Downloaded 421 times
Uploaded bySartony Sihombing
SUBSTANSI GENETIKA
Dokumen tersebut membahas tentang substansi genetika yang mencakup beberapa topik utama seperti kromosom, DNA, RNA, dan kode genetik. Kromosom berisi DNA yang berfungsi sebagai penyimpan informasi genetik dan mereplikasi diri sendiri sebelum pembelahan sel. Ada beberapa jenis RNA yang terlibat dalam ekspresi gen seperti pembentukan protein. Kode genetik mengatur hubungan antara urutan nukleotida DNA/RNA dengan urutan
More Related Content
![Modul Ajar KBC SKI Kelas 6 MI [MODULKELAS.COM]](https://cdn.slidesharecdn.com/ss_thumbnails/modulajarkbcskikelas6mimodulkelas-260207160743-753abfd0-thumbnail.jpg?width=640&height=640&fit=bounds)
![Modul Ajar KBC Akidah Akhlak Kelas 5 MI [MODULKELAS.COM]](https://cdn.slidesharecdn.com/ss_thumbnails/modulajarkbcakidahakhlakkelas5mimodulkelas-260205160818-304c5d00-thumbnail.jpg?width=640&height=640&fit=bounds)
SUBSTANSI GENETIKA
- 1.
- 2. Kromosom Kromatid Nukleus Bentuk kromosom RNA a/penyimpan informasi genetik (pada virus) Tipe dan jumlah kromosom Apa itu RNA Kromatin RNA a/ penyalur informasi genetik (pada proses translasi sintesis protein) Tipe-tipe RNA Solenoid RNA juga dapat menjadi enzim (ribozim) untuk mengkatalis RNA sendiri. RNAm Nukleosom/Nukleoprotein Protein RNAt RNAr Asam Nukleat Komponen : Gula Ribosa Basa N : Adenin, Guanin DNA Apa itu DNA DNA a/ penyimpan informasi genetik DNA a/ makromolekul yang terdiri dari banyak urutan nukleotida (kode genetik) RNA Sitosin Urasil Struktur RNA Bentuk: rantai pendek, tunggal, tdk berpilin Struktur DNA Replikasi DNA Komponen : Gula Dioksiribosa Letak : nukleus, sitoplasma, kloroplas, mitokondria Kadar tidak tetap Basa N : Adenin, Guanin Sitosin Timin Bentuk : rantai panjang double helix Letak : nukleus, kloroplas, mitokondria Kadar : tetap Konservatif Semikonservatif Dispersif
- 3. SUBSTANSI GENETIKA • Molekul besaryang bertanggung jawab mengatur jalannya seluruh peristiwa kimia (metabolisme) di dalam tubuh mahluk hidup adalah DNA dan atau RNA. • DNA dan RNA juga berfungsi sebagai unit informasi genetik yang dapat diwariskan kepada keturunan. • DNA dan RNA digolongkan sebagai Asam Nukleat • DNA adalah salah satu komponen penyusun kromosom.
- 4.
- 5.
- 6. KROMOSOM • Terdapat dalamnukleus (inti sel) • Kromosom berasal dari benang-benang kromatin yang kemudian menebal menjadi kromosom ketika sel siap untuk membelah. • Adalah struktur padat yang terdiri dari dua komponen yaitu : Asam Nukleat dan protein.
- 7.
- 8. Bab 3 SubstansiGenetika KROMOSOM (2) Bereplikasi Sentromer Konstriksi (lekukan) sekunder Kromonema Satelit Konstriksi primer Sentromer Kromomer Bagian-bagian kromosom.
- 9. Bab 3 SubstansiGenetika KROMOSOM (3) Metasentrik Akrosentrik Submetasentrik Telosentrik XY Macam-macam bentuk kromosom. Kariotipe manusia.
- 10. 1. KROMATID :Adalah salah satu lengan dari dua lengan kromosom. 2. KROMOMER : Adalah akumulasi dari materi kromatin 3. SENTROMER : Adalah daerah pelekukan disekitar bagian tengah kromosom. 4. SATELIT : Adalah bulatan diujung lengan kromatid yang terbentuk karena ada pelekukan kedua. 5. TELOMER : Adalah daerah terujung pada lengan kromosom yang berfungsi menjaga stabilitas daerah tersebut agar DNA tidak terurai.
- 11. BENTUK-BENTUK KROMOSOM • KromosomMetasentrik : Adalah kromosom yang letak sentromernya ditengah lengan kromatid. • Kromosom Submetasentrik : Adalah kromosom yang letak sentromernya tidak ditengah lengan kromatid. – Kromosom Aksosentrik : adalah kromosom yang letak sentromernya di daerah antara ujung dengan bagian tengah lengan kromatid – Kromosom Telosentrik : adalah kromosom yang sentromernya terletak di ujung lengan kromatid.
- 12. Bentuk-bentuk kromosom berdasarkan letak sentromernya: A. TELOSENTRIK B. AKROSENTRIK C. METASENTRIK
- 13. TIPE & JUMLAH KROMOSOM •Tampilan Visual kromosom setiap individu disebut KARIOTIPE • Kromosom yang memiliki pasangan dengan panjang, letak sentromer dan pola pewarnaan yang sama disebut Kromosom Homolog Organisme Manusia Jumlah kromosom 46 Lalat buah 8 Simpanse 48 Katak 26 Kuda 64
- 14. Genotype Specificity Each individualis identified by a relatively unique combination of nucleotides found in long coiled strands of DNA organized as chromosomes found in a cell’s nucleus. The number and arrangement of chromosomes in an organism is characteristic of that organism, and can be represented as a karyotype, which derived by arranging the chromosomes in pairs by size. The karyotype can be used to show differences in genetic makeup (genotype), which determines the features that person has (phenotype). Karyotypes of various humans are shown. KARIOTIPE LAKI - LAKI NORMAL Shows 23 pairs of chromosomes. Twenty two pairs are called autosomes, 1 pair is called the sex chromosomes ; XY in a male. Males are associated with secondary sexual characteristics – abundant facial hair, voice, others. Differences are also evident in the genitalia.
- 15. • Tipe Kromosom: – AUTOSOM : Kromosom tubuh menentukan karakter fisik – GONOSOM : Kromosom seks penentu jenis kelamin • Jumlah kromosom pada manusia : – Pada setiap sel somatik ( sel tubuh) terdapat 22 pasang autosom dan 1 pasang gonosom – Pada setiap gamet (sel kelamin) • Sperma (sel kelamin jantan) terdapat 22 autosom dan gonosom X atau gonosom Y • Ovum (sel kelamin betina) terdapat 22 autosom dan gonosom X
- 16. • PENGEMASAN DNA DALAM KROMOSOM Strukturpadat kromosom hanya jelas terlihat pada tahap metafase dalam pembelahan sel • Pada tahap profase terjadi pengemasan DNA dalam kromosom dengan tahapan : – 1. DNA diikat oleh protein menjadi suatu unit yang disebut nukleosom/nukleoprotein. – 2. Nukleosom/nukleoprotein membentuk pintalan benang yang disebut solenoid. – 3. Solenoid tersusun menjadi benang padat yang disebut Benang Kromatin. – 4. Benang kromatin tersusun menjadi lengan kromatid. – 5. Dua lengan kromatid kembar menjadi kromosom.
- 18. BAHAN GENETIKA Bahan genetikyang baik harus memenuhi ciri-ciri sebagai berikut: 1. Mengandung informasi untuk struktur, fungsi, perkembangan, dan reproduksi sel. 2. Bereplikasi secara akurat → sel keturunan memiliki bahan genetik yang sama seperti induknya. 3. Mampu bervariasi (melalui mutasi dan rekombinasi) → adaptasi perubahan dan evolusi terhadap
- 19. MENCARI MOLEKUL MATERI GENETIK •Mendel → Ada faktor yang diturunkan • Percobaan Frederick Griffith
- 20.
- 21.
- 22. GEN • Gen adalahfragmen DNA yang diikat atau diselubungi oleh protein. • Gen adalah unit informasi genetik. • Sifat Gen : – Dominan : adalah gen yang sekalipun bersama dengan gen lain tetapi karakternya diekspresikan sepenuhnya. – Resesif : adalah gen yang karakternya tidak muncul, tertutup oleh gen yang dominan. – Intermedier : adalah gen yang saling mempengaruhi. • Total informasi genetik yang disimpan dalam kromosom disebut GENOM. • Gen penentu karakter tertentu disimbolkan dengan huruf tertentu : – Huruf besar untuk gen yang dominan – Huruf kecil untuk gen yang resesif
- 23. ALEL • Setiap genyang menentukan karakter fisik tertentu menempati Lokus pada masing kromosom homolog. • Misal : gen penentu warna mata menempati suatu lokus pada satu kromosom, maka kromosom homolognya juga memiliki gen penentu warna mata pada lokus yang setara. • Pasangan gen yang seperti ini disebut Alel. Alel atau disebut juga alternatif gen menentukan variasi pada pewarisan suatu sifat.
- 24. STRUKTUR DNA • DNAsudah terbukti merupakan substansi genetika (penyusun gen) • Bagaimana strukturnya? • Bagaimana mekanisme pengaturannya
- 25. Komponen DNA • Polimer,polinukleotida – Deoksiribosa – Basa nitrogen: purin dan pirimidin – Gugus fosfat
- 27. STRUKTUR DNA: DOUBLE HELIX •Aturan Chargaff :
- 28. • Rosalind Franklindan Maurice Wilkins – Difraksi sinar-X
- 29. Rantai DNA Gugus fosfat deoksiribosa terikatpada karbon nomor 5 gula Basa nitrogen terikat pada karbon no 1 gula deoksiribosa Untuk membentuk rantai, nukleotidanukleotida saling berikatan menggunakan ikatan fosfodiester
- 31. • Crick danWatson: DNA double Helix
- 32.
- 33. KROMOSOM A. DNA danKromosom ditemukan pada sel prokariot dan eukariot 1. Sel Prokaryot- DNA berada di sitoplasma, sirkuler, 1 atau lebih
- 34. DNA bakteri panjangnyaberukuran 1000 kali dari panjang bakteri itu sendiri
- 35. 2. Sel Eukaryotik-DNA berada di dalam inti sel
- 36. B. Struktur Kromosom-kromosom terkecil manusia berukuran 30 juta pasang basa 1. Kromosom Eukaryotik terpaket dalam suatu struktur yang disebut chromatin. DNA chromatin mengulir pada protein histones
- 37.
- 38. Gen Organisme Eukariot a g q Promotor– transkripsi dimulai di Area Penyandi Protein sini (Exons) Termination of transcription
- 39. C. Replikasi DNA 1.Duplikasi DNA- sebelum sel membelah, DNA menduplikasi dalam proses yang disebut replikasi
- 40. • • REPLIKASI DNA Replikasi adalahperistiwa sintesis DNA. Ketika sel membelah secara mitosis sel anak harus mengandung DNA penuh dan identik dengan DNA pada sel induk. Karena itu DNA harus direplikasi (diperbanyak) dengan secara tepat sebelum proses pembelahan sel dimulai. Replikasi terjadi dengan tiga model: – Konservatif : dua rantai DNA lama tidak berubah, berfungsi sebagai cetakan untuk dua rantai DNA baru. – Semi Konservatif : dua rantai DNA lama terpisah kemudian rantai baru disintesis dengan prinsip komplementasi pada masing-masing rantai DNA lama tsb. Akhirnya dihasilkan dua rantai DNA baru yang masing-masing mengandung satu rantai lama dan satu rantai baru hasil sintesis. – Dispersif : beberapa bagian dari kedua rantai DNA lama digunakan sebagai cetakan untuk sintesis rantai DNA baru, Akhirnya diperoleh dua rantai DNA yang masing-masing mengandung sebagian rantai DNA lama dan rantai DNA baru.
- 41.
- 42. KODE GENETIK • • • • Kode Genetikadalah pengkodean urutan nukleotida pada DNA atau RNA untuk menentukan urutan asam amino pada saat pembuatan protein (sintesis protein) Informasi pada kode genetik ditentukan oleh basa Nitrogen pada rantai DNA yang akan menentukan susunan asam amino. Susunan tiap tiga nukleotida akan membentuk satu macam asam amino Mis : AGU, GAS, SGS dll Kombinasi triplet dari 4 macam basa Nitrogen akan menghasilkan 64 macam asam amino padahal ditubuh kita hanya ada sekitar 20 asam amino. Hal ini menyebabkan adanya “kelimpahan” dalam kode genetika yang disebut dengan “redundasi”
- 43. KODON (Kode Genetik) •Kodon (Kode Genetik) adalah susunan tiap tiga nukleotida yang mewakili informasi bagi suatu asam amino tertentu
- 44.
- 45. TIPE RNA • • • RNAd adalahRNA yang urutan basanya komplementer (berpasangan) dengan salah satu urutan basa rantai DNA. RNAd membawa pesan atau kode genetik (kodon) dari kromosom di dalam inti sel ke ribosom. RNAd berupa rantai tunggal yang relatif panjang. RNAr adalah RNA yang merupakan komponen utama penyusun ribosom. Setiap unit ribosom terdiri dari 30-46% molekul RNAr dan 70-80% protein. RNAt adalah RNA pembawa asam amino satu persatu ke ribosom yang akan digunakan dalam pengurutan asam amino sesuai urutan kodon pada RNAd. Pada salah satu ujung RNAt terdapat tiga basa N yang disebut antikodon, sedang ujung yang lain adalah tempat melekatnya asam amino.
- 46. Perbedaan DNA danRNA Parameter DNA RNA Komponen : •Gula Deoksiribosa Ribosa -Purin Adenin, Guanin Adenin, Guanin -Pirimidin Bentuk Timin, Sitosin Rantai panjang, ganda dan berpilin Urasil, Sitosin Rantai pendek, tunggal dan tidak berpilin •Basa Nitrogen Letak (double helix) Di dalam nukleus, kloroplas, mitokondria Kadar Tetap Di dalam nukleus, sitoplasma, kloroplas, mitokondria Tidak tetap
- 47. Ekspresi gen :SINTESIS PROTEIN • Fenotip suatu individu ditentukan oleh aktivitas enzim. Enzim yang berbeda akan menimbulkan fenotip yang berbeda. Perbedaan satu enzim dan enzim lain ditentukan oleh jumlah, jenis dan susunan asam amino penyusun enzim. Susunan asam amino ini ditentukan oleh gen/DNA • Ekspresi gen adalah proses dimana kode genetik yang dibawa oleh gen diterjemahkan menjadi urutan asam amino. • Ekspresi gen merupakan sintesis protein yang berlangsung dalam 2 tahap yaitu : • Transkripsi : yaitu penyalinan urutan rantai nukleotida templat dari DNA untuk menghasilkan satu rantai RNA. Proses ini berlangsung di dalam inti sel. • Translasi : Penterjemahan urutan nukleotida rantai RNA menjadi urutan asam amino untuk membentuk rantai polipeptida.
- 48. • • TRANSKRIPSI Adalah sintesis(PENYALINAN)rantai RNA darisalah satu rantai DNA, yaitu cetakan (sense) sedang rantai DNA komplemennya disebut antisense. Transkripsi berlangsung di dalam inti sel dalam 3 tahap yaitu : • Inisiasi (permulaan) : adalah tahap dimana enzyme RNA polimerase melekat pada rantai DNA untuk memutuskan ikatan hidrogen antara 2 rantai DNA sekaligus memilih rantai DNA yang berfungsi sebagai template (sense) dan mana yg sebagai antisense • Elongasi (perpanjangan) : adalah tahap dimana RNA polimerase bergerak disepanjang DNA sambil menambahkan nukleotida ke ujung 3’ dari rantai RNA yang sedang tumbuh. • Terminasi (penutup) : Elongasi terus berlangsung sampai RNA polimerase mentranskripsi urutan DNA yang disebut terminator. Terminator adalah urutan DNA yang berfungsi menghentikan proses transkripsi.
- 49.
- 50.
- 51.
- 52. TRANSLASI (PENTERJEMAHAN) • • • • • • Adalah prosespenterjemahan kode genetik (kodon) dari rantai RNAd hasil transkripsi menjadi urutan asam amino untuk membentuk rantai polipeptida. Translasi berlangsung dengan syarat : ada RNAd hasil transkripsi, satu RNAt yang membawa asam amino pertama (Metionin) serta dua unit ribosom. Translasi berlangsung di ribosom dalam 3 tahap yaitu : Inisiasi : adalah tahap dimana ribosom unit kecil melekat pada kodon AUG RNAd yang memberikan sinyal dimulainya proses translasi, lalu Kodon triplet AUG membentuk ikatan dengan antikodon RNAt yang membawa asam amino metionin. Kodon AUG disebut kodon start karena berfungsi sebagai kodon awal translasi. Elongasi : Pada tahap ini asam amino-asam amino berikutnya ditambahkan satu persatu pada asam amino pertama (Metionin), dengan cara Kodon RNAd berikutnya berikatan dengan antikodon yang komplemen. Pada tahap ini asam amino sebelumnya memisahkan diri dengan RNAt pembawanya lalu bergabung dengan asam amino yang dibawa oleh RNAt berikutnya, sementara itu anti kodon RNAt yang sdh kehilangan asam amino masih melekat pada kodon RNAd. Demikian seterusnya RNAt bergeser samapai akhirnya meninggalkan ribosom sementara rNAt yang membawa asam amino lain masuk ke ribosom. Terminasi : Elongasi berlanjut sampai kodon stop. Triplet kodon stop adalah UAA, UAG dan UGA. Kodon stop tidak mengkode asam amino tetapi bertindak sebagai sinyal untuk menghentikan translasi.
- 53.
- 55.
- 56.
- 58. MUTATIONS Wild-type strain (dominant allele) Mutantstrain (recessive allele) DNA Mutant DNA RNA Altered RNA Correct PROTEIN Defective PROTEIN Normal PHENOTYPE (wild-type) Mutant PHENOTYPE ( functional enzyme) (non-functional enzyme)
- 59. • What are Mutations ? Mutationsare results of changes to the normal DNA sequence for a gene • Typical gene - a linear sequence of about 2000 base pairs AGCCGTGCTGTCGAAAACGTTCAGACTCATTGGCAATCCGAAGTCGGCA TCGGCACGACAGCTTTTGCAAGTCTGAGTAACCGTTAGGCTTCAGCCGT • A mutant allele could result from change in only one of them - knocking out the function of that gene AGCCGTGCTGTCGAAAACTTTCAGACTCATTGGCAATCCGAAGTCGGCA TCGGCACGACAGCTTTTGAAAGTCTGAGTAACCGTTAGGCTTCAGCCGT
- 60. Some types ofpoint mutations 5’ AUG UUA UUA ACU AAG 3’(RNA) met leu leu thr lys (protein) • A neutral mutation - no effect on phenotype AUG UUA UUG ACU AAG met leu leu thr lys
- 61. Some types ofpoint mutations 5’ AUG UUA UUA ACU AAG 3’(RNA) met leu leu thr lys (protein) • A missense mutation -- may cause defective protein AUG UUA UUU ACU AAG met leu phe thr lys Changes ‘sense’ of one amino-acid • A nonsense mutation -- will make shorter protein AUG UUA UGA ACU AAG met leu stop . .
- 62. Some types ofpoint mutations 5’ AUG UUA UUA ACU AAG 3’(RNA) met leu leu thr lys (protein) • A base substitution mutation AUG UUA UUU ACU AAG met leu phe thr lys • An insertion or a deletion (frameshift) U AA AUG UUA UUA ACU AAG G-stop met leu leu thr lys
- 63. Some types ofpoint mutations AUG UUA UUA ACU AAC met leu leu thr asn Insertion of 1 base AUG UUU AUU AAC UAA C met phe ile asn stop ... All amino acids now scrambled from this point on Insertion of 2 bases AUG UUU UAU UAA CUA AC met phe tyr stop ... ... All amino acids now scrambled from this point on Insertion of 3 bases AUG UUA UUA UUA ACU AAC met leu leu leu thr asn Amino acids now OK again
- 64. Summary : typesof mutations • Mutations can be – – – – Neutral - no change to protein Missense - change one a.a. for another Nonsense - cause premature stop signal frameshift - cause scrambled sequence of a.a’s • Mutations can be:– Substitutions - change one base for another – Insertions/Deletions - gain or loss of a base resulting in frameshifts
- 65. Base Substitutions • Asubstitution mutation can be… – a transition A↔G C↔T – a transversion A ↔ T G↔C • purine ↔ purine • pyrimidine ↔ pyrimidine • purine ↔ pyrimidine • Transversions are less likely because they result in a change in helix diameter
- 66. An example: sickle-cellanaemia • Allele HA → HS • DNA template strand -CTC- → -CAC- • mRNA -GAG- → -GUG- • amino acid #6 in β chain of hemoglobin -glu- → -val(acidic) (aliphatic)
- 67. Chromosomal mutations • Sofar have been talking about point mutations - changes to individual base pairs. • However, other mutations can involve large scale changes to chromosomes • • • • Deletions of large sections of a chromosome. Duplications of large sections of a chromosome Inversions (inverted sections of a chromosome). Translocations (exchanges of sections of nonhomologous chromosomes) • Transposons - bits of DNA that suddenly ‘jump’ to a new location - also knock out genes and cause mutation
- 68.
- 70.
- 71.
- 72. From E.coli toa Map of Our Genes • Research on E. coli revealed that these bacteria have a sexual mechanism that can bring about the combining of genes from two different cells • This discovery led to the development of recombinant DNA technology – a set of techniques for combining genes from different sources
- 73. • DNA technologyhas many useful applications – The Human Genome Project – The production of vaccines, cancer drugs, and pesticides – Engineered bacteria that can clean up toxic wastes
- 74. BACTERIA AS TOOLSFOR MANIPULATING DNA In nature, bacteria can transfer DNA in three ways • Transformation, the taking up of DNA from the fluid surrounding the cell DNA enters cell Fragment of DNA from another bacterial cell Bacterial chromosome (DNA) Figure 12.1A
- 75. • Transduction, the• Conjugation, the union transfer of bacterial of cells and the DNA transfer between them genes by a phage Mating bridge Phage Fragment of DNA from another bacterial cell (former phage host) Sex pili Donor cell (“male”) Figure 12.1B Figure 12.1C Recipient cell (“female”)
- 76. • The transferredDNA is then integrated into the recipient cell’s chromosome Donated DNA Degraded DNA Crossovers Recipient cell’s chromosome Figure 12.1D Recombinant chromosome
- 77. Bacterial plasmids canserve as carriers for gene transfer F factor (integrated) • An F factor is a DNA segment in bacteria that enables conjugation and contains an origin of replication Male (donor) cell Origin of F replication Bacterial chromosome F factor starts replication and transfer of chromosome Recipient cell Only part of the chromosome transfers Figure 12.2A Recombination can occur
- 78. F factor (plasmid) Male(donor) cell Bacterial chromosome F factor starts replication and transfer • An F factor can exist as a plasmid, a small circular DNA molecule separate from the bacterial chromosome Plasmids Plasmid completes transfer and circularizes Cell now male Figure 12.2B, C
- 79. Plasmids are usedto customize bacteria: An overview • Plasmids are key tools for DNA technology – Researchers use plasmids to insert genes into bacteria
- 80. 1 Bacterium Plasmid isolated 2 3 Gene Cell containinggene of interest DNA isolated inserted into plasmid Bacterial Plasmid chromosome Gene of interest Recombinant DNA (plasmid) 4 DNA Plasmid put into bacterial cell Recombinant bacterium 5 Cell multiplies with gene of interest Copies of gene Gene for pest resistance inserted into plants Copies of protein Clones of cell Gene used to alter bacteria for cleaning up toxic waste Protein used to make snow form at higher temperature Protein used to dissolve blood clots in heart attack therapy Figure 12.3
- 81. Enzymes are usedto “cut and paste” DNA • Restriction enzymes cut DNA at specific points • DNA ligase “pastes” the DNA fragments together • The result is recombinant DNA Restriction enzyme recognition sequence 1 DNA Restriction enzyme cuts the DNA into fragments 2 Sticky end Addition of a DNA fragment from another source 3 Two (or more) fragments stick together by base-pairing 4 DNA ligase pastes the strand 5 Figure 12.4 Recombinant DNA molecule
- 82. Genes can becloned in recombinant plasmids: A closer look • Bacteria take the recombinant plasmids and reproduce • This clones the plasmids and the genes they carry – Products of the gene can then be harvested
- 83. E. coli 1 IsolateDNA from two sources Human cell 2 Cut both Plasmid DNAs with the same restriction enzyme DNA Gene V Sticky ends 3 Mix the DNAs; they join by base-pairing 4 Add DNA ligase to bond the DNA covalently Recombinant DNA plasmid Gene V 5 Put plasmid into bacterium by transformation 6 Clone the bacterium Bacterial clone carrying many copies of the human gene Figure 12.5
- 84. Gel electrophoresis sortsDNA molecules by size • Restriction fragments of DNA can be sorted by size Mixture of DNA molecules of different sizes Longer molecules Power source Gel Shorter molecules Glass plates Completed gel Figure 12.10
- 85. Restriction fragment analysisis a powerful method that detects differences in DNA sequences Allele 1 • Scientists can compare DNA sequences of different individuals based on the size of the fragments w Cut z x Cut y Figure 12.11A Allele 2 Cut y DNA from chromosomes
- 86.
- 87. • Radioactive probes are alsoused to make comparisons 1 Restriction fragment preparation Restriction fragments 2 Gel electrophoresis 3 Blotting 4 Radioactive probe Filter paper Radioactive, singlestranded DNA (probe) Probe 5 Detection of radioactivity (autoradiography) Film Figure 12.11C
- 88. The PCR methodis used to amplify DNA sequences • The polymerase chain reaction (PCR) can quickly clone a small sample of DNA in a test tube Initial DNA segment 1 2 4 Number of DNA molecules 8 Figure 12.12
- 89. THE CHALLENGE OFTHE HUMAN GENOME Most of the human genome does not consist of genes • The 23 chromosomes in the haploid human genome contain about 3 billion nucleotide pairs – This DNA is believed to include about 35,000 genes and a huge amount of noncoding DNA
- 90. • Much ofthe noncoding DNA consists of repetitive nucleotide sequences – One example includes telomeres at the end of the chromosomes Repeated unit End of DNA molecule NUCLEOTIDE SEQUENCE OF A HUMAN TELOMERE Figure 12.13A
- 91. The Human GenomeProject is unlocking the secrets of our genes • The Human Genome Project involves: – genetic and physical mapping of chromosomes – DNA sequencing – comparison of human genes with those of other species Figure 12.14
- 92. OTHER APPLICATIONS OFDNA TECHNOLOGY DNA technology is used in courts of law • DNA fingerprinting can help solve crimes Defendant’s blood Blood from defendant’s clothes Victim’s blood Figure 12.15A, B
- 93. Recombinant cells andorganisms can mass-produce gene products • Recombinant cells and organisms are used to manufacture useful proteins Table 12.16
- 94. • These sheep carrya gene for a human blood protein that is a potential treatment for cystic fibrosis Figure 12.16
- 95. DNA Technology ischanging the pharmaceutical industry and medicine • Hormones, cancer-fighting drugs, and new vaccines are being produced using DNA technology – This lab equipment is used to produce a vaccine against hepatitis B Figure 12.17
- 96. Genetically modified organismsare transforming agriculture • New genetic varieties of animals and plants are being produced – A plant with a new trait can be created using the Ti plasmid
- 97. Agrobacterium tumefaciens DNA containing gene fordesired trait 1 Ti plasmid T DNA Restriction site Insertion of gene into plasmid using restriction enzyme and DNA ligase Plant cell 2 Recombinant Ti plasmid Introduction into plant cells in culture 3 Regeneration of plant T DNA carrying new gene within plant chromosome Plant with new trait Figure 12.18A
- 98. • “Golden rice”has been genetically modified to contain beta-carotene – This rice could help prevent vitamin A deficiency Figure 12.18B
- 99. Gene therapy maysomeday help treat a variety of diseases Cloned gene (normal allele) • Techniques for manipulating DNA have potential for treating disease by altering an afflicted individual’s genes 1 Insert normal gene into virus Viral nucleic acid Retrovirus 2 Infect bone marrow cell with virus – Progress is slow, however – There are also ethical questions related to gene therapy Figure 12.19 3 Viral DNA inserts into chromosome Bone marrow cell from patient Bone marrow 4 Inject cells into patient
- 100. Genetic Engineering A. SelectiveBreeding- selecting animals with Breeding desired characteristics to produce next generation (domestic animals: horses, cats, farm animals, crop plants)
- 101. 1. Hybridization- crossingdissimilar Hybridization individuals to bring together the best of both organisms. (e.g. disease resistance and foodproducing capacity) Hereford, bred for meat production
- 102. 2. Inbreeding- continuedbreeding of Inbreeding individuals with similar characteristics. Can create serious problems (bringing together 2 recessive alleles) Albinism present in Hopi Indians. Only albino children are produced by albino parents. Two phenotypically normal individuals produce albino and non-albino children. Frequency in US while population = 1 in 37,000. Hopi and Navajo Indians = 1 in 200
- 103. B. Increasing Variation 1.Can increase variation by inducing mutations (using radiation or chemicals) 2. Many mutations are harmful. A few can be beneficial These “oil-eating” bacteria were produced by treating the bacteria with chemicals and radiation, thus inducing a mutation. Hundreds of other useful bacterial strains have been produced this way.
- 104. C. Manipulating DNA 1.Scientist use knowledge of DNA to change DNA molecules 2. Techniques used to extract DNA, cut into smaller pieces and identify base sequences, make unlimited copies of DNA
- 105. 3. Genetic engineering-making changes to engineering DNA code and putting back into cell (by injection into cell, by bacteria, viruses)
- 107. Applications of GeneticEngineering A. Transgenic organisms- contains genes from organisms other organisms 1. Transgenic microorganismsmicroorganisms bacteria used to produce many important substances for health and industry (e.g. transformed bacteria now make insulin, growth hormone, clotting factor cheaply and in great abundance) Transgenic tobacco plant- glows in the dark. Produced by transferring a gene from a firefly into a tobacco plant
- 109. 2. Transgenic Animals-faster growing animals, Animals resistance to disease, etc. A transgenic pig with higher levels of growth hormone produced the meatier pork chop.
- 110. 3. Transgenic Plants-important part of our food Plants supply. (52% of soybeans and 25% of corn are transgenic) resistant to disease, produce their own insecticide, resist weed-killing chemicals, increase vitamin content Transgenic tomato plants containing genes for viral resistance and healthier than those without the resistant genes (right)
- 111. B. Cloning- amember of a population of Cloning genetically identical cells produced from a single cell The adult sheep is Dolly, the first mammal cloned from an adult cell. The lamb is Dolly’s offspring, called Bonnie.
- 112. 1. May findwide use in medical and scientific research 2. Raises serious ethical issues
- 115. RISKS AND ETHICAL CouldGM organisms harm human QUESTIONS health or the environment? • Genetic engineering involves some risks – Possible ecological damage from pollen transfer between GM and wild crops – Pollen from a transgenic variety of corn that contains a pesticide may stunt or kill monarch caterpillars Figure 12.20A, B
- 116. DNA technology raisesimportant ethical questions • Our new genetic knowledge will affect our lives in many ways • The deciphering of the human genome, in particular, raises profound ethical issues – Many scientists have counseled that we must use the information wisely Figure 12.21A-C
- 117.