This document describes the development of a novel biodegradable porous scaffold for skin regeneration using tissue engineering techniques. The scaffold was made of collagen, hyaluronic acid, and gelatin cross-linked with EDC. It had a porous structure with an average pore size of 132.5 μm. In vitro tests showed the scaffold supported growth of keratinocytes, melanocytes, and fibroblasts. In a rat model, wounds treated with the scaffold healed faster and showed less inflammation compared to untreated wounds. Histological analysis confirmed the scaffold facilitated skin repair.
This study developed a novel biodegradable porous scaffold for skin regeneration composed of collagen, hyaluronic acid, and gelatin. The scaffold was tested in vitro by culturing human keratinocytes, melanocytes, and fibroblasts, which all proliferated normally. In vivo tests on rats found the scaffold treated wounds healed faster than untreated wounds, with over 50% closure within 7 days versus only 60% for untreated wounds. Histological analysis further supported the scaffold's ability to facilitate more rapid wound healing and regeneration of skin tissue.
This document compares two in vitro release testing methods - enhancer immersion cells and Float-A-Lyzer dialysis cells - for evaluating the release of progesterone from gel formulations. The Float-A-Lyzer cells provided consistent release profiles, better reproducibility, and sufficient ability to distinguish between three product strengths compared to the traditional enhancer immersion cells. Additionally, the Float-A-Lyzer cells had simpler sample preparation procedures and achieved a faster diffusion rate due to their larger surface area.
The results of the study show a promising role of Acacia Honey, a natural product with proven therapeutic effects on skin wound healing. It accelerated the initial stage of corneal wound healing without the side effects found when using conventional treatments which contain preservatives. Corneal keratocytes cultured in media supplemented with 0.025% Acacia Honey showed an increase in proliferative capacity while retaining their morphology, gene and protein expressions with normal cell cycle.
The DUBLiN method is a multiprocedural approach to facial rejuvenation that incorporates dermaroller, ultrapulse laser, blood factors, light therapy, and neurotoxin. It uses these different technologies sequentially over multiple phases to activate fibroblasts, direct them towards collagen production, reduce skin laxity and cause tightening. A comparative study found patients who received the DUBLiN method saw better results over 3 months compared to those who received standard fractional CO2 laser alone.
The document summarizes various methods used to measure apoptosis and cell viability, including membrane integrity assays, functional assays, DNA labeling assays, and morphological assays. Membrane integrity assays like trypan blue exclusion, annexin V binding, and LDH leakage determine cell viability based on plasma membrane integrity. Functional assays like MTT, XTT, and Alamar Blue measure cell metabolism. DNA labeling assays use fluorescent conjugates to label cells, while morphological assays examine changes in cell morphology during apoptosis. The document provides details on the principles, materials, and procedures for several common assays used to measure apoptosis and cell viability.
This document describes the development of a novel biodegradable porous scaffold for skin regeneration using tissue engineering techniques. The scaffold was made of collagen, hyaluronic acid, and gelatin cross-linked with EDC. It had a porous structure with an average pore size of 132.5 μm. In vitro tests showed the scaffold supported growth of keratinocytes, melanocytes, and fibroblasts. In a rat model, wounds treated with the scaffold healed faster and showed less inflammation compared to untreated wounds. Histological analysis confirmed the scaffold facilitated skin repair.
This study developed a novel biodegradable porous scaffold for skin regeneration composed of collagen, hyaluronic acid, and gelatin. The scaffold was tested in vitro by culturing human keratinocytes, melanocytes, and fibroblasts, which all proliferated normally. In vivo tests on rats found the scaffold treated wounds healed faster than untreated wounds, with over 50% closure within 7 days versus only 60% for untreated wounds. Histological analysis further supported the scaffold's ability to facilitate more rapid wound healing and regeneration of skin tissue.
This document compares two in vitro release testing methods - enhancer immersion cells and Float-A-Lyzer dialysis cells - for evaluating the release of progesterone from gel formulations. The Float-A-Lyzer cells provided consistent release profiles, better reproducibility, and sufficient ability to distinguish between three product strengths compared to the traditional enhancer immersion cells. Additionally, the Float-A-Lyzer cells had simpler sample preparation procedures and achieved a faster diffusion rate due to their larger surface area.
The results of the study show a promising role of Acacia Honey, a natural product with proven therapeutic effects on skin wound healing. It accelerated the initial stage of corneal wound healing without the side effects found when using conventional treatments which contain preservatives. Corneal keratocytes cultured in media supplemented with 0.025% Acacia Honey showed an increase in proliferative capacity while retaining their morphology, gene and protein expressions with normal cell cycle.
The DUBLiN method is a multiprocedural approach to facial rejuvenation that incorporates dermaroller, ultrapulse laser, blood factors, light therapy, and neurotoxin. It uses these different technologies sequentially over multiple phases to activate fibroblasts, direct them towards collagen production, reduce skin laxity and cause tightening. A comparative study found patients who received the DUBLiN method saw better results over 3 months compared to those who received standard fractional CO2 laser alone.
The document summarizes various methods used to measure apoptosis and cell viability, including membrane integrity assays, functional assays, DNA labeling assays, and morphological assays. Membrane integrity assays like trypan blue exclusion, annexin V binding, and LDH leakage determine cell viability based on plasma membrane integrity. Functional assays like MTT, XTT, and Alamar Blue measure cell metabolism. DNA labeling assays use fluorescent conjugates to label cells, while morphological assays examine changes in cell morphology during apoptosis. The document provides details on the principles, materials, and procedures for several common assays used to measure apoptosis and cell viability.
Targeted Drug Delivery System Resealed Erythrocytes discusses using red blood cells (erythrocytes) as carriers for drug and enzyme delivery. Erythrocytes can be isolated from blood and loaded with drugs or enzymes using various methods like hypotonic lysis and resealing. Loaded erythrocytes can then be used to treat conditions by targeting delivery and increasing drug circulation time. New systems like nanoerythrosomes use extruded erythrocyte ghosts to produce smaller drug carrying vesicles.
Histochemistry is a science that combines techniques of biochemistry and histology to study the chemical composition of tissues. Enzyme histochemistry techniques are applied to tissue sections that have undergone controlled chemical fixation or cryofixation to preserve enzyme activity. Common applications include skeletal muscle biopsy to identify fiber types using enzymes like ATPase, and colonic biopsy to diagnose Hirschsprung's disease by detecting acetylcholinesterase in ganglion cells. Immunohistochemistry identifies cellular antigens using antigen-antibody binding and involves tissue collection, fixation, antigen retrieval, primary/secondary antibody incubation, detection such as HRP-DAB, and counterstaining.
Resealed erythrocytes as a novel delivery carrierMariamZewail
Resealed erythrocytes are effective and safe drug carriers for targeted and sustained drug delivery. Drugs can be easily entrapped into erythrocytes by several techniques. Resealed erythrocytes can be used a carrier for drugs, enzyme replacement therapy etc. However, the concept needs further optimization to be converted into a regular drug delivery system.
This document discusses various biomaterial fabrication techniques. It begins with an introduction to biomaterials and their uses. It then describes common materials used as biomaterials and the evolution of biomaterials. Several scaffold fabrication techniques are outlined, including solvent casting, melt molding, gas foaming, freeze drying, and fiber bonding. Limitations of these techniques are noted. Rapid prototyping and nanofabrication techniques that allow for more control and precision are also summarized.
Extraction buffer, Protease inhibitors methods of cell distrubtionAnantha Kumar
This document discusses methods for extracting and preparing proteins for proteomics analysis. It describes how to prepare stable buffer solutions to maintain pH during extraction. Protease inhibitors are also important to prevent proteolysis during extraction and purification. Various mechanical and enzymatic cell lysis techniques are covered, such as sonication, French press, and enzymatic lysis of yeast. Considerations for extracting from prokaryotes, eukaryotes, and animal tissues are provided. Centrifugation can be used to separate subcellular fractions after homogenization.
This document describes a study that synthesized Fe3AlO6 nanoparticles using a soft chemical approach and characterized their structure and properties. It then assessed the cytotoxicity of the nanoparticles in human neural stem cells (hNSCs) through several assays. Specifically, Fe3AlO6 nanoparticles were synthesized via hydrolysis of a single-source molecular precursor under controlled conditions. X-ray diffraction and transmission electron microscopy confirmed the formation of monophasic nanocrystalline particles around 16.5 nm in size. Cytotoxicity assays including MTT, LDH and FDA were performed on hNSCs treated with varying concentrations of the nanoparticles. Scanning electron microscopy was also used to examine changes in cell morphology and nanoparticle distribution within
Resealed erythrocytes in drug deliveryBiplajit Das
This document discusses resealed erythrocytes as a drug delivery system. It begins with an introduction to erythrocytes and how they can be used for drug delivery due to their ability to circulate throughout the body. It then describes how erythrocytes are isolated from blood and various methods for loading drugs into the erythrocytes, such as hypo-osmotic lysis and endocytosis. The document outlines advantages like biocompatibility and targeting specific tissues, as well as disadvantages like limited targeting of non-phagocyte tissues. It concludes that resealed erythrocytes show promise for drug delivery but require further optimization.
This study examined the effects of nitrogen mustard, a vesicant chemical warfare agent, on basal keratinocytes using an in vitro scratch wound assay. The study first optimized parameters for the scratch wound assay using basal keratinocyte cells, determining that a seeding concentration of 3.75x105 cells/mL produced consistent results. Exposure to increasing doses of nitrogen mustard from 0.1 to 10 μM was found to increase the migration rate of basal keratinocytes in non-coated wells, though coating wells with laminin 332 decreased the migration rate at all doses. Further experiments are planned to test higher doses of nitrogen mustard and different extracellular matrix coatings to better model in vivo conditions.
This document introduces expanded bed adsorption (EBA) and provides background information on the principles and operation of EBA. EBA allows target proteins to be purified directly from crude feedstocks containing cells or cell debris without a separate clarification step. It works by expanding the adsorbent bed to allow particulate matter to pass through while proteins bind to the adsorbent. The document discusses the design of stable, expanded beds and adsorbents tailored for EBA, as well as examples of its applications in protein purification.
This document discusses various artifacts that can occur during biopsy and tissue processing. It defines an artifact as a defect or distortion resulting from how the tissue was handled from biopsy to fixation. Artifacts can occur during tissue manipulation, transport, fixation, processing, embedding and sectioning. Specific artifacts discussed include squeeze artifacts from improper forceps use, heat artifacts from electrosurgery, autolysis artifacts from delayed fixation, curling artifacts from thin specimens, and orientation artifacts from unlabeled specimens. Proper techniques such as gentle tissue handling, rapid fixation in adequate formalin volume, and specimen orientation labeling can prevent many artifacts.
Resealed erythrocytes are a novel drug delivery system that involves loading drugs into erythrocytes and resealing them. They offer advantages like biocompatibility, zero-order kinetics, and the ability to circulate throughout the body and target the reticuloendothelial system. There are various methods to isolate erythrocytes from blood and load drugs into them, such as dilution, dialysis, osmotic lysis, and electrical breakdown. Loaded erythrocytes are then evaluated based on drug content, shape, recovery rate, and stability. Resealed erythrocytes show potential as a drug delivery vehicle with the benefits of drug targeting and reduced side effects.
Objective: To evaluate the results of the effect of nebivolol on tibial bone defect and graft application in new bone development in the rat.
Study Design: Thirty Wistar albino rats were divided into 3 groups. In the Control group, tibia bone defect was created without any treatment. In the Defect+ Graft group, allograft treatment was performed by forming a 6 mm tibial bone defect. In the Defect+Graft+ Nebivolol group, alloplastic bone graft was placed in the calvarial bone defect and then nebivolol (0.34 mg/mL solution/day) treatment was intraperitoneally applied for 28 days.
Results: Histopathological examination revealed inflammation in the defect area, congestion in the vessels, degeneration in collagen fibers, and an increase in osteoclast cells. There was an increase in inflammation and blood vessel structure in graft application, and osteoblastic activity matrix formation after reorganization nebivolol application in collagen fibers. Osteonectin expression was positive in the collagen fiber and matrix, starting in the Graft group, in osteoblasts, whereas in the Nebivolol group, osteoblasts increased in osteocytes and new bone formation.
Conclusion: Nebivolol is thought to have a positive effect on osteoinductive bone growth factors and contribute to the cell-matrix interaction, in addition to the supporting effect of the graft with its antioxidative effect.
Keywords: allograft; bone; bone regeneration; disease models, animal; nebivolol; orthopedic procedures; osteonectin; rats; tibia; tibial defect
This document describes a method for fabricating porous poly(DL-lactic-co-glycolic acid) (PLGA) microspheres that fuse together at body temperature to form solid porous scaffolds, creating an injectable scaffold system. The microspheres were treated with ethanolic sodium hydroxide to increase surface porosity without disintegrating. When mixed with media and incubated at 37°C, the microspheres fused to form scaffolds with compressive strength of 0.9 MPa, porosity of 81.6%, and pore diameter of 54 μm, supporting NIH-3T3 cell attachment and proliferation in vitro. This study demonstrates a technique for producing an injectable and porous PLGA scaffold that solid
this presentation contain detail information of resealed erythrocytes from what are the resealed erythrocytes to where they are usesd? basic information like what are RBC and their role, history of resealed erythrocytes, sources and isolation method of erythrocytes,effect of tonicity on RBC's, method of drug loading in erythrocytes, characterization of them, applications
Histopathology techniques are used to demonstrate minute structural alterations in tissues caused by disease. Key techniques include fixing tissues in formalin to preserve structure, processing tissues through dehydration, clearing and infiltration steps, embedding in paraffin wax, sectioning with a microtome, staining, and mounting slides. Histopathology allows diagnosis of diseases through microscopic examination of tissue structures and any pathological changes present. It is a crucial technique when other testing may not be possible or provides definitive confirmation of diseases.
Evaluation n application of resealed erythrocytesbiniyapatel
This document summarizes various methods for analyzing drug-loaded erythrocytes, including measuring drug content through spectroscopy, in vitro drug and hemoglobin release through incubation and filtration, osmotic fragility by exposing cells to solutions of varying tonicities, and osmotic and turbulence shock to evaluate cell integrity and stability. It also discusses evaluating cell morphology by microscopy, common storage methods, and various mechanisms for drug release from erythrocytes. Potential applications include enzyme replacement therapy, treatment of liver tumors and parasitic diseases, and removal of toxic agents. Surface modification methods like antibodies and cross-linking can target erythrocytes to specific organs.
Using Polycaprolactone for Tissue RegenerationSatish Bhat
This study investigated whether polycaprolactone could be used in tissue engineering as a scaffolding material. The hypothesis was that polycaprolactone would have similar properties to polylactic acid, which is currently used successfully in tissue engineering. Nuclear magnetic resonance testing showed that polycaprolactone had resonance peaks in the same locations as polylactic acid. Thermal analysis also demonstrated that polycaprolactone has properties very similar to polylactic acid. The results suggest that polycaprolactone is a viable potential material for use in tissue scaffolding.
* Treponema pallidum causes syphilis.
* A highly aneuploid tumor indicates genomic instability which is associated with increased aggressiveness and poor prognosis.
* Amyloid protein showing apple green birefringence under polarized light microscopy has clinical significance as it indicates amyloidosis.
* The signs ±, ± ± indicate the type of birefringence shown by substances under polarized light microscopy. ± indicates negative birefringence shown by uric acid while ± ± indicates positive birefringence shown by calcium pyrophosphate.
* Osmium tetroxide reacts with phospholipids in cell membranes, making them electron dense and visible under electron microscopy. This helps in better structural visualization of cells
This document provides information about platelet-rich plasma (PRP) and its use in orthopedic applications. It discusses:
1) The basic science behind PRP, including the clotting cascade and platelet function. Platelets release growth factors that promote healing when they aggregate at the site of injury.
2) How PRP is created by concentrating the platelet fraction that is separated after centrifugation of blood. There is no consensus on the optimal platelet concentration.
3) The two main types of PRP systems - buffy coat systems and plasma based systems. Buffy coat systems require more steps but produce a higher platelet concentration, while plasma based systems are simpler.
4) Potential risks of PR
This document discusses the use of platelet rich plasma (PRP) for hair regrowth. PRP contains growth factors that stimulate hair follicle growth and cycling. When injected into the scalp along with an extracellular matrix material, PRP has been shown to promote hair growth in cases of androgenetic alopecia and alopecia areata. The presentation reviews literature supporting PRP treatment, describes how to prepare and apply PRP injections, and discusses tools to measure hair growth outcomes.
Targeted Drug Delivery System Resealed Erythrocytes discusses using red blood cells (erythrocytes) as carriers for drug and enzyme delivery. Erythrocytes can be isolated from blood and loaded with drugs or enzymes using various methods like hypotonic lysis and resealing. Loaded erythrocytes can then be used to treat conditions by targeting delivery and increasing drug circulation time. New systems like nanoerythrosomes use extruded erythrocyte ghosts to produce smaller drug carrying vesicles.
Histochemistry is a science that combines techniques of biochemistry and histology to study the chemical composition of tissues. Enzyme histochemistry techniques are applied to tissue sections that have undergone controlled chemical fixation or cryofixation to preserve enzyme activity. Common applications include skeletal muscle biopsy to identify fiber types using enzymes like ATPase, and colonic biopsy to diagnose Hirschsprung's disease by detecting acetylcholinesterase in ganglion cells. Immunohistochemistry identifies cellular antigens using antigen-antibody binding and involves tissue collection, fixation, antigen retrieval, primary/secondary antibody incubation, detection such as HRP-DAB, and counterstaining.
Resealed erythrocytes as a novel delivery carrierMariamZewail
Resealed erythrocytes are effective and safe drug carriers for targeted and sustained drug delivery. Drugs can be easily entrapped into erythrocytes by several techniques. Resealed erythrocytes can be used a carrier for drugs, enzyme replacement therapy etc. However, the concept needs further optimization to be converted into a regular drug delivery system.
This document discusses various biomaterial fabrication techniques. It begins with an introduction to biomaterials and their uses. It then describes common materials used as biomaterials and the evolution of biomaterials. Several scaffold fabrication techniques are outlined, including solvent casting, melt molding, gas foaming, freeze drying, and fiber bonding. Limitations of these techniques are noted. Rapid prototyping and nanofabrication techniques that allow for more control and precision are also summarized.
Extraction buffer, Protease inhibitors methods of cell distrubtionAnantha Kumar
This document discusses methods for extracting and preparing proteins for proteomics analysis. It describes how to prepare stable buffer solutions to maintain pH during extraction. Protease inhibitors are also important to prevent proteolysis during extraction and purification. Various mechanical and enzymatic cell lysis techniques are covered, such as sonication, French press, and enzymatic lysis of yeast. Considerations for extracting from prokaryotes, eukaryotes, and animal tissues are provided. Centrifugation can be used to separate subcellular fractions after homogenization.
This document describes a study that synthesized Fe3AlO6 nanoparticles using a soft chemical approach and characterized their structure and properties. It then assessed the cytotoxicity of the nanoparticles in human neural stem cells (hNSCs) through several assays. Specifically, Fe3AlO6 nanoparticles were synthesized via hydrolysis of a single-source molecular precursor under controlled conditions. X-ray diffraction and transmission electron microscopy confirmed the formation of monophasic nanocrystalline particles around 16.5 nm in size. Cytotoxicity assays including MTT, LDH and FDA were performed on hNSCs treated with varying concentrations of the nanoparticles. Scanning electron microscopy was also used to examine changes in cell morphology and nanoparticle distribution within
Resealed erythrocytes in drug deliveryBiplajit Das
This document discusses resealed erythrocytes as a drug delivery system. It begins with an introduction to erythrocytes and how they can be used for drug delivery due to their ability to circulate throughout the body. It then describes how erythrocytes are isolated from blood and various methods for loading drugs into the erythrocytes, such as hypo-osmotic lysis and endocytosis. The document outlines advantages like biocompatibility and targeting specific tissues, as well as disadvantages like limited targeting of non-phagocyte tissues. It concludes that resealed erythrocytes show promise for drug delivery but require further optimization.
This study examined the effects of nitrogen mustard, a vesicant chemical warfare agent, on basal keratinocytes using an in vitro scratch wound assay. The study first optimized parameters for the scratch wound assay using basal keratinocyte cells, determining that a seeding concentration of 3.75x105 cells/mL produced consistent results. Exposure to increasing doses of nitrogen mustard from 0.1 to 10 μM was found to increase the migration rate of basal keratinocytes in non-coated wells, though coating wells with laminin 332 decreased the migration rate at all doses. Further experiments are planned to test higher doses of nitrogen mustard and different extracellular matrix coatings to better model in vivo conditions.
This document introduces expanded bed adsorption (EBA) and provides background information on the principles and operation of EBA. EBA allows target proteins to be purified directly from crude feedstocks containing cells or cell debris without a separate clarification step. It works by expanding the adsorbent bed to allow particulate matter to pass through while proteins bind to the adsorbent. The document discusses the design of stable, expanded beds and adsorbents tailored for EBA, as well as examples of its applications in protein purification.
This document discusses various artifacts that can occur during biopsy and tissue processing. It defines an artifact as a defect or distortion resulting from how the tissue was handled from biopsy to fixation. Artifacts can occur during tissue manipulation, transport, fixation, processing, embedding and sectioning. Specific artifacts discussed include squeeze artifacts from improper forceps use, heat artifacts from electrosurgery, autolysis artifacts from delayed fixation, curling artifacts from thin specimens, and orientation artifacts from unlabeled specimens. Proper techniques such as gentle tissue handling, rapid fixation in adequate formalin volume, and specimen orientation labeling can prevent many artifacts.
Resealed erythrocytes are a novel drug delivery system that involves loading drugs into erythrocytes and resealing them. They offer advantages like biocompatibility, zero-order kinetics, and the ability to circulate throughout the body and target the reticuloendothelial system. There are various methods to isolate erythrocytes from blood and load drugs into them, such as dilution, dialysis, osmotic lysis, and electrical breakdown. Loaded erythrocytes are then evaluated based on drug content, shape, recovery rate, and stability. Resealed erythrocytes show potential as a drug delivery vehicle with the benefits of drug targeting and reduced side effects.
Objective: To evaluate the results of the effect of nebivolol on tibial bone defect and graft application in new bone development in the rat.
Study Design: Thirty Wistar albino rats were divided into 3 groups. In the Control group, tibia bone defect was created without any treatment. In the Defect+ Graft group, allograft treatment was performed by forming a 6 mm tibial bone defect. In the Defect+Graft+ Nebivolol group, alloplastic bone graft was placed in the calvarial bone defect and then nebivolol (0.34 mg/mL solution/day) treatment was intraperitoneally applied for 28 days.
Results: Histopathological examination revealed inflammation in the defect area, congestion in the vessels, degeneration in collagen fibers, and an increase in osteoclast cells. There was an increase in inflammation and blood vessel structure in graft application, and osteoblastic activity matrix formation after reorganization nebivolol application in collagen fibers. Osteonectin expression was positive in the collagen fiber and matrix, starting in the Graft group, in osteoblasts, whereas in the Nebivolol group, osteoblasts increased in osteocytes and new bone formation.
Conclusion: Nebivolol is thought to have a positive effect on osteoinductive bone growth factors and contribute to the cell-matrix interaction, in addition to the supporting effect of the graft with its antioxidative effect.
Keywords: allograft; bone; bone regeneration; disease models, animal; nebivolol; orthopedic procedures; osteonectin; rats; tibia; tibial defect
This document describes a method for fabricating porous poly(DL-lactic-co-glycolic acid) (PLGA) microspheres that fuse together at body temperature to form solid porous scaffolds, creating an injectable scaffold system. The microspheres were treated with ethanolic sodium hydroxide to increase surface porosity without disintegrating. When mixed with media and incubated at 37°C, the microspheres fused to form scaffolds with compressive strength of 0.9 MPa, porosity of 81.6%, and pore diameter of 54 μm, supporting NIH-3T3 cell attachment and proliferation in vitro. This study demonstrates a technique for producing an injectable and porous PLGA scaffold that solid
this presentation contain detail information of resealed erythrocytes from what are the resealed erythrocytes to where they are usesd? basic information like what are RBC and their role, history of resealed erythrocytes, sources and isolation method of erythrocytes,effect of tonicity on RBC's, method of drug loading in erythrocytes, characterization of them, applications
Histopathology techniques are used to demonstrate minute structural alterations in tissues caused by disease. Key techniques include fixing tissues in formalin to preserve structure, processing tissues through dehydration, clearing and infiltration steps, embedding in paraffin wax, sectioning with a microtome, staining, and mounting slides. Histopathology allows diagnosis of diseases through microscopic examination of tissue structures and any pathological changes present. It is a crucial technique when other testing may not be possible or provides definitive confirmation of diseases.
Evaluation n application of resealed erythrocytesbiniyapatel
This document summarizes various methods for analyzing drug-loaded erythrocytes, including measuring drug content through spectroscopy, in vitro drug and hemoglobin release through incubation and filtration, osmotic fragility by exposing cells to solutions of varying tonicities, and osmotic and turbulence shock to evaluate cell integrity and stability. It also discusses evaluating cell morphology by microscopy, common storage methods, and various mechanisms for drug release from erythrocytes. Potential applications include enzyme replacement therapy, treatment of liver tumors and parasitic diseases, and removal of toxic agents. Surface modification methods like antibodies and cross-linking can target erythrocytes to specific organs.
Using Polycaprolactone for Tissue RegenerationSatish Bhat
This study investigated whether polycaprolactone could be used in tissue engineering as a scaffolding material. The hypothesis was that polycaprolactone would have similar properties to polylactic acid, which is currently used successfully in tissue engineering. Nuclear magnetic resonance testing showed that polycaprolactone had resonance peaks in the same locations as polylactic acid. Thermal analysis also demonstrated that polycaprolactone has properties very similar to polylactic acid. The results suggest that polycaprolactone is a viable potential material for use in tissue scaffolding.
* Treponema pallidum causes syphilis.
* A highly aneuploid tumor indicates genomic instability which is associated with increased aggressiveness and poor prognosis.
* Amyloid protein showing apple green birefringence under polarized light microscopy has clinical significance as it indicates amyloidosis.
* The signs ±, ± ± indicate the type of birefringence shown by substances under polarized light microscopy. ± indicates negative birefringence shown by uric acid while ± ± indicates positive birefringence shown by calcium pyrophosphate.
* Osmium tetroxide reacts with phospholipids in cell membranes, making them electron dense and visible under electron microscopy. This helps in better structural visualization of cells
This document provides information about platelet-rich plasma (PRP) and its use in orthopedic applications. It discusses:
1) The basic science behind PRP, including the clotting cascade and platelet function. Platelets release growth factors that promote healing when they aggregate at the site of injury.
2) How PRP is created by concentrating the platelet fraction that is separated after centrifugation of blood. There is no consensus on the optimal platelet concentration.
3) The two main types of PRP systems - buffy coat systems and plasma based systems. Buffy coat systems require more steps but produce a higher platelet concentration, while plasma based systems are simpler.
4) Potential risks of PR
This document discusses the use of platelet rich plasma (PRP) for hair regrowth. PRP contains growth factors that stimulate hair follicle growth and cycling. When injected into the scalp along with an extracellular matrix material, PRP has been shown to promote hair growth in cases of androgenetic alopecia and alopecia areata. The presentation reviews literature supporting PRP treatment, describes how to prepare and apply PRP injections, and discusses tools to measure hair growth outcomes.
El documento describe los factores de crecimiento plaquetarios y su papel en la regulación del crecimiento celular. Los factores de crecimiento son señales proteicas que regulan funciones como el crecimiento, proliferación y supervivencia celular. Se liberan de las plaquetas y activan vías de señalización intracelular que conducen a la expresión génica involucrada en la regeneración tisular. La terapia con plasma rico en plaquetas utiliza estos factores de crecimiento para promover la cicatrización de tejidos.
Platelet rich plasma (PRP) is an effective concentration of growth factors derived from platelets that are released upon activation. PRP is prepared through a double spin process to separate and concentrate platelets. It has various indications like hair loss and wound healing. For hair loss, a dermaroller causes microinjury followed by PRP application to stimulate hair follicle stem cells and prolong the growth phase through growth factors. Research shows PRP increases proliferation of stem cells in vitro and has an angiogenic effect, making it useful for hair growth. While side effects are minimal as PRP is autologous, more research is needed due variability in PRP content and response between patients.
This document discusses the use of platelet rich plasma (PRP) for the treatment of tendon injuries in horses. PRP involves concentrating the platelets found in a horse's own blood, which contain growth factors, and injecting them into an injured tendon to aid the healing process. The document reviews what PRP is, how it is prepared, common indications for its use, and the procedure for administering PRP to a tendon lesion in a horse.
Bone regeneration in extraction sockets with autologous plateletNasim Siddiqui
This document summarizes a study on the use of autologous platelet rich fibrin gel to promote bone regeneration in tooth extraction sockets. The study involved placing PRF gel in extraction sockets of 22 patients after removing their third molars, with the contralateral extraction site serving as a control without the gel. Radiographic analysis at 1, 3, and 6 months found greater bone fill in sites with PRF gel, though the differences were not statistically significant. The conclusions are that PRF gel improves bone regeneration after extraction and accelerates soft tissue healing, suggesting it is a valid method for hard and soft tissue regeneration after tooth removal. Larger studies are still needed to better evaluate the benefits of PRF gel.
Platelet-rich plasma (PRP) is a concentration of platelets from a patient's own blood. When activated, platelets release growth factors that can help with tissue regeneration and healing. This document discusses how PRP works, the rationale for its use, preparation methods, applications for aesthetic procedures like skin rejuvenation and hair restoration, and combination therapies with other treatments. PRP harnesses the body's natural healing responses to enhance results from procedures by stimulating fibroblasts, promoting collagen production, and accelerating wound healing through growth factors. Selection of the PRP system and proper techniques are important to maximize benefits and minimize risks.
Platelet-rich plasma (PRP) is a concentration of autologous platelets that contain growth factors that stimulate healing. PRP is prepared by centrifuging a patient's own blood to obtain a plasma with a higher platelet concentration than normal blood. When activated, platelets in PRP secrete growth factors that promote tissue regeneration through angiogenesis, collagen synthesis, and cell proliferation/migration. The document discusses how PRP can be used in aesthetic procedures by injection to enhance effects of treatments like microneedling, fractional laser, and fat grafting through growth factor stimulation of the healing process. Combination therapies using PRP with other modalities like radiofrequency or ultrasound are also proposed to further augment skin rejuvenation and
Platelet rich fibrin (PRF) is an autologous platelet concentrate that can be used to deliver growth factors to bone defects for regeneration. It has advantages over platelet rich plasma as it requires no biochemical handling or additives like bovine thrombin. PRF is prepared by centrifuging blood samples without anticoagulant. This results in a fibrin clot containing platelets and growth factors between the acellular plasma and red blood cell layers. PRF can be used with bone grafts or as a membrane to promote wound healing, bone growth, and graft stabilization. The case report describes using PRF mixed with a bone graft to regenerate an intra-bony defect in a patient, which resulted in reduction of pocket
The study examined the effects of blue LED light irradiation at 470nm on keloid and adjacent skin fibroblasts in vitro. Fibroblasts were obtained from keloid and skin samples from patients and cultured. Cells were irradiated with doses of 6J, 12J, or 18J of blue light and cell counts were performed 24 hours later. There was no significant difference in keloid fibroblast counts between the different doses. Adjacent skin fibroblast counts were significantly lower after an 18J dose compared to a 6J dose, indicating the higher dose inhibited skin fibroblast proliferation in vitro.
This study investigated how tumor secreted factors alter the responses of human endothelial cells (HUVECs) to matrix stiffness during capillary formation. The researchers used synthetic hydrogels of varying stiffness to culture HUVECs with or without tumor cells. They found that while HUVECs prefer a substrate of intermediate stiffness for optimal capillary formation in the absence of tumor factors, stimulation by tumor secreted factors disrupts the HUVECs' mechanosensitive behavior. Additionally, the anti-angiogenic drug vandetanib was less effective at reducing capillary formation when HUVECs were activated by tumor factors, particularly on stiffer gels. This suggests tumor activation alters the mechanosensitivity and drug responsiveness
Growth factors for periodontal an d periimplant regeneration - Copy.pdfahmedbadr179
1. Growth factors are proteins that stimulate cellular growth, proliferation, and differentiation. They play an important role in wound healing.
2. Platelet concentrates like PRP, PRF, and CGF are autologous products prepared from centrifuged blood that contain increased levels of growth factors.
3. PRF is prepared by low-speed centrifugation without anticoagulants and provides a fibrin matrix that slowly releases growth factors over 1-2 weeks to aid healing. CGF involves higher centrifugation speeds and forms a denser fibrin network rich in growth factors.
Piroxicam Nanostructured Lipid Carrier Drug Delivery SystemYogeshIJTSRD
This document describes a study that developed and evaluated a piroxicam (PXM) nanostructured lipid carrier (NLC) gel for topical delivery. PXM-loaded NLCs were prepared using the high-pressure homogenization method and characterized for particle size, drug entrapment efficiency, and in vitro drug release. The optimized NLC formulation was incorporated into a gel and evaluated for properties such as viscosity, drug content, and in vitro diffusion. Ex vivo skin irritation studies showed the gel caused no irritation. In vivo tests in rats demonstrated the NLC gel effectively reduced carrageenan-induced paw edema, indicating anti-inflammatory effects. Overall, the NLC gel was found to be a promising delivery
3D BIOPRINTING USING ORGAN DERIVED SCAFFOLDS AND HUMAN PLURIPOTENT STEM CELLNivaasvignopathy
This document discusses 3D bioprinting of human organs using organ-derived extracellular matrix scaffolds and human pluripotent stem cells. The authors hypothesize that decellularized liver tissue can act as a suitable scaffold for stem cells to reorganize and potentially give rise to a fully functional liver organ when combined with 3D bioprinting techniques. The objectives are to decellularize liver tissue, recellularize it with stem cells, and 3D bioprint a liver graft. The methodology involves decellularizing a liver organ using perfusion, recellularizing the decellularized extracellular matrix with stem cells, and 3D bioprinting the stem cell-seeded scaffold
This study investigated the effects of lyophilized platelet-rich plasma (PRGF) on osteoblast-like MG-63 cells. The results showed that PRGF significantly increased cell proliferation, as measured by total protein content, and alkaline phosphatase (ALP) activity, a marker of osteoblast function. Specifically, cells treated with PRGF for 6 days in low-serum or serum-free medium had higher ALP activity and protein levels compared to controls. This suggests PRGF supports osteoblast proliferation and differentiation.
comparison between sticky bone and concentrated growth factorRutu Dabhi
This randomized clinical trial compared the efficacy of sticky bone (an autologous fibrin glue-enriched bone graft matrix) and concentrated growth factor (CGF) in treating intrabony defects. 40 intrabony defects in 20 patients were randomly assigned to receive either sticky bone or CGF. Clinical parameters and cone-beam computed tomography scans found that sticky bone resulted in significantly greater clinical attachment level gain, probing pocket depth reduction, and defect depth reduction compared to CGF alone at 12 months. The study concluded that sticky bone is more effective than CGF for treating intrabony osseous defects.
Cancer-related cachexia causes devastating changes to facial structure such as muscle wasting and fat loss. While pharmaceuticals and nutrition have addressed total body mass loss, little research was done on restoring facial aesthetics. The author describes using a combination approach called the DUBLiN Lift to treat a cachexic cancer patient, combining hyaluronic acid fillers, platelet-rich plasma growth factors, dermal needling, fractional CO2 resurfacing, and red light therapy to address volume loss, poor skin texture, and sagging caused by long-term cachexia. This multiprocedure approach aimed to stimulate collagen production through multiple established techniques and appeared to successfully restore the patient's facial volume and quality of life.
1) A digital microfluidic (DμF) platform was developed to automate the liquid handling steps for differentiating embryonic stem cells into cardiomyocytes and assaying the resulting tissue.
2) The DμF platform improved upon existing manual methods by automating embryoid body growth, differentiation medium exchanges, and non-invasive assays of beating cardiomyocyte tissue using electric fields.
3) Beating cardiomyocyte embryoid bodies were cultured on the DμF platform for up to 8 weeks and responses to known chronotropic agents were measured non-invasively through impedance changes, demonstrating the potential of the system for screening cardiotoxicity.
Dr Patrick Treacy explains how the use of a combination of
restorative dermal techniques allowed him to address the
poor skin texture and facial sagging in a patient with cancer
related cachexia
Fractional carbon dioxide (CO2) laser resurfacing (FxCR) is an effective treatment for wrinkles but can cause prolonged erythema and scarring. This study applied platelet-rich plasma (PRP) to sites treated with FxCR to evaluate its effects on wound healing. PRP was prepared from subjects' blood and applied to randomly selected FxCR sites. Sites treated with PRP showed significantly faster recovery of the skin barrier and lower erythema levels compared to control sites, indicating PRP enhanced wound healing and reduced side effects after FxCR. Biopsies further showed thicker collagen bundles in PRP-treated skin.
Platelet-rich plasma (PRP) is an autologous concentration of platelets that contains high levels of growth factors. It is used in regenerative medicine to promote healing. PRP is prepared by drawing a patient's blood, centrifuging it to separate platelets from other blood components, and collecting the platelet-rich plasma. The growth factors in PRP stimulate healing in conditions like tendonitis and joint injuries. In gynecology, PRP is being used for procedures like vaginal rejuvenation and reconstructive surgery after cancer to reduce complications and speed healing. The PRP injection process takes less than 5 minutes after blood is drawn and centrifuged to obtain the plasma.
Uses of prp in different gynecological disordersAyman Shehata
The document discusses the history and uses of platelet rich plasma (PRP) in gynecology. PRP involves concentrating platelets from a patient's own blood, which contain growth factors that can promote healing. Studies have found PRP reduces postoperative pain and accelerates wound healing after gynecological surgeries. It has also shown benefits for treating vulvar lesions and dystrophies when other treatments are ineffective. The document reviews the preparation of PRP and its proposed mechanisms of action through growth factor release and fibrin scaffolding to support regeneration.
This is my short presentation in one of my university classes. It's obvious that the future of the stem cell biology is tightly engaged with organoids and they will absolutely change the way science is going to.
Kind regards
Shahin Ahmadian
"A Nano-In-Micro System for Enhanced Stem Cell Therapy of Ischemic Diseases" is a research article published in ACS central science http://pubs.acs.org/journal/acscii
Schuco is a company located in the UK that can be reached by phone or email for sales. They will have representatives and service experts at the British Association of Dermatologists conference on stand 62 providing free health checks using DermLite equipment.
Punch biopsy and curettage are two common dermatological procedures. A punch biopsy uses a hollow circular instrument to remove a full-thickness sample of skin for examination. Curettage scrapes or scoops superficial lesions for removal. Stiefel offers single-use biopsy punches and curettes to ensure sharpness and sterility. Their instruments are designed for precision and comfort during minor skin surgeries.
The document summarizes key details about the Nescens anti-aging skincare line produced by Laboratories Genolier in Switzerland. It provides information on the brand's unique selling points, product range and sizes, ingredient focuses, and clinical testing results showing effectiveness in firming skin. The line takes a comprehensive approach to anti-aging through products targeting different stages and concerns like cleansing, protection, renewal, and pigmentation.
The document describes several dermatoscope products from DermLite. It summarizes the key features of the DermLite Basic, Carbon, PRO II HR, Hybrid, DL3, and Lumio dermatoscopes. The DermLite Basic provides 10x magnification and cross-polarization viewing at an affordable price. The Carbon allows toggling between superficial and deep structure visualization. The PRO II HR is the brightest with optional camera connection. The Hybrid enables both polarized and non-polarized/fluid viewing. The DL3 integrates an improved lens with various lighting modes. And the Lumio is suited for general skin examinations with its large lens and bright LEDs.
This document provides summaries of various aesthetic products and treatments, including:
1. Platelet rich plasma treatment from Regen Labs that uses a patient's own blood to stimulate skin cells.
2. The NESCENS anti-aging skincare system formulated by a Swiss physician to address biological factors of skin aging.
3. The Excimer 308 device, a handheld 308nm UVB light for treating conditions like psoriasis and vitiligo.
4. Medical Z compression garments and scar treatment gels used post-operatively and for scar management.
RegenPRP is an aesthetic treatment that uses a patient's own platelet-rich plasma (PRP), obtained from their blood, to stimulate skin cell regeneration and revitalization. PRP contains growth factors that promote tissue healing and the formation of new collagen and blood cells. Preparing PRP involves a safe, quick process to concentrate a patient's own platelets and plasma, eliminating risks of immunological or disease transmission. RegenPRP kits are designed for various skin issues like aging, pigmentation, and alopecia, providing natural treatment options.
The systematic review and meta-analysis examined 24 studies on the use of platelet rich plasma (PRP) gel for wound healing. The meta-analysis found that PRP therapy significantly improved complete healing of chronic wounds compared to standard care. It also found that PRP treated acute wounds were less likely to develop infections compared to controls. Overall, the review concluded that PRP therapy improved both complete and partial wound healing outcomes.
Handyscope by FotoFinder is a mobile connected dermatoscope that converts an iPhone into a handheld device using a unique accessory, allowing up to 20X magnification for exploring moles and adding information that can be shared with colleagues worldwide.
The document provides information on using the Hyfrecator 2000 for electrosurgery. It compares the Hyfrecator to other electrosurgery methods like electrocautery and cryotherapy. It discusses the principles of electrosurgery using the Hyfrecator, describing tissue destruction methods like fulguration, desiccation, and coagulation. It provides guidance on choosing electrodes, adjusting power settings, and using different Hyfrecator configurations for various procedures.
The Coa-Comp M is an automatic bipolar electrocoagulator recommended for use in various surgical specialties. It is lightweight, portable, and has rapid setup. The generator continuously monitors tissue impedance and stops producing energy once coagulation is achieved, preventing over-coagulation. It has an LED display and audio tones to confirm activation and provide operating information. Built-in self-tests allow users to easily check that it is functioning properly.
The Beauty Treat uses radio waves to gently heat and stimulate fibroblasts in the dermis. This causes a shortening of structures that have become too long and encourages reproduction of collagen, tightening the skin from within without stressing the epidermis. Known as ReFacing, this safe, gentle, non-surgical method achieves a younger appearance by stimulating collagen reconstruction in the dermis.
Cryosurgery uses extreme cold, such as liquid nitrogen, to destroy abnormal or diseased cells. Liquid nitrogen or nitrous oxide are applied with a probe or spray to freeze tissues down to -25°C to -50°C, killing cells through ice crystal formation and blood vessel damage. Cryosurgery can treat various skin lesions and early-stage skin cancers. It has advantages over other treatments as it is minimally invasive, causes little pain or scarring, and is a quick and inexpensive procedure.
The Schuco Cryospray is a liquid nitrogen spray device designed for ease of use, safety, and cost effectiveness in minor surgery. It features an ergonomic design for comfort, a 350ml vacuum container to hold a day's supply of liquid nitrogen, and a set of brass spray tips for accurate aiming. The brass collar and stabilizing base contribute to safety and durability. It comes in a custom fitted canvas case for convenient storage and transport.
The Schuco 120 is an electrosurgical unit that provides cut, coagulation, and combined cut and coagulation modes for minimally invasive surgery. It can also be used for bipolar procedures with an adapter. The cut mode performs pure dissection like a scalpel without pressure or snagging. The blend mode combines cutting and coagulation in one for a haemostatic field. The coagulation modes include forced for superficial coagulation and soft for deeper coagulation without carbonization.
The Cryosuccess is a simple and effective handheld cryotherapy device for accurate treatment of skin lesions making it ideal for general practice, dermatology, podiatry and minor surgery applications.
The document discusses technology for early skin cancer detection using digital dermoscopy. It outlines the advantages of digital dermoscopy such as better diagnostic accuracy and less documentation time. It then describes the 3 easy steps to using digital dermoscopy which involves overview pictures of the skin, microscopic pictures of suspicious moles linked to the overview, and follow-up pictures for comparison. Additional tools discussed include mole mapping, body mapping, mole analyzer, hair analysis, and fluorescence diagnosis to aid in early skin cancer detection.
The document describes several dermatoscope models from Dermlite, including the Dermlite Basic, Dermlite Carbon, Dermlite II PRO HR, Dermlite Hybrid, and Dermlite DL3. Each model provides different features such as number of LEDs, magnification, ability to view superficial structures vs deeper pigmentation, and inclusion of polarized vs non-polarized lighting capabilities. The Dermlite DL3 is highlighted as the most advanced model, featuring a high-quality lens, increased lighting power from LEDs, and the ability to switch between polarized and non-polarized modes.
These instructions summarize the reprocessing steps for reusable medical devices supplied by PADGETT INSTRUMENTS, including cleaning, inspection, lubrication, packaging, sterilization and storage. Key steps include cleaning devices using an automated washer or manually to remove all soil, inspecting devices to ensure all surfaces are clean, applying lubricant to joints, packaging according to standards, sterilizing using steam sterilization, and storing in dry conditions until next use. It is the responsibility of the reprocessor to properly reprocess devices to achieve decontamination.
Biography and career history of Bruno AmezcuaBruno Amezcua
Bruno Amezcua's entry into the film and visual arts world seemed predestined. His grandfather, a distinguished film editor from the 1950s through the 1970s, profoundly influenced him. This familial mentorship early on exposed him to the nuances of film production and a broad array of fine arts, igniting a lifelong passion for narrative creation. Over 15 years, Bruno has engaged in diverse projects showcasing his dedication to the arts.
The Fascinating World of Bats: Unveiling the Secrets of the Nightthomasard1122
The Fascinating World of Bats: Unveiling the Secrets of the Night
Bats, the mysterious creatures of the night, have long been a source of fascination and fear for humans. With their eerie squeaks and fluttering wings, they have captured our imagination and sparked our curiosity. Yet, beyond the myths and legends, bats are fascinating creatures that play a vital role in our ecosystem.
There are over 1,300 species of bats, ranging from the tiny Kitti's hog-nosed bat to the majestic flying foxes. These winged mammals are found in almost every corner of the globe, from the scorching deserts to the lush rainforests. Their diversity is a testament to their adaptability and resilience.
Bats are insectivores, feeding on a vast array of insects, from mosquitoes to beetles. A single bat can consume up to 1,200 insects in an hour, making them a crucial part of our pest control system. By preying on insects that damage crops, bats save the agricultural industry billions of dollars each year.
But bats are not just useful; they are also fascinating creatures. Their ability to fly in complete darkness, using echolocation to navigate and hunt, is a remarkable feat of evolution. They are also social animals, living in colonies and communicating with each other through a complex system of calls and body language.
Despite their importance, bats face numerous threats, from habitat destruction to climate change. Many species are endangered, and conservation efforts are necessary to protect these magnificent creatures.
In conclusion, bats are more than just creatures of the night; they are a vital part of our ecosystem, playing a crucial role in maintaining the balance of nature. By learning more about these fascinating animals, we can appreciate their importance and work to protect them for generations to come. So, let us embrace the beauty and mystery of bats, and celebrate their unique place in our world.
Amid the constant barrage of distractions and dwindling motivation, self-discipline emerges as the unwavering beacon that guides individuals toward triumph. This vital quality serves as the key to unlocking one’s true potential, whether the aspiration is to attain personal goals, ascend the career ladder, or refine everyday habits.
Understanding Self-Discipline
MISS TEEN LUCKNOW 2024 - WINNER ASIYA 2024DK PAGEANT
In the dynamic city of Lucknow, known for its wealthy social legacy and authentic importance, a youthful star has developed, capturing the hearts of numerous with her elegance, insights, and eagerness. Asiya, as of late delegated as the champ from Lucknow for Miss Youngster India 2024 by the DK Pageant, stands as a confirmation of the monstrous ability and potential dwelling inside the youth of India. This exceptional young lady is a signal of excellence and a paragon of devotion and aspiration.
Insanony: Watch Instagram Stories Secretly - A Complete GuideTrending Blogers
Welcome to the world of social media, where Instagram reigns supreme! Today, we're going to explore a fascinating tool called Insanony that lets you watch Instagram Stories secretly. If you've ever wanted to view someone's story without them knowing, this blog is for you. We'll delve into everything you need to know about Insanony with Trending Blogers!
MRS PUNE 2024 - WINNER AMRUTHAA UTTAM JAGDHANEDK PAGEANT
Amruthaa Uttam Jagdhane, a stunning woman from Pune, has won the esteemed title of Mrs. India 2024, which is given out by the Dk Exhibition. Her journey to this prestigious accomplishment is a confirmation of her faithful assurance, extraordinary gifts, and profound commitment to enabling women.
At Affordable Garage Door Repair, we specialize in both residential and commercial garage door services, ensuring your property is secure and your doors are running smoothly.
Types of Garage Doors Explained: Energy Efficiency, Style, and More
PRP Animal study
1. + MODEL
Journal of Plastic, Reconstructive & Aesthetic Surgery (2010) xx, 1e9
Effect of platelet-rich plasma on ultraviolet
b-induced skin wrinkles in nude mice
Jeong Mok Cho, Yoon Ho Lee, Rong-Min Baek, Sang Woo Lee*
Department of Plastic and Reconstructive Surgery, Seoul National University College of Medicine, Seoul, South Korea
Received 27 February 2010; accepted 12 August 2010
KEYWORDS Summary Background: Platelet-rich plasma (PRP) is researched and used in many clinical
Platelet-Rich Plasma; fields as it contains an abundance of various growth factors. Recently, a topical injection of
Photoageing; PRP has been clinically tried for treatment of photoageing-related skin wrinkles. Nevertheless,
Skin Wrinkles; there have been only a few studies including objective data or explaining the mechanisms of
Skin Rejuvenation PRP. Therefore, the authors performed animal experiments to collect laboratory data and to
infer the basal mechanism of the effect of PRP on skin rejuvenation.
Methods: Mice photoaged by ultraviolet B (UVB) irradiation for 8 weeks were divided into three
groups (no-treatment group, saline injected group and PRP-injected group) with 10 mice in
each group. After 4 weeks, the degree of wrinkle formation was compared among three groups
by replica analysis, and skin biopsies were performed. An additional in vitro assay with growth-
factor-neutralising antibodies was performed to evaluate whether growth factors contained in
PRP could accelerate fibroblast proliferation and collagen production, which may play a major
role in skin rejuvenation.
Results: The wrinkles in the PRP-injected group were significantly reduced than in the other
groups. Biopsy results indicated that the dermal layer was remarkably thicker in the PRP-injec-
tion group. In in vitro assay, fibroblast proliferation and collagen production were increased in
the experimental group through growth factors in the PRP.
Conclusion: Although more in vivo studies and research about the mechanism of PRP are
required, the results of this study indicate that PRP is effective in the rejuvenation of photo-
aged skin.
ª 2010 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by
Elsevier Ltd. All rights reserved.
* Corresponding author. Department of Plastic and Reconstructive Surgery, Seoul National University College of Medicine, Seoul National
University Bundang Hospital, 166 Gumiro, Bundang, Seongnam, Gyeonggi 463-707, South Korea.
E-mail address: sangwoolee7@naver.com (S.W. Lee).
1748-6815/$ - see front matter ª 2010 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.bjps.2010.08.014
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive & Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014
2. + MODEL
2 J.M. Cho et al.
Skin ageing consists of intrinsic and extrinsic ageing. National University’s Institutional Animal Care and Use
Extrinsic ageing progresses due to environmental factors, Committee (IACUC), and the Guideline for the Care and Use
which could be attributable to ultraviolet rays in most of Laboratory Animals was observed.
cases, and hence, extrinsic ageing is also called ‘photo-
ageing’.1e3 Extrinsic ageing is characterised by small and Preparation of PRP
fine wrinkles, roughness, dryness, laxity and pigmentation.
The characteristics of extrinsic ageing are the result of Under the approval of Institutional Review Board (IRB) of
epidermal thinning, atypia of keratinocytes and collagen the Seoul National University Bundang Hospital, a 32-ml
degradation in the dermal layer due to the increased sample of venous blood was collected from a 28-year-old
synthesis of collagenase. Collagen production is decreased healthy male under informed consent. PRP was manufac-
with the reduction of skin elasticity, and wrinkles are tured by using the commercialised materials of Regen PRP
formed by the collapse of fibroblasts.4 (Regen Laboratory, Mollens, Switzerland) and formulated
Recently, platelet-rich plasma (PRP) is being widely by following the instructions of the manufacturer. After
researched in many clinical fields. In the field of plastic distributing 8 ml of peripheral venous blood into four sets of
surgery, it is used to stimulate bone adhesion and wound Anticoagulant Citrate Dextrose Solution A (ACD-A) tubes
healing, and to minimise bleeding during surgery by (8 ml per tube, each containing 0.9 ml of ACD-A solution;
enhancing coagulation.5e12 Such functions can be attrib- final blood:ACD ratio 10:1), blood plasma samples were
utable to the presence of rich growth factors in PRP, collected by conducting 10 min of centrifugation by using
especially epidermal growth factor (EGF), platelet-derived a Regen bench centrifugation system. To analyse platelet
growth factor (PDGF), transforming growth factor beta count, the Sysmex XE-200 system (TOA Medical Electronics
(TGFb) and vascular endothelial growth factor (VEGF). It Co., Kobe, Japan) was used.
has been reported that the concentrations of these growth
factors are several times higher than in normal plasma.13,14 Fibroblast isolation
There have been many studies regarding the role of
growth factors in the skin, and several growth factors have
Skin biopsy was done at the dorsum of the nude mouse
been reported to have positive effects on skin rejuvenation
(1 cm  1 cm). Biopsy samples were washed 7e8 times with
through stimulative effects on the proliferation of collagen
5% antibiotics/antimycotics-added phosphate-buffered
and fibroblasts, and on the growth of keratinocytes.15e17
saline (PBS). After slicing the samples into small pieces,
However, the production, transportation and storage of
they were immersed in 0.92 unit dispase solution and
growth factors require high costs, and unintended compli-
incubated overnight at 4 C. After separating the tissue into
cations can develop during the processes. Therefore, if
epidermal and dermal parts, the separated dermal layer
growth factors can be derived from the patients themselves,
was sliced into pieces as small as possible, and treated with
superfluous costs could be saved and concerns of complica-
0.35% collagenase type I solution and incubated for 2 h in an
tions could be set aside to a great extent. Recently, various
incubator to carry out the reaction. The reaction solution
clinical trials for anti-wrinkle treatments have been con-
was retrieved for centrifugation at 12 000 rpm for 5 min.
ducted by using topical injections of PRP, based on this
After discarding the supernatants, the pellet was sus-
background knowledge. However, so far, studies conducted
pended in Dulbecco’s Modified Eagle Medium (DMEM) and
by analysing the effects of PRP on wrinkles with comparable
transferred to a culture dish. As the preparation reached
control groups or experimental data concerning the mecha-
about 80% conference in a 37 C CO2 incubator, subculture
nism of PRP function are very limited. It is questionable
was performed. The following experiments were conducted
whether the favourable clinical effects are the result of PRP
by using fibroblasts acquired from the third subculture.
or if they are transient effects caused by oedema.
Therefore, we devised this current study to confirm the
Fibroblast proliferation
effects of PRP on wrinkles formed by photoageing through
animal experiments. Moreover, in vitro studies were per-
formed to confirm whether PRP stimulates fibroblast To instigate the proliferation of fibroblasts, the water-
proliferation and collagen production, which are consid- soluble tetrazolium salt (WST) technique was used.
ered to have important roles in skin rejuvenation. By using Initially, fibroblasts were washed twice with PBS, and
various neutralising antibodies of growth factors, we tried treated with trypsin-ethylenediamine tetraacetic acid
to confirm whether or not growth factors in PRP could play (EDTA) to detach cells. The detached cells were collected
major roles in the stimulation of the skin rejuvenation by adding DMEM and centrifuged for the seeding of 3 Â 104
process to provide fundamental knowledge concerning the count of cells. After incubating the cells for 24 h by using
mechanism of the anti-wrinkling effects of PRP. DMEM media, the media was refreshed with serum-free
Materials and methods Table 1 Primer sequence
Sequence
Animals for experiments Collagen type 1 (F) CATCTCCCCTTCGTTTTTGA
(R) CTGTGGAGGAGGGTTTCAGA
A total of 30 female nude mice, aged 6 weeks, were b-actin (F) CCAAGGCCAACCGCGAGAAGATGAC
purchased from Sankyo Laboservice Corporation Inc. (SLC, (R) AGGGTACATGGTGGTGCCGCCAGAC
Tokyo, Japan). The experiment was approved by the Seoul
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014
3. + MODEL
Platelet-rich plasma on skin wrinkles 3
with PBS and fibroblasts were lysed by adding lysis buffer.
Table 2 Parameters used in assessment of wrinkles
After adding 70% EtOH into the soup, the preparation was
Parameters Description filled in a column and centrifuged at 10 000 rpm for 15 s and
Rt Skin roughness centrifuged again for 15 s at 10 000 rpm after adding buffer
Rm Maximum roughness RW (washing buffer from RNeasy kit, Qiagen, Hilden,
Rz Average roughness Germany). The samples were centrifuged for 15 s at 10
Rp Smoothness roughness 000 rpm after adding RPE buffer (washing buffer from RNeasy
Ra Arithmetic average roughness kit, Qiagen, Hilden, Germany), which was followed by
centrifugation for 2 min at 10 000 rpm after adding RPE
buffer. Subsequently, the preparations were centrifuged
media. The preparation was divided into a total of six again for 1 min at 10 000 rpm. After adding 30 ul of RNase-free
groups, including an untreated control group, a PRP-only water to the media, the isolated RNA fraction was collected
treated group and four other PRP-treated groups that were into an Eppendorf (EP)-tube to measure RNA concentration.
prepared by adding only a single neutralising antibody The measured total 1 ug RNA was collected and added to an
among the selections of anti-PDGF-BB neutralising anti- reverse transcriptase (RT) premix (Intron Biotechnology,
bodies (Sigma, St. Louis, MO, USA), anti-EGF neutralising Seoul, Korea), and 1e2 ul of template DNA and 10 pg primer
antibodies (Sigma, St. Louis, MO, USA), anti-VEGF neutral- (Table 1) were added, and distilled water (DW) was added to
ising antibodies (Sigma, St. Louis, MO, USA) and anti-TGFb make a final volume of 20 ul. After preparing 1.5% agarose gel,
neutralising antibodies (Sigma, St. Louis, MO, USA) electrophoresis was performed and photographed after
(n Z 10). On the 7th day, after adding PRP and selected staining with ethidium bromide (EtBr).
neutralising antibody into each media, the absorbance was
measured. Before the measurement, 200 ul of fresh media Animal experiment
was additionally added. After adding 10% of WST-8
(Dojindo, Kumamoto, Japan), the preparation was vortexed
All mice were housed at a temperature of 24 C and 50%
and placed in a 37 C CO2 incubator for 1e4 h. Afterwards,
humidity, and a 12/12 h light/dark cycle was maintained at
the absorbance was measured at 450 nm by using an
a specific pathogen-free (SPF) animal laboratory facility at
enzyme-linked immunosorbent assay (ELISA) reader.
the medical science department of the Seoul National
University. Mice were provided with sterilised water and
Collagen production fed without limitation, and monitored daily. The mice were
irradiated with ultraviolet B (UVB) on the back 5 times
After seeding a 3 Â 104 count of fibroblasts and incubating a week for 8 weeks using an UVB-emitting system of Biolink
with DMEM media for 24 h, the media was replaced with BLX-312 UV crosslinker (Vilbert Lourmat, Marne-LaVallee,
a new fresh serum-free media. For the total of six test France). By using Toshiba SE lamps, the emission peak was
groups, PRP and preselected neutralising antibody (n Z 10) achieved at a wavelength of 312 nm without filtering UVB,
were added to each media preparation. On the 7th day of and 55% of the total UVB volume was controlled to be
incubation, 1 ml of the collagen assay kit (Biocolor Ltd., generated between the wavelengths of 290 nm and 320 nm.
Belfast, UK) reagent was added with 100 ul of culture soap. During exposure, the mice were allowed to move freely
The preparation was well vortexed at the room tempera- within the cage. The irradiation intensity represented as
ture for 30 min and centrifuged at 10 000 rpm for 10 min. the minimal erythemal dose (MED) was set at 1 MED during
After centrifugation, the supernatant was discarded and the first 2 weeks (60 mJ cmÀ2), and was elevated to 2 MED
the remaining pellet was thoroughly dried without mois- (120 mJ cmÀ2) in the 3rd week, to 3 MED (180 mJ cmÀ2) in
ture. For each pellet, 1 ml of alkali reagent was added and the 4th week and to 4 MED (240 mJ cmÀ2) during the
well dissolved, and 200 ul of the preparation was trans- 5the8th weeks of the experiment. The total irradiated UVB
ferred into a 96-well plate to measure the absorbance at volume was approximately 115 MED (6.9 J cmÀ2).
540 nm by using an ELISA reader. After the generation of wrinkles, the mice were divided
into three groups with 10 mice in each group. As the
Real-time polymerase chain reaction (RT-PCR) negative control, no special treatment was carried out for
the first group. The second group was set as the positive
The fibroblasts were detached and subsequently seeded in control and 1 ml of subcutaneous injection of physiological
1 Â 106 culture media. After dividing the preparation into saline was given to their backs. The mice of the third group
six groups as done in the other experiments, PRP and pre- were used as the experimental group, and were treated
selected neutralising antibody were added to each group. with 1 ml of subcutaneous injection of manufactured PRP
RNA was extracted on the 7th day. They were washed twice on their backs.
Table 3 Fibroblast proliferation and collagen production (n Z 10)
Control PRP - PDGF-BB - EGF - VEGF - TGFb
Fibroblast proliferation 3.145 Æ 0.27 3.391 Æ 0.11 3.228 Æ 0.25 3.199 Æ 0.16 3.256 Æ 0.13 3.202 Æ 0.09
Collagen production 0.084 Æ 0.01 2.25 Æ 0.23 1.821 Æ 0.12 1.474 Æ 0.37 1.840 Æ 0.32 1.166 Æ 0.18
- PDGF-BB: cultured with PRP and neutralising anti-PDGF-BB antibody, - EGF: cultured with PRP and neutralising anti-EGF antibody, -
VEGF: cultured with PRP and neutralising anti-VEGF antibody, -TGF: cultured with PRP and neutralising anti-TGFb antibody.
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014
4. + MODEL
4 J.M. Cho et al.
Figure 1 The amount of fibroblast proliferation (left) and collagen production (right) in each group. * P 0.05 Compared with
control group, y P 0.05 Compared with PRP group, n Z 10. - PDGF-BB: cultured with PRP and neutralising anti-PDGF-BB antibody, -
EGF: cultured with PRP and neutralising anti-EGF antibody, - VEGF: cultured with PRP and neutralising anti-VEGF antibody, -TGF:
cultured with PRP and neutralising anti-TGFb antibody.
Skin replica and wrinkle analysis comparison tests were performed. When the p-value was
found to be less than 0.05, the result was considered
After 8 weeks of UVB irradiation and on the 4th week after statistically significant.
injection, the back skin of the mice was replicated by using
a silicone product of Flextime (Heraeus Kulzer, NY, USA). To Results
simplify measurement, all replicas were trimmed into
a circular form with a 1-cm diameter and images were
analysed using the SV600 Skin visiometer wrinkle analysis
Platelet-rich plasma
system (Courage Khasaka, Cologne, Germany). The
parameters used in the assessment of skin wrinkles are The platelet count of the manufactured PRP was
listed in Table 2. 1.341 Â 106 mlÀ1, which was 4.6 times higher than that of
normal whole blood (130e400 Â 106 mlÀ1).
Histology
Fibroblast proliferation and collagen production
At the 4th week after injection, the tissues were evalu-
ated. Each 1 cm  1 cm piece of back skin was fixed with Compared with the untreated control group, the PRP-
10% formalin neutral buffered solution. After treatment treated group showed an increase of fibroblast proliferation
with polyester wax, the skin samples were sliced into 6- and collagen production (p 0.05) (Table 3). In the fibro-
mm thicknesses. The sliced sections were treated with blast proliferation assay, the PRP- and neutralising anti-
haematoxylin and eosin (HE) and Masson’s trichrome body-treated group showed a decrease in fibroblast
staining solutions. Through tissue evaluations, the proliferation in the order of VEGF, PDGF-BB, TGFb and EGF
thickness of the dermal layer and presence of collagen antibody. Excluding the PDGF-BB-treated group, the other
fibres were observed. The thickness of the dermal layer antibody-treated groups showed statistically significant
was calculated by measuring at five different sites reduction compared with the PRP-treated group. In the
from each section, and the mean value of the thickness collagen production assay, the decrease of the production
of the dermal layer for each group was used for the was significant in the order of VEGF, PDGF-BB, EGF and
comparison. TGFb. The reductions observed from all groups were found
to be statistically significant compared with the PRP group
Statistical analysis (Figure 1).
The results were expressed as mean Æ SD. Statistical Real-time polymerase chain reaction (RT-PCR)
analysis was performed by using an Statistical Package for
Social Sciences (SPSS) program (SPSS, Inc., USA), and The intensity of the Collagen I RNA band was found to be
analysis of variance (ANOVA) and post hoc multiple reduced in the order of PRP group, VEGF-added group and
Figure 2 Effect of PRP with each neutralising antibody on the expression of collagen type I RNA.
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014
5. + MODEL
Platelet-rich plasma on skin wrinkles 5
Table 4 Wrinkle analysis (n Z 10)
T0 T4
NT NS PRP P NT NS PRP P
Rt 2.29 Æ 0.5 2.31 Æ 0.55 2.04 Æ 0.42 0.423 2.12 Æ 0.72 2.23 Æ 0.53 1.22 Æ 0.37 0.001
Rm 1.9 Æ 0.34 1.88 Æ 0.3 1.8 Æ 0.36 0.719 1.85 Æ 0.62 1.91 Æ 0.37 1.08 Æ 0.3 0.001
Rz 1.41 Æ 0.27 1.32 Æ 0.2 1.3 Æ 0.26 0.588 1.33 Æ 0.45 1.42 Æ 0.23 0.76 Æ 0.22 0.001
Rp 0.94 Æ 0.3 0.86 Æ 0.2 0.79 Æ 0.21 0.355 0.78 Æ 0.3 0.88 Æ 0.2 0.44 Æ 0.15 0.001
Ra 0.45 Æ 0.13 0.45 Æ 0.14 0.39 Æ 0.1 0.418 0.37 Æ 0.14 0.41 Æ 0.1 0.2 Æ 0.08 0.001
T0: initial value.
T4: value after 4 weeks.
The unit of R is arbitrary unit.
PDGF-BB-added group, EGF-added group and TGFb-added Wrinkle analysis
group and control group (Figure 2). This result was consis-
tent with the results observed from the collagen production The five sets of wrinkle parameters that were measured
assay. after 8 weeks of photoageing did not show a statistically
Figure 3 The changes of wrinkle parameter in each group. NO: no-treatment, NS: normal saline, PRP: platelet-rich plasma,
T0: initial value, T4: value after 4 weeks, * P 0.05 Compared with other group.
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014
6. + MODEL
6 J.M. Cho et al.
significant difference between groups (Table 4). The Discussion
wrinkle parameters that were measured after 4 weeks
of experiment revealed that all parameters of the The platelet count of the PRP produced in this current
PRP-injected group were significantly lower than the experiment was 4.6 times higher than the basal value. This
no-treatment and the saline-injected groups (p 0.05). No increase satisfies the condition that the platelet count of
statistically significant difference was observed between PRP be 3e7 times that of the basal value, which has been
the no-treatment group and the saline-injected group suggested by many researchers.6,18e20 Comparing the
(Figures 3 and 4). platelet concentration level of results reported in many
researches to the current experiment, it was possible to
Histological observation confirm indirectly that the current experiment produced
PRP-containing rich growth factor.21e23
The dermal thickness of the PRP-injected group was Lorraine H. Kligman, while studying photoageing in an
284 Æ 16.2, which was significantly increased compared animal model, exposed the mice to UVB rays and subse-
with the non-treated group (196 Æ 14.2) and the saline- quently performed histological studies. After UV exposure,
injected positive control group (212 Æ 17.4) (p 0.05) initial histological analysis revealed that an increase in
(Figures 5 and 6). Although the dermal thickness of the metabolism and in fibroblasts led to an increase in collagen
physiological saline-injected group was thicker than the synthesis; however, over the course of time, severe damage
non-treated negative control group, it was not statistically in mature collagen was observed under electronmicroscopy
significant. and through Gieson’s staining. The results were similar to
Figure 4 Wrinkles in (above, left) initial non-treatment group, (above, centre) initial normal saline injected group, and (above,
right) initial PRP injected group. Wrinkles changes in (below, left) no-treatment group after 4 weeks, (below, centre) normal saline
injected group after 4 weeks, and (below, right) PRP injected group after 4 weeks.
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014
7. + MODEL
Platelet-rich plasma on skin wrinkles 7
Figure 5 HE staining shows that dermal thickness in the PRP injected group (above, left) was thicker than those in the non-
treatment group (above, centre) and the saline injection group (above, right). In the Masson’s trichrome staining, collagen fibres
were stained blue, and collagen contents were increased in the PRP injected group (below, left) compared to those in the
no-treatment group (below, centre) and the saline injected group (below, right). Scale bars are 200 mm.
histological changes in human skin after exposure to natural only treated group. In this study, we can assume that PRP
sunlight.24 could rejuvenate skin through the action of growth factors.
Much time is required to induce photoageing through The significance of wrinkle parameters used in the result
natural exposure to UV light. The amount of UVB exposure analysis can be summarised below. Rt is the distance from
in experimental studies does not usually equate to average the highest wrinkle height to the lowest wrinkle height
sun exposure. Therefore, Cho et al. used a fixed protocol to among wrinkle valleys, which indicates skin roughness. Rm
induce photoageing while studying the anti-wrinkling is the highest Rt value that was observed from five equally
effects of vitamin C, vitamin E, pycnogenol and evening dissected portions of a wrinkle valley, which indicates
primrose oil on UVB-induced skin wrinkles. The authors maximum roughness. Rz is the mean Rt value that was
applied this protocol in the preparation of this study.25 calculated from Rt values observed from five equally
Rejuvenation of skin injury caused by UV light is dissected portions of a wrinkle bent, which indicates
a complex process that organically involves several cyto- average roughness. The reading error caused by replica
kines and growth factors such as in a wound-healing shape is small in the case of Rz than Rt. Rp is the distance of
process. The involved cytokines and growth factors tend to wrinkle height from the parallel line made at the highest
function by interacting with other several factors and wrinkle height to the middle line located below, which
control proteins rather than function independently. Five indicates smoothness or roughness. Ra is the distance of
major growth factors such as TGF, insulin-like growth factor a wrinkle after drawing two parallel lines at the top and
(IGF), PDGF, EGF and VEGF have been known to be related bottom of a middle line. The wrinkle distance meets the
to the wound-healing processes. The growth factors
released from platelets initiate the interaction, and the
release is continuously stimulated by inflammatory cells,
fibroblasts and epithelial cells to maintain the wound-
healing process.15 The most important rejuvenation process
for photoaged skin is the collagen remodelling process, and
dermal fibroblasts are known to have the most important
function. The production of collagen of fibroblasts is stim-
ulated by many growth factors including IGF, EGF, inter-
leukin-1 (IL-1) and tumour necrosis factor (TNF)-a. In vivo
studies report TGFb to be the most stimulative growth
factor.15,26 The reported results are consistent with the
results of the current experiment.
Fibroblast proliferation and collagen production were
increased in the PRP-treated group than in other groups. On Figure 6 Dermal thickness in HE staining. PRP injection
the other hand, the amount of increase was reduced in increased dermal thickness. * P 0.05 compared to no-treat-
each neutralising antibody-treated group than in the PRP- ment group and saline injected group.
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014
8. + MODEL
8 J.M. Cho et al.
parallel lines and represents the average deviation of Rp needed to investigate the mechanism of the aesthetic effect
values, which indicates the arithmetic average roughness. of PRP including the long-term effect in human skin wrinkles.
Rt, Rm and Rz are the values that represent wrinkle depth. Although future studies would be required, the results of this
Rp and Ra represent skin roughness and shallow wrinkle study confirm that PRP injection is effective to relieve skin
depth. Therefore, a smaller R value indicates shallow depth wrinkles caused by photoageing and suggest the basic mech-
of wrinkles and more regularity of the skin surface. anism of skin rejuvenation.
The results acquired from the current study showed that
all the R-values measured 4 weeks after the PRP injection Conflict of interest
were higher than in the non-treated group or the saline-
injected group. In other words, wrinkles in the PRP-injec-
None.
ted group showed statistically significant reduction than in
other groups. In addition, no statistically significant
difference was observed between the saline-injected group Funding
and the non-treated group.
According to Coleman et al., the duration of oedema None.
after filler injection is less than 1 week. Although a 4-week
experiment is insufficient to evaluate the long-term effects Disclosure
of PRP injection, the effects on photoageing cannot be
explained only by a transient volume effect.27 The authors received no financial support from any
Based upon these results, the PRP effect is not consid- company or sources, and have no commercial association or
ered to be a transient volume effect, and the effect caused financial relationships to disclose.
by oedema disappeared within 4 weeks.
Photoageing is a complex process that shares many
pathological features in common with skin wounds.28,29
References
Deformation of the extracellular matrix is one of the histo-
1. Chung JH, Hanft VN, Kang S. Aging and photoaging. J Am Acad
logical characteristics of photoaged skin, and alterations and
Dermatol 2003;49:690.
reductions in collagen components cause reductions in skin
2. Chung JH, Lee SH, Youn CS, et al. Cutaneous photodamage in
strength and elasticity.30,31 During the course of rejuvena- Koreans: influence of sex, sun exposure, smoking, and skin
tion of skin injuries, dermal fibroblasts have been known to color. Arch Dermatol 2001;137:1043e51.
play key roles through the interaction of keratinocytes, 3. Chung JH. Photoaging in Asians. Photodermatol Photoimmunol
adipocytes and mast cells. In addition, fibroblasts produce Photomed 2003;19:109e21.
extracellular matrix, glycoprotein, adhesive molecules and 4. Fisher GJ, Varani J, Voorhees JJ. Looking older: fibroblast
various cytokines.32 By providing these molecules and collapse and therapeutic implications. Arch Dermatol 2008;
maintaining the interactions between the cells, dermal 144:666e72.
fibroblasts stimulate wound healing and play essential roles 5. Froum SJ, Wallace SS, Tarnow DP, et al. Effect of platelet-rich
plasma on bone growth and osseointegration in human maxil-
in maintaining skin youth. By using lasers or localised medi-
lary sinus grafts: three bilateral case reports. Int J Periodontics
cations, many anti-ageing treatments have focussed on the Restorative Dent 2002;22:45e53.
activation of fibroblasts to stimulate interactions between 6. Marx RE, Carlson ER, Eichstaedt RM, et al. Platelet-rich
cells and increase the production of extracellular matrix. plasma: growth factor enhancement for bone grafts. Oral Surg
Histological results and in vitro assay results suggest an Oral Med Oral Pathol Oral Radiol Endod 1998;85:638e46.
approximate mechanism of PRP regarding skin rejuvena- 7. Petrungaro PS. Using platelet-rich plasma to accelerate soft
tion. Through organic and complex interactions between tissue maturation in esthetic periodontal surgery. Compend
growth factors, such as TGF, EGF and PDGF, present in PRP, Contin Educ Dent 2001;22:729e32.
the proliferation of fibroblasts is stimulated. Fibroblasts 8. Robiony M, Polini F, Costa F, et al. Osteogenesis distraction and
activate the skin rejuvenation process by helping the platelet-rich plasma for bone restoration of the severely
atrophic mandible: preliminary results. J Oral Maxillofac Surg
migration and proliferation of other cells, and produce
2002;60:630e5.
collagen and extracellular matrix that are key factors in 9. Margolis DJ, Kantor J, Santanna J, et al. Effectiveness of
skin rejuvenation. platelet releasate for the treatment of diabetic neuropathic
PRP is used for dermal augmentation, used in combination foot ulcers. Diabetes Care 2001;24:483e8.
with free fat injection and in many other clinical applications. 10. Welsh WJ. Autologous platelet gel: clinical function and usage
Sclafani used PRP for dermal augmentation and observed in plastic surgery. Cosmetic Derm 2000;11:13e9.
aesthetic improvements of the nasolabial fold in less than 2 11. Man D, Plosker H, Winland-Brown JE. The use of autologous
weeks and the results lasted for up to 3 months.33 Further, platelet-rich plasma (platelet gel) and autologous platelet-
Cervelli added PRP to fat grafts and obtained aesthetic results poor plasma (fibrin glue) in cosmetic surgery. Plast Reconstr
in facial contouring and in the soft tissue of the skin surface, Surg 2001;107:229e37.
12. Bhanot S, Alex JC. Current applications of platelet gels in facial
which lasted for up to 18 months.34 Controlled animal studies
plastic surgery. Facial Plast Surg 2002;18:27e33.
of soft and hard tissues have suggested that the application of 13. Eppley BL, Woodell JE, Higgins J. Platelet quantification and
autogenous PRP can enhance wound healing. Nevertheless, growth factor analysis from platelet-rich plasma: implications
healing of hard and soft tissue is mediated by a complex for wound healing. Plast Reconstr Surg 2004;114:1502e8.
array of intracellular and extracellular events that are regu- 14. Weibrich G, Kleis WK, Hafner G, et al. Growth factor levels in
lated by many signalling proteins, a process that is, at present, platelet-rich plasma and correlations with donor age, sex, and
incompletely understood.35 Especially, further studies are platelet count. J Craniomaxillofac Surg 2002;30:97e102.
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014
9. + MODEL
Platelet-rich plasma on skin wrinkles 9
15. Fitzpatrick RE, Rostan EF. Reversal of photodamage with topical 25. Kim Won-Serk, Park Byung-Soon, Park So-Hyun, et al. Anti-
growth factors: a pilot study. J Cosmet Laser Ther 2003; wrinkle effect of adipose-derived stem cell: activation of dermal
5:25e34. fibroblast by secretory factors. J Dermatol Sci 2009;53:96e102.
16. Ehrlich M, Rao J, Pabby A, et al. Improvement in the appear- 26. Pierce GF, Brown D, Mustoe TA. Quantitative analysis of
ance of wrinkles with topical transforming growth factor beta inflammatory cell influx, procollagen type I synthesis, and
(1) and 1-ascorbic acid. Dermatol Surg 2006;32:618e25. collagen cross-linking in incisional wounds: influence of PDGF-
17. Gold MH, Goldman MP, Biron J. Efficacy of novel skin cream BB and TGF-beta 1 therapy. J Lab Clin Med 1991;117:373e82.
containing mixture of human growth factors and cytokines for 27. Monheit Gary D, Coleman Kyle M. Hyaluronic acid fillers.
skin rejuvenation. J Drugs Dermatol 2007;6:197e201. Dermatologic Therapy 2006;19:141e50.
18. Marx RE. Platelet concentrate: a strategy for accelerating and 28. Kligman AM. Psychological aspects of skin disorders in the
improving bone regeneration. In: Davies JE, editor. Bone elderly. Cutis 1989;43:498e501.
engineering. Toronto: University of Toronto; 2000. p. 447e53. 29. Watson RE, Griffiths CE. Pathogenic aspects of cutaneous
19. Kevy SV, Jacobson MS. Comparison of methods for point of care photoaging. J Cosmet Dermatol 2005;4:230e6.
preparation of autologous platelet gel. J Extra Corpor Technol 30. Tsukahara K, Nakagawa H, Moriwaki S, et al. Inhibition of
2004;36:28e35. ultraviolet-B-induced wrinkle formation by an elastase-inhib-
20. Gonshor A. Technique for producing platelet-rich plasma and iting herbal extract: implication for the mechanism underlying
platelet concentrate: background and process. Int J Peri- elastase-associated wrinkles. Int J Dermatol 2006;45:460e8.
odontics Restorative Dent 2002;22:547e57. 31. Cauchard JH, Berton A, Godeau G, et al. Activation of latent
21. Dohan Ehrenfest DM, Rasmusson L, Albrektsson T. Classification transforming growth factor beta 1 and inhibition of matrix
of platelet concentrates: from pure platelet-rich plasma (P- metalloprotease activity by a thrombospondin-like tripeptide
PRP) to leucocyte- and platelet-rich fibrin (L-PRF). Trends linked to elaidic acid. Biochem Pharmacol 2004;67:2013e22.
Biotechnol 2009;27:158e67. 32. Le Pillouer-Prost A. Fibroblasts: what’s new in cellular biology?
22. Mazzucco L, Balbo V, Cattana E, et al. Platelet-rich plasma and J Cosmet Laser Ther 2003;5:232e8.
platelet gel preparation using Plateltex. Vox Sang 2009;97: 33. Sclafani AP. Applications of platelet-rich fibrin matrix in facial
110e8. plastic surgery. Facial Plast Surg. 2009 Nov;25:270e6.
23. Mazzucco L, Balbo V, Cattana E, et al. Not every PRP-gel is born 34. Cervelli V, Palla L, Pascali M, et al. Autologous platelet-rich
equal. Evaluation of growth factor availability for tissues plasma mixed with purified fat graft in aesthetic plastic
through four PRP-gel preparations: Fibrinet, RegenPRP-Kit, surgery. Aesthetic Plast Surg. 2009 Sep;33:716e21.
Plateltex and one manual procedure. Vox Sang 2008;94:202e8. 35. Eppley BL, Pietrzak WS, Blanton M. Platelet-rich plasma:
24. Kligman Lorraine H. The ultraviolet-irradiated hairless mouse: a review of biology and applications in plastic surgery. Plast
A model for photoaging. J Am Acad Dermatol 1989;21:623e31. Reconstr Surg. 2006 Nov;118:147ee59e.
Please cite this article in press as: Cho JM, et al., Effect of platelet-rich plasma on ultraviolet b-induced skin wrinkles in nude mice,
Journal of Plastic, Reconstructive Aesthetic Surgery (2010), doi:10.1016/j.bjps.2010.08.014