shuminasa

THE UNIVERSITY OF CHICAGO
Toxoplasmsa gondii:
A Study of Host and Parasite
Macrophage Inhibitory Factor
Interactions
By
Annie Shuminas-Nelson
December 2010
A paper submitted in partial fulfillment of the requirements
for the
Master of Arts degree in the
Master of Arts Program in the Social Sciences
Faculty Advisor: Rima McLeod, MD
Preceptor: Christy Hoffman

T. gondii:
A Study of Host-Parasite MIF Interaction
1
Introduction
Toxoplasma gondii is a protozoan parasite in the phylum
apicomplexa. Although the primary host of T. gondii is the feline in
which it reproduces sexually within the gut, mammals, including
humans, are also affected. The feline is considered its primary host
because it is in the small intestines of the feline that T. gondii will
reproduce sexually. This sexual phase of reproduction produces
oocysts that are shed through feces. T. gondii will then be acquired by
intermediary hosts, typically rodents such as mice and rats as well as
birds, through feces infected soil, grass and food. This allows for
continuation of the T. gondii life cycle by asexual reproduction.
The life cycle of T. gondii involves a sexual and a sexual stage.
The sporozoites within oocysts, once ingested by an intermediate host,
will transform into tachyzoites, which characterize active infection.
Disease caused by T. gondii tachyzoites is called Toxoplasmosis. T.
gondii tachyzoites migrate through the body to settle in muscle and
neuronal cells. At this point T. gondii will encyst into its latent form
which contains a slowly growing form known as a bradyzoite. These
encysted bradyzoites can leave a ruptured cyst causing both tissue
destruction and an inflammatory response.

A. Shuminas-Nelson
2
The asexual forms of T. gondii are also of interest due to the
effects they have on the intermediate and accidental hosts. These
forms affect the host’s immune response and also behavior2,3,4,5,6,7,8
.
Typically a host clears a majority of the tachyzoites from the body.
Most tachyzoites will transform into bradyzoites upon onset of host
immune response. Bradyzoites reside in protective cysts, while the
hosts’ immune response keeps local inflammatory pressure in order to
prevent reactivation and transformation to tachyzoites1
The bradyzoite form characterizes the chronic phase of
toxoplasmosis and it has recently been associated with behavioral
alteration traits in rats chronically infected with T. gondii
.
2,3
. Several
human behavioral studies have also found a correlation to the
presence of serum antibodies for T. gondii along with behavioral
changes within infected persons. However, despite this correlation the
studies do not actually prove a cause and effect relationship4,5
Animal studies have proved to be more illustrative of the effects T.
gondii has on the infected host. Bedroy et al, 2000 found that rats with
Toxoplasma infection not only lost their fear of the odor of feline urine,
the cat being the definitive host for T. gondii, but also appeared to be
attracted to the odor. The study looked at adult Lister-hooded lab rats.
They measured the nocturnal exploratory behavior using outdoor pens
with 16 cells. Each cell contained 1 of 4 scents; undiluted rabbit urine,
.

T. gondii:
3
the rats’ own scent, water and undiluted cat urine. The response to
odor was determined by the number of visits to the cells. Infected rats
made more visits and showed less aversion and a preference to the cat
odor cell compared to non-infected rats. It is important to note that
infected rats exhibited similar behavior to the remaining cells to that of
the non-infected rats6
Another study, performed by Vyas, et al, 2007, looked at the
specificity of behavior alterations, such as innate fear, anxiety and
learned fear in male Long-Evans rats and female BALB/c mice
.
7
. Vyas
found infected animals developed a slight attraction to Bobcat odor.
The study also found little to no change in infected animals with fear
conditioning, hippocampal-dependent learning and food preference,
compared to uninfected animals. This implies a very specific control by
the parasites. The findings lead us away from solely a mechanical, or
direct cellular death, caused by bradyzoites as a cause of the behavior
change as no overt damage to the hippocampus, learned fear or to
olfaction was seen. These findings are significant as they suggest a
specificity of behavioral change that does not seem to support the
assumption that changes are due to general neurologic disease not
specific to T. gondii. If the behavioral changes that are observed in the
murine models are not due to general neurologic disease then what
other mechanisms may play a role?

A. Shuminas-Nelson
4
One possible mechanism through which T. gondii may control its
environment within the host is via a proinflammatory cytokine called
Macrophage Inhibitory Factor (MIF). MIF has been shown to play an
important role in T. gondii infection in rats and mice. Flores et al, 2008
produced a murine MIF knockout model using highly susceptible
CB57BL/6 mice and resistant BALB/c mice and two strains of T. gondii,
a less virulent strain, ME49 and a highly virulent strain, RH8
What role and if so by what properties, does MIF play in T.
gondii infection and how might that cause behavior changes?
Macrophage inhibitory factor (MIF) is a cytokine that has been
correlated with inflammatory immune responses in several
autoimmune diseases and parasite pathology
. Flores
found several important factors in the proposed relationship between
MIF and T. gondii proliferation. The CB57BL/6 and the BALB/c MIF-/-
mice, compared to the Wild Type (WT) control mice succumbed sooner
to infection with more plaque formation and a decrease in the
production of proinflammatory cytokines. It is interesting to note a
decrease was seen in MIF production by the susceptible CB57BL/6 WT
mice. Flores’ findings demonstrate that MIF is protective in T. gondii
infection in BALB/c and CB57BL/6 mice.
9
. It has been suggested
that MIF can act as a modulating molecule between the immune and
the endocrine systems10
. Studies have shown MIF is secreted by

T. gondii:
5
monocytes and macrophages in response to glucocorticoid
stimulation9,11
MIF is expressed as mRNA and as a protein that is stored and
secreted by many different types of cells in humans as well as in rats
and mice. Studies which performed immunochemical reactivity tests
and in situ hybridization found MIF secretion and expression in several
cells, such as T/B-cells, monocytes, macrophages10,
.
12
, neurons in the
cortex, hypothalamus, hippocampus, cerebellum, pons 13,14
Human and murine MIF has both oxidoreductase and
tautomerase activity but in T. gondii it has only been shown to have
tautomerase activity22
. This is significant as the enzymatic activity
associated with this type of hydrogen migration, enol- to keto-, amide-
to imidic acid and amine to imine, is a key component of toxic quinone
detoxification of dopamine production along the catecholamine
tyrosine pathway
,
astrocytes9
, parenchyma cells of the skin, liver, kidneys and lens of the
eye8
, endothelial cells11
as well as in cerebral spinal fluid9
.
15
. Studies support that MIF catalyzes toxic
catecholaminechromes (toxic byproducts of dopamine production) into
indoledihydroxy derivatives, which can lead to neuromelanin
production16
,17
. The ability to breakdown the toxic by-products of
dopamine production may contribute to two important factors in T.
gondii infections: maintenance of host cell viability and environmental

A. Shuminas-Nelson
6
control. The products of the tautomerase activity could protect the
host cells from dopaminergic signaled apoptosis and could help to
control inflammatory response by controlling melanin production and
in turn glucocorticoids18
Human MIF has been found to catalyze the conversion of toxic
catecholamine quinones, the by-products of deamination of tyrosine to
L-Dopa, into neuromelanin precursors
.
19
. Interestingly, neuromelanin is
considered to be neuroprotective of dopaminergic neurons. MIF has
also been shown to exhibit phenylpyruvate tautomerase activity16
. The
significance of an enzymatic similarity by phenylpyruvate tautomerase
to that of MIF adds to the likelihood of melanin biosynthesis, which
decreases the dopaminergic signaled apoptosis, thus allowing for T.
gondii to maintain its host cell environment under the radar of host
immunity20
Behavior can be modulated along the tryosine pathway if this
pathway can be enacted upon. It has been found that T. gondii
encodes for two molecules that putatively influence the tyrosine
pathway12
. The first of these two molecules is aromatic amino acid
hydroxylases 1 and 2 (TgAAAH1, TgAAAH2)
. The evidence, discussed, of the presence of MIF in several
brain regions supports the hypothesis of MIF’s inflammatory influence
during T. gondii infection, but what is the relationship between MIF’s
inflammatory response and mood/behavior alterations?
21,22
. TgAAAH catalyzes the

T. gondii:
7
reaction of tyrosine to L-Dopa, via the penta-functional protein AROM,
which is part of the shikimate pathway23
The ability for TgAAAH1,2 to catalyze dopamine production could
suggest increases in dopamine levels and higher levels of dopamine
are associated with anxiety and psychosis
. Secondly, T. gondii also
encodes a macrophage migration inhibition factor homologue, TgMIF.
24,25
. Increased dopamine in
the prefrontal cortex has also been associated with decrease in
cognitive impairment and delayed reaction, which has been correlated,
without causation, to T. gondii infection23
,24
. Correlations of
seropositivity for T. gondii infections have been shown to has been
correlated with higher rates of anxiety, impaired reaction times,
schizophrenia and depression26
,27
,28
,29
. Higher dopamine levels may
be able to explain T. gondii’s effect on anxiety, impaired reaction times
and schizophrenia but raises the question about the correlation it has
with depression. It is commonly thought that lower levels of dopamine
tend to be associated with depression, which could disconnect the
association with T. gondii infection; however, levels of glucocorticoids
and chronic activation of the hypothalamic–pituitary–adrenal axis
(HPA) by dopamine have been associated with depression, both of
which are associated with increased dopamine availability30
,31
. It thus
becomes plausible that the mode of action related in part to both
immunological and behavioral modulation by T. gondii is via MIF,

A. Shuminas-Nelson
8
either by a combination of modulation of both tyrosine and tryptophan
pathways or primarily by dopamine production.
The pathway that is initiated by T. gondii expression of these
enzymes is an area that is just beginning to be explored. Both
molecules not only have powerful enzymatic activity but also affect the
host’s immune response and the neurotransmitters associated with
behavior. It is currently hypothesized that the mechanism in which the
protozoa may utilize in order to control their environment once inside
the host may be explained, in part, by these two enzymes, with MIF
being the prominent subject of our investigation.
T. gondii has been shown to elicit behavioral changes, as
discussed earlier, that are quite specific, in a murine model that
involves rats or a highly resistant mouse strain, that are not due to
general neurologic disease5
. A possible mechanism for behavioral
alteration is along the tyrosine pathway and MIF does act upon it. We
know that T. gondii has a homologue to the human MIF gene (TgMIF)
and that T. gondii produces a second enzyme that affects the tyrosine
pathway known as aromatic amino acid hydroxylase via the shikimate
pathway. I believe that it is via the two enzymes that T. gondii is able
to control both its immune and behavioral environments. It is along
the tyrosine pathway leading to dopamine production that I will study
to explore the mechanism of alteration of both the immune and the

T. gondii:
9
behavioral environments. In order to better understand the role of
TgMIF and the neurobehavioral consequences of T. gondii infection I
am working on creating a T. gondii MIF knockout parasite.
Methods:
Parasite Strain:
I used RH Δ HXGPRT Type I and Prugneaud Δ HXGPRT (Pru Δ
HXGPRT) Type II parasites for the knock our construct and RH Δ
HXGPRT Type I parasites for our knock-down construct. The RH Δ
HXGPRT parasites were chosen for a faster growth rate and Pru Δ
HXGPRT was chosen for their ability to be used to assess behavioral
conditions in a murine model. Both strains utilized the hypoxanthine-
xanthine-guanine phosphoribosyltransferase (Hxgprt) purine salvage
pathway as a construct for our T. gondii MIF knockout32
Tissue Culture:
. Selection of
the knockout was based on the survival of parasites exposed to two
different purines, mycophenolic acid and xanthine. Wild type of both
the RH Δ HXGPRT Type I and Pru Δ HXGPRT Type II parasites would
not be able to process the mycophenolic acid and xanthine and thus
would not be able to propagate and conversely parasites that took in
the plasmid would survive.

A. Shuminas-Nelson
10
Parasites were maintained in 6-Well plates seeded with human
foreskin fibroblasts (HFFs). HFFs were allowed to grow to 100%
confluence and maintained in Iscove’s Modified Dulbecco’s Medium
(IMDM) [Lonza] with 10% FBS (GIBCO), 1% PSF and 1% glutamax
(IMDM-C). Media in HFF only flasks and wells were changed every
three to four days. Parasites in wells were passed at intervals of two to
three days for RH Δ HXGPRT and every three to four days for Pru Δ
HXGPRT. Both HFF seeded flasks and parasites were maintained under
incubation conditions of 37°C with 5% CO2.
Parasite Knock-out:
We utilized the Multi-site Gateway system (Invitrogen33
) for
production of a linear integrative KO plasmid in tandem with the purine
salvage pathway hypoxanthine-xanthine-guanine
phosphoribosyltransferase (HXGPRT). The Multi-site Gateway system
uses att sites, which are site-specific areas of recombination using
bacteriophage lambda sites on the E.coli chromosome chosen from
genomic sequence TgME49_090040 chrIX MIF[ToxoDB] (Figure #1)
gene specific primer sequences (Table #1). We used 3 Donor Vectors
along with a ccdB suicide gene vector and transformed our fragments
to create 3 entry clones, pENTR-5’, pENTR-3’ and pENTR-Hxgprt
[pENTR-5’ and pENTR-3’ contained our TgMIF flanks and the pENTR-
Hxgprt had already been prepared by using the Donor Vector

T. gondii:
11
pDONR221 (Invitrogen)] (Figure #2). The 5’ element used Donor
Vector P411RA (Invitrogen), which contains the attR4 and attR1 sites
that are recognized only by attB4 and attL1 of the final KO plasmid
vector. The 3’ element utilized the Donor Vector P2RP3A (Invitrogen),
which contains attR2 and attR3 sites that are recognized only by attB3
and attL2 of the final KO vector (Figure #3). The HXGPRT element
utilized the Donor Vector pDONR221 (Invitrogen), which is flanked by
attL1 and attL2 sites (Figure #3).
The three vectors were recombined into one plasmid using 2
catalyzed reactions; the first reaction used BP Clonase II (Invitrogen),
which contains λ Integrase and E. coli Integration Host Factor and the
second reaction used LR Clonase II (Invitrogen), which contains λ
Integrase, Excicionase Proteins and E. coli Integration Host Factor.
The ccdB gene allowed for a negative selection of TOP10 E. coli
competent cell transformed colonies by inhibiting gyase, which in turn
inhibits colony growth. The colonies that were present had the ccdB
gene replaced with our plasmid which contained the 3 vectors, pENTR-
5’, pENTR-3’ and pENTR-Hxgprt (Figure #3).
The 5’ element and the 3’ element of the TgMIF gene were
amplified by PCR (Titanium Taq, Clontech) with T. gondii Type II Pru
gDNA using the following nucleotide sequence primers: 5’ forward of
the TgMIF flank with att site B4F (in bold)

A. Shuminas-Nelson
12
GGGGACAACTTTGTATAGAAAAGTTGAACGGGTCACCTG AAACGA and
5’ reverse of the TgMIF flank with att site B1R (in bold)
GGGGACTGCTTTTTTGTACAAACTTGGAACGCAAAGGGGTGAAGA and
the 3’ forward of the TgMIF flank with att site B2F (in bold)
GGGGACAGCTTTCTTGTACAAAGTGGTTGTCGCGGAAAACGTCTC and
the 3’ reverse of the TgMIF flank with att site B3R (in bold)
GGGGACAACTTTGTATAATAAAGTTGTGGCAGCTTCTCTGAAAAC.
Entry clones pENTR-5’, pENTR-3’ and pENTR-HXGPRT were
chemically transformed using One Shot TOP10 (Invitrogen) competent
cells. All clones were grown on Kanamycin supplemented agar plates.
Colonies were tested via colony PCR using respective primers and
positive pENTR clones were chosen for the LR recombination reaction.
Parasite Transfection:
All parasites were maintained in HFF in IMDM (Lonza) with 10%
FBS (GIBCO), 1% PSF and 1% glutamax (IMDM-c) with (KO) or
without (WT) the addition of the challenge compounds, mycophenolic
acid and xanthine, under incubation conditions of 37°C with 5% CO2.
The TgMIF gene was transfected in both RH Δ HXGPRT Type I strain
and Pru Δ HXGPRT Type II of T. gondii using the Multi-site Gateway
System (Invitrogen) along with the purine salvage pathway HXGPRT,
as previously explained. The HXGPRT cassette allowed for selectivity of

T. gondii:
13
successful T. gondii knockout parasites challenged with mycophenolic
acid and xanthine.
The TgMIF KO plasmid was transfected using the following
electroporation methods: parasites were infected into T-25 flasks with
confluent HFF cells and allowed to grow for several days to allow for a
high parasite burden on the HFF cells [~ 3days for RH and ~5 days for
PRU].
PCR was used to increase plasmid yield and the PCR product was
cleaned using a PH based PCR clean-up kit (Qiagen). The PCR product
was dissolved in a 7.6 PH cytomix buffer, which was also used for the
electroporation transfection.
The flasks were scraped and washed with 1% PBS (GIBCO). The
parasite solution was centrifuged at 15,000 x G rpm for 15 mins to
pellet the cellular products. The pellet was resuspended in cytomix
buffer without ATP and GSH and centrifuged at 15,000 x G rpm for 15
mins. The pellet was resuspended in cytomix buffer with the addition
of ATP and GSH. The parasite-cytomix solution was added to a 4mm
gap cuvette (Molecular BioProducts #5540) and the KO plasmid was
added for the KO parasite and for the control an additional amount of
cytomix was added to bring to an equal volume as the KO parasite
cuvette. The transfection used a 1.5Kv electric pulse with a 25

A. Shuminas-Nelson
14
capacitance for each electroporation reaction (conditions were
maintained for all transfections).
Transfected parasites were allowed to grow for 24 hours in T-25
flasks with IMDM-c. After the initial 24 hour resting period the
selection compounds, mycophenolic acid and xanthine, were added
directly to the flasks. The transfected parasites were allowed to grow
for 3 days and were then passed into 6-well HFF confluent plates.
Parasites were maintained in HFF confluent plates with IMDM-c and
selection compounds.
TgMIF KO Cloning:
Parasites were seeded at 1.25 parasites per mL (par/mL) and
2.5 parasites per mL (par/mL) into 96 well plates with confluent HFF
cells for both RH and PRU strains by limiting dilution. The parasites
were allowed to grow undisturbed, RH at 5 days and Pru at 10 days in
37°C incubation chamber with 5% CO2. After the 5 or the 10 day
growing period the wells that contained 1 parasite plaques were
scraped and infected into 24 well plates and allowed to grow for 3
days.
Diagnostic PCR:
Genomic DNA (gDNA) from the clones were extracted via phenol
extraction and used as template DNA in diagnostic PCR. The following

T. gondii:
15
Primers were used to determine the presence or the absence of our
plasmid and if the plasmid was integrated elsewhere within the T.
gondii genome: DNA efficacy was determined using Toxoplasma gondii
Tubulin (TgTub) forward sequence (TgTubFOR)
CGGGTACGCTATCAACT and reverse sequence (TgTubRev)
CAGTGTTCCGTGCTCTTTCA, the presence of our cassette was
determined using primers from just inside the 5’ flank of our vector
(P5’FOR) GCGTGGATTCTCTCACCGGACGACTT and just inside the 3’
flank (P3’REV) GCTCTTCCTTGCAAGGCTTGCCGTTT as well as
primers to verify the absence of the TgMIF gene from the start codon
(TgMIFsFOR)ATGCCCAAGTGCATGATCTTTTGCCC to a mid section of
MIF (TgMIFmREV)CTGCGACGGCTGAAGAAGAGCAGCA. In order to
determine correct integration of the insert into the MIF gene we used
primers upstream of the insert sequence along with primers
approximately 100bp into the HXGPRT cassette of the third entry gene
(see Table #1 for complete list of primer sequences).
Conditional TgMIF Knock-Down
As an alternative approach, in the event that TgMIF is an essential
gene and to better study the effect on bradyzoites the following
conditional knockout approach was used:
Plasmid Preparation:

A. Shuminas-Nelson
16
We used T. gondii RPS13 sub(IV) template gDNA for production
of our knock-down plasmids. RPS13 sub (IV) contains both the
bacterial reporter protein β-galactosidase (LacZ) and HINDIII and
BGLII restriction cut sites allowing for increased efficacy of the knock-
down plasmid selection and integration.
Promoter regions of 2kbp, 1.5kbp and 1kbp upstream from the
MIF gene were amplified with PCR using the following primers:
TgMIF2For ATCGATCGTGTCATCCCCGTTCTT, TgMIF1.5For
AAGCTTGAGGACGACAGAGGGGGAGATT, TgMIF1For
AAGCTTAGGTCTTCGCCTTCTGCTTC and TgMIFRev
AGATCTTTTGGGGGGGAACTTGAAAG (Table #1). After electrophoresis
and gel extraction samples were ligated with the TOPO TA cloning kit
(Invitrogen) and chemically transformed using One Shot TOP10
(Invitrogen). Bacterial transformations were plated on x-gal and
ampicillin supplemented agar and incubated overnight at 37°C. White
colonies were chosen via blue/white colony selection, white colonies
signal higher likelihood of positively integrated primer sequences.
Non-blue colonies were grown overnight at 37°C in Luria Broth
(LB) supplemented with ampicillin. Bacterial culture was pelleted and
DNA was purified using Wizard miniprep DNA purification kit
(Promega). DNA template was digested with HINDIII and BGLII.

T. gondii:
17
Positively identified samples were digested with T4 ligase (Invitrogen)
and transformed in DH5α chemically competent cells (Invitrogen).
Cultures were grown in 250ml of LB supplemented with
ampicillin and DNA was purified by a PH based DNA purification
(Qiagen). DNA was suspended in a 7.6 PH cytomix buffer.
Parasite Transfection:
All parasites (RH Δ HXGPRT Type I) were maintained in HFF in
IMDM (GIBCO) with 10% FBS (GIBCO), 1% PSF and 1% glutamax
(IMDM-C). The flasks were scraped and washed with 1% PBS (GIBCO).
The parasite solution was centrifuged at 15,000 x G rpm for 15 mins to
pellet the cellular products. The pellet was resuspended in a 7.6 PH
cytomix buffer without ATP and GSH and centrifuged at 15,000 x G
rpm for 15 mins. The pellet was resuspended in cytomix buffer with
the addition of ATP and GSH. The parasite-cytomix solution was added
to a 4mm gap cuvette (Molecular BioProducts) and the TgMIF
promoter region plasmid was added and for the control an additional
amount of cytomix was added to bring to an equal volume. The
transfection used a 1.5Kv electric pulse with a 25 capacitance for each
electroporation reaction (conditions were maintained for all
transfections).
Transfected parasites were allowed to grow for 6 days in T-75
flasks with IMDM-c. After 6 days the parasites were harvested and

A. Shuminas-Nelson
18
sonicated using β-Galactosidase assay (Zhang and Brema 1995).
Sonicated samples were measured using the Bradford protein assay.
Cryopreservation and recovery of parasites:
Cryopreservation: Parasites were prepared for cyropreservation
by the scraping flasks or wells and passing the parasites through 25g
needles 2x. The parasites were then spun at 15K x G rpm for 15min.
The supernatant was decanted and the parasite pellet was
resuspended in 4ml of IMDM-c with additional 10% FBS and 10%
DMSO. The parasites were then aliquoted into 1.25 ml tubes and
placed overnight at -70°C. The next day tubes were placed into long
term storage at -130°C.
Thaw: Parasites were slowly thawed and moved to a 15ml
conical tube. DMSO was neutralized by adding drop-wise 10ml of
chilled Hanks balanced salt solution without calcium and magnesium
(Lonza). Parasites were then spun at 15k x G rpm for 15min.
Supernatant was decanted and pellet was resuspended in 1ml of
IMDM-c. Parasites were then infected into a T-25 flask that was
seeded with HFF cells grown to 100% confluence. Parasites were
passed three times prior to any conditional manipulation and
maintained in media and passed as required dependent on
experimental conditions.

T. gondii:
19
Results
KO Plasmid Confirmation:
Entry clones pENTR-5’, pENTR-3’ and the KO plasmid were
confirmed by diagnostic PCR (see Figures #4 and #5). The diagnostic
PCR resulted in positive correlating band sizes for entry clone pENTR-5’
with an expected band size of ~ 1200bp and pENTR-3’ with an
expected band size of ~ 1000bp. The diagnostic PCR for the KO
plasmid also gave positive correlating band sizes at ~ 4000bp.
Transfection and KO Cloning:
We have produced ten viable clones in RH Δ HXGPRT. Out of the
ten clones eight have shown positive integration of the insert through
diagnostic PCR (see Figure #6 and #7). PRU Δ HXGPRT clones had not
been tested as they are showing slower then normal growth rates.
However, in both our bulk of RH (Figure #6) and PRU Δ HXGPRT
(results not shown) and in the RH Δ HXGPRT clones tested we have
found both the insert and MIF gene present (Figure #7).
Conditional Knock-down Plasmid Confirmation:
TgMIF promoter plasmids were confirmed by digestion with
HINDIII and BGLII enzymes (Promega) and then run on 1% agarose
electrophoresis gel at 110V for 1 hour (see Figures #8). The

A. Shuminas-Nelson
20
electrophoresis resulted in positive correlating band sizes for TgMIF
2kbp, 1.5kbp and 1kbp.
β-Galactosidase activity:
The Bradford protein assay was used to measure LacZ protein
activity at A595 nm using BioTek Synergy™ 4 Hybrid Microplate
Reader (BioTek). Data was standardized and compared for best protein
expression (Figure #9). TgMIF 1.5kbp promotor showed best
expression of the LacZ protein and was chosen for Tet ingegration into
the knock-down plasmid.
Discussion:
I have produced T. gondii clones with our insert integration;
however the current clones have shown a persistence of the MIF gene
in both RH Δ HXGPRT (bulk culture and clones) and PRU Δ HXGPRT
(bulk culture) (Figure #6 and 7). Three likely possibilities as to why
homologous integration of the insert have not been positively
identified are: 1) The MIF gene is essential for parasite survival; 2)
Upstream and downstream flanking regions of the plasmid are shorter
then required for gene-specific homologous integration; 3) Small
numbers of testable clones have not allowed for positive results of
insert integration.

T. gondii:
21
1) Essentiality of MIF: Although MIF has been successfully knocked
out of CB57BL/6 mice, resistant BALB/c mice7
and Plasmodium
berghei34
2) Gene Flank size: Another key aspect to the possible non-
homologous integration of our MIF knockout insert in T. gondii may
be the size of our flanking regions within our plasmid. In
Plasmodium berghei the flanking region upstream and downstream
of MIF was approximately 1100bp (our construct also utilized
flanking regions approximately 1000 – 1100 bp). Donald and Roos,
1993, found that continuous genome sequences < 1700bp
, it is possibile that the MIF gene is essential for T. gondii.
As discussed previously, successful MIF knockouts have both
oxidoreductase activity as well as tautomerase activity, while in T.
gondii enzymatic activity is currently found to be reserved for
acting upon the hydrogen bonds (tautomerization). The ability for
MIF to have dual enzymatic activity may be the determining factor
in successful deletion of the gene. Perhaps, the tautomerase only
activity is life-cycle limiting for T. gondii if the activity connects
directly with T. gondii’s ability to scavange catecholamines, such as
tyrosine and tryptophan, and/or if MIF has a direct connection to
the shikimate pathway; thus, if MIF’s tautomerization activity is
directly correlated with the parasites ability to scavenge
catecholamines in T. gondii the possibility of essentiality increases.

A. Shuminas-Nelson
22
increased the likelihood of non-homologous integration35
3) Clone numbers: At the present the number of single clones
produced by limited dilution have remained small for the RH Δ
HXGPRT, with only 10 usable clones and only 8 of them showing
any insert integration. PRU Δ HXGPRT clones have produced 24
single clones but an extremely slow growth rate has limited the
ability for genetic analysis. However, this suggest a phenotype in
insert integration of the MIF KO gene as both strains have shown a
slowed growth rate in both the cloning wells and the bulk wells.
. T. gondii
may diverge from the apicomplexa Plasmodium species in this
regard, as P. berghei, which had integration with only
approximately 1200bp upstream and 1700bp downstream of the
MIF gene, produced a successful knockout37
.
Conditional Knock-Down: I have been able to pinpoint the best
promoter region for a conditional knock-down parasite. As shown in
Figure #10 the region of best promotion of the LacZ protein was
produced at 1.5kbp upstream of the MIF gene start codon. This
suggests the best region to integrate the TetO and TetR sites being in
the 1.5kbp range for a successful conditional knock-down. We are
currently working on producing such a knock-down in order to study
the effects TgMIF has on a human dopamine synthesizing neuronal cell
line and the resulting host-parasite relationship.

T. gondii:
23
The cell line of interest will be differentiated from endometrial
regenerative adult stem cells (ERCs) [purchased from General
BioTechnology, IN]. The ERCs have been shown to have the ability to
be differentiated into dopamine synthesizing neurons in a two-step
culturing process adapted from E. F. Wolff Et Al, 201036
Significance: The pathway enacted upon by MIF in both human
and murine models suggests direct correlation with dopamine, melanin
and cytokine production. The ability to elucidate how and at what
points the MIF molecule affects both the inflammatory and the
behavioral responses within the host may inform us on other pathways
and possible treatments for diseases and inflammatory pathology
linked to dopamine, such as sepsis and Parkinson’s disease.
. The cells,
once differentiated, will be infected with both WT and the conditional
MIF knock-down in order to measure dopamine and the affected
cytokines and to develop host-parasite interaction phenotypes in four
conditions plus controls.
Inflammation and dopamine in Parkinson’s disease (PD) has been
linked to neurodegeneration of dopaminergic cells. Death of these cells
in PD contributes to associated motor and sensory symptoms. Deficits
in sensorimotor systems have also been seen in T. gondii infected
mice, and although the deficits are not contributed to general neural
degeneration37
there is some correlation to the subtle cognitive deficits

A. Shuminas-Nelson
24
seen early stages of PD38
. It is known that dopamine plays a role in PD
as several brain regions connected to PD, such as substantia nigra,
caudate nucleus and pallidum, have neurons that synthesize dopamine
and are affected by neuromelanin39
. Although the root cause of PD
remains unknown and the precise role dopamine and melanin has yet
to be fully understood, it is possible that TgMIF interaction with host
MIF may improve are current understanding of the relationship
between dopamine, neuromelanin and their effects on the
inflammatory and behavioral responses associated with MIF and
dopamine. Supporting the hypothesis of inflammatory processes
playing a larger role in innate immunity, several studies on sepsis
looked at MIF and dopamine as main contributors to the pathology of
infection. In a clinical review of the immunomodulatory effects of
dopamine by Beck et al, 2004, the influence of dopamine on the
suppression of pituitary hormones and several cytokines and
chemokines and influence the induction of glucocorticoids, IL-10, IL-8
(HUVECs) and apoptosis in neutrophils and lymphocytes is discussed40
.
MIF has also been shown to override glucocorticoid anti-inflammatory
actions increasing inflammatory response in the presence of increased
glucocorticoid production41
The ability for T. gondii to control innate immune response during
times of active infection is extremely advantageous for the parasite.
.

T. gondii:
25
The ability for immune control is suggested in MIF -/- mice that
showed resistance to lethal levels of lipopolysaccharide (LPS) and S.
aureus enterotoxin B42
. Conversely, WT mice infected with T. gondii
were found to be more susceptible to intracellular bacterial
infections43
. Herak-Perković, et al, 2001 found that dopamine
antagonists increased inflammation in inflammatory bowel disease44
,
which has been correlated with MIF production45
. Taking into account
the increased mortality of MIF -/- mice in the Flores Et Al, 2008 study,
discussed earlier, along with reaction resistance to LPS and S. aureus
enterotoxin B and the increased susceptibility to intracellular infection
in MIF -/- mice the possibility of dopamine playing a larger role in
place of MIF, or at least in tandem with MIF and glucocorticoids,
grows. [Interestingly the antipsychotic Haloperidol, a dopamine
receptor blocker, inhibits growth of T. gondii tachyziotes46
Our continuing study of MIF and the catecholamine pathways it
enacts upon may provide insight to the pathology seen in
inflammatory and infectious diseases as well as behavioral and
neurodegenerative disorders, allowing for improved therapies and
prevention of further morbidity of diseases associated with either
increased or deceased levels of dopamine and MIF.
.] These
studies together suggest a distinct relationship between MIF and
dopamine during an inflammatory response.

A. Shuminas-Nelson
26
Condition Primer Sequence Position place
GatewayVectorKO
attB4F GGGGACAACTTTGTATAGAAAAGTTGAACGGGTCACCTGAAACGA 782
attB1R GGGGACTGCTTTTTTGTACAAACTTGGAACGCAAAGGGGTGAAGA 1883
attB2F GGGGACAGCTTTCTTGTACAAAGTGGTTGTCGCGGAAAACGTCTC 3975
attB3F GGGACAACTTTGTATAATAAAGTTGTGGCAGCTTCTCTGAAAAC 4796
TgMIFKODiagnosticPCR
TgTubFOR CGGGTACGCTATCAACT N/A
TgTUBREV CAGTGTTCCGTGCTCTTTCA N/A
P5'FOR GCGTGGATTCTCTCACCGGACGACTTT 819
P3'REV GCTCTTCCTTGCAAGGCTTGCCGTTT 4743
TgMIFsFOR ATGCCCAAGTGCATGATCTTTTGCCC 1965
TgMIFmREV CTGCGACGGCTGAAGAAGAGCAGCA 3014
TgMIFUPFor ACAGAGAGAAGCCTCGAGGAGGAGGAA 532
HXGPRT102-76 ACAGAGACGGCGCGGCCGACAGGA N/A
TgMIFKnock-down
TgMIF2For ATCGATCGTGTCATCCCCGTTCTT N/A
TgMIF1.5For AAGCTTGAGGACGACAGAGGGGGAGATT N/A
TgMIF1For AAGCTTAGGTCTTCGCCTTCTGCTTC N/A
TgMIFRev AGATCTTTTGGGGGGGAACTTGAAAG N/A
Table #1. Primer sequences used in each condition. Gateway Vector
KO used primers with att priming sites. TgMIF KO Diagnostic PCR
used several primers for plasmid and insert diagnostics. TgMIF
Knock-down used primers correlating to TgMIF promoter region
length for knock-down plasmid production and mapping.

T. gondii:
27
CGCTCTTCTCTCTGTCTCTTTCTTCTTCTTCGTGTCATCCCCGTTCTTGTCTTTGCGCCTCCTCTCCCTCGAGTTTCGTTGGCTGCATGCACGCCTACCGAAG
ACGCGACTCCACCAGATGAAGAAGGCGAAGGCGGCGGCGGAGGTCCAGGCGTTCCCGAAGAAGAAGAAGCTTCGATTGGCGAACTGCGCCTCCCAGAACTGCT
TCCACACCGGCTGTCGGAGGAAGTTGGGGGGCTCGACCACCCAGAGAGGCTGGAGAATCTCCTTCATCGGCACATTCCTCTCCAGCGTCTTTGCAGCTTCCGC
CGCCGGCGCCGCCGCGTTCAGACGCGGACGAGAGAGACGCAGAAGCGACAGGAAACGAGAAGAATTCGCGACCGGCGAGGCCAGGCGACAGCCAGCGGTGGCC
GCGAAGGCCGGGGAGAGCCCCATGGTGCGAGGGACGCGGAGAAGAAGAAGGCGAGGACAGAGGGGGAGATTTTACGAAGAGACAGAGAGCGAGGGGGAGACTA
CGAAGAAGGAACGGAGACAGAGAGAAGCCTCGAGGAGGAGGAAGAACGGCAGAGGTGGACGAAGCAACACACAGAAGGCGGGAGAAGAAAGAGACGGTCGACC
GGCGGGGCGAGAGGAGAGAGAGGCAGCGCGCAGGGCGTCCTCTCTCAGGAAGACGGAGGAGAAAACACCGAAGCGAGGCAGGAGGAACGCGACCTCGTCCTTC
TTTCCACCGGACTGCCTTCCACTCCGAAAGAAGAAAAGAAAATGTGAAGAAAGCGAGGAAAACGGGTCACCTGAAACGATGCATGCCCTGTGCTCTCGCGTGG
ATTCTCTCACCGGACGACTTTCGTCTCGCGCCGTGGCGCCAACGTTCACACGCACACTGGAGGAAGAAGTTTTTTCAGGCACCCAGGAGACACCCTTCTTCCT
TCTCGCTTTTCTAGCTTCTTCTGCACCTGCGACACAAGTCCTTCGCCTTCTGCTTCCTTTTGGTCTCGCGTTTTCTACAGTTTTTCGCGCCCCTGTCTGGCGA
GAGTAACCTCACATATAGGGCGTCTGGTTTTGTGCCTCTCCGAAACGGCCTCTCTGTCTCCGTACCTTTGCGCTCCTCCGCTGATAGAACGCATGCGCTGTTG
CCGCTCGGAGCTTTTTCCGTCGGTGGCTGGTTTGGTTGTTGAGACACAACTCCTCGCAACTCTCTACAGAAGCGGAAGAAAAAGCCGAAGAAAAGACGAAGAA
TTGAGATCCTGAAGCGTTCTGGATCTCTGTCTTTCTCTGTTTCCTCTTTACACGTCGCCACTTGTCCCCAATTCAACAAGAAGGCCTTCGGATTACCTGTCCG
GAGCGGTGTGCGAGTTACGCTGTCCACGGTCACTCCTGCGTCGCCGCAAATCTTCCCTATTTCTTGGTTCTTTCTCTTTAAAGGTCTCTCCTCCGCTCGAAAA
GCTCGTCTTCCTGGTGACCAGCAGAGAGCGACCGTCTGCGTCGAACGGACGCCCGAGACAGCTTCTCTCGGAGTCGCGCCAGACGCAGAAGATTCTGGCAGAC
TCGACCTCCCGCCTGTTGAGGCGCGCGTTTTCCGCGGGGGGGGGGGGGGGTCGCATTTGCGGCTCTTTCGATCGACACTAGAGTCTGGAGACACACAGACGCG
AAGTCTAGCGTTTAGCAGCGCGTTTTTGAGGCTGAAACAGAGGGAAAAGCGCGCTTGCGTCGAGACAAGCTGGCGCCGTGAACCTCACAGTCGCCGCCTTCTC
GTTTGAGCGAAGAAACCGCGAACGCGAGACGACTGAAATCCCGCGCTTTCTGCACAGACGGAGGCGCGCGCGCGCGAGTTGCGTCTCCGCCACCGGTGCACTC
AGGAGTCCTCCGGAGAAAATTCACTTGGTGTCTTCACCCCTTTGCGTTCCGGGTCGCTCTGACTTTTTTTGTCTCTTTCTCTTCGCACACCTTTCAAGTTCCC
CCACAAAATGCCCAAGTGCATGATCTTTTGCCCCGTCGCGGCGACGCCGGCGCAGCAGGACGCCCTCTTGAAGGACGCCGAAAAAGGTGAGAGCAAATGATGT
TTCCAAAAGAATGCTCCGATATACAATGCAGAGAAAACTCGAGTTCCAACGGCGCCCTGGCGACGGACGGGTTTTTAGCGAGAAAAGCAACGAAGATGCCACC
GTTTGACGATAGAACCCTCTCAGGGAAAAAATGCACACACCCATCCTGTCTCCTGGCTTGACATGCAATATATACATACATATATATATATATATATATATTT
ATATATGTATTTATATATATAAATATATATGTTACACACATGTATGTTCATTGACAGAGAGGCCGAGAACACCACAGTCCCTTTTCGACTTTTTTCTTGACTT
CTTTCTCTTGTTTTTTCTTCCCCCCGCGTCCATTTTGTTCTGCCACCCTTGTGTGTACCTTTTTCCTGTCGCTTTTCTCGCTAAACATCCGTCCGTCGCAAGC
GCGCTGTTCGAACTCGAGTTTTCTCTGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGAACTGGAGTTTTCTCTGCACTGTGTCTCGAAGCATGGTTGTCTTTCTCTTCTTCTCTCCCTCTCTGCAGTCCTCT
CTCCTCCACCATTTCTTCATCGTCTATCAGTCTGTCATTTCTGTTTCTTGACGTTTCCACGACCCCGATTTCTGCGTTTCTCCTGTGCCAGTTTGCTTCACGC
TCACGGATTTACTCGAATCTCTGTTCTGTCTAACTTCCCCGATCCCTCCTCCGTCTCTTTGGTATTTCTTGCTCTTCTTTCTTCCCCTGTCTCGTTGCTTCTT
CTTTCTCCGTGCTTTCTCTGTGTCCCTGCTTCCTTCTTCGACTGCCAACTTCTTGACCGCAGCCTTTTTCCGTCGCTTCAGAGTTTGAGCGACGACGACGTCC
TGTGGAGTGGACGCTCTCCATCTGTTTGCTGCTCTTCTTCAGCCGTCGCAGACGCTCTGGGGAAGCCTCTGAGCTACGTCATGGTGGGATACTCGCAGACCGG
GCAGATGCGTTTCGGCGGGAGCAGCGACCCGTGTGCGTTCATTCGCGTTGCTTCCATTGGAGGCATCACCAGTTCCACGAACTGCAAAATCGCCGCTGCTCTC
TCCGCTGCATGCGAACGCCACCTGGGCGTCCCCAAGAACCGCATGTAGGCCGAACGGACCAGAGCGCCTCACACCGCGCTCAACGCTCGGAAAACAAAGAGGA
TTCAGGGTCGACTCACACTGTAGAGAGTAAAGCTTTGAGTAGACGATTCCACTCCGGTCGCGGAGATGCTTTTCCAGCTTCTGACTCTGGTTGAAGTCTGCCT
CTCCCTTCTCTCTCTTCCGTGCGTCGCTGACTCTGTGGCGCATGTGGAGAGCGGGAGCGGCGAGCGCACAGCTGAGCAGAGGCGCAAAAGGCATGTTGCGAGC
GAGTCGCGGAAGCAGAAGCGTACTGAGAGAAAAAAGGGAGATGGCAGTTAAAAGGCGGGAGAAGAAGAGTCCGTCGAAGAAAGACACAGGAGCAACAGAAACG
ACGTAAATCGAGAGAAAGCGAGTGTGCGCGTCTCTCTCTTTTGCGGGAGGGTGTGTTGGGCGCGCTGTAGAAGTTGGAATCAGATCGAGAAAAAAGCAGGTGA
GGAGAAAGAGGAGAGAGCGAAAAGGCAGAGGGGAAGCAGAAAAAGAGAGACAAGTCCGCATGCAGTGAGGACGAGGAGGCGTTTGTGCATGCGCAACGGAGCC
AGTCTGCTCCGAACAGGGCATTTGCGGTTTTGTTTTGCTTGCGTTTTCCTTCAGCTACACGACATTCACAAACAAGAGCCCCTCTGAGTGGGCCATGGGCGAC
CGAACTTTCGGCTGAGCTGAGAGCGCTCTGGACGTTTCATGCAGAGATCTGTCTTCGGATTTGTCGCGGAAAACGTCTCGGTTTGCGAACCGTGTCGAGTATG
AACTGAGGGGTGCACCCAGAGACTTCATCCGCGGGCGCTGGTTACCGGAACTGAGTTGAAAAGGCGCTCTATACATACAGCTGGAACTGTCACAGACTCACGA
GAGCACCGAGTCGAATACTGCCGCAGACTTCTTTCCATTTGTTGCATGGTATTATTTCAAGTTCTTTCTAAACGTCTGTGCTCCTTCCTCTCTGCGCTCGGGC
ATCACCCTTGTACAAGAAAAGAGATTTACGAACCAAGGAGACTTATCTCCACCAGGTAGAGTACTTGCTGCTTCTCTCCTCTGTGCGTCTTTCGCACTCTTTT
CCTGGCGTCCTGCTTCCGTCGTTCTCTCACTCTTCTGCTCTTTCGCCGCTTCTTCTCGCTCTCTTCTCTCCCCTTCCTCCTTCTCGCGTTCTTTCTCCGTCTC
TCTTCTTTATTCCTTTTTCTCGCTCGTCTCTCGATGCGGAAGAGACGCGCGAACGCCACCCGCGACGTCGCAGCTAAAAGTGGTGGATGGCCCGCGACACACA
CAGCCGGTTTTTCCACATAAAAATTGGCCGCGTTACAAGCAGAAGAAAGCATGTTTCACACTGAGTTAGAGAAGCAGCAGCAGCGTAGAAACTTCGGATCGTG
CATGCGACACCACCCTTTTTCGCGTTCTGCTGTATTTTGACGTTTTTGGTGATTGTGTAGCTGAGAGGATTTCGCCGATGTTTCTTTCCGGGGAGAAGTCAAA
ACTGAAACGGCAAGCCTTGCAAGGAAGAGCCAGGAGGGACAGGCCTCCACACTCTCCGTTTTCAGAGAAGCTGCCAAAGACGTTCTGAAGTAAATGGACGGTA
GAGGAGGGCGTAGAGAGGGAGCAAATGATTTTGAGAAATCTACGAAGACCTGGAGAAAGCAAGAAAGATATACAGAGTTTCACAACGATCTACGAAGGCCTCG
AGAGAGAGCTCAGGGAGACCCTGTGGGATCCGCACAGATCGACGGAAAAAGCCGTTTCTCAAAGAAAGTCCGCAAATGGCCTCGCGCCCAGCGTGGAGAGGCA
ACGTGTGTGGCGGCGAAGGCGAAACGGGAGTCTCCGAAAAACAGCCGCACCGGCGAGGTGTATGTACACCTGAGACGAACAGCGGATCGGCGAGCGGCGGAGA
CACCTCAGAAGCCTGGACCCAATACAGAGAAGAACGCTCTCTCTGGGAGGCGCGTCTCCGACGAACATTTCACATCGAACGAAAAAGCCACACATGCACATGG
ATCGTCAAAATCAGGTTTTCACCAAGTTCTCAAACACACAACAGAACGTTGACTTTGAATTCCTTCTGCGTCCCTCTCGAGCCTCGCGCATGCTCGCGAGATT
TCTCTCGCGTGCGAAGACGCGTCTGCCGACCAAAGGCGCCTCTTCTTCTTT
Figure #1. TgME49_090040 chrIX MIF with length of 5407bp
[ToxoDB]. Genomic sequence used for primer selection. Primer
sequences are colored as follows: att sites B4F and B1R in red, att
sites B2F and B3R in blue, MIF Start and Stop codons in yellow,
TgMIF start and stop codons (italics) and TgMIFsFOR in violet,
P5'FOR and P3’REV in green, TgMIFmREV in orange and TgMIFUPFor
in gray.

A. Shuminas-Nelson
28
A
B
Figure #2. A. The 5’ element uses Donor Vector P411RA. This
vector contains attR4 and attR1 sites that will be recognized only
by attB4 and attL1 of the final KO vector (Fig. #X). B. The 3’
element uses the Donor Vector P2RP3A. This vector contains attR2
and attR3 sites that will be recognized only by attB3 and attL2 of
the final KO vector (Fig. #X).
pENTR-3’
pENTR-5’

T. gondii:
29
Figure #3. The 3 entry clones are transformed in one reaction using the
LR Clonase II enzyme mix to produce the KO vector which will then be
transfected into the RH Δ-Hxgprt Type I parasite (pENTR-A represents
pENTR-5’, pENTR-B and represents pENTR-3’). This illustrates the
specific att sites of recombination of the 3 vectors into the final plasmid.
The ccdB gene has been replaced by the HXGPRT cassette allowing for
colonial selection. Colonies of E. coli without the HXGPRT will not be able
to grow due to DNA gyrase inhibition by the maintained ccdB gene, or
by-product, present thus allowing for growth of only our plasmid of
interest.

A. Shuminas-Nelson
30
Figure #4. Gateway PCR
results from vectors
pENTR-3’ and pENTR-5’
using 1kb ladder
(Promega) A. PCR product
of pENTR-3’ DNA from
four colonies showing
positive correlation with
expexted band size of
~1kbp B. Colony PCR of
transformation clones for
pENTR-5’ with positive
transformation correlation
of 23 colonies showing
expected band size of
~1.1kbp
A
B

T. gondii:
31
Figure #5. Results
from Gateway PCR
of KO plasmid using
1kb plus ladder
(invitrogen). A. PCR
product of full
plasmid showing
positive correlation
to recombination of
the 3 vectors,
pENTR-5’, pENTR-3’
and pHXGPRT with
expected band size
of ~4kbp B.
Diagnostic PCR
using P5'FOR
primer with
HXGPRT102-76 rev
primer (lane 3)
showing psitive
correlation to
expected band size
of ~1200bp and
P3’REV with
HXGPRT 1860 FOR
primers (lane 5)
showing positive
correlation with
expected band size
of ~1kbp.
B
A

A. Shuminas-Nelson
32
Figure #6. Diagnostic PCR of KO RH Δ HXGPRT Bulk culture using 1kb plus
ladder (Invitrogen). Lane 1 utilized primers TgMIFsFOR and TgMIFeREV(expected
band size ~3kbp), lane 2 used TgMIFsFOR and TgMIFmREV (expected band size
~1kb), lane 3 used TgMIFmFOR and TgMIFeREV (expected band size ~1kb), lane
4 used p5’FOR HXGPRT 102-76 (expected band size ~1200bp), lane 5 used
HXGPRT 1860 and P3'REV (expected band size ~1kbp) and lane 6 used TgTUB
For and REV as DNA control (expected band size ~ 400bp. Here we tested the
pre-cloned KO RH Δ HXGPRT bulk culture. Lanes 1, 2 and 3 show persistence of
the TgMIF gene and lanes 4 and 5 show insert integration in the same culture.

T. gondii:
33
Figure # 7. Diagnostic
PCR of 10 KO RH Δ
HXGPRT clones and RH Δ
HXGPRT WT, using 1kb
plus ladder (Invitrogen) A.
Lanes 3-14 used primers
TgMIFsFOR and
HXGPRT102-76 and
produced no bands. Lanes
15-20 (see 7b for
remaining samples with
primers) used primers
TgMIFsFOR and
TgMIFmREV (expected
band size if TgMIF gene
present in the clones is
~1kbp) B. Diagnostic PCR
of 10 KO RH Δ HXGPRT
clones and RH Δ HXGPRT
WT continued. Lanes 3-6
(continued) used primers
TgMIFsFOR and
TgMIFmREV (expected
band size if TgMIF gene
present in the clones is
~1kbp). Lanes 7-17 used
primers P5'FOR and
HXGPRT102-76 (expected
band of integrated insert
is ~ 1200bp). 8 out of the
10 clones show insert
integration with the
exception of RH Δ
HXGPRT WT.
A
B

A. Shuminas-Nelson
34
Figure # 8. The above gel shows TgMIF promoter mapping diagnostic
digestion. PCR product from primers TgMIF2For anf TgMIFRev, TgMIF1.5For
and TgMIFRev and TgMIF1For and TgMIFRev was digested with restriction
enzymes HINDIII and BGLII. The digestion was then run for positive
identification of the 2kbp, 1.5kbp and 1kbp promoter regions ligated with
LacZ in RPS13sub(IV). Promoter regions 2kbp, 1.5kbp and 1kbp are seen,
as compared to 1kb plus ladder (Invitrogen). Lane 2 contains TgMIF 1, lane
4 contains TgMIF 1.5, lane 6 contains TgMIF 2 and lanes 8 and 9 are
digestion controls. Lane 8 used HINDIII only digestion of LacZ TDHAP DNA
and lane 9 used BGLII only digestion of LacZ TDHAP DNA.

T. gondii:
35
Standard Curve
R
2
=0.9445
0
1
2
3
4
5
6
7
8
0.2 0.25 0.3 0.35 0.4
Absorbance
Concentration(ug/ml)
BSA
Figure #10. A. Scatter plot of
averaged absorbance of
Bradford protein assay for LacZ
expression. The line of best fit
for LacZ production with the
positive control shows a close
relationship to promoter region
1.5kbp for MIF. B. The
histogram with the line of best
fit of BSA protein standard for
protein concentrations.
B.
A.
LacZ Expression
0.1
0.12
0.14
0.16
0.18
0.2
0.22
0.24
0 50 100 150 200
Read Time (Min)
Absorbance
Substrate Mixture Only
Non-transfected (- Control)
LacZ (+ Control)
MIF 1
MIF1.5
MIF2

A. Shuminas-Nelson
36
References
1
Khan, I.A. et al “IP-10 is Critical for Effector T Cell Trafficking and Host Survival in
Toxoplasma gondii Infection” Immunity (May 2000) 12:483-494
2
Berdoy, M. et al “Fatal attraction in rats infected with Toxoplasma gondii” Proc. R.
Soc. Lond. B (2000) 267, 1591-1594
3
Flores, M. et al “Macrophage migration inhibitory factor (MIF) is critical for the host
resistance against Toxoplasma gondii” The FASEB Journal (October 2008)22: 3661-
3671
4
Novotná, M. et al “Probable neuroimmunological link between Toxoplasma and
cytomegalovirus infections and personality changes in the human host” BMC
Infectious Diseases (2005) 5:54,
5
Flegr, J. “Effects of Toxoplasma on Human Behavior” Schizophrenia Bulletin (2007)
Vol. 33 No. 3: 757-760
6
Berdoy, M. et al “Fatal attraction in rats infected with Toxoplasma gondii” Proc. R.
Soc. Lond. B (2000) 267, 1591-1594
7
Vyas, A. et al “Behavioral changes induced by Toxoplasma infection of rodents are
highly specific to aversion of cat odors” PNAS (April 2007) Vol. 104 No. 15: 6442-
6447
8
Flores, M. et al “Macrophage migration inhibitory factor (MIF) is critical for the host
resistance against Toxoplasma gondii” The FASEB Journal (October 2008)22: 3661-
3671
9
Calandra, T and Roger, T. “MACROPHAGE MIGRATION INHIBITORY FACTOR: A
REGULATOR OF INNATE IMMUNITY” Nature Reviews, Immunology (October 2003)
Vol. 3: 791-800
10
Bacher, M. et. al “Migration Inhibitory Factor Expression in

T. gondii:
37
Experimentally Induced Endotoxemia” American Journal of Pathology, Vol. 150, No.
1, January 1997
11
Bacher, M. et. al “An essential regulatory role for macrophage migration inhibitory
factor in T-cell activation” Proc. Natl. Acad. Sci. USA Immunology Vol. 93, pp. 7849-
7854, July 1996
12
Calandra, T. et al “The Macrophage Is an Important and Previously Unrecognized
Source of Macrophage Migration Inhibitory Factor” J. Exp. Med (June 1994) Vol.
179:1895-1902
13
Ogata, A. et al “Identification of macrophage migration inhibitory factor mRNA
expression in neural cells of the rat brain by in situ hybridization” Neuroscience
Letters 246 (1998) 173–177
14
Bacher, M. et al “MIF Expression in the Rat Brain: Implications for Neuronal
Function” Molecular Medicine (April 1998)Vol 4, No. 4: 217-230
15
Rosengren, E., Et Al “The Immunoregulatory Mediator Macrophage
Migration Inhibitory Factor (MIF)
Catalyzes a Tautomerization Reaction” Molecular Medicine, (January 1996 ) Volume
2, Number 1,143-149
16
Matsunaga, J. et al “Macrophage migration inhibitory factor (MIF)--its role in
catecholamine metabolism “ Cell Mol Biol (Nov. 1999); 45(7): 1035-40
17
Evald Rosengren, “The Immunoregulatory Mediator Macrophage
Migration Inhibitory Factor (MIF)Catalyzes a Tautomerization Reaction” Molecular
Medicine (January 1996 ) Volume 2, Number 1, 143-149
18
Matsunaga, J. et al “Enzyme Activity of Macrophage Migration Inhibitory Factor
toward Oxidized Catecholamines” The Journal Of Biological Chemistry (February 5
1999) Vol. 274, No. 6 pp. 3268–3271,

A. Shuminas-Nelson
38
19
Matsunaga, J. et al “Macrophage migration inhibitory factor (MIF)--its role in
catecholamine metabolism “ Cell Mol Biol (Nov. 1999); 45(7): 1035-40
20
Rosengren E et al “The macrophage migration inhibitory factor MIF is a
phenylpyruvate tautomerase.” FEBS Letters 417(1): 85-88 (1997)
21
Gaskell EA, Smith JE, Pinney JW, Westhead DR, McConkey GA “A Unique Dual
Activity Amino Acid Hydroxylase in Toxoplasma gondii.” PLoS
ONE (2009) 4(3): e4801. doi:10.1371/journal.pone.0004801
22
Unpublished data (Sommerville, C., 2009)
23
Matsunaga, J. et al “Enzyme Activity of Macrophage Migration Inhibitory Factor
toward Oxidized Catecholamines” The Journal of Biological Chemistry (February
1999) Vol. 274No. 6: 3268-3271
24
Murphy, B. L., Arnsten, A. F. T., Goldman-Rakic, P. S. and. Roth, R. H “Increased
dopamine turnover in the prefrontal cortex impairs
spatial working memory performance in rats and monkeys” Proc. Natl. Acad. Sci.
USA Neurobiology (February 1996) Vol. 93 pp. 1325-1329,
25
Brunswick, D. J., Amsterdam, J.D., Mozley, P.D., Newberg, A. “Greater Availability
of Brain Dopamine Transporters in Major Depression Shown by [99mTc]TRODAT-1
SPECT Imaging” Am J Psychiatry 2003; 160:1836–1841
26
Delgado García G, Rodríguez Perdomo E:”Reactivity of toxoplasmin intradermal
test in neurotic and manic - depressive patients.” Rev Cubana Med Trop 1980; 32:
35–39.
27
Flegr J, Havlícek J, Kodym P, Malý M, Smahel Z “Increased risk of traffic accidents
in subjects with latent toxoplasmosis: a retrospective case-control study” BMC Infect
Dis 2002; 2: 11
28
Hodková H, Kolbeková P, Skallová A, Lindová J, Flegr J: “Higher perceived
dominance in Toxoplasma infected men – A new evidence for role of increased level

T. gondii:
39
of testosterone in toxoplasmosis-associated changes in human behavior” Neuro
Endocrinol Lett (2007) 28: 110–114.
29
Hinze-Selch D, Däubener W, Eggert L, ErdagS, Stoltenberg R, Wilms S. “A
controlled prospective study of Toxoplasma gondii infection in individuals with
schizophrenia: beyond seroprevalence.” Schizophr Bull (2007)33: 782–788.
30
Eric J. Nestler “Neurobiology of Depression” Neuron (March 28, 2002) Vol. 34: 13–
25
31
Ron M. Sullivan and Marc M. Dufresne Mesocortical dopamine and HPA axis
regulation: Role of laterality and early environment Brain Research Volume 1076,
Issue 1, 3 March 2006, Pages 49-59
32
Kshitiz Chaudhary Purine Salvage Pathways in the Apicomplexan
ParasiteToxoplasma gondii The Journal of Biological Chemistry (July 23, 2004) Vol.
279, No. 30, pp. 31221–31227
33
Invitrogen “MultiSite Gateway® Three-Fragment Vector Construction Kit” Catalog
no. 12537-023 Ver. C (November 29, 2004) 25-0541
34
Augustijn, K.D. Et Al “Functional Characterization of the Plasmodium falciparum
and P. bergheiHomologues of Macrophage Migration Inhibitory Factor” Infection and
Immunity (Mar. 2007) p. 1116–1128
35
Donald, R.G.K and Roos, D. S. “Homologous recombination and gene replacement
at the dihydrofolate reductase-thymidylate synthase locus in Toxoplasma gondii”
Molecular and Biochemical Parasitology (1994) 63:243-253
36
Wolff. E.F. Et Al “ Endometrial stem cell transplantation restores
dopamine production in a parkinson’s disease model” Journal of Cellular and
Molecular Medicine “Postprint”;10.1111/j.1582-4934.2010.01068.x

A. Shuminas-Nelson
40
37
Gulinello M, et al, “Aquired Infection with Toxoplasma gondii in adult mice results
in sensorimotor deficits but normal cognitive behavior despite widespread brain
pathology” Microbes Infect.(July 2010)12(7):528-37
38
Lees, A.J. and Smith, E. “Cognitive Deficits in the Early Stages of Parkinson’s
Disease” Brain (1983) 106(2):257-270
39
Bernheimer, H. Et Al “Brain Dopamine and the Syndromes of Parkinson and
Huntington Clinical, Morphological and Neurochemical Correlations” Journal of the
neurological Sciences (1973) 20:41-455
40
Beck, G.C. Et Al “Clinical review: Immunomodulatory effects of dopamine in
general inflammation” Critical Care (2004) 8:485-491
41
Aeberli, D., Leech, M. and. Morand, E. F “Macrophage migration inhibitory factor
and glucocorticoid sensitivity” Rheumatology (2006)45:937–943
42
Bozza, M. Et Al “Targeted Disruption of Migration Inhibitory Factor Gene Reveals
Its Critical Role in Sepsis” JEM (January 18, 1999) vol. 189 (2): 341
43
Wing, E.J., Boehmer, S. M. And Christner, L. K. “Toxoplasma gondii: Decreased
resistance to intracellular bacteria in mice” Experimental Parasitology Volume 56,
Issue 1, August 1983, Pages 1-8
44
Herak-Perković, V. Et Al “ Effects of dopaminergic drugs on inflammatory bowel
disease induced with 2,4-dinitrofluorbenzene in BALB/c mice” Journal of Veterinary
Pharmacology and Therapeutics (2001) 24: 267–273.
45
Ohkawara, T. Et Al “Amelioration of dextran sulfate sodium–induced colitis by anti-
macrophage migration inhibitory factor antibody in mice” Gastroenterology (July
2002) Vol 123 (1):256-270
46
Webster, J.P. “The Effect of Toxoplasma gondii on Animal Behavior: Playing Cat
and Mouse” Schizophrenia Bull. (2007) 33(3): 752-756

T. gondii:
41
Special Thanks to Rima McLeod , Ernest Mui, Fiona Henriquez, Kamal El-
Bissati and William Witola, without their help and patience this would not
have been possible.

shuminasa

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Viewers also liked

Viewers also liked (7)

Similar to shuminasa

Similar to shuminasa (20)

shuminasa