1. Teaching Guide for Senior High School
GENERAL
BIOLOGY 2
SPECIALIZED SUBJECT | ACADEMIC-STEM
This Teaching Guide was collaboratively developed and reviewed by
educators from public and private schools, colleges, and universities. We
encourage teachers and other education stakeholders to email their
feedback, comments, and recommendations to the Commission on Higher
Education, K to 12 Transition Program Management Unit - Senior High School
Support Team at k12@ched.gov.ph. We value your feedback and
recommendations.
The Commission on Higher Education
in collaboration with the Philippine Normal University
INITIAL RELEASE: 13 JUNE 2016
2. This Teaching Guide by the
Commission on Higher Education is
licensed under a Creative
Commons Attribution-
NonCommercial-ShareAlike 4.0
International License. This means
you are free to:
Share — copy and redistribute the
material in any medium or format
Adapt — remix, transform, and
build upon the material.
The licensor, CHED, cannot revoke
these freedoms as long as you
follow the license terms. However,
under the following terms:
Attribution — You must give
appropriate credit, provide a link to
the license, and indicate if changes
were made. You may do so in any
reasonable manner, but not in any
way that suggests the licensor
endorses you or your use.
NonCommercial — You may not use
the material for commercial
purposes.
ShareAlike — If you remix,
transform, or build upon the
material, you must distribute your
contributions under the same license
as the original.
Development Team
Team Leader: Ivan Marcelo A. Duka
Writers: Neil Andrew B. Bascos, Ph.D., Ma.
Genaleen Q. Diaz, Ph.D., Ian Kendrich C. Fontanilla,
Ph.D., Ma. Carmina C. Manuel, Ph.D., Sharon Rose
M. Tabugo, Ph.D., Eugenio P. Quijano Jr.
Technical Editors: Annalee S. Hadsall, Ph.D.
Copy Reader: Caroline H. Pajaron
Illustrator: Ma. Daniella Louise F. Borrero
Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz
Published by the Commission on Higher Education, 2016
Chairperson: Patricia B. Licuanan, Ph.D.
Commission on Higher Education
K to 12 Transition Program Management Unit
Office Address: 4th Floor, Commission on Higher Education,
C.P. Garcia Ave., Diliman, Quezon City
Telefax: (02) 441-0927 / E-mail Address: k12@ched.gov.ph
Senior High School Support Team
CHED K to 12 Transition Program Management Unit
Program Director: Karol Mark R. Yee
Lead for Senior High School Support:
Gerson M. Abesamis
Lead for Policy Advocacy and Communications:
Averill M. Pizarro
Course Development Officers:
John Carlo P. Fernando, Danie Son D. Gonzalvo
Teacher Training Officers:
Ma. Theresa C. Carlos, Mylene E. Dones
Monitoring and Evaluation Officer:
Robert Adrian N. Daulat
Administrative Officers:
Ma. Leana Paula B. Bato, Kevin Ross D. Nera,
Allison A. Danao, Ayhen Loisse B. Dalena
Printed in the Philippines by EC-TEC Commercial, No. 32 St.
Louis Compound 7, Baesa, Quezon City, ectec_com@yahoo.com
Consultants
THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY.
University President: Ester B. Ogena, Ph.D.
VP for Academics: Ma. Antoinette C. Montealegre, Ph.D.
VP for University Relations & Advancement: Rosemarievic V. Diaz, Ph.D.
Ma. Cynthia Rose B. Bautista, Ph.D., CHED
Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University
Carmela C. Oracion, Ph.D., Ateneo de Manila University
Minella C. Alarcon, Ph.D., CHED
Gareth Price, Sheffield Hallam University
Stuart Bevins, Ph.D., Sheffield Hallam University
4. Introduction
As the Commission supports DepEd’s implementation of Senior High School (SHS), it upholds the vision
and mission of the K to 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic
Education Act of 2013, that “every graduate of basic education be an empowered individual, through a
program rooted on...the competence to engage in work and be productive, the ability to coexist in
fruitful harmony with local and global communities, the capability to engage in creative and critical
thinking, and the capacity and willingness to transform others and oneself.”
To accomplish this, the Commission partnered with the Philippine Normal University (PNU), the National
Center for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this
Teaching Guide was studied and reviewed by education and pedagogy experts, and was enhanced with
appropriate methodologies and strategies.
Furthermore, the Commission believes that teachers are the most important partners in attaining this
goal. Incorporated in this Teaching Guide is a framework that will guide them in creating lessons and
assessment tools, support them in facilitating activities and questions, and assist them towards deeper
content areas and competencies. Thus, the introduction of the SHS for SHS Framework.
The SHS for SHS Framework, which stands for “Saysay-Husay-Sarili for Senior High School,” is at the
core of this book. The lessons, which combine high-quality content with flexible elements to
accommodate diversity of teachers and environments, promote these three fundamental concepts:
SAYSAY: MEANING
Why is this important?
Through this Teaching Guide,
teachers will be able to facilitate
an understanding of the value
of the lessons, for each learner
to fully engage in the content
on both the cognitive and
affective levels.
HUSAY: MASTERY
How will I deeply understand this?
Given that developing mastery
goes beyond memorization,
teachers should also aim for
deep understanding of the
subject matter where they lead
learners to analyze and
synthesize knowledge.
SARILI: OWNERSHIP
What can I do with this?
When teachers empower
learners to take ownership of
their learning, they develop
independence and self-
direction, learning about both
the subject matter and
themselves.
SHS for SHS
Framework
5. iii
This Teaching Guide is intended for Science, Technology, Engineering, and Mathematics (STEM) Strand
teachers who are teaching learners under the Academic Track. The prerequisite course for this subject is
General Biology 1, that primarily focuses on life processes at the cellular and molecular levels. The said
prerequisite course also covers the transformation of energy in organisms.
As we go broader on a macro-level perspective, General Biology 2 is designed to enhance the
understanding of the principles and concepts in the study of Biology, particularly heredity and variation,
and the diversity of living organisms, their structure, function, and evolution. It is with passionate desire
that the teachers who will tackle the concepts in General Biology 2 lead Grade 12 students to pursue
Science-related courses in college. Studies conducted across the globe have identified innovation and
education in the fields of Science, Technology, Education and Mathematics (STEM) as critical
determinants economic prosperity. Indeed, STEM educated and trained individuals have been shown to
be major determinants of innovation and, thus, contributors to significant economic productivity.
Through this Teaching Guide, teachers are also empowered to be Designers, Facilitators, and
Learners of their own lessons:
1. When teachers are Designers, they should be able to:
- Contextualize available resources, content, and tools to fit their learners and environments
- Collaborate with fellow teachers in preparing materials and lessons
- Create and utilize assessments (rubrics, exams, projects)
- Leverage Pedagogical-Content Knowledge in developing lessons
- Design lessons that encourage creativity and leadership
2. When teachers are Facilitators, they should be able to:
- Ask questions, facilitate discussions, and encourage student reflection
- Use learner-centered teaching strategies
- Provide useful feedback for learners
- Mentor learners for careers and further education
- Be sensitive to teenage development (gender, identity, character, grit)
3. When teachers are Learners, they should be able to:
- Gather data and student feedback
- Reflect on student feedback and classroom insights to improve teaching
- Use teacher/peer observations
- Critically use research and information
- Connect prior knowledge and debunk common misconceptions in education
About this
Teaching Guide
6. This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly
usable for teachers. It contains classroom activities and pedagogical notes, and is integrated with
innovative pedagogies. All of these elements are presented in the following parts:
1. Introduction
• Highlight key concepts and identify the essential questions
• Show the big picture
• Connect and/or review prerequisite knowledge
• Clearly communicate learning competencies and objectives
• Motivate through applications and connections to real-life
2. Motivation
• Give local examples and applications
• Engage in a game or movement activity
• Provide a hands-on/laboratory activity
• Connect to a real-life problem
3. Instruction/Delivery
• Give a demonstration/lecture/simulation/hands-on activity
• Show step-by-step solutions to sample problems
• Give applications of the theory
• Connect to a real-life problem if applicable
4. Practice
• Discuss worked-out examples
• Provide easy-medium-hard questions
• Give time for hands-on unguided classroom work and discovery
• Use formative assessment to give feedback
5. Enrichment
• Provide additional examples and applications
• Introduce extensions or generalisations of concepts
• Engage in reflection questions
• Encourage analysis through higher order thinking prompts
6. Evaluation
• Supply a diverse question bank for written work and exercises
• Provide alternative formats for student work: written homework, journal, portfolio, group/individual
projects, student-directed research project
Parts of the
Teaching Guide
7. v
As Higher Education Institutions (HEIs) welcome the graduates of
the Senior High School program, it is of paramount importance to
align Functional Skills set by DepEd with the College Readiness
Standards stated by CHED.
The DepEd articulated a set of 21st century skills that should be
embedded in the SHS curriculum across various subjects and tracks.
These skills are desired outcomes that K to 12 graduates should
possess in order to proceed to either higher education,
employment, entrepreneurship, or middle-level skills development.
On the other hand, the Commission declared the College
Readiness Standards that consist of the combination of knowledge,
skills, and reflective thinking necessary to participate and succeed -
without remediation - in entry-level undergraduate courses in
college.
The alignment of both standards, shown below, is also presented in
this Teaching Guide - prepares Senior High School graduates to the
revised college curriculum which will initially be implemented by AY
2018-2019.
College Readiness Standards Foundational Skills DepEd Functional Skills
Produce all forms of texts (written, oral, visual, digital) based on:
1. Solid grounding on Philippine experience and culture;
2. An understanding of the self, community, and nation;
3. Application of critical and creative thinking and doing processes;
4. Competency in formulating ideas/arguments logically, scientifically, and creatively; and
5. Clear appreciation of one’s responsibility as a citizen of a multicultural Philippines and a
diverse world;
Visual and information literacies, media literacy, critical thinking
and problem solving skills, creativity, initiative and self-direction
Systematically apply knowledge, understanding, theory, and skills for the development of
the self, local, and global communities using prior learning, inquiry, and experimentation
Global awareness, scientific and economic literacy, curiosity,
critical thinking and problem solving skills, risk taking, flexibility
and adaptability, initiative and self-direction
Work comfortably with relevant technologies and develop adaptations and innovations for
significant use in local and global communities
Global awareness, media literacy, technological literacy,
creativity, flexibility and adaptability, productivity and
accountability
Communicate with local and global communities with proficiency, orally, in writing, and
through new technologies of communication
Global awareness, multicultural literacy, collaboration and
interpersonal skills, social and cross-cultural skills, leadership
and responsibility
Interact meaningfully in a social setting and contribute to the fulfilment of individual and
shared goals, respecting the fundamental humanity of all persons and the diversity of
groups and communities
Media literacy, multicultural literacy, global awareness,
collaboration and interpersonal skills, social and cross-cultural
skills, leadership and responsibility, ethical, moral, and spiritual
values
On DepEd Functional Skills and CHED College Readiness Standards
8. K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 1 of 3
Grade: Grade 11/12 Quarters: 3rd to 4th Quarter
Subject Title: Biology 2 I No. of Hours: 40 hours/10 Weeks per Quarter
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly heredity and variation, and
the diversity of living organisms, their structure, function, and evolution.
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
Organismal
Biology
The learners demonstrate
an understanding of:
1. Plant and Animal
Organ Systems and
their Functions
The learners shall be able to:
develop a presentation (e.g.
role-playing, dramatization and
other forms of multimedia) to
show how an organism
maintains homeostasis through
the interaction of the various
organ systems in the body
The learners:
1. compare and contrast the following processes in plants
and animals: reproduction, development, nutrition, gas
exchange, transport/circulation, regulation of body
fluids, chemical and nervous control, immune systems,
and sensory and motor mechanisms
STEM_BIO11/12-
IVa-h-1
2. Feedback Mechanisms
2. explain how some organisms maintain steady internal
conditions that possess various structures and processes
STEM_BIO11/12-
IVi-j-2
3. describe examples of homeostasis (e.g., temperature
regulation, osmotic balance and glucose levels) and the
major features of feedback loops that produce such
homeostasis
STEM_BIO11/12-
IVi-j-3
Genetics
1. Mendel’s Laws of
Inheritance
2. Sex Linkage
3. Central Dogma of
Molecular Biology
4. Recombinant DNA
1. make a pedigree analysis in
the learner’s family using a
simple genetic trait
2. make a research paper/case
study/poster on genetic
diseases
3. make a diagram (e.g.,
pictogram, poster) showing
the evolution of a
domesticated crop
4. differentiate the 3-Domain
Scheme from the 5-Kingdom
Scheme of classification of
living things
1. predict genotypes and phenotypes of parents and
offspring using the laws of inheritance
STEM_BIO11/12-
IIIa-b-1
2. explain sex linkage and recombination STEM_BIO11/12-
IIIa-b-2
3. describe modifications to Mendel’s classic ratios (gene
interaction)
STEM_BIO11/12-
IIIa-b-3
4. illustrate the molecular structure of DNA, RNA, and
proteins
STEM_BIO11/12-
IIIa-b-4
5. diagram the steps in DNA replication and protein
synthesis
STEM_BIO11/12-
IIIa-b-5
6. outline the processes involved in genetic engineering STEM_BIO11/12-
IIIa-b-6
7. discuss the applications of recombinant DNA STEM_BIO11/12-
IIIa-b-7
9. K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 2 of 3
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
Evolution and
Origin of
Biodiversity
Relevance, Mechanisms,
Evidence/Bases, and
Theories of Evolution
1. describe general features of the history of life on Earth,
including generally accepted dates and sequence of the
geologic time scale and characteristics of major groups
of organisms present during these time periods
STEM_BIO11/12-
IIIc-g-8
2. explain the mechanisms that produce change in
populations from generation to generation (e.g.,
artificial selection, natural selection, genetic drift,
mutation, recombination)
STEM_BIO11/12-
IIIc-g-9
3. show patterns of descent with modification from
common ancestors to produce the organismal diversity
observed today
STEM_BIO11/12-
IIIc-g-10
4. trace the development of evolutionary thought STEM_BIO11/12-
IIIc-g-11
5. explain evidences of evolution (e.g., biogeography,
fossil record, DNA/protein sequences, homology, and
embryology)
STEM_BIO11/12-
IIIc-g-12
6. infer evolutionary relationships among organisms using
the evidence of evolution
STEM_BIO11/12-
IIIc-g-13
Systematics
Based on
Evolutionary
Relationships
Basic Taxonomic Concepts
and Principles, Description,
Nomenclature,
Identification, and
Classification
1. explain how the structural and developmental
characteristics and relatedness of DNA sequences are
used in classifying living things
STEM_BIO11/12IIIh-
j-14
2. identify the unique/distinctive characteristics of a
specific taxon relative to other taxa
STEM_BIO11/12IIIh-
j-15
3. describe species diversity and cladistics, including the
types of evidence and procedures that can be used to
establish evolutionary relationships
STEM_BIO11/12IIIh-
j-16
10. K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 3 of 3
Code Book Legend
Sample: STEM_BIO11/12IIIh-j-16
LEGEND SAMPLE
First Entry
Learning Area and Strand/ Subject or
Specialization
Science, Technology, Engineering and
Mathematics
STEM_BIO11/12
Grade Level Grade 11 or 12
Uppercase Letter/s
Domain/Content/
Component/ Topic
General Biology
-
Roman Numeral
*Zero if no specific quarter
Quarter Third Quarter III
Lowercase Letter/s
*Put a hyphen (-) in between letters to indicate
more than a specific week
Week Weeks eight to ten h-j
-
Arabic Number Competency
describe species diversity and cladistics,
including the types of evidence and
procedures that can be used to establish
evolutionary relationships
16
11. K to 12 Senior High School Science, Engineering, Technology and Mathematics Strand Scheduling * 80 hours per subject
SUGGESTED ACADEMIC TRACK – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) STRAND SCHEDULING OF SUBJECTS*
STEM
Grade 11 Grade 12
1st
Semester 2nd
Semester 1st
Semester 2nd
Semester
CORE
SUBJECTS
Oral Communication in Context Reading and Writing Skills
21st
Century Literature from the
Philippines and the World
Physical Education and Health
Komunikasyon at Pananaliksik sa
Wika at Kulturang Pilipino
Pagbasa at Pagsusuri ng Iba’t-Ibang
Teksto Tungo sa Pananaliksik
Contemporary Philippine Arts from
the Regions
General Mathematics Statistics and Probability Media and Information Literacy
Earth Science
Disaster Readiness and Risk
Reduction
Understanding Culture, Society and
Politics
Introduction to the Philosophy of
the Human Person / Pambungad sa
Pilosopiya ng Tao
Personal Development / Pansariling
Kaunlaran
Physical Education and Health
Physical Education and Health Physical Education and Health
CONTEXTUALIZED
SUBJECTS
Empowerment Technologies (E-
Tech): ICT for Professional Tracks
Research in Daily Life 1
English for Academic and
Professional Purposes
Research in Daily Life 2
Entrepreneurship
Pagsulat sa Filipino sa Piling
Larangan (Akademik)
Research Project
SPECIALIZATION
SUBJECTS
Pre-Calculus Basic Calculus General Physics 1 General Physics 2
General Chemistry 1 General Biology 1 General Biology 2
General Chemistry 2
Research/Capstone Project
HOURS
PER DAY 5.8 6.6 6.6 5.8
Please note that some subjects have prerequisites. These are indicated in the Curriculum Guides and are listed below for easy referral.
SUBJECT PREREQUISITE/S
Research in Daily Life 2 Statistics and Probability
Basic Calculus Pre-Calculus
General Biology 2 General Biology 1
General Chemistry 2 General Chemistry 1
General Physics 1 Pre-Calculus, Calculus
General Physics 2 General Physics 1
12. General Biology 2
Lesson 1: Pedigree Analysis
Content Standard
The learners understand Mendel’s Laws of Inheritance.
Performance Standard
The learners shall be able to:
• make a Pedigree Analysis in the learner’s family using a simple genetic trait.
Learning Competency
The learners shall be able to construct pedigrees and predict genotypes based
on pedigree analysis (STEM_BIO11/12-IIIa-b-1)
Specific Learning Outcomes:
At the end of the lesson, the learners will be able to:
• identify the mode of inheritance of a particular trait given the pedigree;
• predict the genotypes of parents; and
• compute the probability of occurrence of an affected offspring in a given
cross.
60 MINS
LESSON OUTLINE
Introduction Communicating Learning Objectives and
Relevant Vocabulary
5
Motivation Narrative 5
Instruction Recall in Mendelian Ratios, Discussion
on Co-Dominance and Multiple Alleles
40
Practice Group Work: Non-Mendelian Traits in
Humans, Plants, and Animals
40
Materials
Pen, paper, and ruler
Resources
(1) Klug WS, Cummings MR, Spencer CA, Palladino MA.
2012. Essentials of genetics. 8th ed. Benjamin Cummings;
2012. 624 p.
(2) Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV,
Jackson RB. 2012. Campbell biology, 9th ed. The
Benjamin Cummings Publishing Co., Inc: 2012. 1464 p.
(3) Bennett RL, Steinhaus KA, Uhrich SB, O’Sullivan CK, Resta
RG, Lochner-Doyle D, Markel DS, Vincent V, Hamanishi J.
Recommendations for standardized human pedigree
nomenclature. Am J Human Genet. 1995; 56:745-752.
13. INTRODUCTION (5 MINS)
1. Cite the learning objectives, which are as follows:
I. identify the mode of inheritance of a particular trait given the pedigree
II. predict the genotypes of parents
III. predict the probability of having an affected offspring
2. Relevant vocabulary
I. Pedigree. Making use of diagrams showing the ancestral relationships and transmission of
genetic traits over several generations in a family
II. Proband. The individual in the pedigree that led to the construction of the pedigree. For
example, a couple consults a medical geneticist because they have an offspring who is
afflicted with a disease and they want to find out the mode of transmission of this disease.
When the medical geneticist constructs the pedigree, the offspring will be labeled as the
proband. Through the pedigree, the probability of having other affected children may be
determined.
III. Law of Segregation (1st Mendelian Law). For every trait governed by a pair of alleles,
these alleles segregate or separate during gamete formation in meiosis
IV. Law of Independent Assortment (2nd Mendelian Law). A pair of alleles for one trait will
segregate or separate independently of another pair of alleles for another trait during
meiosis
V. Autosomal trait. A trait whose alleles that control it are found in the autosomes (body
chromosomes/ non-sex chromosomes)
VI. Genotype. The gene pair an individual carries for a particular trait symbolized with a pair
of letters. By convention, uppercase letter (eg. A) for a dominant allele and lowercase
letter (eg. a) for the recessive allele. Any letter in the alphabet may be used
A. For a diploid organism with two alleles in a given gene pair, genotypes may be
written as:
i. Homozygous dominant, i.e. with two dominant alleles (DD)
ii. Heterozygous, i.e. with a dominant and recessive allele (Dd). The individual will
show the dominant phenotype.
iii. Homozygous recessive, i.e. with two recessive alleles (dd)
Teacher Tip:
Tell the learners that they have to use a letter in
which the uppercase and lowercase versions are
easy to distinguish using cursive to avoid
confusion.
Ask learners to recall their lessons in classical
genetics in their previous grade levels.
2
14. VII. Phenotype
A. The observable trait of an individual based on its genotype. Examples: red flower, curly
hair, blood types ( i.e. the blood type is the phenotype)
B. For a typical Mendelian trait, phenotypes may either be:
i. Dominant. A trait that requires at least one dominant allele for the trait to be
expressed, e.g. Dd
ii. Recessive. A trait that requires two recessive alleles for the trait to be expressed
VIII.Phenocopy. A trait that is expressed due to specific environmental conditions (i.e. having
hair that is dyed of a different color) and is not due to the genotype.
IX. Identical twins. Also known as monozygotic twins, which are derived from a single
fertilization event. After the first cleavage or cell division of the zygote, the cells or
blastomeres separate and become independent blastocysts implanted in the mother’s
uterus.
X. Fraternal twins. Twins that are derived from separate fertilization events (two eggs
fertilized by two sperms) within the fallopian tube, resulting in two separate zygotes; also
known as dizygotic twins
REVIEW (15 MINS)
1. Ask the learners to recall Mendelian Laws of Inheritance
I. Law of Segregation (1st Mendelian Law)
II. Law of Independent Assortment (2nd Mendelian Law)
2. Ask the learners to define genotypes and phenotypes, dominant and recessive traits,
homozygous and heterozygous dominants as well as homozygous recessive
3. Ask the learners to review the classic monohybrid Mendelian F2 genotypic and phenotypic
ratios by filling out a table (see table 1 at the end of this document)
4. In a monohybrid cross and assuming complete dominance, the ratio of the F2 progenies may
be predicted as 3:1, i.e. 3 with the dominant trait and 1 with the recessive trait.
5. In a dihybrid cross and assuming complete dominance, the ratio of the F2 progenies may be
predicted as 9:3:3:1.
Teacher Tip:
Note that the phenotype is determined by the
genotype. In complete dominance, RR- red flower;
rr- white flower; but Rr will express the red flower
condition because one dominant allele is enough
for the dominant trait to be expressed in the
organism.
Teacher Tip:
The learners should be able to predict correctly
the Mendelian ratios without having to use a
Punnett square. They should be able to solve for
probabilities of occurrence of a trait by analyzing a
pedigree.
15. INSTRUCTION (15 MINS)
1. Define pedigree analysis.
2. Enumerate uses of pedigree analysis:
I. Describe the mode of inheritance of a trait
II. Calculate the probability of occurrence an affected offspring
in a given cross
3. Establish symbols for creating pedigrees
I. Male (square) vs female (circle)
II. Affected (shaded) vs unaffected (unshaded) individual
III. Marriage/mating line (line connecting mates) vs. sibship line
(line connecting siblings)
IV. Fraternal twins (one birthline branching out into the
individual twin) vs. identical twins (same as fraternal twins but
with a horizontal bar connecting the branches)
V. Generation (Roman numerals) vs. individuals in the same
generation, counting left to right (designated by Hindu-
Arabic numerals)
VI. Proband (arrow)
Sample pedigree with symbol guides
4. What to expect in a human pedigree
I. For autosomal dominant trait: Two affected individuals can
have a normal offspring
II. For autosomal recessive trait: Two affected individuals can
NEVER have a normal offspring
5. Give an example of a pedigree and solve some questions
PRACTICE (25 MINUTES)
1. Divide learners into groups of four.
2. Provide copies of four sample pedigrees. (See samples in Figure
2 at the end of this document.)
3. For each pedigree, provide questions for the group to answer
I. Identify the mode of inheritance
II. Write down the genotypes of specific individuals
III. Compute for the probability of having an affected offspring
4
16. A. Look at the family of IV-9 and IV-10. If the trait is dominant, is
it possible for them to have an affected offspring?
(Answer: NO. If the trait is dominant, then unaffected
individuals are homozygous recessive. Two recessive
individuals CANNOT produce a dominant offspring.)
B. If the trait is recessive, is it also possible for IV-9 and IV-10 to
have an unaffected offspring?
(Answer: YES. This can happen if both parents are
heterozygous for the trait, which means they can each
give a recessive allele to produce a homozygous
recessive offspring.)
C. Based on your answers for a) and b), is the trait dominant or
recessive?
(Answer: RECESSIVE)
D. Give the genotypes of the following:
i. IV-9 (Answer: Dd)
ii. IV-10 (Answer: Dd)
iii. V-1 (Answer: DD or Dd)
iv. I-1 (Answer: dd)
v. I-2 (Answer: Dd)
E. If IV-9 and IV-10 were to have another child, what is the
probability that they will have an affected offspring?
(Answer: 1/4 or 25% following the Mendelian ratio from a
hybrid cross)
A. Is this trait dominant or recessive?
(Answer: RECESSIVE. If the trait were dominant, then
individuals I-3 and I-4 are both homozygous recessive, which
means they CANNOT have a dominant offspring.)
B. What are the most probable genotypes of I-3 and I-4?
(Answer: Dd and Dd in order for each parent to be able to
contribute a recessive allele to give rise to a recessive
offspring.)
C. What are the most probable genotypes of II-4 and II-5?
(Answer: Dd and Dd. Same reason as b.)
D. What is the probability that II-4 and II-5 will have another normal
offspring?
(Answer: 75%. A hybrid cross will produce 75% dominant
offspring and 25% recessive offspring.)
17. A. Is the trait dominant or recessive?
(Answer: DOMINANT. If the trait were recessive, then
individuals I-1 and I-2 are homozygous recessive, and
they CANNOT produce a dominant affected offspring.)
B. What are the most probable genotypes of I-2 and I-3?
(Answer: Dd and Dd. Each parent must be heterozygous
in order to give a recessive allele to produce a recessive
unaffected offspring.)
C. What is the probability that II-2 is Dd?
(Answer: 1 or 100%. II-2, together with the homozygous
recessive II-1, was able to produce homozygous
recessive unaffected offspring. This can only happen if
II-2 also possesses a recessive allele, which means s/he is
a heterozygote.)
D. What is the probability that II-1 and II-2 will have another
normal offspring?
(Answer: 1/2 or 50%. Following the Mendelian cross of
dd x Dd, there is a 50% probability of producing a
homozygous recessive unaffected offspring.)
A. Is the trait dominant or recessive?
(Answer: DOMINANT. If the trait were recessive, then
individuals I-3 and I-4 must be homozygous recessive, and
they CANNOT produce a dominant offspring.)
B. What are the genotypes of I-1 and I-2?
(Answer: dd and dd. Since the trait is dominant, it follows that
unaffected individuals are homozygous recessive.)
C. What is the probability that I-1 and I-2 will have an affected
offspring?
(Answer: 0. Homozygous recessive individuals CANNOT
produce an offspring with a dominant trait.)
D. What are the genotypes of I-3 and I-4?
(Answer: Dd and Dd. Each parent must have a recessive allele
in order to produce a homozygous recessive offspring.)
E. What is the probability that II-6 is Dd?
(Answer: 2/3. II-6’s parents are both heterozygotes. Following
the Mendelian cross of Dd x Dd, the probabilities of
occurrence of phenotypes in this cross are 25% (1/4) DD, 50%
(2/4) Dd, and 25% (1/4) dd, giving a ratio of 1:2:1. Since II-6 is
already affected, then his phenotype is dominant. Therefore,
the probability of II-6 being affected is 0. So instead of a ratio
of 1:2:1, the ratio to be considered should now be just 1:2
(DD:Dd). The probability of II-6 being Dd should now be 2/3.)
6
18. ENRICHMENT
1. As a homework, assign each learner to construct a pedigree of an authentic family using any of the following traits:
I. With (dominant) or without finger hair (recessive)
II. Normal (dominant) or hitchhiker’s thumb (recessive)
III. Widow’s peak (dominant) or straight hairline (recessive)
IV. Free (dominant) or attached earlobe (recessive)
V. Curly (dominant), wavy (heterozygous) or straight (recessive) hair
2. B. Where possible, determine the genotypes of every individual in the family
CROSS EXPECTED GENOTYPE(S) EXPECTED PHENOTYPE(S)
1. DD x DD 100% DD 100% dominant
2. DD x Dd 50% DD: 50% Dd 100% dominant
3. DD x dd 100% Dd 100% dominant
4. Dd x Dd 25% DD: 50% Dd: 25% dd 75% dominant: 25% recessive
5. Dd x dd 50% Dd: 50% dd 50% dominant: 50% recessive
19. General Biology 2
Lesson 2: Sex Linkage and
Recombination
Content Standard
The learners understand inheritance of Sex Linked characters
Performance Standard
The learners shall be able to
• make a a research paper/case study/poster on transmission of a sex-linked
genetic disease
Learning Competency
The learners shall be able to explain sex related inheritance and
recombination; illustrate the transmission of sex-linked characters; and
distinguish sex-linked traits from other sex-related traits (STEM_BIO11/12-IIIa-
b-2)
Specific Learning Outcomes
At the end of the lesson, the learners will be able to:
• illustrate the transmission of an X-linked and a Y-linked character;
• compute the probability of the occurrence of a sex-linked trait; and
• give examples of other sex-related traits.
60 MINS
LESSON OUTLINE
Introduction Communicating Learning Objectives and
Relevant Vocabulary
5
Motivation Case Study 10
Instruction Discussion of Sex-Linked Traits 25
Practice Group Work 20
Enrichment Narrative
Materials
Pen, paper, and ruler
Resources
(1) Klug, W. S., M. R. Cummings, C. A. Spencer and M.A.
Palladino. 2012. Essentials of Genetics. 8th ed. Benjamin
Cummings.
(2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A.,
Minorsky, P.V., and Jackson, R.B. 2012. Campbell Biology,
(9th ed). The Benjamin Cummings Publishing Co., Inc.
(3) Sheridan, M. 1999. Instructor’s guide for Biology, 5th ed.
By Campbell, Reece, Mitchell. Addison Wesley Longman,
Inc.
8
20. INTRODUCTION (5 MINS)
Communicating Learning Objectives
1. Cite the learning objectives, which are as follows:
I. illustrate the transmission of an X-linked and a Y-linked character
II. compute the probability of the occurrence of a sex-linked trait
III. give examples of other sex-related traits
Relevant Vocabulary
2. State the relevant vocabulary:
I. Sex linked trait. The gene (pair) that determines a character (e.g. hemophilia) is located
on the sex chromosomes
II. X-linked trait. A sex-linked trait is where the gene or allele for the trait is found on the X
chromosome
III. Color blindness. An X-linked recessive trait where a affected individual could not
distinguish red from green color (red green color blindness)
IV. Hemophilia. An X-linked recessive trait where an affected individual suffers from delayed
blood clotting during injuries because of the absence of certain blood clotting factors
V. Y-linked trait. A sex-linked trait where the gene or allele for the trait is found on the Y
chromosome
VI. Hypertrichosis pinnae auris. A Y-linked trait where affected males have hair growing from
their external ears
VII. Other sex-related traits.
A. Sex-influenced trait- Any trait in a diploid organism whose expression is affected by
an individual’s biological sex; a trait that occurs at a higher frequency in one sex over
the other
B. Sex-limited trait- Any trait in a diploid organism whose expression is limited to just
one biological sex
C.
Teacher tip:
Ask the learners to review the topic on
recombination in Meiosis that they took up in BIO 1.
Recombination or shuffling of genes/ alleles in
Meiosis results to variation in the genome of
gametes, the sperm cells and egg cells.
In any cell of the body (somatic), there are
chromosome pairs. In humans, pair numbers 1-22 are
the autosomes or body chromosomes while the last
(23rd
) pair is the sex chromosome.
Normal human females have two X chromosomes
and normal human males have one X chromosome
and a Y chromosome; that is:
XX- female
XY- male
21. MOTIVATION (10 MINS)
Case Study
Present these three cases using pictures:
Use a high resolution figure (photograph or image projected on a
computer or LCD) to ensure the accuracy of the color blindness test.
Those that could see the figure are normal; those that cannot are
colorblind. In most cases, the colorblind males outnumber the
colorblind females, which are rare. If there are no colorblind
individuals in the class, the teacher will just have to mention as a
matter of fact that colorblind females are rare.
Be careful in conducting this test to discourage teasing of actual
colorblind learners. Emphasize that colorblind individuals are
normal except that they could not distinguish between red and
green colors.
Misconception: Common misconception is that baldness occurs
only in males. Emphasize that baldness does happen in women,
although the frequency is much lower and is therefore rare.
A picture of a color blindness test chart
Ask the learners if they could see a figure in
the picture and ask the class to recite aloud
the figure/ number.
A picture of a family with male members
who are bald
Ask the learners if baldness occurs more in
men or women.
A picture or description of a woman
breastfeeding a baby
Ask the learners who among the men and
women are able to lactate or breastfeed their
young.
10
22. INSTRUCTION (25 MINS)
Sex-linked traits
• Give the definition of an X-linked trait
• Explain why X-linked traits may occur more frequently in one
sex over the other
• In humans, males and females are represented by different
sex chromosomes
• Females have two X chromosomes in the nucleus of their
cells.
• Males have one X chromosome and one Y chromosome in
the nucleus of their cells.
• Depending on whether the trait is dominant or recessive, the
expression pattern of the trait differs in males and females
• Colorblindness in humans as an example of sex-linked trait
• The alleles responsible for colorblindness is found on the X
chromosome only
• The dominant allele is the normal allele; the recessive allele
causes colorblindness
• Females need two copies of the recessive allele, one from
each of the two X chromosomes, for the trait to be
manifested. If they only have one copy of the recessive
allele, they have normal color vision. However, they are
carriers for the trait in that they may pass it on to their
offspring.
• Males only need one recessive allele in their sole X
chromosome for the trait to be expressed.
• Explain what happens to the expression patterns if the trait
is X-linked and dominant.
• Use Table 2 as guide.
• Give the definition of a Y-linked trait
• Explain why there is difference in expression between males
and females for Y-linked traits. (Since the allele is found only
in the Y chromosome, and since only males have Y-
chromosomes, then only males will express the trait.
Females CANNOT express Y-linked traits.)
• Hypertrichosis pinnae auris as an example of a Y-linked trait
• If a male has the allele responsible for the trait, then his Y
chromosome will possess that allele. Since he will pass on his
Y chromosome to his sons, then all his sons will inherit the
trait, and they, in turn, can pass on the allele to their sons.
3. Describe other sex-related traits
Sex-influenced trait
• Give the definition
• Explain why traits may be expressed differently between
sexes
• Hormonal or physiological differences between the sexes
cause differences of expression of certain genes
• Baldness in humans as an example of a sex-influenced
trait. See Table 1 how baldness is hypothesized to be
expressed by a single pair of alleles, with B as the
dominant allele for baldness and b as the recessive
normal allele.
Sex-limited traits
• Give the definition
• Explain why traits may be limited to one sex only
• Hormonal or physiological differences between sexes
may limit the expression of some genes to one biological
sex only
• Functional mammary glands as an example of a sex-
limited trait. Only females can express functional
mammary glands that produce milk immediately after
giving birth.
• Note that baldness behaves like a dominant trait in
males in that only one dominant allele is needed for
baldness to be expressed. On the other hand, the trait
behaves like a recessive trait in women in that they need
both dominant alleles to be present for baldness to be
expressed.
23. PRACTICE (20 MINS)
1. Divide learners into groups of four.
2. Ask each group to answer a set of questions related to sex-related traits in humans. See
sample questions.
ENRICHMENT
As a homework, provide this narrative to the class:
The last Emperor of Russia, Nicolas II, was married to Empress Alexandra, and they had five
children, Olga, Tatiana, Maria, Anastasia, and Alexis. Alexis was the only one who was afflicted
with hemophilia or the royal bleeding disease; all other members were normal.
• Research on this medical condition and determine the mode of inheritance.
• If only Prince Alexis was afflicted with the disease, determine his genotype.
• What could be the genotypes of the Emperor and Empress?
• Is it possible that each daughter could have been a carrier?
Teacher tip:
Hemophilia is an X-linked recessive trait. Empress
Alexandra was most likely a carrier of the trait (XC
X).
She was a descendant of Queen Victoria of the
United Kingdom, who herself was a probable carrier.
The Emperor was completely unaffected and
therefore had an XY genotype. Based on the
genotypes of the parents, Alexis had an XC
Y
genotype, with the defective X chromosome carrying
the allele for hemophilia coming from his mother.
Each daughter, in turn, had a 50% probability of
being a carrier, but they could NEVER have been
affected.
12
24. General Biology 2
Lesson 3: Modification to Mendel’s Classic
Ratios
Content Standard
The learners understand Non-Mendelian Modes of Inheritance
Performance Standard
The learners shall be able to
• make a research paper/case study/poster on a non-Mendelian genetic trait
Learning Competency
The learners shall be able to describe some modifications to Mendel’s classic
ratios (gene interactions) (STEM_BIO11/12-IIIa-b-3)
Specific Learning Outcomes
At the end of the lesson, the learners will be able to:
• distinguish Mendelian from non-Mendelian modes of inheritance; and
• describe some cases of non-Mendelian genetic traits
60 MINS
LESSON OUTLINE
Introduction Communicating Learning Objectives and
Relevant Vocabulary
5
Motivation Narrative 5
Instruction Recall in Mendelian Ratios, Discussion
on Co-Dominance and Multiple Alleles
40
Practice Group Work: Non-Mendelian Traits in
Humans, Plants, and Animals
40
Materials
Pen and Paper
Resources
(1) Klug, W.S., Cummings, M.R., Spencer, C.A. and Palladino, M.A.. 2012.
Essentials of Genetics. 8th
ed. Benjamin Cummings.
(2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
Jackson, R.B. 2012. Campbell Biology, (9th
ed). The Benjamin
Cummings Publishing Co., Inc.
(3) Sheridan, M. 1999. Instructor’s guide for Biology, 5th
ed. By Campbell,
Reece, Mitchell. Addison Wesley Longman, Inc.
25. INTRODUCTION (5 MINS)
Communicating Learning Objectives
1. Cite the major learning objectives, which are as follows:
I. distinguish Mendelian from non-Mendelian modes of
inheritance
II. describe some cases of non-Mendelian genetic traits
Relevant Vocabulary
2. Present the following relevant vocabulary:
I. Co-dominance - When two contrasting alleles are present in
the same locus or trait (heterozygote genotype), then the
phenotype expressed is a “blend” of the two extreme
phenotypes. The two genes interact and the offspring shows
the effects of both alleles.
II. Incomplete dominance - When two contrasting alleles are
present in the same locus or trait (heterozygote genotype),
then both alleles are expressed in the same phenotype
III. Multiple alleles - When there are more than two types of
alleles for a given locus or trait, this will result in more than
two kinds of phenotypes that may be expressed for that
trait.
MOTIVATION (5 MINS)
Narrative
1. Provide this narrative to the class:
2. A local hospital has sent word to a family of a possible mix up of
some of the children with other families when they were born.
To rule out any possible mix up, the hospital obtained the blood
types of every individual in the family, including the surviving
maternal grandfather and paternal grandmother. The results
were as follows:
Father: Type O
Mother: Type A
1st child: Type O
2nd child: Type A
3rd child: Type B
Maternal grandfather: Type AB
Paternal grandmother: Type B
3. Based on the results, is there a possibility that any one of the
children is not a biological offspring of the couple? To answer
this question, we must first understand how blood types, a non-
Mendelian trait is inherited.
14
26. INSTRUCTION (40 MINS)
Recall in Mendelian Ratios, Discussion on Co-Dominance and Multiple Alleles
1. Let the learners recall the Mendelian Ratios in STEM_BIO11/12-IIIa-b-1
2. Discuss incomplete dominance. Define the trait. The heterozygote genotype is expressed as a
distinct phenotype (a “blend” of the two extreme phenotypes). In this case, the phenotypic
ratio is the same as the genotypic ratio
I. Use snapdragon plants (Antirrhinum majus) as example (see figure 1).
A. RR – red flowers
B. Rr – pink flowers
C. rr – white flowers
3. Discuss co-dominance. Define the trait. The heterozygote genotype is expressed as a distinct
phenotype (both extreme phenotypes are expressed at the same time). Similar to incomplete
dominance, the phenotypic ratio is the same as the genotypic ratio.
I. Use human MN blood typing as an example
A. MM – type M
B. MN – type MN
C. NN – type N
4. Discuss multiple alleles. Define the trait. There are more than two types of alleles, and the
relationship of each allele with respect to others will determine the number of phenotypes
that may be expressed.
I. Use coat color in rabbits as example (see figure 2)
A. There are four different types of alleles in rabbits: C (Agouti), Cch (Chinchilla), Ch
(Himalayan), and c (Albino), with the following dominance hierarchy: C> Cch>Ch> c.
B. The following genotypes will have the corresponding phenotypes in coat color:
i. CC – Agouti
ii. CCch – Agouti
iii. CCh – Agouti
iv. Cc – Agouti
v. CchCch – Chinchilla
Teacher Tip:
Review the Mendelian ratios and ensure that the
learners are familiar with them before they could
proceed with the lesson.
Emphasize that incomplete dominance and co-
dominance are similar in that their phenotypic
ratios follow their genotypic ratios. However, they
differ in the expression of the heterozygote
condition: in co-dominance, the heterozygote
expresses both extreme phenotypes; in
incomplete dominance, the heterozygote is
expressed as a “blend” of the two extreme
phenotypes.
27. vi. CchCh – Chinchilla
vii. Cchc – Chinchilla
viii.ChCh – Himalayan
ix. Chc – Himalayan
x. Cc – Albino
C. Use ABO blood typing in humans as example
i. There are three different types of alleles A (or IA), B (or IB) and O (or i)
ii. The following genotypes will have the following blood types (phenotypes):
iii. AA (or IAIA) – Type A
iv. AO (or IAi) – Type A
v. BB (or IBIB) – Type B
vi. BO (or IBi) – Type B
vii. AB (IAIB) – Type AB
viii.OO (ii) – Type O
5. Go back to the Motivation narrative
I. The class will now answer the question/narrative provided during the Motivation part. The
teacher will ask first the most probable genotypes of all the members of the family as
follows:
i. Father: Type O - OO
ii. Mother: Type A - AO
iii. 1st child: Type O - OO
iv. 2nd child: Type A - AO
v. 3rd child: Type B – B?
vi. Maternal grandfather: Type AB - AB
vii. Paternal grandmother: Type B – BO
viii.Possible mix-up? Yes, 3rd child.
Teacher Tip:
Note that in the ABO system, the O allele is
recessive to both A and B alleles while the A and B
alleles are co-dominants of one another.
Blood types O and AB can only have OO and AB
genotypes, respectively.
The mother must be AO in order to have an
offspring that is either A or O.
The paternal grandmother must be BO in order to
have an offspring (father) who is blood type O.
The 3rd
child could have been the result of a mix
up because the B allele is not present in either
parent.
Misconception
Emphasize that blood typing could only be used to
exclude/disprove biological parentage, not to
prove it.
16
28. PRACTICE (40 MINS)
1. Divide learners into groups of four.
2. Ask each group to answer a set of questions related to non-
Mendelian modes of inheritance. See sample questions.
1. In cattle, coat color is inherited in a co-dominant fashion.
Homozygous B1B1 produces black coat, homozygous B2B2
produces white coat, and the heterozygous B1B2 produces
roan coat. Give the phenotypic ratio of the offspring of the
following crosses:
A. B1B1 x B1B1 (ANSWER: all black)
B. B1B1 x B2B2 (ANSWER: all roan)
C. B1B2 x B1B2 (ANSWER: 25% Black: 50% Roan: 25%
White)
D. B1B1 x B1B2 (ANSWER: 50% Black: 50% Roan)
E. B1B2 x B2B2 (ANSWER: 50% Roan: 50% White)
2. In a hypothetical plant, a serrated leaf margined plant, when
crossed with a smooth leaf margined plant, produces
offsprings with wavy leaf margin.
A. Identify the mode of inheritance. (ANSWER: Incomplete
dominance)
B. Two serrated plants, when crossed, will give what type of
offspring? (ANSWER: Serrated plants; the trait is
homozygous, therefore producing offspring with the
same phenotype as the parents)
C. Two wavy plants will produce what possible kinds of
offspring? Give their ratios? (ANSWER: 25% serrated:
50% wavy: 25% smooth; this is a hybrid cross, which will
give a 1:2:1 ratio)
3. In guinea pigs, coat color is governed by four alleles that
constitute a multiple allelic series, C (black), cS (sepia), cC
(cream), and c (albino) with the following dominance
hierarchy: C>cS>cC>c. Determine the phenotypic ratios of
the progeny from the following crosses:
A. Cc x CcS (ANSWER: 75% black: 25% sepia; the
genotypes and their probabilities of occurrence are: 25%
CC, 25% CcS, 25% Cc, and 25% cSc, giving a phenotypic
ratio of 75% black and 25% sepia)
B. CcS x cCc (ANSWER: 50% black: 50% sepia; the
genotypes and their probabilities of occurrence are 25%
CcC, 25% Cc, 25% cScC, 25% cSc, giving a phenotypic
ratio of 50% black and 50% sepia)
4. A man who is blood type B is married to a woman who is
blood type A. None of the man’s parents is blood type O.
This couple has 4 children with the following blood types: B,
AB, AB and O. Give the genotypes of the parents.
(ANSWER: Man: BO; Woman: AO; Both parents must have
an O allele in order to produce and offspring with blood
type O with genotype OO)
29. Incomplete dominance in snapdragons, Antirrhinum majus. The
cross involving homozygote red flowers (RR) and homozygote white
flowers (rr) will yield a heterozygote (Rr) that expresses a different
phenotype, which is pink flowers. The cross between pink-flowered
individuals will produce offsprings where the genotypic ratio also
becomes the phenotypic ratio (25% red: 50% pink: 25% white).
(Wikipedia)
Coat color in rabbits. The trait is controlled b multiple alleles with
the following dominance hierarchy: C (Agouti) > Cch (Chinchilla) >
Ch (Himalayan) > c (Albino).
18
30. General Biology 2
Lesson 4: Molecular Structure of DNA,
RNA, and Proteins
Content Standard
The learners understand Structures and Functions of DNA, RNA and proteins
Performance Standard
The learners shall be able to
• build models of DNA, RNA and proteins
Learning Competency
The learners shall explain how the structures of DNA, RNA and proteins are
related to their functions (STEM_BIO11/12- IIIa-b-4)
Specific Learning Outcomes
At the end of the lesson, the learners will be able to:
• describe the building blocks of DNA, RNA and proteins;
• identify the structural and functional differences between DNA and RNA
and
• explain the different levels of protein structure
60 MINS
LESSON OUTLINE
Introduction Communicating Learning Objectives 5
Motivation Group Work 5
Instruction Discussion on the Molecular Structures
of DNA, RNA, and Proteins
30
Practice Building Models of DNA 5
Enrichment Conversion to mRNA Transcripts 5
Evaluation Identification of Biomolecule
Represented by Given Chain Structures
10
Materials
Recyclable materials for model construction; freely
downloadable molecular modeling software.
Resources
Biochemistry textbooks; SwissPDB Viewer software (free
download); Protein Data Bank (www.pdb.org)
31. INTRODUCTION (5 MINS)
Communicating Learning Objectives
1. The learning outcomes will be presented as follows:
I. describe building blocks of DNA, RNA and Proteins.
II. identify the structural and functional differences between DNA and RNA.
III. discuss the different levels of protein structure (primary, secondary, tertiary and quaternary)
IV. 4.explain how protein structural features may influence their functions
2. Ask learners if they have heard of the term “genes”. Ask them what “genes” have they
inherited from their parents.
Sample answers: genes for dimples, straight hair, etc.
MOTIVATION (5 MINS)
1. Divide the class into groups of learners. Allow each group to enumerate the most important
functions of DNA and proteins that they can recall from their previous grade levels.
2. Consolidate these answers on the board.
INSTRUCTION (30 MINS)
1. The building blocks of any nucleic acid are the nucleotides.
2. A nucleotide is composed of a phosphate group (with negative charges), a sugar portion and
an N-base.
3. The sugar in DNA is deoxyribose while the sugar in RNA is ribose. Explain the difference
through a visual aid.
4. DNA and RNA are polynucleotides. N-bases are either purines or pyrimidines. Purine bases
are Adenine (A) and Guanine (G). Pyrimidines are Cytosine (C), Thymine (T, in DNA only) and
Uracil (U, found only in RNA)
5. Specific base pairings occur in DNA. A pairs with T; G pairs with C
6. DNA is double stranded while RNA is single stranded with Uracil instead of Thymine.
Teacher Tip:
One dimensional and two dimensional models of
DNA should be presented to the class.
Teacher Tip:
Expected Answers:
DNA: repository of genetic information
RNA: transcripts; link between the gene and the
gene product (protein)
Protein: functional products; executors of cellular
functions
20
32. 7. Main Functions:
I. DNA: repository of genetic information; sequence of bases encodes the blueprint for life
processes
II. RNA: information in the form of base sequence is transformed (transcribed) into mRNA,
tRNA and rRNA. DNA is the template copied into RNA by base pairing. G with C; A with
U.
III. Protein: functional products of genes; executes cellular functions
8. The four structural levels of proteins are: 1.Primary- sequence of amino acids in the
polypeptide chain; 2. Secondary- when the polypeptide chains form a helix or a pleated sheet
structure; 3. Tertiary- coiling of the polypeptide, combining helices and sheet forms; 4.
Quaternary- the association of two or more polypeptides in space
Summary of Important Physical Properties
Teacher Tip:
If computers and internet facilities are available,
structures for these biomolecules are available as
molecular structure files (*.pdb) from the Protein
Data Bank (www.pdb.org).Focus on the important
parts of the structure that provide the necessary
physical properties of DNA, RNA and proteins.
Discuss the importance of these physical features
for the functions of DNA, RNA and proteins.
Emphasize that the DNA has negative charges on
the outside due to the phosphate groups. Other
stabilizing factors in the DNA should be
mentioned.
Note:
For each classification of amino acid,give the
names of each amino acid. Give the one letter
symbol for each amino acid. The three letter code
for each amino acid may also be provided.
BIOMOLECULE Physical Property Functional Relevance
DNA Complementary Base Pairs Allows each strand to serve as a template
for replication and transcription
Phosphodiester bonds Essential for polynucleotide chain
elongation
RNA Single stranded but some bases
can be complementary; hence,
some portions may be double
stranded
For stability
Uracil Nitrogenous base found only in RNA.
PROTEIN Amino (N)Terminus Start of the polypeptide chain
Amino (N)Terminus End of the polypeptide chain
Peptide Bond Links amino acids together
One letter symbol for each
amino acid
Classes:
a. non-polar- aliphatic or aromatic
b. polar, uncharged
c. polar, charged- acidic and basic
33. PRACTICE (5 MINS)
Given the following coding sequence for DNA, provide the sequence of the complementary
(template) sequence.
Coding sequence : 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
(Answer)
Complementary sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
Ask the learners to build models of DNA by using recyclable materials such as popsicle sticks or
pieces of colored papers to represent the complementary bases: G with C; A with T. The DNA
backbone (phosphate, sugar) should be included.
ENRICHMENT (5 MINS)
1. Convert the given coding sequence into an mRNA transcript:
Complementary Non-coding/ Template sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
(Answer)
Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
2. Translate the given mRNA transcript into a polypeptide sequence:
Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
(Answer)
Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
Teacher Tip:
Be sure to note the antiparallel orientation of the
coding and non-coding strands of DNA. Explain
the relative positions of the 5’ and 3’ ends.
Teacher Tip:
The mRNA transcript has almost the same
sequence as the coding sequence (DNA), but the
thymines are replaced to Uracil.
Show the learners how to read the codon Table
Teach the learners the single letter codes for the
amino acids (e.g. ryptophan ! Trp ! W).
Ask the learners to spell their names using the
amino acid codes (e.g. N-E-I-L ! Asn – Glu – Ile –
Lue).
22
34. EVALUATION (10 MINS)
Ask learners to identify the type of biomolecule represented by a given chain structure:
1. DNA-
2. RNA-
3. Protein-
Example
Template sequence
3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’
5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’
Learners may be asked to identify the important structural features in these chain structures
(features are listed in the instruction/ delivery table). A similar exercise of generating non-coding
sequences (DNA), transcripts (RNA) and translated polypeptides may be done to test the learners
understanding of the topic.
Teacher Tip:
To help learners practice the generation of
complementary sequences, worksheets with
partially completed sequences may be used.
35. General Biology 2
Lesson 5: DNA Replication and Protein
Synthesis
Content Standard
The learners understand Central Dogma of Molecular Biology.
Performance Standard
The learners shall be able to
• identify requirements, enzymes and products in DNA Replication,
transcription, and protein synthesis.
Learning Competency
The learners should be able to diagram the steps in DNA replication,
transcription, and protein synthesis (STEM_BIO11/12- IIIa-b-5)
Specific Learning Outcomes
At the end of the lesson, the learners will be able to:
• describe the requirements, proteins and enzymes in DNA replication;
• transcription and translation; and
• diagram the steps in replication, transcription and translation.
60 MINS
LESSON OUTLINE
Introduction Communicating Learning Objectives and
Review
5
Motivation Inquiry 5
Instruction Discussion on DNA Replication or DNA
Synthesis
20
Practice Matching Type Game 10
Evaluation Take-home Activity 5
Materials
Paper, coloured pens
Resources
(1) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
Jackson, R.B. 2012. Campbell Biology, (9th
ed). The Benjamin
Cummings Publishing Co., Inc.
24
36. INTRODUCTION (5 MINS)
1. The learning objectives will be communicated as follows:
A. Describe the requirements, proteins and enzymes in DNA replication, transcription and
translation
B. Diagram the steps in replication, transcription and translation.
C. Explain what happens to a gene sequence that undergoes transcription and eventual
translation into protein
2. Ask the learners to recall the significance of Mitosis.
Mitosis is an equational cell division that produces daughter cells which are identical or clones
of the original, mother cell. This ensures that every cell of the body has the same genetic
content, i.e. chromosome number. To make this possible, cells have to duplicate their genetic
material which is primarily DNA.
MOTIVATION (5 MINS)
1. Ask learners to imagine how many cells a typical mature human contains. Tell them that they
all came from just one fertilized egg cell. A zygote goes through millions of generations of cell
divisions to become just the one person that a learner is. Even until now, cells in an individual
are still dividing. Ask learners what examples of tissues in their body are undergoing cell
division. (sample answers: skin; blood cells)
2. Also, ask learners to recall that in the previous topics on genetics, the phenotype is the
outside, visible characteristic of an organism. Any phenotype (eg. red flower) is directly
determined by proteins or enzymes functioning in a metabolic pathway. Proteins are made by
“turning on” specific portions of DNA that are called genes. Particular sequences of DNA are
transcribed to become RNAs. These are then used to produce proteins in a process called
translation.
Teacher Tip:
To help learners practice the generation of
complementary sequences, worksheets with
partially completed sequences may be used.
37. INSTRUCTION (65 MINS)
1. DNA replication or DNA synthesis. DNA strands separate and serve as templates for the
production of new DNA molecules.
A. The following are features of replication:
i. Semiconservative- the resulting DNA consists of one old and one new strand
ii. Base pairing is maintained; Adenine pairs with Thymine, Guanine pairs with Cytosine
iii. New DNA molecules are produced in the 5’ to 3’ direction
iv. Semidiscontinuous. The leading strand is synthesized in a continuous manner (5’ to 3’)
while the lagging strand is produced discontinuously in short stretches called Okazaki
fragments.
B. In lagging strand synthesis, there is a need for a primer terminus which is provided by an
RNA molecule. RNA is synthesized by a primase or RNA polymerase. The 3’OH of the
RNA is where new DNA nucleotides are added thus new DNA is built in the 5’ to 3’
direction.
C. Enzymes in replication are as follows: 1. helicase; 2. gyrase; 3. SSB (single strand binding
proteins); 4. primase or RNA polymerase; 4. DNA polymerase and 5. DNA ligase.
Teacher Tip:
To help learners practice the generation of
complementary sequences, worksheets with
partially completed sequences may be used.
26
38. 2. Transcription or RNA synthesis. DNA is unwound and one strand is used as template for the
production of an RNA molecule. An RNA polymerase makes RNA in the 5’ to 3’ direction.
Specific regions in the DNA called promoters allow the binding of transcription factors which
make possible the binding of RNA polymerase. Three major types of RNA are: messenger
RNA (mRNA); transfer RNA (tRNA) and ribosomal RNA (rRNA).
3. Translation or protein synthesis. This occurs in the ribosome. Basic ingredients are the
various types of RNAs produced in transcription and some proteins or enzymes. The mRNA
contains triplets of bases called codons that specify an amino acid, eg. UUU-phe. Various
tRNAs carry amino acids from the cytoplasm to the actual site of translation in the ribosome. A
tRNA has an anticodon that pair with a codon in the mRNA. Different rRNAs combine with
ribosomal proteins to make up the subunits of a ribosome. A functional ribosome has a small
and a large subunit.
In bacteria, transcription and translation may be simultaneous. In eukaryotic cells, mRNA,
tRNA and rRNA travel from the nucleus to the cytoplasm through the nuclear pores. RNAs
may undergo processing. Some unnecessary parts like introns are removed. In eukaryotic
mRNA, a 5’ cap and a 3’ poly A tail are added. Coding regions of mRNA are called exons.
They specify functional protein products.
Teacher Tip:
To help learners practice the generation of
complementary sequences, worksheets with
partially completed sequences may be used.
39. In the elongation
process of translation,
amino acids are linked
by peptide bond
formation due to the
action of peptidyl
transferase known to
be a part of the
ribosome subunit. The
process is summarized
in the diagram above.
To initiate translation, the small and the big subunits of the ribosome have
to be separated. Initiation factors (IF) make this possible. They also prevent
the premature reassociation of these subunits. The small subunit of the
ribosome binds the mRNA and allows the entrance of a tRNA to the P site
bearing the first amino acid. The big subunit then binds and together they
form an assembly ready for the next amino acid in the A site of the
ribosome.
A stop codon signals the
end of translation. No
amino acid corresponds
to a stop codon. Release
factors halt the process
and the polypeptide is
released.
The genetic code is the correspondence of the mRNA codons to
amino acids. An amino acid is specified by a codon with three
code letters. The genetic code is shown as above.
28
40. The genetic code is the correspondence of the mRNA codons to amino acids. An amino acid is
specified by a codon with three code letters. The genetic code is shown as follows:
PRACTICE (5 MINS)
1. Matching Type Game: For each protein or enzyme or structure mentioned above, identify
whether such is involved in replication, transcription or translation.
2. Explain why both DNA replication and RNA transcription are disrupted by the loss of RNA
polymerase.
EVALUATION (5 MINS)
1. As an assignment, ask the learners to make their own diagram of the steps involved in DNA
replication, transcription and translation or protein synthesis. (Note: The learners may choose a
variety of medium for presenting the steps of the processes.)
Teacher Tip:
Use flash cards. Organize learners into groups and
ask them to compete.
Point out the effect of the loss of the
following:
ENZYME EFFECT OF LOSS
DNA Polymerase No replication
Helicases Decreased DNA replication
efficiency
Peptidyl
transferase
No peptide bond formation
RNA Polymerase No replication
No transcription
Ribosomes No translation
41. General Biology 2
Lesson 6: Genetic Engineering
Content Standard
The learners outline the steps in Recombinant DNA.
Performance Standard
The learners shall be able to
• explain how genes may be modified and/or inserted in host cells/
organisms.
Learning Competency
The learners should be able to outline the steps involved in genetic
engineering (STEM_BIO11/12-III a-b-6)
Specific Learning Outcomes
At the end of the lesson, the learners will be able to:
• compare classical breeding with modern genetic engineering techniques;
• enumerate the steps in molecular cloning;
• describe some methods to introduce DNA into cells; and
• explain the selection and screening of transformants / genetically modified
organisms (GMOs)
60 MINS
LESSON OUTLINE
Introduction Communicating Learning Objectives and
Review
5
Motivation Desirable Traits 5
Instruction Genetic Engineering 35
Practice Recitation 5
Enrichment Poster Making 5
Evaluation Assignment 5
Materials
Recyclable materials for paper models of plasmids; scissors; tape; pens of
various colors
Resources
Biochemistry textbooks; online videos on genetic engineering
and GMOs
30
42. INTRODUCTION (5 MINS)
Communicating Learning Objectives and Review
1. The learning outcomes will be presented and the overall idea on how organisms may be
modified will be discussed.
2. In order to survive, man has successfully domesticated selected plants and animals. He has
taken an active part in choosing desired traits of plants and animals. Traits that were
considered valuable (i.e. high fruit yield; high milk production, etc.) were sought out and
propagated. The processes involved may include classical breeding practices such as
controlled pollination of plants, and the mating of animals with desired traits. In today’s
modern science, molecular biology techniques are being employed in the insertion and
expression of proteins in different organisms for various purposes.
MOTIVATION (5 MINS)
Desirable Traits
1. Ask for volunteers to enumerate plants and animals that have desirable or enhanced traits.
2. Ask learners to explain how each of the traits was introduced or developed (i.e. classical
breeding or recombinant DNA technology).
Teacher Tip:
Make a quick review of the previous lesson on
DNA replication and protein synthesis.
Teacher Tip:
Group the learners into 3’s or 4’s and allow each
group to discuss examples of “enhanced” animals/
plants.
ENHANCED TRAIT MODIFYING TECHNIQUE
Kobe / Wagyu Beef (Beef with good fat
distribution)
Classical breeding
Guapple (Large sized guava) Classical breeding
Human Insulin-producing bacteria Recombinant DNA Technology
Flavr-Savr (Delayed-ripening tomatoes) Recombinant DNA Technology
Macapuno trait in coconuts Classical breeding
43. INSTRUCTION (60 MINS)
Genetic Engineering
1. Classical breeding practices focus on the mating of organisms with desirable qualities.
2. Genetic engineering involves the use of molecular techniques to modify the traits of a target
organism. The modification of traits may involve:
I. introduction of new traits into an organism
II. enhancement of a present trait by increasing the expression of the desired gene
III. enhancement of a present trait by disrupting the inhibition of the desired genes’
expression.
3. A general outline of recombinant DNA may be given as follows:
I. cutting or cleavage of DNA by restriction enzymes (REs)
II. selection of an appropriate vector or vehicle which would propagate the recombinant
DNA ( eg. circular plasmid in bacteria with a foreign gene of interest)
III. ligation (join together) of the gene of interest (eg. from animal) with the vector ( cut
bacterial plasmid)
IV. transfer of the recombinant plasmid into a host cell (that would carry out replication to
make huge copies of the recombined plasmid)
V. selection process to screen which cells actually contain the gene of interest
VI. sequencing of the gene to find out the primary structure of the protein
4. After outlining the key steps in recombinant DNA, the teacher can proceed to describe the
ways in which these plasmids may be introduced into host organisms.
Biolistics. In this technique, a “gene gun” is used to fire DNA-coated pellets on plant tissues.
Cells that survive the bombardment, and are able to take up the expression plasmid coated
pellets and acquire the ability to express the designed protein.
Plasmid insertion by Heat Shock Treatment. Heat Shock Treatment is a process used to
transfer plasmid DNA into bacteria. The target cells are pre-treated before the procedure to
increase the pore sizes of their plasma membranes. This pretreatment (usually with CaCl2) is
said to make the cells “competent” for accepting the plasmid DNA. After the cells are made
Teacher Tip:
Pictures of common domesticated plants and
animals may be shown in class.
High cost of medicine and other agricultural
products may be mentioned.
32
44. competent, they are incubated with the desired plasmid at about 4°C for about 30min. The
plasmids concentrate near the cells during this time. Afterwards, a “Heat Shock” is done on
the plasmid-cell solution by incubating it at 42°C for 1 minute then back to 4°C for 2 minutes.
The rapid rise and drop of temperature is believed to increase and decrease the pore sizes in
the membrane. The plasmid DNA near the membrane surface are taken into the cells by this
process. The cells that took up the plasmids acquire new traits and are said to be
“transformed”.
Electroporation. This technique follows a similar methodology as Heat Shock Treatment, but,
the expansion of the membrane pores is done through an electric “shock”. This method is
commonly used for insertion of genes into mammalian cells.
5. Some methods to screen recombinant cells are as follows:
Selection of plasmid DNA containing cells
A selection marker within the inserted plasmid DNA sequence allows the selection of
“transformants”. Usually, an antibiotic resistance gene (e.g. AMP ampicillin resistance gene) is
included in the plasmid DNA. This allows only “transformed” cells to survive in the presence
of the antibiotic (e.g. ampicillin). Plating the plasmid-cell solution on antibiotic-containing
media will select for these “transformants” and only allow plasmid-containing cells to grow
and propagate into colonies.
Selection of transformed cells with the desired gene
Certain inserted genes within the plasmids provide visible proof of their presence. These
include the antibiotic resistance genes that allow for the selection of the transformed cells
within the solution. Some inserted genes also produce colored (e.g. chromogenic proteins) or
fluorescent products (e.g. GFP) that label the colonies/cells with the inserted gene.
In some cases, the location of the cloning site within the plasmid is in the middle of a gene
(i.e. β-galactosidase, lacZ) that generates a (blue) colored product in the presence of a
substrate (i.e. isopropyl β-D-1 thiogalactopyranoside, or IPTG). Cells transformed with these
“empty” plasmids will turn blue in the presence of IPTG. Insertion of a gene in the cloning site
disrupts the sequence of the β-galactosidase gene and prevents the generation of the colored
Teacher Tip:
Agarose gel electrophoresis (AGE) allows the
identification of PCR products and estimation of
their sizes. This is done by running a molecular
weight (MW) ladder alongside the samples. The
MW ladder is made up of DNA fragments of
known size (e.g. 100bp, 200bp, 300bp, 500bp,
etc). The size of the PCR product may be
approximated by the DNA fragment in the MW
ladder that runs a similar distance.
45. product in the presence of the substrate. Cells transformed with the disrupted β-galactosidase
gene will remain “white” in the presence of IPTG. This “blue-white screening” protocol is thus
able to screen for cells that were transformed with the desired gene in the cloning site.
PCR detection of plasmid DNA
Alternatively, the presence of the desired gene in the inserted plasmids may be confirmed
using PCR amplification. PCR reactions specific for the desired gene may be done using DNA
from cells. Amplification of the expected product would confirm the presence of the gene
within the samples. PCR reactions specific for plasmid sequences will also confirm/identify the
type of plasmid used for the transformation.
Genetically Modified Organisms (GMOs)
With the ability to insert gene sequences, comes the possibility of providing new traits for
these target organisms. This has allowed the development of GMOs. Some of these genetic
modifications promise higher product yield for their targets. These include the Flavr-Savr
Tomato and Bt-Corn.
The Flavr-Savr (“Flavor Savor”) tomato was the first genetically modified organism that was
licensed for human consumption. The trait modified in this tomato is its ripening process. A
gene for an enzyme that causes the degradation of pectin in the cell walls (i.e.
polygalacturonase) normally softens the fruit as it ripens. In Flavr Savr tomatoes, an inhibitor
(i.e. antisense RNA) disrupts the expression of this gene, thereby delaying the softening of the
fruit and extending the time it may be kept in storage and transported to markets.
Bt-Corn was developed to incorporate the production of a toxin (i.e. Bt-endotoxin) from
Bacillus thuringensis in corn plants. This toxin results in the death of pests that feed on these
plants like the corn borer larvae. The toxin has been shown to be selective for Lepidoptera
larvae and is non-toxic to humans, mammals, fish and birds. The selective toxicity of the toxin
allows its use in foodcrops. The introduction of the toxin is believed to increase crop
production due to decreased losses from pest infestation. The same technology has been
applied in the Philippines for the development of Bt-Eggplant.
Teacher Tip:
Note that antisense RNA strands bind to mRNAs.
This prevents their expression into proteins.
Note:
Which of the techniques discussed can be used to
detect if GMOs were used in a certain food
product?
Answer: Assuming that the DNA is still intact in the
sample, testing for specific marker genes in
expression plasmids can be used to detect the
presence of these engineered plasmids.
34
46. Despite the proposed benefits of GMOs, some people have raised their concerns regarding
the consumption of these modified foods. While most of the products are tested for safety,
concerns are raised for the possibility of not being able to detect hazards that are present, but
are currently undetectable by today’s current technology.
Because of these issues, manufacturers are urged to provide labels that notify consumers of
GMO presence in their products. While GMOs are believed to be safe when licensed by the
food regulatory agencies, it is believed that the consumers must be provided with enough
information to make their own choices regarding their use.
PRACTICE (5 MINS)
Recitation
1. Ask the learners to differentiate the various technologies for delivering genes into cells.
2. Determine which technologies are most appropriate for which cell types.
(Answers: Biolistics for plants; Electroporation for mammalian cells; Heat shock for
bacterial cells)
ENRICHMENT (5 MINS)
Poster Making
1. Learners may be asked to make a poster on the steps and other methods involved in
recombinant DNA.
EVALUATION (5 MINS)
Assignment
1. Give an assignment and allow learners to research on the pros and cons of genetic
engineering.
2. Ask them for their opinion on the matter, and ask them to support these opinions with facts
learned in class. Be sure that issues of biosafety are included in the discussion.
Teacher Tip:
Biolistics may be more suitable for plants due to
their thick cell walls.
Teacher Tip:
This may also be given as an assignment.
47. General Biology 2
Lesson 7: Discuss the Applications of
Recombinant DNA
Content Standard
The learners demonstrate an understanding of recombinant DNA and
examples of products from Recombinant DNA Technology.
Performance Standards
The learners shall be able to:
• describe some techniques for the expression of desired traits in target
organisms; and
• search online databases for specific traits and source organisms.
Learning Competency
The learners should be able to discuss the applications of Recombinant DNA
Technology (STEM_BIO11/12-III a-b-7)
Specific Learning Outcomes:
At the end of the lesson, the learners will be able to:
• give examples of products from recombinant DNA technology;
• illustrate the use of databases to search genes for desired traits;
• describe steps in PCR to amplify and detect a gene of interest;
• identify the parts of an expression vector;
• explain how genes may be cloned and expressed
60 MINS
LESSON OUTLINE
Introduction Communicating Learning Objectives 5
Motivation Thought Experiment 5
Instruction Presentation of Recombinant DNA 35
Practice Steps in PCR and Gene Cloning 5
Enrichment User of PCR and GMOs 5
Evaluation Sample Exercise 5
Materials
Writing materials, recyclable materials for models of plasmids,
tape, pens
Resources
(1) Genbank, www.ncbi.nlm.nih.gov
(2) Protein Data Bank, www.pdb.org
36
48. INTRODUCTION (5 MINS)
Communicating Learning Objectives
1. The learning objectives will be presented and the processes in the Central Dogma of Molecular
Biology will be reviewed:
DNA (gene) ! RNA (transcript) ! Protein (trait)
2. Different organisms have different traits based on their genes (DNA sequences).
For example, frogs have antimicrobial peptides on their skin. Some jellyfish have proteins that
allow them to glow in the dark. Mutations in hemoglobin genes lead to anemia.
3. Based on the central dogma, if transcription and translation of genes lead to some traits, then
the insertion of certain genes in a given organism may provide it with new traits. This is the basis
for the development of genetically modified organisms (GMOs).
MOTIVATION (5 MINS)
Thought Experiment
1. The learner may be given a group activity/ thought experiment for constructing a genetically
modified organism/trait in a fruit. “Designer Genes group work”
I. Arrange the learners into groups of 3 or 4.
II. Have them identify a special trait (e.g. large fruit size)
III. Have them identify a source organism (e.g. jackfruit / langka)
IV. Have them identify a target organism (e.g. aratilis)
V. Have them identify the modified / added trait (e.g. langka-sized aratilis).
VI. Have the learners present their work to the rest of the class, and let the class decide on the
best proposal.
Teacher Tip:
Be sure to stress that for a gene to add a trait to
an organism, the gene for the trait must be
inserted within the target organism, and the
organism should have the necessary
“equipment” (i.e. enzymes, materials ) to
produce the protein that results in the trait or
desired phenotype.
Teacher Tip:
Discuss the merits of the different proposed
“designer genes” based on the following
criteria:
1. Originality of the study (i.e. Has anyone
done studies of this type before?)
2. Feasibility of the study (How possible is the
proposed modification? Can the target
organism support the proposed trait? )
3. Potential Applications of the new organism
(What benefits would the recombinant
organism provide to society?)
Some examples: Flood-resistant rice Delayed-
ripening fruits
49. INSTRUCTION (35 MINS)
Presentation of Recombinant DNA
1. After the exercise, the learners should now be aware that there are many different traits that can
be introduced to organisms to change their properties. The following table shows examples of
modified traits using cloned genes and their applications:
Teacher Tip:
Ask the learners on the significance of finding
many versus few entries on a given topic in the
database.
MODIFIED TRAIT
GENE
MODIFICATION
RECIPIENT
ORGANISM
APPLICATION
(FIELD)
Insulin Production Insertion of Human
Insulin Gene
Bacteria (Medicine)
Production of Human
Insulin in Bacteria
Pest Resistance Insertion of Bt-toxin
gene
Corn / Maize (Agriculture)
Production of corn
plants with increased
resistance to corn
boxer
Delayed Ripening Disruption of a gene
for a ripening enzyme
(e.g.
polygalacturonase)
Tomato plant Agriculture)
Production of plants
with fruits that have
delayed ripening
fruits. These fruits will
survive longer
transport time,
allowing their delivery
to further locations
(i.e. export deliveries)
FEW entries
in the
database
MANY
entries in the
database
PROS
Topic has not
been
extensively
studied
High chance
to discover
novel traits /
applications
Topic is much
studied
Much
information is
available on
the topic
CONS Low number
of research to
verify the
observations
Difficult to
discover new
information
on the topic
38
50. Web based research:
Search for these different traits and how they may be made useful. This involves the collection of gene sequences in accessible locations, such
as databases (e.g. Genbank (www.ncbi.nlm.nih.gov) ; Protein Data Bank (www.pdb.org)). These databases serve like libraries that may be
consulted when trying to find specific traits that belong to different organisms.
For example, one would want to find out if any work has been done on spider silks. The databases (e.g. Genbank:Nucleotide database) may be
searched for entries that contain information on “Spiders, and Silk” (Result: 93615 entries). The results may be screened for more specific
studies (e.g. Malaysia, Spiders, and Silk- Result two entries).
Chymosin Production Insertion of a gene for
chymosin
Bacteria (Industry)
Enhance large scale
production of
chymosin. This enzyme
serves as a substitute
for rennet in the
coagulation of milk.
Rennet has to be
harvested from calves.
The large scale
production of this
enzyme in bacteria
provides an abundant
supply of this
important component
for the cheese
production industry.
51. PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or expression in a
given organism.
1. Detection
Some researchers may be interested in determining if a given gene/trait is available in a particular
organism. If no previous research provides this information, researchers may test the DNA of
different organisms for the presence of these specific genes. A technique that allows the detection
of specific genes in target organisms is called PCR.
PCR amplification is an in-vitro method that simulates DNA replication in vivo. It utilizes a
thermostable (heat-resistant) DNA polymerase that builds single stranded DNA strands unto
unwound DNA templates. PCR uses repeated cycles of incubation at different temperatures to
promote the unwinding of the DNA template (~95°C); the annealing of a primer (a ~20bp
oligonucleotide sequence (recall RNA primers in DNA replication) onto the ssDNA template strand
(~54 - 60°C); and the extension of the generated ssDNA strand through the binding of
complementary bases to the template strand (~72° C). The thermostability of the polymerase allows
it to survive the repeated cycles of denaturation, annealing and extension with little loss of enzyme
function. Each cycle of PCR doubles the amount of the target sequence. A typical PCR experiment
uses about 35 cycles of amplification. This increases the original amount of the target sequence by
235 (i.e. ~34 billion) times.
Gene detection by PCR involves the design of primers that would only bind to sequences that are
specific to a target. For example, researchers would want to find out if gene X (e.g. the gene for
insulin) is available in a target organism (e.g. a mouse, Mus musculus). Primers may be designed by
looking at the available sequences for gene X in the databases (e.g. all the genes for insulin in
different organisms; humans, pigs, cows, etc.). The different gene X sequences must be aligned/
compared to match areas of sequence similarity (conserved sequences) and areas of sequence
dissimilarity (non-conserved sequences). Primers designed to have the same sequence as the
conserved areas will be specific for binding gene X sequences in all the target organisms. Primers
designed to have the same sequence as the non-conserved areas will only be specific for the
organisms which match its sequence.
Teacher Tip:
Mention that unlike DNA replication in
vivo, PCR reactions do not use too many
helper enzymes such as helicases and
gyrases to help denature and stabilize the
template DNA strands.
The cyclic heating of the samples is meant
to provide the physical separation of the
template DNA strands through heat
denaturation of the inter-strand H-bonds.
40
52. Primers may be classified as forward or reverse primers. Forward primers are complementary and
bind to the reverse complementary (non-coding) sequence of the gene. Reverse primers are
complementary and bind to the coding sequence of the gene.
STEPS in PCR Amplification
Step 0: Undenatured Template ; Temp ~ 54 °"C;
Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-bonds
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)
Step 1: Template denaturation ; Temp ~ 95 °"C;
Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)
Step 2: Primer Annealing ; Temp ~ 54 °"C (dependent on primer melting temperature);
Template: ssDNA strands. H-bonds are formed between complementary sequences on the primers
and the target sequences.
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
Direction of elongation CCATAGATC (Reverse Primer)
5’ GCGATGAGG 3’ Direction of elongation (Forward Primer)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)
Teacher Tip:
Let the learners recall the antiparallel orientation
of the bound primers to the template DNA. If the
template is represented from left to right in the
5’ ! 3’ orientation; then the primers should bind
near the 3’ end and the primers would be
represented 3’ ! 5’ going left to right.
53. Step 3: New DNA strand elongation ; Temp ~ 72 °"C;
The two new dsDNA strands are formed by the elongation of the generated ssDNA and the H-bonds
between the complementary sequences on these new strands and their templates. Each of the new
dsDNA strands is made up of one old strand from the original template, and one new strand that was
generated as a reverse complement of the template. This is called semiconservative replication of the
sequence.
New Strand 1:
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’ CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5’ (Reverse Primer) (new)
New Strand 2:
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3’ (Forward Primer) (new)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand) (old)
Step 4: Repeat step 1 to 3 for N number of cycles (N is usually 35)
PCR Results
The expected product of PCR amplification will depend on the sequences / position at which the
primer sequences bind. If the forward primer starts binding at nucleotide 3 (coming from the 5’ end) of
a 43bp long gene, and the reverse primer binds at a position complementary to nucleotide 39 of the
coding strand, then a 37bp product is expected per cycle of PCR.
New Strand 1:
Nucleotide # 3 Nucleotide # 39
37 bp product
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’- CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC – 5’ (Reverse Primer) (new)
Teacher Tip:
Illustrate how by the 2nd
round of PCR the two
newly synthesized DNA strands can now be used
as templates. For the given example, new strand
synthesis will again generate a 37 base pair long
product. Repeated cycles of PCR will make this
product the predominant type of double stranded
DNA in the solution.
Note: Other types of organisms (e.g. Yeast,
Mammalian Cells, etc.) may also be “transformed”
to exhibit new traits. The type of DNA constructs
used for insertion of genes into these organisms
will vary (e.g. Bacmids, Cosmids, etc.)
42
54. New Strand 2:
Nucleotide # 3 Nucleotide # 39
37 bp product
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG -3’ (Forward Primer) (new)
3’ T A C GCTACTCCTATACTGGGCTATCTATCTCCATAGATC TCTA 5’ (Non-coding strand) (old)
PCR Applications
PCR may be used to detect the presence of a desired gene in an organism. Depending on the primer
design, the expected product may represent only a specific region of the gene or the entire gene itself.
The first case is useful for detection of the gene, or the detection of organisms with that specific gene
within a sample. The second case is useful for the amplification of the entire gene for eventual
expression in other organisms. The direct amplification/copying of a full gene is part of the process for
“cloning” that gene.
2. Cloning and Expression
Some genes provide economically, and industrially important products (e.g. insulin-coding genes;
genes for collagen degradation). In some cases, scientists would want to put these genes into
organisms for the expression of their products. One example would be the insertion of an insulin-
coding gene from the human genome into bacteria. This allows the “transformed” bacteria to now
produce human insulin as a product.
Certain types of bacteria are capable of this process since they are able to take genes within their cell
membranes for eventual expression. The genes are normally in the form of small, circular DNA
structures called plasmids.
The genes found in the inserted plasmid DNA sequence will be expressed as proteins that provide
specific traits to the transformed bacteria. The basic components of an expression plasmid are listed in
the following table. The purpose of each of these is also provided.
Teacher Tip:
The multiple cloning site (MCS) may contain
sequences that may be cut by different restriction
enzymes. Stress how the use of two restriction
enzymes may control the orientation of the
inserted gene in the plasmid.
Note: Forward and Reverse primers should not be
complementary.
55. COMPONENT PURPOSE
Promoter Allows the controlled expression of the desired gene in the presence
of an inducing agent (e.g. beta- galactosidase; heat treatment (~65°"C)
Multiple Cloning Site DNA sequence or portion for the insertion of the desired gene. This
section may contain sequences that will be cut by specific restriction
endonucleases ( cuts within the molecule) If both the amplified gene
and the plasmid are cut with the same restriction enzyme, then
complementary sequences will be generated for each, allowing them
to bind together or anneal. The desired gene is inserted into the
multiple cloning site through this process.
Restriction enzymes cut at specific sequences.
EcoR1 Target Sequence:
5’ GAATTC 3’
3’ CTTAAG 5’
Digestion Reaction
Undigested: Digested dsDNA:
5’ GAATTC 3’ 5’ G AATTC3’
3’ CTTAAG 5’ 3’ CTTAA G5’
If the desired cut sites are not found in the gene that needs to be
inserted; the sequences can be added by including the target
sequences in the primers used for PCR amplification.
44
56. COMPONENT PURPOSE
Multiple Cloning Site PCR Primers:
5’ GCGATGAGG 3’ (Forward Primer)
3’ CCATAGATC 5’ (Reverse Primer)
Forward Primer + EcoRI target sequence:
5’ GAATTCGCGATGAGG 3’
Reverse Primer + EcoRI target sequence:
3’ CCATAGATCCTTAAG 5’
Inserted Gene Sequence Successful insertion of a gene allows the expression of its protein
product. This usually provides a specific trait to the “transformed”
bacteria. For example, if the gene for Green Fluorescent Protein is
placed within the expression plasmid, bacteria transformed with this
plasmid will produce protein (GFP) that will allow the bacterial cells /
colonies to glow green in the dark.
Antibiotic Resistance
Gene
Provides a way to screen a population of bacteria for those that took
up the plasmid. For example, if an ampicillin resistance gene is
encoded in the plasmid, then only bacteria which took up the plasmid
will be able to grow on media with ampicillin.
However, if the ampicillin resistance gene is cut and the gene is
inserted here for cloning, then the cell will no longer be resistant to
ampicillin. This is a way to select which among the colony of cells
actually contain the inserted gene sequence. Bacterial cells whose
ampicillin resistance gene have been cut will die in the presence (agar
plate) of ampicillin.
57. PRACTICE (5 MINS)
Steps in PCR and Gene Cloning
1. Let learners give other hypothetically modified or genetically engineered plants and animals which
can be used for health, industry, agriculture and for the protection of the environment.
2. Ask learner to draw the parts of an expression vector.
3. Using pieces of paper, allow the learners to illustrate the steps in restriction digestion and PCR
ENRICHMENT (5 MINS)
Uses of PCR and GMOs
1. Discuss how PCR may be used for the detection of disease causing pathogens in a population. For
example, it may be used to check if a patient has a dengue virus infection. This is done by using
primers that are specific for complementary DNA (cDNA) sequences that correspond to the
dengue viruses. If PCR amplification occurs using cDNA from a patient’s blood sample then the
patient likely has dengue viruses in his/her blood.
2. Discuss how the cloning and expression of certain genes allows for massive production of the
desired product. For example, the cloning and expression of insulin in bacteria allows for the mass
production of this necessary protein for use by diabetic patients. Prior to insulin production in
bacteria, insulin was harvested from other animals such as pigs.
Teacher Tip:
At this point, learners’ imagination could be
stretched, but caution the learners that certain
ethical principles should be followed and adhered
to in the production of genetically modified
organisms. Animal welfare should be taken cared
of and human cloning must never be conducted.
Teacher Tip:
Try using other classic restriction enzymes:
Ex. Xho1; HindIII
46
58. EVALUATION (5 MINS)
Sample Exercise
1. Give learners a set of known Restriction Enzyme (RE) cut sites:
EcoRI BamH1
5’ GAATTC 3’ 5’ GGATTC 3’
3’ CTTAGG 5’ 3’ CTTAGG 5’
DNA Sequence (69 bp long) 28 49
5’ ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATCCTATGCCCGAATGTC 3’
3’ TACGTACCATGCATCTCAAGGTACTTAAGCGGGGATATCCCATCGGCTCCTAGGATACGGGCTTACAG 5’
Expected Fragment sizes:
With EcoR1 digestion : 28 bp, 41 bp
With BamH1 digestion : 20 bp, 49 bp
With both EcoR1 and BamH1: 20bp, 28bp, and 21 bp
