, CJ2157, CJ2262, and CJ2090, respectively. pTB99,
pTB81a, pTB94a, and pTB79 express GldK, GldL, GldM, and GldN, respec-
tively, and thus complement the indicated mutants. Fifteen micrograms of
protein was loaded into each lane.
2 64
gldLFjoh_1852 gldM gldNgldK
0
685
695
692
705
616690
2 1312111098765431
kbp
+control
-control
RT-PCR
685/705
+control
-control
RT-PCR
+control
-control
RT-PCR
+control
-control
RT-PCR
616/695 692/695690/695
2.0
1.5
3.0
10.0
8.0
4.0
6.0
5.0
2.5
3.5
A
B
FIG 4 RT-PCR analysis of the gldKLMN operon. (A) Map of the gldKLMN
operon with primers used for RT-PCR (numbered arrows). (B) RT-PCR of
wild-type F. johnsoniae UW101 RNA. Reverse transcription was carried out
with primer 695, which is complementary to a sequence internal to gldN. PCR
was conducted by using the primer pairs shown. For each primer pair, three
reaction mixtures were loaded onto the gel: a positive-control PCR mixture
with F. johnsoniae chromosomal DNA as the template (lanes 2, 5, 8, and 11), a
no-RT control reaction mixture (lanes 3, 6, 9, and 12), and an RT-PCR mix-
ture (lanes 4, 7, 10, and 13). Lane 1, DNA ladder as a size standard; lanes 2 to 4,
primer pair 685/705; lanes 5 to 7, primer pair 690/695; lanes 8 to 10, primer
pair 616/695; lanes 11 to 13, primer pair 692/695.
F. johnsoniae Motility and T9SS Proteins
July 2013 Volume 195 Number 14 jb.asm.org 3205
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
7. rial). Cells of the deletion mutants were also examined by time-
lapse microscopy for possible slow or intermittent movements on
glass or agar using methods previously described (2), but no
movements were observed. In each case, complementation with
the appropriate gene restored motility. Complementation of the
gldM deletion mutant was incomplete, perhaps because expres-
sion of gldM from a plasmid did not result in optimal GldM levels
or did not allow optimal formation of a complex with the other
Gld proteins. The results indicate that GldK, GldL, and GldM are
each essential for gliding motility. Previous experiments demon-
strated that the presence of GldN, or its paralog GldO, is also
required for gliding (5).
GldK, GldL, and GldM are each required for secretion of the
cell surface motility adhesins SprB and RemA. Components of
the F. johnsoniae T9SS, such as GldN, SprE, SprF, and SprT, are
required for surface localization of SprB (5–7, 16). GldN is also
required for secretion of the mobile cell surface motility adhesin
RemA (4, 5). Here we examined the roles of GldK, GldL, and
GldM in secretion of SprB and of recombinant RemA that carried
a Myc tag to allow easy detection. Cells with deletion mutations in
gldK, gldL, or gldM produced SprB and Myc-tagged RemA pro-
teins, as determined by Western blot analyses (Fig. 6), but they
failed to secrete these proteins to the cell surface (Tables 2 and 3).
Anti-SprB-coated polystyrene spheres attached readily to wild-
type cells but failed to attach to cells of an sprB deletion mutant or
to cells that had deletions in gldK, gldL, or gldM (Table 2). Com-
plementation with a plasmid expressing the appropriate gene in
each case restored SprB to the cell surface. Similarly, anti-Myc-
coated polystyrene spheres attached readily to CJ2083 cells, which
express Myc-tagged RemA, but they failed to attach to cells with
mutations in gldK, gldL, or gldM (Table 3).
Cells of gldK, gldL, and gldM mutants were also resistant to
infection by bacteriophages that infect wild-type cells (Fig. 7).
SprB is thought to be a receptor for phages Cj1, Cj13, Cj23,
and Cj29 (3), and RemA appears to be a receptor for phages
Cj42, Cj48, and Cj54 (4), so it is not surprising that mutants
with defects in secretion of SprB, RemA, and perhaps additional
cell surface motility proteins exhibit phage resistance.
Cells of the deletion mutants were also deficient in attachment
to glass (Table 4), as has previously been observed for other mo-
tility mutants of F. johnsoniae (18). This may be the result of the
absence of motility adhesins such as SprB and RemA on the cell
surface. However, the lack of SprB and RemA on the cell surface
cannot explain the entire attachment defect. Cells of an sprB mu-
tant or of a remA mutant attached to glass almost as well as wild-
type cells, and cells lacking both genes were only partially deficient
in attachment to glass (Table 4). In contrast, cells with mutations
in gldK, gldL, or gldM were completely deficient in attachment to
glass. This suggests that cell surface adhesins in addition to SprB
and RemA are secreted by the T9SS. Proteins secreted by T9SSs
typically have conserved CTDs belonging to the TIGRFAMs
TIGR04131 and TIGR04183. Analysis of the F. johnsoniae genome
revealed 53 proteins with these T9SS CTDs (see Table S2 in the
supplemental material). Some of these may be the additional cell
surface adhesins that contribute to the ability of wild-type cells to
attach to glass.
GldK, GldL, and GldM are each required for chitin utiliza-
tion. F. johnsoniae was originally identified as a chitin-digesting
bacterium (30). It produces a variety of proteins involved in chitin
utilization, including at least one extracellular chitinase that we
refer to as ChiA, encoded by Fjoh_4555. Mutations in the T9SS
FIG 5 gldK, gldL, and gldM are each required for formation of spreading
colonies. Colonies were grown for 36 h at 25°C on PY2 agar medium. Photo-
micrographs were taken with a Photometrics Cool-SNAPcf
2
camera mounted
on an Olympus IMT-2 phase-contrast microscope. The wild-type strain was
CJ1827. CJ1827, CJ2122 (⌬gldK), CJ2157 (⌬gldL), and CJ2262 (⌬gldM) car-
ried control vector pCP23 so that all strains were resistant to tetracycline and
could be grown on identical media. pTB99, pTB81a, and pTB94a express
GldK, GldL, and GldM, respectively. The bar indicates 0.5 mm and applies to
all panels.
170
130
kDa
∆gldK
∆gldM
∆gldL
∆sprB
Wild-type
170
130
kDa
∆gldK
∆gldM
∆gldL
∆remA
Wild-type
A
B
SprB
RemA
FIG 6 Immunodetection of SprB and RemA in cells of wild-type and mutant
F. johnsoniae strains. (A) Cell extracts (15 g of protein) of wild-type (CJ1827),
⌬sprB (CJ1922), ⌬gldK (CJ2122), ⌬gldL (CJ2157), and ⌬gldM (CJ2262) strains
were examined by Western blotting using antiserum against SprB. (B) Cell
extracts (15 g of protein) of wild-type (CJ2083), ⌬remA (CJ1984), ⌬gldK
(CJ2140), ⌬gldL (CJ2281), and ⌬gldM (CJ2263) strains were examined by
Western blotting using antiserum against RemA. All strains in panel B except
the ⌬remA strain (CJ1984) were derived from CJ2083 and thus expressed the
Myc-tagged version of RemA.
Shrivastava et al.
3206 jb.asm.org Journal of Bacteriology
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
8. genes gldN, sprE, and sprT result in defects in chitin utilization and
defects in secretion of ChiA (5–7). Cells with deletion mutations
in gldK, gldL, and gldM were examined for chitin utilization
(Fig. 8). Deletion of any of these genes resulted in an inability to
digest colloidal chitin, indicating that GldK, GldL, and GldM are
each required for chitin digestion and suggesting that they may be
required for secretion of ChiA. In each case, complementation
with plasmids carrying the appropriate genes restored the ability
to digest chitin, although chitin utilization was only partially re-
stored by complementation of the gldM mutant.
Localization of GldK, GldL, and GldM. GldK, GldL, and
GldM were each present primarily in the insoluble (membrane)
fraction of cell extracts (Fig. 9). GldK is a predicted outer mem-
brane lipoprotein, and GldL and GldM have hydrophobic alpha-
helical segments that are predicted to anchor them to the cytoplas-
mic membrane (17). The mild detergent Sarkosyl solubilizes the F.
johnsoniae cytoplasmic membrane while leaving the outer mem-
brane intact (25). Sarkosyl solubilization was used to examine
protein localization. GldL and GldM were enriched in the Sarko-
syl-soluble (cytoplasmic membrane) fraction as predicted,
whereas GldK was present in both the Sarkosyl-soluble (cytoplas-
mic membrane) and Sarkosyl-insoluble (outer membrane) frac-
tions. While integral outer membrane proteins of F. johnsoniae are
generally not solubilized by Sarkosyl, lipoproteins such as GldK
might have a more tenuous connection to the membrane and thus
might be partially solubilized by this treatment. The absence of
GldL and GldM in the outer membrane fraction suggests that the
cytoplasmic membrane was completely solubilized by the deter-
gent, and the enrichment of GldK in the outer membrane fraction
suggests that GldK may be associated primarily with the outer
membrane.
SprA is required for secretion of SprB and RemA and for uti-
lization of chitin. SprA is an outer membrane protein that is in-
volved in gliding motility (18). SprA is similar in sequence to the P.
gingivalis T9SS protein Sov (18, 19). The similarity between SprA
and Sov suggested that SprA might have a role in secretion. sprA
deletion mutants were constructed and examined for secretion of
SprB and RemA. The mutants produced SprB and RemA proteins
(see Fig. S1 in the supplemental material) but failed to secrete
them to the cell surface (Tables 2 and 3), suggesting that SprA has
a role in secretion. Previous results using transposon-induced
sprA mutants suggested that SprA was not completely essential for
TABLE 2 Binding of protein G-coated polystyrene spheres carrying anti-SprB antibodies
Strain Description Antibody added
Avg % of cells with spheres
attached (SD)a
CJ1827/pCP23 Wild type with control plasmid pCP23 No antibody 0.0 (0.0)
CJ1827/pCP23 Wild type with control plasmid pCP23 Anti-SprB 53.7 (3.1)
CJ1922/pCP23 ⌬sprB with control plasmid pCP23 Anti-SprB 1.0 (1.0)
CJ2122/pCP23 ⌬gldK with control plasmid pCP23 Anti-SprB 0.3 (0.6)
CJ2122/pTB99 ⌬gldK with pTB99 carrying gldK Anti-SprB 54.0 (2.0)
CJ2157/pCP23 ⌬gldL with control plasmid pCP23 Anti-SprB 0.3 (0.6)
CJ2157/pTB81a ⌬gldL with pTB81a carrying gldL Anti-SprB 54.3 (3.5)
CJ2262/pCP23 ⌬gldM with control plasmid pCP23 Anti-SprB 0.0 (0.0)
CJ2262/pTB94a ⌬gldM with pTB94a carrying gldM Anti-SprB 56.0 (2.0)
CJ2302/pCP23 ⌬sprA with control plasmid pCP23 Anti-SprB 0.3 (0.6)
CJ2302/pSN48 ⌬sprA with pSN48 carrying sprA Anti-SprB 51.3 (4.0)
a
Purified anti-SprB antiserum and 0.5-m-diameter protein G-coated polystyrene spheres were added to cells as described in Materials and Methods. Samples were introduced
into a tunnel slide, incubated for 2 min at 25°C, and examined by using a phase-contrast microscope. Images were recorded for 30 s, and 100 randomly selected cells were examined
for the presence of spheres that remained attached to the cells during this time. Numbers in parentheses are standard deviations calculated from three measurements.
TABLE 3 Binding of protein G-coated polystyrene spheres carrying antibodies against Myc-tagged peptide
Strain Description Antibody added
Avg % of cells with spheres
attached (SD)a
CJ1827 Wild type Anti-Myc 0.0 (0.0)
CJ1984 ⌬remA Anti-Myc 0.0 (0.0)
CJ2083 remA::myc-tag-1 No antibody 0.0 (0.0)
CJ2083 remA::myc-tag-1 Anti-Myc 54.0 (4.0)
CJ2140/pCP23 ⌬gldK remA::myc-tag-1 with control plasmid pCP23 Anti-Myc 1.0 (0.0)
CJ2140/pTB99 ⌬gldK remA::myc-tag-1 with pTB99 carrying gldK Anti-Myc 57.0 (1.0)
CJ2281/pCP23 ⌬gldL remA::myc-tag-1 with control plasmid pCP23 Anti-Myc 1.0 (1.0)
CJ2281/pTB81a ⌬gldL remA::myc-tag-1 with pTB81a carrying gldL Anti-Myc 52.7 (2.1)
CJ2263/pCP23 ⌬gldM remA::myc-tag-1 with control plasmid pCP23 Anti-Myc 1.0 (1.0)
CJ2263/pTB94a ⌬gldM remA::myc-tag-1 with pTB94a carrying gldM Anti-Myc 53.0 (1.7)
CJ2317 ⌬sprA remA::myc-tag-1 Anti-Myc 0.6 (0.5)
CJ2317/pSN48 ⌬sprA remA::myc-tag-1 with pSN48 carrying sprA Anti-Myc 55.3 (2.5)
CJ2327 sprT remA::myc-tag-1 Anti-Myc 0.0 (0.0)
CJ2327/pKF002 sprT remA::myc-tag-1 with pKF002 carrying sprT Anti-Myc 64.6 (2.0)
a
Purified anti-Myc tag antiserum and 0.5-m-diameter protein G-coated polystyrene spheres were added to cells as described in Materials and Methods. Samples were introduced
into a tunnel slide, incubated for 2 min at 25°C, and examined by using a phase-contrast microscope. Images were recorded for 30 s, and 100 randomly selected cells were examined
for the presence of spheres that remained attached to the cells during this time. Numbers in parentheses are standard deviations calculated from three measurements.
F. johnsoniae Motility and T9SS Proteins
July 2013 Volume 195 Number 14 jb.asm.org 3207
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
9. chitin utilization (18). The sprA mutants were severely but incom-
pletely deficient in chitin utilization. Because the mutants ana-
lyzed would have produced truncated SprA protein that might
have been partially functional, we revisited this phenotype with
the deletion mutant. sprA deletion mutant strain CJ2302 failed to
utilize chitin, suggesting a more severe defect in chitinase secre-
tion than was observed for the transposon-induced mutant (see
Fig. S2 in the supplemental material).
SprT and SprE have previously been shown to be required for
secretion of SprB and for chitin utilization (6, 7). Like SprA, SprT
was also required for secretion of RemA (Table 3, and see Fig. S1 in
the supplemental material). The involvement of SprE in RemA
secretion is less certain, but the resistance of sprE mutants to
phages Cj42, Cj48, and Cj54, which are thought to use RemA
FIG 7 Effect of mutations on susceptibility to phages. Bacteriophages (5 l of
lysates containing approximately 109
PFU/ml) were spotted onto lawns of cells
in CYE overlay agar. The plates were incubated at 25°C for 24 h to observe lysis.
Bacteriophages were spotted in the following order from left to right, as also
indicated by the numbers in panel A: top row, Cj1, Cj13, and Cj23; middle
row, Cj28, Cj29, and Cj42; bottom row, Cj48 and Cj54. (A) Wild-type
F. johnsoniae CJ1827. (B) CJ2122 (⌬gldK). (C) CJ2122 complemented with
pTB99, which carries gldK. (D) CJ2157 (⌬gldL). (E) CJ2157 complemented
with pTB81a, which carries gldL. (F) CJ2262 (⌬gldM). (G) CJ2262 comple-
mented with pTB94a, which carries gldM. (H) CJ2302 (⌬sprA). (I) CJ2302
complemented with pSN48, which carries sprA. (J) KDF001 (sprT mutant).
(K) KDF001 complemented with pKF002, which carries sprT.
TABLE 4 Effect of deletion of gldK, gldL, gldM, and sprA on attachment
of cells to glass coverslips
Strain Description
Avg no. of cells
attached to
0.03-mm2
region of glass
coverslip (SD)a
CJ1827/pCP23 Wild type with control vector pCP23 69.1 (4.9)
CJ2122/pCP23 ⌬gldK with control vector pCP23 0.3 (0.5)
CJ2122/pTB99 ⌬gldK with pTB99 carrying gldK 67.7 (8.6)
CJ2157/pCP23 ⌬gldL with control vector pCP23 0.3 (0.5)
CJ2157/TB81a ⌬gldL with pTB81a carrying gldL 60.7 (6.8)
CJ2262/pCP23 ⌬gldM with control vector pCP23 0.6 (1.0)
CJ2262/pTB94a ⌬gldM with pTB94a carrying gldM 24.1 (2.5)
CJ2302/pCP23 ⌬sprA with control vector pCP23 0.1 (0.3)
CJ2302/pSN48 ⌬sprA with pSN48 carrying sprA 64.2 (8.5)
KDF001 sprT mutant 1.4 (1.3)
KDF001/pKF002 sprT mutant with pKF002 carrying
sprT
53.0 (5.4)
FJ149 sprE mutant 2.6 (1.2)
CJ1922/pCP23 ⌬sprB with control vector pCP23 66.6 (11.3)
CJ1984/pCP23 ⌬remA with control vector pCP23 54.8 (7.3)
CJ1985/pCP23 ⌬sprB ⌬remA with control vector
pCP23
22.6 (4.1)
a
Approximately 106
cells in 2.5 l of MM were introduced into a Petroff-Hausser
counting chamber and incubated for 2 min at 25°C. Samples were observed by using an
Olympus BH-2 phase-contrast microscope, and cells attached to a 0.03-mm2
region of
the glass coverslip were counted. Numbers in parentheses are standard deviations
calculated from 9 measurements.
wild-type
∆gldK
∆gldK
pTB99
wild-type
∆gldL
∆gldL
pTB81a
wild-type
∆gldM
∆gldM
pTB94a
A CB
FIG 8 gldK, gldL, and gldM are each required for chitin utilization. Approxi-
mately 106
cells of F. johnsoniae were spotted onto MYA-chitin medium con-
taining tetracycline and incubated at 25°C for 60 h. (A) F. johnsoniae CJ1827
(wild type), CJ2122 (⌬gldK), and CJ2122 complemented with pTB99, which
carries gldK (⌬gldK pTB99). (B) F. johnsoniae CJ1827 (wild type), CJ2157
(⌬gldL), and CJ2157 complemented with pTB81a, which carries gldL (⌬gldL
pTB81a). (C) F. johnsoniae CJ1827 (wild type), CJ2262 (⌬gldM), and CJ2262
complemented with pTB94a, which carries gldM (⌬gldM pTB94a). CJ1827,
CJ2122, CJ2157, and CJ2262 carried control vector pCP23 so that all strains
were resistant to tetracycline.
Shrivastava et al.
3208 jb.asm.org Journal of Bacteriology
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
10. as a receptor, suggests a role for SprE in RemA secretion also (4, 6).
Cells with mutations in sprA, sprE, and sprT were each deficient in
attachment to glass (Table 4), presumably as a result of a failure to
secrete SprB, RemA, and other adhesins to the cell surface.
SprA, SprE, and SprT may be less central than GldK, GldL,
GldM, and GldN to protein secretion and to gliding motility.
Cells with mutations in sprA, sprE, and sprT differ from cells of the
gldK, gldL, gldM, and gldNO deletion mutants in two respects.
First, cells of the gld mutants are completely nonmotile, whereas
cells of sprA, sprE, and sprT mutants are severely deficient in mo-
tility but exhibit weak gliding movements on wet glass surfaces (6,
7, 18). This phenotype was verified for the newly constructed sprA
deletion mutant (see Movie S4 in the supplemental material). Sec-
ond, cells of the gld mutants were completely resistant to infection
by all bacteriophages tested, whereas cells of sprA, sprE, and sprT
mutants exhibited resistance to some but not all bacteriophages.
They exhibited increased resistance to Cj1, Cj13, Cj23, and
Cj29, as do sprB mutants (3, 16), and they were partially resistant
to Cj42, Cj48, and Cj54, as are remA mutants (4), but they
remained susceptible to Cj28 (Fig. 7). Resistance of gldK, gldL,
gldM, and gldNO mutants to phages such as Cj28, which infect
cells of CJ1985 (⌬sprB ⌬remA) (4), supports the idea suggested
above that the T9SS secretes cell surface proteins in addition to
SprB and RemA. The sensitivity of sprA, sprE, and sprT mutants to
phages such as Cj28 suggests that although SprA, SprE, and SprT
are needed for secretion of some proteins by the T9SS, they may be
less central to the function of this secretion system than are GldK,
GldL, GldM, and GldN/O. The similar phenotypes of sprA, sprE,
and sprT mutants also suggest the possibility that the proteins
encoded by these genes may function together to support T9SS
function.
DISCUSSION
gldK, gldL, gldM, and gldN were originally discovered as genes
required for F. johnsoniae gliding motility (17). Later, orthologs of
these genes (porK, porL, porM, and porN, respectively) were dem-
onstrated to be required for secretion of P. gingivalis gingipains
(7). The P. gingivalis secretion system was referred to as the Por
secretion system (7) or, more recently, as the T9SS (2, 8). In F.
johnsoniae, gldN and/or its paralog gldO was shown to be essential
for secretion of the motility adhesins SprB and RemA (4, 5). The
results presented here demonstrate that F. johnsoniae gldK, gldL,
and gldM are cotranscribed with gldN and that the products of
each of these genes are required for secretion of SprB and RemA.
The outer membrane motility protein SprA, an ortholog of the P.
gingivalis T9SS protein Sov, is also shown to be required for secre-
tion of SprB and RemA. The results suggest that GldK, GldL,
GldM, GldN, and SprA are each components of the F. johnsoniae
T9SS. Other components of this system, previously shown to be
involved in secretion in F. johnsoniae, include SprE, SprF, and
SprT (6, 7, 16), which are similar in sequence to the P. gingivalis
T9SS proteins PorW, PorP, and PorT, respectively (7, 31). The
demonstration that the F. johnsoniae orthologs of the P. gingivalis
T9SS proteins have roles in protein secretion provides inde-
pendent confirmation of the function of these proteins. Similar
proteins are found in many members of the large and diverse
phylum Bacteroidetes, suggesting that T9SSs are common in
this phylum (2).
The phenotypes of the F. johnsoniae mutants suggest that
GldK, GldL, GldM, and GldN are essential for T9SS function and
that SprA, SprE, and SprT are essential for secretion of many, but
perhaps not all, proteins targeted to this system. Cells lacking
GldK, GldL, GldM, or GldN and its paralog GldO failed to secrete
SprB and RemA and were completely deficient in gliding motility
and attachment to glass. They were also deficient in chitin utiliza-
tion. The defect in chitin utilization is likely the result of a failure
to secrete the chitinase encoded by Fjoh_4555, as previously re-
ported for an sprT mutant (7). SprB and RemA appear to function
as receptors for some but not all F. johnsoniae phages. Cells lacking
GldK, GldL, GldM, or GldN and GldO were resistant to all phages
tested, suggesting that some other proteins secreted by the T9SS
also serve as phage receptors. In contrast, cells with mutations in
sprA, sprE, and sprT exhibited partial phage resistance. They were
resistant to phages Cj1, Cj13, Cj23, and Cj29 (indicating the
absence of SprB on the cell surface) and were partially resistant to
Cj42, Cj48, and Cj54 (suggesting the absence of RemA on the
cell surface). They remained fully susceptible to Cj28. These re-
sults support the suggestion that GldK, GldL, GldM, and GldN (or
GldO) are essential components of the T9SS, whereas SprA, SprE,
and SprT are required for secretion of SprB and RemA but not for
secretion of some other cell surface phage receptors secreted by
the T9SS.
72
56
kDa
95
soluble
membrane
CM
OM
wholecell
wild-type ∆gldK
GldK
A
B
C
soluble
membrane
CM
OM
wholecell
wild-type ∆gldM
56
72
GldM
26
17
soluble
membrane
CM
OM
wholecell
wild-type ∆gldL
GldL
FIG 9 Cell fractionation and immunodetection of GldK, GldL, and GldM.
Cell fractions of wild-type F. johnsoniae CJ1827 cells (lanes 1 to 4) and extracts
of gld mutants (lanes 5) were examined for GldK (A), GldL (B), and GldM (C)
by Western blot analyses. Lanes 1, soluble fraction of cell extract (cytoplasmic
and periplasmic proteins); lanes 2, insoluble fraction of cell extract (primarily
membrane proteins); lanes 3, Sarkosyl-soluble fraction of membranes (pri-
marily cytoplasmic membrane proteins [CM]); lanes 4, Sarkosyl-insoluble
fraction of membranes (primarily outer membrane proteins [OM]); lanes 5,
cell extracts of gldK, gldL, or gldM mutants to demonstrate specificity of the
antisera used in each panel.
F. johnsoniae Motility and T9SS Proteins
July 2013 Volume 195 Number 14 jb.asm.org 3209
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
11. GldK,GldL,GldM,andGldNmayformacomplex.Orthologs
of gldK, gldL, gldM, and gldN are present in many members of the
phylum Bacteroidetes, and they appear to be invariably clustered
together on the genomes in this order, suggesting that, as in F.
johnsoniae, they may be transcribed as a unit. Of 27 sequenced
genomes analyzed that had each of these genes (2), 26 had gldK,
gldL, gldM, and gldN organized as in F. johnsoniae, and the 27th
(Chitinophaga pinensis) had the same organization except that a
201-bp open reading frame of unknown function was present be-
tween gldK and gldL. Unlike the highly conserved gene order, the
sequences of the individual proteins have diverged substantially
(see Fig. S3 to S6 in the supplemental material). This argues
against recent horizontal gene transfer as an explanation for the
conserved gene order. Phylogenetic trees based on GldK, GldL,
GldM, and GldN sequences are similar to those based on 16S
rRNAs (see Fig. S7 to S11 in the supplemental material), suggest-
ing that the T9SS genes have primarily been passed vertically. The
genetic organization of gldK, gldL, gldM, and gldN has probably
been conserved because it is important for function. For example,
the products of conserved gene clusters often interact (32). GldK,
GldL, GldM, and GldN may interact to form a T9SS complex, and
coordinated expression may be required for efficient assembly of
this complex.
Several experimental observations support the suggestion that
GldK, GldL, GldM, and GldN interact. First, as indicated above,
cells with nonpolar mutations in gldL, gldM, and gldN had de-
creased levels of GldK protein. Similarly, cells with mutations in
gldM had decreased levels of GldL protein, and cells with nonpolar
mutations in gldK, gldL, and gldM appeared to have decreased
levels of GldN protein (Fig. 3). These results suggest the possibility
of instability of the proteins in the absence of their partners. Sec-
ond, moderate overexpression (less than 10-fold) of gldK and gldL
together, but not individually, in wild-type cells resulted in ad-
verse effects on growth and motility, suggesting interaction be-
tween the encoded proteins (17). Third, a gldK mutant was iden-
tified that could be partially suppressed by moderate
overexpression of gldL (17). Finally, the P. gingivalis T9SS proteins
PorK, PorL, PorM, and PorN (orthologs of F. johnsoniae GldK,
GldL, GldM, and GldN, respectively) migrate as a large complex
by blue native PAGE (7).
Comparative analysis of GldK, GldL, GldM, and GldN pro-
teins. GldK, GldL, GldM, and GldN are novel proteins, and their
exact functions in secretion and motility are not known. Analysis
of genome sequences revealed orthologs of the genes encoding
each of these proteins in many members of the phylum Bacte-
roidetes but not in bacteria belonging to other phyla (2). GldK is
the most highly conserved of the four proteins. Fifty-six residues
are completely conserved among the 26 sequences examined (see
Fig. S3 in the supplemental material). Each of the proteins has an
N-terminal type 2 signal peptide followed immediately by a cys-
teine, characteristic of bacterial lipoproteins. GldK is similar to
sulfatase-modifying enzymes such as human formylglycine-gen-
erating enzyme (FGE). FGE activates sulfatases by catalyzing the
conversion of the active-site cysteine to formylglycine. GldK is not
thought to have this activity, however, because it lacks the active-
site cysteine residues corresponding to C336 and C341 of FGE (33).
The conserved regions of GldK may be important for protein fold-
ing and/or for protein-protein interactions, but further studies are
needed to determine the exact functions of these regions. GldL
and GldM localize to the cytoplasmic membrane, and sequence
analyses suggest that they each have hydrophobic alpha-helical
membrane-spanning regions. The N-terminal region of GldL is
highly conserved and has two predicted membrane-spanning he-
lices (see Fig. S4 in the supplemental material). The second trans-
membrane helix has a glutamate residue that is conserved in all 26
sequences. The high level of conservation of this charged residue
within a hydrophobic stretch is unusual and suggests the possibil-
ity that it may have an important function. For example, it may be
involved in harvesting cellular energy to power secretion, al-
though other explanations are possible. The remainder of the
GldL protein is predicted to be soluble. Several regions of strong
conservation are scattered across this soluble region of the pro-
tein, including a pocket of high identity near the C terminus.
GldM has a single predicted transmembrane helix. This region lies
near the N terminus and is very highly conserved (see Fig. S5 in
the supplemental material). The high levels of conservation in the
transmembrane regions of GldL and GldM suggest that these have
functions in secretion and/or motility beyond simple membrane
anchoring. GldN is the least conserved of the four proteins (see
Fig. S6 in the supplemental material), with only two residues (N77
and N265; numbered based on F. johnsoniae GldN) present in each
sequence. GldN appears to have a cleavable type 1 signal peptide,
but there is little else to assist in prediction of function. The pres-
ence of GldN, or the nearly identical protein GldO, is essential for
motility and for secretion of SprB, RemA, and chitinase (4, 5).
Future studies will be needed to elucidate their roles in these pro-
cesses.
The results presented indicate that GldK, GldL, GldM, and
SprA are each required for secretion of SprB, RemA, and chitinase.
These proteins presumably function with other previously known
components of the F. johnsoniae T9SS, including GldN, SprE, and
SprT, that are also required for secretion of the same proteins. The
predicted outer membrane protein SprF, which exhibits similarity
to the P. gingivalis T9SS protein PorP, is also required for secretion
of SprB but is not needed for secretion of RemA or for chitin
utilization (4, 16). Unlike P. gingivalis, F. johnsoniae has many
sprF-like (porP-like) genes that may encode semiredundant pro-
teins involved in secretion of different proteins. A speculative
model depicting our current understanding of the F. johnsoniae
T9SS is illustrated in Fig. 10. As shown in this diagram, GldL and
GldM are the only known cytoplasmic membrane components of
the F. johnsoniae T9SS. As such, they have potential roles in har-
vesting cellular energy to power secretion, as suggested above, but
further experiments will be needed to determine their exact func-
tions.
GldK, GldL, and GldM are required not only for secretion but
also for gliding motility. The motility defects of cells lacking these
proteins may be explained by their inability to deliver motility
adhesins, such as SprB and RemA, to the cell surface. However,
GldK, GldL, and GldM may also have more direct roles in cell
movement. Although the cell surface adhesins involved in motility
are known, the motor for cell movement has not yet been identi-
fied. Gliding of F. johnsoniae and related bacteria requires the
proton gradient across the cytoplasmic membrane (34–37), and
proteins that span this membrane must be involved in converting
this into cell movement. Twelve Gld proteins required for gliding
of F. johnsoniae have been identified (17), and only four of these
(GldF, GldG, GldL, and GldM) are thought to span the cytoplas-
mic membrane. GldF and GldG do not appear to be central com-
ponents of the gliding machinery because some relatives of F.
Shrivastava et al.
3210 jb.asm.org Journal of Bacteriology
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
12. johnsoniae lack these proteins and yet exhibit rapid gliding motil-
ity (2). This leaves GldL and GldM as candidates for the motor
proteins that harvest cellular energy and propel SprB and RemA,
resulting in cell movement. Alternatively, some other unidentified
cytoplasmic membrane proteins may perform these motor func-
tions. Further study is needed to determine whether GldL and
GldM have roles in gliding beyond secretion of SprB and RemA
and to determine the exact functions of each of the T9SS proteins
in protein secretion.
ACKNOWLEDGMENT
This research was supported by grant MCB-1021721 from the National
Science Foundation.
REFERENCES
1. Jarrell KF, McBride MJ. 2008. The surprisingly diverse ways that pro-
karyotes move. Nat. Rev. Microbiol. 6:466–476.
2. McBride MJ, Zhu Y. 2013. Gliding motility and Por secretion system
genes are widespread among members of the phylum Bacteroidetes. J. Bac-
teriol. 195:270–278.
3. Nelson SS, Bollampalli S, McBride MJ. 2008. SprB is a cell surface
component of the Flavobacterium johnsoniae gliding motility machinery.
J. Bacteriol. 190:2851–2857.
4. Shrivastava A, Rhodes RG, Pochiraju S, Nakane D, McBride MJ. 2012.
Flavobacterium johnsoniae RemA is a mobile cell surface lectin involved in
gliding. J. Bacteriol. 194:3678–3688.
5. Rhodes RG, Samarasam MN, Shrivastava A, van Baaren JM, Pochiraju
S, Bollampalli S, McBride MJ. 2010. Flavobacterium johnsoniae gldN and
gldO are partially redundant genes required for gliding motility and sur-
face localization of SprB. J. Bacteriol. 192:1201–1211.
6. Rhodes RG, Samarasam MN, Van Groll EJ, McBride MJ. 2011. Muta-
tions in Flavobacterium johnsoniae sprE result in defects in gliding motility
and protein secretion. J. Bacteriol. 193:5322–5327.
7. Sato K, Naito M, Yukitake H, Hirakawa H, Shoji M, McBride MJ,
Rhodes RG, Nakayama K. 2010. A protein secretion system linked to
bacteroidete gliding motility and pathogenesis. Proc. Natl. Acad. Sci.
U. S. A. 107:276–281.
8. Sato K, Yukitake H, Narita Y, Shoji M, Naito M, Nakayama K. 2013.
Identification of Porphyromonas gingivalis proteins secreted by the Por
secretion system. FEMS Microbiol. Lett. 338:68–76.
9. Abdallah AM, Gey van Pittius NC, Champion PA, Cox J, Luirink J,
Vandenbroucke-Grauls CM, Appelmelk BJ, Bitter W. 2007. Type VII
secretion—mycobacteria show the way. Nat. Rev. Microbiol. 5:883–891.
10. Desvaux M, Hebraud M, Talon R, Henderson IR. 2009. Secretion and
subcellular localizations of bacterial proteins: a semantic awareness issue.
Trends Microbiol. 17:139–145.
11. Economou A, Christie PJ, Fernandez RC, Palmer T, Plano GV, Pugsley
AP. 2006. Secretion by numbers: protein traffic in prokaryotes. Mol. Mi-
crobiol. 62:308–319.
12. Nguyen KA, Travis J, Potempa J. 2007. Does the importance of the
C-terminal residues in the maturation of RgpB from Porphyromonas gin-
givalis reveal a novel mechanism for protein export in a subgroup of
Gram-negative bacteria? J. Bacteriol. 189:833–843.
13. Seers CA, Slakeski N, Veith PD, Nikolof T, Chen YY, Dashper SG,
Reynolds EC. 2006. The RgpB C-terminal domain has a role in attach-
ment of RgpB to the outer membrane and belongs to a novel C-terminal-
domain family found in Porphyromonas gingivalis. J. Bacteriol. 188:6376–
6386.
14. Shoji M, Sato K, Yukitake H, Kondo Y, Narita Y, Kadowaki T, Naito M,
Nakayama K. 2011. Por secretion system-dependent secretion and glyco-
sylation of Porphyromonas gingivalis hemin-binding protein 35. PLoS One
6:e21372. doi:10.1371/journal.pone.0021372.
15. Slakeski N, Seers CA, Ng K, Moore C, Cleal SM, Veith PD, Lo AW,
Reynolds EC. 2011. C-terminal domain residues important for secretion
and attachment of RgpB in Porphyromonas gingivalis. J. Bacteriol. 193:
132–142.
16. Rhodes RG, Nelson SS, Pochiraju S, McBride MJ. 2011. Flavobacterium
johnsoniae sprB is part of an operon spanning the additional gliding mo-
tility genes sprC, sprD, and sprF. J. Bacteriol. 193:599–610.
17. Braun TF, Khubbar MK, Saffarini DA, McBride MJ. 2005. Flavobacte-
rium johnsoniae gliding motility genes identified by mariner mutagenesis.
J. Bacteriol. 187:6943–6952.
18. Nelson SS, Glocka PP, Agarwal S, Grimm DP, McBride MJ. 2007.
Flavobacterium johnsoniae SprA is a cell surface protein involved in gliding
motility. J. Bacteriol. 189:7145–7150.
19. Saiki K, Konishi K. 2007. Identification of a Porphyromonas gingivalis
novel protein Sov required for the secretion of gingipains. Microbiol. Im-
munol. 51:483–491.
20. Rhodes RG, Pucker HG, McBride MJ. 2011. Development and use of a gene
deletion strategy for Flavobacterium johnsoniae to identify the redundant mo-
tility genes remF, remG, remH, and remI. J. Bacteriol. 193:2418–2428.
21. McBride MJ, Kempf MJ. 1996. Development of techniques for the genetic
manipulation of the gliding bacterium Cytophaga johnsonae. J. Bacteriol.
178:583–590.
22. Agarwal S, Hunnicutt DW, McBride MJ. 1997. Cloning and character-
ization of the Flavobacterium johnsoniae (Cytophaga johnsonae) gliding
motility gene, gldA. Proc. Natl. Acad. Sci. U. S. A. 94:12139–12144.
23. Liu J, McBride MJ, Subramaniam S. 2007. Cell surface filaments of the
gliding bacterium Flavobacterium johnsoniae revealed by cryo-electron to-
mography. J. Bacteriol. 189:7503–7506.
24. Kempf MJ, McBride MJ. 2000. Transposon insertions in the Flavobacte-
rium johnsoniae ftsX gene disrupt gliding motility and cell division. J. Bac-
teriol. 182:1671–1679.
25. Hunnicutt DW, McBride MJ. 2000. Cloning and characterization of the
Flavobacterium johnsoniae gliding motility genes gldB and gldC. J. Bacte-
riol. 182:911–918.
26. Chang LYE, Pate JL, Betzig RJ. 1984. Isolation and characterization of
nonspreading mutants of the gliding bacterium Cytophaga johnsonae. J.
Bacteriol. 159:26–35.
27. Pate JL, Petzold SJ, Chang L-YE. 1979. Phages for the gliding bacterium
Cytophagajohnsonaethatinfectonlymotilecells.Curr.Microbiol.2:257–262.
28. Wolkin RH, Pate JL. 1985. Selection for nonadherent or nonhydrophobic
mutants co-selects for nonspreading mutants of Cytophaga johnsonae and
other gliding bacteria. J. Gen. Microbiol. 131:737–750.
29. Chen S, Bagdasarian M, Kaufman MG, Bates AK, Walker ED. 2007.
Mutational analysis of the ompA promoter from Flavobacterium john-
soniae. J. Bacteriol. 189:5108–5118.
SprB
ChiA
SprF SprT
SprA
GldK
GldL
GldN
GldM
SprE
T9SS
OM
CM
RemA
SecYEG
SprB
RemA
ChiA
FIG 10 Speculative model of the F. johnsoniae T9SS. GldK, GldL, GldM, and
GldN form the core components that are required for secretion. GldO (not
shown) is nearly identical to GldN and is partially redundant with it. The outer
membrane proteins SprA and SprT and the lipoprotein SprE are required for
secretion of SprB, RemA, and ChiA, but they may not be required for secretion
of all proteins targeted to the T9SS. SprF is needed for secretion of SprB but not
for secretion of RemA and ChiA. F. johnsoniae has many paralogs of sprF that
may encode proteins involved in secretion of proteins other than SprB. Pro-
teins secreted by the T9SS all have predicted type 1 signal peptides and are
predicted to be exported across the cytoplasmic membrane by the Sec system
before being secreted across the outer membrane by the T9SS. Black lines
indicate lipid tails on lipoproteins. Proteins are not drawn to scale, and stoi-
chiometry of components is not known.
F. johnsoniae Motility and T9SS Proteins
July 2013 Volume 195 Number 14 jb.asm.org 3211
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom
13. 30. Stanier RY. 1947. Studies on non-fruiting myxobacteria. I. Cytophaga
johnsonae, n. sp., a chitin-decomposing myxobacterium. J. Bacteriol. 53:
297–315.
31. Sato K, Sakai E, Veith PD, Shoji M, Kikuchi Y, Yukitake H, Ohara N,
Naito M, Okamoto K, Reynolds EC, Nakayama K. 2005. Identification
of a new membrane-associated protein that influences transport/
maturation of gingipains and adhesins of Porphyromonas gingivalis. J. Biol.
Chem. 280:8668–8677.
32. Dandekar T, Snel B, Huynen M, Bork P. 1998. Conservation of gene
order: a fingerprint of proteins that physically interact. Trends Biochem.
Sci. 23:324–328.
33. Dierks T, Dickmanns A, Preusser-Kunze A, Schmidt B, Mariappan M,
von Figura K, Ficner R, Rudolph MG. 2005. Molecular basis for multiple
sulfatase deficiency and mechanism for formylglycine generation of the
human formylglycine-generating enzyme. Cell 121:541–552.
34. Duxbury T, Humphrey BA, Marshall KC. 1980. Continuous observa-
tions of bacterial gliding motility in a dialysis microchamber: the effects of
inhibitors. Arch. Microbiol. 124:169–175.
35. Dzink-Fox JL, Leadbetter ER, Godchaux W, III. 1997. Acetate acts as a
protonophore and differentially affects bead movement and cell migra-
tion of the gliding bacterium Cytophaga johnsonae (Flavobacterium john-
soniae). Microbiology 143:3693–3701.
36. Pate JL, Chang L-YE. 1979. Evidence that gliding motility in prokaryotic
cells is driven by rotary assemblies in the cell envelopes. Curr. Microbiol.
2:59–64.
37. Ridgway HF. 1977. Source of energy for gliding motility in Flexibacter
polymorphus: effects of metabolic and respiratory inhibitors on gliding
movement. J. Bacteriol. 131:544–556.
38. McBride MJ, Braun TF. 2004. GldI is a lipoprotein that is required for
Flavobacterium johnsoniae gliding motility and chitin utilization. J. Bacte-
riol. 186:2295–2302.
39. McBride MJ, Xie G, Martens EC, Lapidus A, Henrissat B, Rhodes RG,
Goltsman E, Wang W, Xu J, Hunnicutt DW, Staroscik AM, Hoover TR,
Cheng YQ, Stein JL. 2009. Novel features of the polysaccharide-digesting
gliding bacterium Flavobacterium johnsoniae as revealed by genome se-
quence analysis. Appl. Environ. Microbiol. 75:6864–6875.
Shrivastava et al.
3212 jb.asm.org Journal of Bacteriology
onNovember13,2013byHarvardLibrarieshttp://jb.asm.org/Downloadedfrom