SlideShare a Scribd company logo
1 of 58
Jyotsna Chauhan
Division of Veterinary Public Health
&
Bhoj R singh
Division of Epidemiology
Indian Veterinary Research Institute, Izatnagar, India
Peste des Petits Ruminants (PPR)
in India
Epidemiology and Control
Peste des Petits Ruminants (PPR)
French name for “disastrous disease of small ruminants”.
An acute or sub acute viral disease of goats and sheep
By morbillivirus of the family Paramyxoviridae.
Ovine Rinderpest
Goat Plague
Plague of Small Ruminants
Kata
History
1. 1942 - First reported in Ivory Coast in West Africa
(Gargadennec & Lalanne, and subsequently in sub-
Saharan Africa (Senegal, Ghana, Togo, Benin and Nigeria),
the Arabian Peninsula, the Middle East and the Indian
subcontinent (Shaila et al., 1996)
2. 1962 – PPRV first isolated in sheep cell culture
3. 1986 - First confirmed outbreak in India in sheep in village
Arasur in Villapuram district of Tamil Nadu (Shaila et al.,
1989).
4. First reported in North India from HP (1996).
5. Both the field strains were adapted in VERO cell and
attenuated vaccines have been developed
Can affect some wild ungulates, but there is very limited information on species
susceptibility and the occurrence of disease
Two severe outbreaks
1.Dorcas gazelles (Gazella dorcas)
2.Thomson's gazelles (Gazella thomsoni) in Saudi Arabia
in 2002.
Affected Buffalo in India in 1995.
White-tailed deer (Odocoileus virginianus) infected experimentally.
Captive Nubian ibex, Laristan sheep and gemsbok wild ruminants may be important in
the epidemiology of this disease but exact role is unknown.
Though Sheep and Goat are
the main host but?
Species affected :-
 Sheep & Goat – primarily
 Cattle & Buffalo
 Wild ungulates ( Gazelles, White tailed deer )
Symptomology
Acute, contagious viral disease of small ruminants
Mucopurulent nasal & ocular discharge Necrotising & Erosive stomatitis
Enteritis Pneumonia
Signs
(Khan et al., 2007)
1. The severity of disease depends on Animal’s immunity to PPRV and animal
breed/ strain.
2. Peracute cases can be seen when PPR first occurs in naïve populations of sheep
or goats. In this form, the clinical signs are generally limited to high fever, severe
depression and death
3. In acute cases: Initial signs include a sudden high fever, inappetence, marked
depression and somnolence.
4. Serous nasal and ocular discharges appear soon after the onset of disease.
Matting is common around the eyes and the nose may become obstructed.
5. Within a few days of the onset of fever, the gums become hyperaemic, and small,
gray, necrotic foci, covering shallow erosions, begin to appear in the mouth.
Lesions are most common on the lips and gums, but they can also be found on
the dental pad, palate, cheeks and their papillae, and tongue.
6. In severe cases, the mouth may be completely covered in thick cheesy material.
7. The oral lesions are painful, and animals may resist opening their mouths
1. Necrotic lesions in nasal cavity, vulva and vagina.
2. Most animals develop profuse diarrhoea- blood-stained, and
sometimes contain shreds of tissue.
3. Rapid respiration is common, and dyspnoea, coughing and other signs
of pneumonia may be seen.
4. Abortion.
5. Sub-acute disease lasts for 10-15 days with variable signs including
respiratory signs.
6. Deer may show disease similar to sheep and goats, but subclinical
infections have also been reported.
7. PPR is highly contagious when it first occurs in a naïve population.
8. Periodic outbreaks may also be seen in endemic regions.
9. The morbidity and mortality rates can reach 100%, particularly in naïve
herds but lower in endemic areas, as low as 20%.
10.High case fatality rates have been reported when PPRV affects exotic
ungulates.
11.In an outbreak among buffalo in India, the case fatality rate was 96%.
12.In captive gazelles, the morbidity rate was 51% and the case fatality
rate was 100%.
13.In a countrywide outbreak among camels in Ethiopia morbidity was ˃
90% and mortality ranged between 5% to 70%.
More Lesions
Mode of Transmission
Direct contact
Respiratory route
Oral route
Conjunctival
Cattle can be infected with PPRV but is unable to transmit the
disease to another host (Khan et al., 2008)
1. Close contact.
2. Inhalation is thought to be an important route of spread.
3. PPRV is shed in nasal and ocular secretions, saliva, urine and
feces.
4. Probably through milk of affected animals.
5. Animals are not expected to become long-term carriers. However,
recent studies reported that viral antigens were shed in the faeces
of clinically recovered goats for at least 11 to 12 weeks of recovery.
6. PPRV is relatively fragile in the environment thus long distance
aerosol transmission is unlikely; in cool temperatures and in the dark
(devoid of sunlight) Virus are shown to spread for approximately 10
meters.
7. Fomites such as water, feed troughs and bedding can probably
transmit PPRV for a short time, but do not remain infectious for long
periods.
Transmission of PPR
(Pronab et al., 2002)
Four Lineages of Virus
• East Africa
• Arabia
• Southern
India
• Middle East
• Asia
• India
• West Africa• West Africa
Lineage
1
Lineage
2
Lineage
3
Lineage
4
Characteristic features of PPR virus
Survive at 60° C for 60
minutes
Stable at pH 4 - 10
Can be killed by alcohols,
ethers, detergents
Long survival time in
chilled & frozen tissue
1. Virus is very similar to Rinderpest
virus, which is inactivated by
ultraviolet light and desiccation
within four days.
2. Normally survives for very short
periods in carcasses.
3. Temperatures above 70°C, as well
as pH less than 5.6 or greater than
9.6, inactivate PPRV.
4. PPRV survives for a long time in
refrigerated meat and for
5. Several months in salted or frozen
meat.
EPIDEMIOLOGY
 Notifiable disease
 Endemic in Africa, Turkey, Middle East and the Indian sub-continent
(Banyard et al., 2010)
 Economic losses due to PPR have been estimated to be 1,800 million
INR annually in India
(Singh et al., 2009)
 The reported seroprevalence of PPRV in India :-
Goats and sheep - 43.56 % (Balamurugan et al., 2011)
Cattle and buffalos – 4.58% (Balamurugan et al., 2012)
 Solitary report of PPR in Indian Buffalo in Tamil Nadu
(Govindarajan et al., 1997)
Mortality and Case Fatality Rate
More severe in goats than sheep
CFR in Goats : 55-85%
CFR in Sheep : < 10%
Highly fatal in young animals
High mortality rates :- 90–100% in naive populations
20% in endemic areas
(Roeder & Obi, 1999)
Recovered animals have lifetime immunity
No carrier state reported.
In mixed populations, the serological prevalence rate is higher in
sheep than in goats
(Singh et al., 2009)
Epidemiological
determinants
Host Agent Environment
Species
Breed
Age
Immune status
Intercurrent
infection
PPRV lineage Stress
Stocking density
Nomadism
Steps in PPR geographical
distribution
(Albina et al., 2013)
Map showing the present PPRVdistribution
Over all Global PPR situation
2015
(OIE WAHIS & FAO EMPRES)
INTRODUCTION OF PPR VACCINE
&
Spread of Disease
Year Outbreaks Diseased
animals
Animal vaccinated
1998-1999 5 85 Work initiated and
vaccine developed1999-2000 6 699
2000-2001 15 1,242
2001-2002 0 0
2002-2003 148 7,293 196,218
2003-2004 70 1,620 859,346
2004-2005 184 4,370 1,612,692
2005-2006 169 3,448 3,480,409
2006-2007 27 683 4,621,871
Trend of reduction of PPR outbreaks in Andhra Pradesh (a), Karnataka (b) and whole of India
(c) from 2005-2012 based on reports from Gov. of India to OIE. (Singh & Bandyopadhyay, 2015)
In early years of Vaccinations:
Trends of outbreaks following PPR
immunization changed
0
200
400
600
800
1000
1200
numberofoutbreaks
2002 2003 2005
year
PPR outbreaks yearwise
Series1
Alignment Report of PPR Virus outbreaks and Vaccine strain
AT CGCCT CGCAGGCT GGGGACGAAAGAACCGCXAGAGGGACT GGGCCT CGACAGGCGCAGGT CT CCT T CCT CCAGCACAAMajority
10 20 30 40 50 60 70 80
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80sungri 96.seq
. . . . . . . . A. . . A. . . . . . . - - . . C. . . . . . T - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - 72AR 87.seq
. . . . . . . . A. . . A. . . . . . . T . . . C. . . . . . T T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . 80DQ176753.1 PPRV TNLK 04 2.seq
. . . . . . . . A. . . A. . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80DQ176754.1 PPRV TNVero 04 3.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80DQ176755.1 PPRV Ind TNSw ab 04 3.seq
. . . . . . . . A. . . A. . . . . . . T . . . C. . . . . . T T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . 80DQ176756.1 PPRV Ind TNLK 04 3.seq
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . T . . A. . . . . . - . . . . . . . 29EF641263.1 PPRV Ind Mukthesw ar 07 Cattl
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80FJ750559.1 PPRV Revati UP05.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80FJ750560.1 PPRV Bhopal 03.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80GU014574.1 PPRV Revati UP 06.seq
AACAGGAGAGGGAGAGT CGT CCGCACCAGCGACCAGAGAAGGGGT CAAGGCT GCGAT CCCAAACGGAT CT GAAGAGAGGGMajority
90 100 110 120 130 140 150 160
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160sungri 96.seq
. . . . . A- - - . . . . . . . . . . C. T A. . . . . . . . . . . . . . . . . . AA. . . . . A. . . . . . . . . . . . . . T . . G. . C. . . . GA. . . . 149AR 87.seq
. . . . . AT . . . . . . . . . . . . C. T A. . . . . . . . . . . . . . . . . . AA. . . . . A. . . . . . . . . . . . . . T . . G. . C. . . . GA. . . . 160DQ176753.1 PPRV TNLK 04 2.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . G. . . . . . . . . . G. . . . . . . . 160DQ176754.1 PPRV TNVero 04 3.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . G. . . . . . . . . . G. . . . . . . . 160DQ176755.1 PPRV Ind TNSw ab 04 3.seq
. . . . . AT . . . . . . . . . . . . C. T A. . . . . . . . . . . . . . . . . . AA. . . . . A. . . . . . . . . . . . . . T . . G. . C. . . . GA. . . . 160DQ176756.1 PPRV Ind TNLK 04 3.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109EF641263.1 PPRV Ind Mukthesw ar 07 Cattl
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160FJ750559.1 PPRV Revati UP05.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160FJ750560.1 PPRV Bhopal 03.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160GU014574.1 PPRV Revati UP 06.seq
ACAGAAAGCAAACACGCCCAGGAAGGCCCAXXXXXXXXXXXMajority
170 180 190 200
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190sungri 96.seq
. . . C. . . . . G. . . . . . . T . . . . . . A. . . . . GAGGAGAAACT 190AR 87.seq
. . . C. . . . . G. . . . . . . T . . . . . . A. . . . . 190DQ176753.1 PPRV TNLK 04 2.seq
. . . . . . . . . . . . . . . . . A. . . A. . . . . T . . 190DQ176754.1 PPRV TNVero 04 3.seq
. . . . . . . . . . . . . . . . . A. . . A. . . . . T . . 190DQ176755.1 PPRV Ind TNSw ab 04 3.seq
. . . C. . . . . G. . . . . . . T . . . . . . A. . . . . 190DQ176756.1 PPRV Ind TNLK 04 3.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139EF641263.1 PPRV Ind Mukthesw ar 07 Cattl
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190FJ750559.1 PPRV Revati UP05.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190FJ750560.1 PPRV Bhopal 03.seq
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190GU014574.1 PPRV Revati UP 06.seq
Decoration 'Decoration #1': Hide (as '.') residues that match the Consensus exactly.
Alignment Report of PPR Virus outbreaks and Vaccine strain
PercentIdentity
1 2 3 4 5 6 7 8 9 10
1 88.3 86.8 94.7 95.8 86.8 98.6 99.5 99.5 99.5 1 sungri96.seq
2 13.2 100.0 87.2 86.0 100.0 85.7 88.8 88.8 88.8 2 AR87.seq
3 15.0 0.0 86.3 85.3 100.0 84.9 87.4 87.4 87.4 3 DQ176753.1 PPRVTNLK 042.seq
4 5.5 14.6 15.6 98.9 86.3 93.5 95.3 95.3 95.3 4 DQ176754.1 PPRVTNVero04 3.seq
5 4.4 16.1 17.1 1.1 85.3 93.5 96.3 96.3 96.3 5 DQ176755.1 PPRVIndTNSwab04 3.seq
6 15.0 0.0 0.0 15.6 17.1 84.9 87.4 87.4 87.4 6 DQ176756.1 PPRVIndTNLK 043.seq
7 1.5 16.5 17.6 6.8 6.8 17.6 97.8 97.8 97.8 7 EF641263.1 PPRVInd Muktheswar07 Cattl
8 0.5 12.5 14.3 5.0 3.8 14.3 2.2 100.0 100.0 8 FJ750559.1 PPRVRevati UP05.seq
9 0.5 12.5 14.3 5.0 3.8 14.3 2.2 0.0 100.0 9 FJ750560.1 PPRVBhopal 03.seq
10 0.5 12.5 14.3 5.0 3.8 14.3 2.2 0.0 0.0 10 GU014574.1 PPRVRevati UP 06.seq
1 2 3 4 5 6 7 8 9 10
Recovered animals have lifetime immunity and no carrier
state reported.
1. Prior to the development of the PPR vaccine the RP
vaccine was used for PPR.
2. In the RP Eradication programme too the RP vaccine
was used for small animals (only in intensive rearing
areas) and thus there was herd immunity in the animals
for the PPR in sheep and Goats and PPR outbreaks
were not reported in the country
3. With the introduction of the PPR vaccine in field trial
and later intensive immunization , there was surge in
the outbreaks of PPR in country
Is spread of PPR outbreaks an
outcome of wrong Policies?
PPR outbreak in Sheep & Goat at
I.V.R.I. Izzatnagar 1994
(Kumar et al., 1999)
Percentage%
33
9.4
0
5
10
15
20
25
30
35
Goat Sheep
Morbidity rate (%)
9.4
0
2
4
6
8
10
Goat Sheep
Case fatality rate (%)
Percentage%
( Nanda et al., 1996)
Isolation of PPR Virus from Northern
India - 1996
(96/291) (8/85)
CFR%
Species
Species
PPR among Gaddi sheep & goat in
Himachal Pradesh- 1996
82.89
64.61
57.91
53.4
26.66
17.08
63.37
41.26
29.49
0
10
20
30
40
50
60
70
80
90
Flock 1 Flock 2 Flock 3
Morbidity rate
Mortality rate
Case fatality rate
(Joshi et al., 1996)
Rate
(N= 208) (N= 390) (N= 480)
Occurrence of PPR in Andhra Pradesh
1995-97
Period Outbreaks
(N)
Sera sample Tissue sample
Number Positive Number Positive
1995 2 7 4 --- ---
1996 14 91 72 --- ---
1997 60 93 61 45 43
(Rao et al., 1998)
Occurrence of PPR in small ruminants
in Uttar Pradesh-1998
(Shankar et al., 1998)
Rate
District
0
10
20
30
40
50
Etawah
Mathura
19.3
29.3
48.9
40.5
Attack rate
Case fatality rate
PPR outbreak in goats – CIRG
Makhdoom (UP) 2000
Rate
(Kumar et al., 2001)
(4/45)
(1/45)
(20/30)
(3/30)
Animal
affected
Adult Young ones
Flock size Affected Died Flock size Affected Died
Goat 501 286 161 426 420 317
Sheep 100 25 8 32 28 25
Occurrence of PPR in Punjab-2002
(Dhand et al., 2002)
Prevalence of antibodies to PPRV in
sheep and goat in India 1998-2003
State Sheep serum Goat serum
Jammu & Kashmir 11/27 (40.7%) 8/21 (38.1%)
Himachal Pradesh 15/97 (15.5%) 34/84 (40.5%)
Uttarakhand 12/44 (27.3%) 128/630 (20.3%)
Uttar Pradesh 87/244 (35.7%) 252/1017 (24.8%)
Chhattisgarh ------- 45/102 (44.1%)
Maharashtra 216/428 (50.4%) 388/536 (72.4%)
Andhra Pradesh 114/278 (41.1%) 20/56 (35.7%)
(Singh et al., 2004)
Prevalence of PPRV in small
ruminants in India 1998-2003
(Singh et al., 2004)
Temporal distribution of PPR in
Andhra Pradesh 1998-2004Proportionofoutbreak
(Rajasekhar, 2005)
Month
PPR among sheep & goat
in Tamil Nadu 2006
Age wise mortality in Sheep & Goat
0
5
10
15
20
25
30
35
40
45
50
Lambs/Kids Young Adult
5.13
49.48
7.88
15.56
26.79
5.32
Sheep
Goat
(Soundararajan et al., 2006)
Percentage%
0
5
10
15
20
25
30
35
2001-02 2002-03 2003-04 2004-05 2005-06
9
23
35
14
28
No. of Outbreaks
Status of PPR outbreak in
Maharashtra 2001-06
Surveillance Report (2007), Western Regional Disease Investigation Section, Pune, Maharashtra
No.ofoutbreaks
Year
30
55.33
27.8 42.76
0
10
20
30
40
50
60
Delhi Haryana
Sheep
Goat
Prevalence%
Prevalence of PPR antibodies
in Sheep & Goat in Delhi &
Haryana- 2006
(Singh et al., 2006)
(3/10)
(52/187)
(192/347)
(65/152)
Species Adult Kids/ Lambs
Total
animals
Morbidity
(%)
Mortality
(%)
CFR
(%)
Total
animals
Morbidity
(%)
Mortality
(%)
CFR(%)
Goat 225 14.7 4.4 30.3 208 56.7 49 86.4
Sheep 158 1.3 0.6 50.0 54 16.7 13.0 77.8
PPR outbreaks in sheep and goats in
Ludhiana Punjab - 2007
(Sharma et al., 2007)
PPR outbreaks in Karnataka,
April 1998 - March 2007
(Hegde et al., 2009)
5 6 15
0
148
70
184
169
27
0
20
40
60
80
100
120
140
160
180
200
Outbreaks
Outbreaks
Noofoutbreaks
Year
0
10
20
30
40
50
60
Sheep Goat
52.99
51.47
13.5
8.53
Incidence Rate
Mortality Rate
PPR in sheep and goats: Pune,
Maharashtra-2009
(Thombarea & Sinha, 2009)
Rate
Species
Seroprevalence of PPR in sheep and
goats in India (2003-2009)
(Balamurugan et al., 2011)
Year Sheep Goat
Tested Positive Prevalence
(%)
Tested Positive Prevalence
(%)
2003-04 567 169 31.47 456 187 43.77
2004-05 253 112 47.35 484 166 36.40
2005-06 580 323 59.90 610 334 58.87
2006-07 292 114 41.61 630 276 46.85
2007-08 256 101 42.06 184 87 50.66
2008-09 249 82 34.90 323 189 63
Map showing the seroprevalence
of PPR from 2003 to 2009 by
state in India
(Balamurugan et al., 2011)
(a) Sheep (b) Goats
Isolation of PPRV from Bhopal 2010
0
10
20
30
40
50
60
70
80
90
Morbidity (%) Mortality (%) Case fatality
rate (%)
28.7
24.7
86
22
14
64
Bhadus, Bhopal (n=251
goats)
Joulkheda, Bhopal (n=198
goats & n= 30 sheep)
(Balamurugan et al., 2010)
Percentage%
PPR in Himachal Pradesh during
2003-2012
Year No. of
outbreaks
No. of deaths/
affected
2003-04 102 967/11018
2004-05 13 875/2885
2005-06 5 54/131
2006-07 10 509/3291
2007-08 7 777/4280
2010-11 4 167/968
2011-12 7 738/1461
(Disease surveillance report Himachal Pradesh)
PPR in goats in
Madhya Pradesh-2013
(Awase et al., 2013)
(Rate%)
13.1
5.1
5.2
1.6
0
2
4
6
8
10
12
14
Indore Barwani
Incidence rate
Mortality rate
(58/442)
(23/442) (28/551)
(9/551)
Incidence of PPR in nomadic
sheep & goat of Jammu-2013
(Mahajan et al., 2013)
Detection of PPR virus antigen in
Sheep and goat in
Andhra Pradesh-2015
Prevalence of PPR virus antigen
in tissues
Prevalence of PPR virus antigen in
nasal swabs
Species
Sheep
Goat
Tissue
tested
39
18
Positivity
(%)
19
(48.7)
9 (50)
Species
Sheep
Goat
Swab
tested
72
66
Positivity
(%)
18 (25)
20
(30.3)
(Saritha et al., 2015)
Incidence of PPR in India 2009-14
(Annual Reports, DAHD)
165
184
300
197
122
82
0
50
100
150
200
250
300
350
2009 2010 2011 2012 2013 2014
No. Of Outbreaks
Year
No.ofoutbreaks
PPR disease outbreaks in different
states of India 2011- 2015
0
5
10
15
12
8
7
4
3
No of outbreaks
(Monthly Report, Deptt. Of Epidemiology)
No.ofoutbreaks
Distribution of PPR outbreaks in India
2005–2013
(Singh & Bandyopadhyay, 2015)
Year State Species
affected
Outbreak /
Seroprevalence
Reference
1998 Andhra Pradesh Sheep Morbidity- 30.56%
Mortality – 13.2%
CFR – 43.2%
Sreeramulu, 2000
1999 Dehradun &
Etawah
Sheep & Goat Mortality – 15-20% Singh et al., 1999
1999 West Bengal Sheep & Goat Morbidity- 18%
Mortality- 35.3%
Jana & Ghosh,
2002
1999 Himachal Pradesh Sheep & Goat
(n=5205)
Morbidity- 25.84%
Mortality – 3.43%
Katoch et al., 1999
Some PPR outbreaks in India
Year State Species
affected
Outbreak /
Seroprevalence
Reference
2000 Himachal Pradesh Sheep
Goat
Morbidity- 11.7%
Mortality – 4.1%
Morbidity – 30.3%
Mortality – 20.8%
Jithendran et
al., 2000
2001 Andhra Pradesh Sheep
(n= 505)
Morbidity – 16%
Mortality – 25%
Rao et al., 2001
2001 Gujarat Sheep
Goat
Buffaloes
Seroprevalence- 55.29%
Seroprevalence- 100%
Seroprevalence- 4.76%
Hinsu et al.,
2001
2001 IVRI Izzatnagar
U.P.
Sheep
Goat
Mortality – 44.4%
Mortality – 64.7%
Kumar et al.,
2001
Some PPR outbreaks in India
Year State Species
affected
Outbreak /
Seroprevalence
Reference
2005 Kerala Sheep
(n=166)
Goat
(n=536)
Seroprevalence- 45.78%
Seroprevalence – 0.93%
Sunilkumar et al.,
2005
2008 Chennai, Tamil
Nadu
Goat
( n=30)
Morbidity – 66.7 %
Mortality – 16.67 %
Narayanan et al.,
2008
2009 Maharashtra Goat Seroprevalence-
46.01%
Chavan et al.,
2009
2012 Rajasthan Goat Morbidity – 120
Mortality - 5
Tanwar, 2013
2012 Gujarat Camel Seroprevalence- 11.33% Chauhan et al.,
2012
2014 Gujarat
(2 outbreaks)
Sheep
(n=146)
Goat
(n=476)
Morbidity- 100%
Mortality – 73.68%
56.67%
Sharma et al.,
2015
Some PPR outbreaks in India
Through Clinical signs
Laboratory tests
Immunocapture ELISA (ICE) counter
immunoelectrophoresis (CIEP) or agar gel
immunodiffusion (AGID)
CEIP and ICE can distinguish PPRV from Rinderpest virus but
the AGID test cannot differentiate these two viruses.
Viral nucleic acids can be detected with RT-PCR or with other
forms of PCR- multiplex RT-PCR and a RT-PCR-ELISA
Serological tests as virus neutralization and competitive ELISA
assays can distinguish PPR from Rinderpest
Complement fixation test has also been used.
Diagnosis
Diagnosis
Clinical Signs & Lesions
Post mortem findings
Differential Diagnosis
Differentiation between PPR and a few similar diseases
is important for instituting effective control
programme. Differentiate it from:
Pneumonic Pasteurellosis
Rinderpest
CCPP in goats
Coccidiosis
Contagious Ecthyma
Helminthosis
Heart water
Treatment
 Early stages of disease – Hyper immune serum
 Supportive therapy :- Fluid therapy
Antibiotics to prevent secondary infection
 Lesions around eyes, nostrils & mouth should be cleaned
No specific treatment is recommended
Control
1. Not introducing flock from unknown sources. Combination of
quarantines, isolation and movement control is required.
2. Immediate isolation of affected goats from clinically healthy
goats.
3. Euthanasia of infected and exposed animals is important in
eradication. Carcasses are generally buried or burned.
4. Disinfection of infected area. PPRV can be inactivated by many
disinfectants including alkalis (sodium carbonate, sodium
hydroxide), halogens (sodium hypochlorite), phenolic
compounds, citric acid, alcohols and iodophores.
5. Kids & lambs vaccinated at 4-5 months age.
6. Ring vaccination and/or vaccination of high-risk populations can
also be helpful.
7. Vaccination susceptible wildlife and captive wild animals
such as gazelles.
PPR Control Programme (Gov. of India) - 2010
a. Sungri 96 : IVRI Mukteshwar (isolate of goat origin)
b. Arasur 87 : TNUVAS (isolate of sheep origin)
c. Coimbtore 97 : TNUVAS ( isolate of goat origin)
(Muthuchelvan et al., 2015)
Three live attenuated vaccines developed in India
Vaccine
Used for mass
vaccination
Conclusion
1. PPR is endemic in India in sheep & goats.
2. Mainly young stocks are more affected.
3. Disease occurs throughout the year but more common
in October & March.
4. Though vaccination is the only method for control &
eradication, even the institutes those developed the
effective vaccine in India to control the disease fear to
use it because many a time outbreaks ensue on
vaccination.
5. The other important reason for persistence of disease is
undeclared Policy of suppressed reporting of PPR
outbreaks.

More Related Content

What's hot (20)

Blue tongue in India
Blue tongue in IndiaBlue tongue in India
Blue tongue in India
 
Enterotoxemia ppt
Enterotoxemia pptEnterotoxemia ppt
Enterotoxemia ppt
 
Colic in horses
Colic in horsesColic in horses
Colic in horses
 
Bovine Ephemeral Fever (Three Day Sickness)
Bovine Ephemeral Fever (Three Day Sickness)Bovine Ephemeral Fever (Three Day Sickness)
Bovine Ephemeral Fever (Three Day Sickness)
 
Bovine ephemeral fever
Bovine ephemeral feverBovine ephemeral fever
Bovine ephemeral fever
 
Hemorrhagic septicemia
Hemorrhagic septicemiaHemorrhagic septicemia
Hemorrhagic septicemia
 
Infectious Bursal Disease
Infectious Bursal DiseaseInfectious Bursal Disease
Infectious Bursal Disease
 
Milk fever
Milk feverMilk fever
Milk fever
 
Colibacillosis
ColibacillosisColibacillosis
Colibacillosis
 
Blue tongue disease in sheep and goats
Blue tongue disease in sheep and goatsBlue tongue disease in sheep and goats
Blue tongue disease in sheep and goats
 
Leptospirosis dogs
Leptospirosis  dogsLeptospirosis  dogs
Leptospirosis dogs
 
ketosis In Cows
ketosis In Cowsketosis In Cows
ketosis In Cows
 
Fowl typhoid
Fowl typhoidFowl typhoid
Fowl typhoid
 
Peste des Petits Ruminants ( PPR ) in Goat
Peste des Petits Ruminants( PPR ) in GoatPeste des Petits Ruminants( PPR ) in Goat
Peste des Petits Ruminants ( PPR ) in Goat
 
Canin parvovirus disease
Canin parvovirus diseaseCanin parvovirus disease
Canin parvovirus disease
 
Canine babesiosis Dr.Jibachha Sah,M.V.Sc ,Lecturer NPI
Canine babesiosis Dr.Jibachha Sah,M.V.Sc ,Lecturer NPICanine babesiosis Dr.Jibachha Sah,M.V.Sc ,Lecturer NPI
Canine babesiosis Dr.Jibachha Sah,M.V.Sc ,Lecturer NPI
 
Bovine Viral Diarrhea
Bovine Viral DiarrheaBovine Viral Diarrhea
Bovine Viral Diarrhea
 
Contagious ecthyma
Contagious ecthymaContagious ecthyma
Contagious ecthyma
 
Enterotoxemia in sheep Goat
Enterotoxemia in sheep Goat Enterotoxemia in sheep Goat
Enterotoxemia in sheep Goat
 
UTERINE TORSION
UTERINE TORSIONUTERINE TORSION
UTERINE TORSION
 

Viewers also liked

Peste des Petits Ruminants (PPR) outbreak in southern, Tanzania
Peste des Petits Ruminants (PPR) outbreak in southern, TanzaniaPeste des Petits Ruminants (PPR) outbreak in southern, Tanzania
Peste des Petits Ruminants (PPR) outbreak in southern, TanzaniaRUFORUM
 
PPR Control in Modern Goat Farms in India
PPR Control in Modern Goat Farms in IndiaPPR Control in Modern Goat Farms in India
PPR Control in Modern Goat Farms in IndiaIbne Ali
 
Prevelane Estimation of PPR in Puntland Somalia
Prevelane Estimation of PPR in Puntland SomaliaPrevelane Estimation of PPR in Puntland Somalia
Prevelane Estimation of PPR in Puntland SomaliaMohamed Said DVM,Msc
 
The Real Parvo
The Real ParvoThe Real Parvo
The Real ParvoLovesme11
 
My pet has chronic renal failure!
My pet has chronic renal failure!My pet has chronic renal failure!
My pet has chronic renal failure!Jacquelyn Burns
 
Important facts about Canine Parvovirus
Important facts about Canine ParvovirusImportant facts about Canine Parvovirus
Important facts about Canine ParvovirusStefan Malic
 
Assessing the Economic Impact of Swine Disease - The Case of PRRS
Assessing the Economic Impact of Swine Disease - The Case of PRRSAssessing the Economic Impact of Swine Disease - The Case of PRRS
Assessing the Economic Impact of Swine Disease - The Case of PRRSJohn Blue
 
My Puppy Has Parvo! Now What?
My Puppy Has Parvo!  Now What?My Puppy Has Parvo!  Now What?
My Puppy Has Parvo! Now What?Jacquelyn Burns
 
VAXXITEK HVT + IBD - Field Study - Egypt - Merial
VAXXITEK HVT + IBD - Field Study - Egypt - MerialVAXXITEK HVT + IBD - Field Study - Egypt - Merial
VAXXITEK HVT + IBD - Field Study - Egypt - MerialMerial EMEA
 
OIE Pathway for declaration of disease freedom
OIE Pathway for declaration of disease freedomOIE Pathway for declaration of disease freedom
OIE Pathway for declaration of disease freedomAsif Sahir
 
VAXXITEK HVT + IBD - Field Study - Brazil - Merial
VAXXITEK HVT + IBD - Field Study - Brazil - MerialVAXXITEK HVT + IBD - Field Study - Brazil - Merial
VAXXITEK HVT + IBD - Field Study - Brazil - MerialMerial EMEA
 
Introduction to postweaning diarrhea
Introduction to postweaning diarrhea Introduction to postweaning diarrhea
Introduction to postweaning diarrhea PlusVet Animal Health
 
Dr. Phil Gauger - Influenza ‘A’ Virus in Swine: Overview of Disease and Diagn...
Dr. Phil Gauger - Influenza ‘A’ Virus in Swine: Overview of Disease and Diagn...Dr. Phil Gauger - Influenza ‘A’ Virus in Swine: Overview of Disease and Diagn...
Dr. Phil Gauger - Influenza ‘A’ Virus in Swine: Overview of Disease and Diagn...John Blue
 
Dr. Darin Madson - Deciphering Diarrhea - What's Important
Dr. Darin Madson - Deciphering Diarrhea - What's ImportantDr. Darin Madson - Deciphering Diarrhea - What's Important
Dr. Darin Madson - Deciphering Diarrhea - What's ImportantJohn Blue
 
Pestedes petits ruminants in Pakistan by Shakira sulehri
Pestedes petits ruminants in Pakistan by Shakira sulehriPestedes petits ruminants in Pakistan by Shakira sulehri
Pestedes petits ruminants in Pakistan by Shakira sulehriShakira Sulehri
 

Viewers also liked (20)

Peste des Petits Ruminants (PPR) outbreak in southern, Tanzania
Peste des Petits Ruminants (PPR) outbreak in southern, TanzaniaPeste des Petits Ruminants (PPR) outbreak in southern, Tanzania
Peste des Petits Ruminants (PPR) outbreak in southern, Tanzania
 
PPR Control in Modern Goat Farms in India
PPR Control in Modern Goat Farms in IndiaPPR Control in Modern Goat Farms in India
PPR Control in Modern Goat Farms in India
 
Prevelane Estimation of PPR in Puntland Somalia
Prevelane Estimation of PPR in Puntland SomaliaPrevelane Estimation of PPR in Puntland Somalia
Prevelane Estimation of PPR in Puntland Somalia
 
The Real Parvo
The Real ParvoThe Real Parvo
The Real Parvo
 
My pet has chronic renal failure!
My pet has chronic renal failure!My pet has chronic renal failure!
My pet has chronic renal failure!
 
Important facts about Canine Parvovirus
Important facts about Canine ParvovirusImportant facts about Canine Parvovirus
Important facts about Canine Parvovirus
 
Assessing the Economic Impact of Swine Disease - The Case of PRRS
Assessing the Economic Impact of Swine Disease - The Case of PRRSAssessing the Economic Impact of Swine Disease - The Case of PRRS
Assessing the Economic Impact of Swine Disease - The Case of PRRS
 
The Real Parvovirus
The Real ParvovirusThe Real Parvovirus
The Real Parvovirus
 
My Puppy Has Parvo! Now What?
My Puppy Has Parvo!  Now What?My Puppy Has Parvo!  Now What?
My Puppy Has Parvo! Now What?
 
VAXXITEK HVT + IBD - Field Study - Egypt - Merial
VAXXITEK HVT + IBD - Field Study - Egypt - MerialVAXXITEK HVT + IBD - Field Study - Egypt - Merial
VAXXITEK HVT + IBD - Field Study - Egypt - Merial
 
OIE Pathway for declaration of disease freedom
OIE Pathway for declaration of disease freedomOIE Pathway for declaration of disease freedom
OIE Pathway for declaration of disease freedom
 
VAXXITEK HVT + IBD - Field Study - Brazil - Merial
VAXXITEK HVT + IBD - Field Study - Brazil - MerialVAXXITEK HVT + IBD - Field Study - Brazil - Merial
VAXXITEK HVT + IBD - Field Study - Brazil - Merial
 
Diaroak pigs
Diaroak   pigsDiaroak   pigs
Diaroak pigs
 
Introduction to postweaning diarrhea
Introduction to postweaning diarrhea Introduction to postweaning diarrhea
Introduction to postweaning diarrhea
 
Dr. Phil Gauger - Influenza ‘A’ Virus in Swine: Overview of Disease and Diagn...
Dr. Phil Gauger - Influenza ‘A’ Virus in Swine: Overview of Disease and Diagn...Dr. Phil Gauger - Influenza ‘A’ Virus in Swine: Overview of Disease and Diagn...
Dr. Phil Gauger - Influenza ‘A’ Virus in Swine: Overview of Disease and Diagn...
 
Parvo virus
Parvo virusParvo virus
Parvo virus
 
Dr. Darin Madson - Deciphering Diarrhea - What's Important
Dr. Darin Madson - Deciphering Diarrhea - What's ImportantDr. Darin Madson - Deciphering Diarrhea - What's Important
Dr. Darin Madson - Deciphering Diarrhea - What's Important
 
Pestedes petits ruminants in Pakistan by Shakira sulehri
Pestedes petits ruminants in Pakistan by Shakira sulehriPestedes petits ruminants in Pakistan by Shakira sulehri
Pestedes petits ruminants in Pakistan by Shakira sulehri
 
canine parvo virus
canine parvo viruscanine parvo virus
canine parvo virus
 
Nutrition Of The Ewe And Lamb
Nutrition Of The Ewe And LambNutrition Of The Ewe And Lamb
Nutrition Of The Ewe And Lamb
 

Similar to Peste des Petits Ruminants (PPR) in India Epidemiology and Control

australian_spike in the nucleus.pdf
australian_spike in the nucleus.pdfaustralian_spike in the nucleus.pdf
australian_spike in the nucleus.pdfwww.epidella.com
 
Prevention and control of Mycoplasma sinoviae without vaccination
Prevention and control of Mycoplasma sinoviae without vaccinationPrevention and control of Mycoplasma sinoviae without vaccination
Prevention and control of Mycoplasma sinoviae without vaccinationRafael Monleon
 
Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...
Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...
Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...ExternalEvents
 
veterinary infectious diseases 2nd edition.pdf
veterinary infectious diseases 2nd edition.pdfveterinary infectious diseases 2nd edition.pdf
veterinary infectious diseases 2nd edition.pdfhazemmassaod5
 
OS18 - 7.3 The GMO (Adenovirus) option A Current Perspective on adenovirus 5-...
OS18 - 7.3 The GMO (Adenovirus) option A Current Perspective on adenovirus 5-...OS18 - 7.3 The GMO (Adenovirus) option A Current Perspective on adenovirus 5-...
OS18 - 7.3 The GMO (Adenovirus) option A Current Perspective on adenovirus 5-...EuFMD
 
Human Ad-5 based FMD vaccines (T. de Los Santos)
Human Ad-5 based FMD vaccines (T. de Los Santos)Human Ad-5 based FMD vaccines (T. de Los Santos)
Human Ad-5 based FMD vaccines (T. de Los Santos)EuFMD
 
Dr. Dick Hesse - Recent Emergence of Swine Coronaviruses in North America
Dr. Dick Hesse - Recent Emergence of Swine Coronaviruses in North AmericaDr. Dick Hesse - Recent Emergence of Swine Coronaviruses in North America
Dr. Dick Hesse - Recent Emergence of Swine Coronaviruses in North AmericaJohn Blue
 
Brucellosis in cattle interim manual for the veterinarian &amp; aht sept2016
Brucellosis in cattle interim manual for the veterinarian &amp; aht   sept2016Brucellosis in cattle interim manual for the veterinarian &amp; aht   sept2016
Brucellosis in cattle interim manual for the veterinarian &amp; aht sept2016Eduardo J Kwiecien
 
Veterinary Internship Programme 2013-14
Veterinary Internship Programme 2013-14Veterinary Internship Programme 2013-14
Veterinary Internship Programme 2013-14Tarun Paul
 
Poultry diseases zagazig university egypt
Poultry diseases zagazig university egyptPoultry diseases zagazig university egypt
Poultry diseases zagazig university egyptfsl hggi
 
Overview on current practices of poultry slaughtering and poultry meat inspec...
Overview on current practices of poultry slaughtering and poultry meat inspec...Overview on current practices of poultry slaughtering and poultry meat inspec...
Overview on current practices of poultry slaughtering and poultry meat inspec...Harm Kiezebrink
 
Hepatitis final pride pdf 1
Hepatitis final pride pdf 1Hepatitis final pride pdf 1
Hepatitis final pride pdf 1TANYIPRIDE
 
Linezolid versus vancomycin MIC assay for the treatment of infections caused ...
Linezolid versus vancomycin MIC assay for the treatment of infections caused ...Linezolid versus vancomycin MIC assay for the treatment of infections caused ...
Linezolid versus vancomycin MIC assay for the treatment of infections caused ...AditiSurjeet07
 
Veterinary Mycology ( PDFDrive ).pdf
Veterinary Mycology ( PDFDrive ).pdfVeterinary Mycology ( PDFDrive ).pdf
Veterinary Mycology ( PDFDrive ).pdfMubaboyMubaboy
 
Animal Disease Control Programs in India.ppt
Animal Disease Control Programs in India.pptAnimal Disease Control Programs in India.ppt
Animal Disease Control Programs in India.pptBhoj Raj Singh
 
animaldiseasecontrolprogramsinindia-220420052030.pdf
animaldiseasecontrolprogramsinindia-220420052030.pdfanimaldiseasecontrolprogramsinindia-220420052030.pdf
animaldiseasecontrolprogramsinindia-220420052030.pdfSukumarSharma1
 
Dengue epidemiology 03.10.2017
Dengue epidemiology 03.10.2017Dengue epidemiology 03.10.2017
Dengue epidemiology 03.10.2017jbkathiriya
 
Vaccination Programmes for cattles in Sri Lanka
Vaccination Programmes for cattles in Sri LankaVaccination Programmes for cattles in Sri Lanka
Vaccination Programmes for cattles in Sri LankaRavindu Priyashan Perera
 

Similar to Peste des Petits Ruminants (PPR) in India Epidemiology and Control (20)

australian_spike in the nucleus.pdf
australian_spike in the nucleus.pdfaustralian_spike in the nucleus.pdf
australian_spike in the nucleus.pdf
 
Prevention and control of Mycoplasma sinoviae without vaccination
Prevention and control of Mycoplasma sinoviae without vaccinationPrevention and control of Mycoplasma sinoviae without vaccination
Prevention and control of Mycoplasma sinoviae without vaccination
 
Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...
Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...
Applications of Whole Genome Sequencing (WGS) to Food Safety – Perspective fr...
 
veterinary infectious diseases 2nd edition.pdf
veterinary infectious diseases 2nd edition.pdfveterinary infectious diseases 2nd edition.pdf
veterinary infectious diseases 2nd edition.pdf
 
OS18 - 7.3 The GMO (Adenovirus) option A Current Perspective on adenovirus 5-...
OS18 - 7.3 The GMO (Adenovirus) option A Current Perspective on adenovirus 5-...OS18 - 7.3 The GMO (Adenovirus) option A Current Perspective on adenovirus 5-...
OS18 - 7.3 The GMO (Adenovirus) option A Current Perspective on adenovirus 5-...
 
Human Ad-5 based FMD vaccines (T. de Los Santos)
Human Ad-5 based FMD vaccines (T. de Los Santos)Human Ad-5 based FMD vaccines (T. de Los Santos)
Human Ad-5 based FMD vaccines (T. de Los Santos)
 
02 henry too
02 henry too02 henry too
02 henry too
 
Dr. Dick Hesse - Recent Emergence of Swine Coronaviruses in North America
Dr. Dick Hesse - Recent Emergence of Swine Coronaviruses in North AmericaDr. Dick Hesse - Recent Emergence of Swine Coronaviruses in North America
Dr. Dick Hesse - Recent Emergence of Swine Coronaviruses in North America
 
Brucellosis in cattle interim manual for the veterinarian &amp; aht sept2016
Brucellosis in cattle interim manual for the veterinarian &amp; aht   sept2016Brucellosis in cattle interim manual for the veterinarian &amp; aht   sept2016
Brucellosis in cattle interim manual for the veterinarian &amp; aht sept2016
 
Veterinary Internship Programme 2013-14
Veterinary Internship Programme 2013-14Veterinary Internship Programme 2013-14
Veterinary Internship Programme 2013-14
 
Poultry diseases zagazig university egypt
Poultry diseases zagazig university egyptPoultry diseases zagazig university egypt
Poultry diseases zagazig university egypt
 
Overview on current practices of poultry slaughtering and poultry meat inspec...
Overview on current practices of poultry slaughtering and poultry meat inspec...Overview on current practices of poultry slaughtering and poultry meat inspec...
Overview on current practices of poultry slaughtering and poultry meat inspec...
 
Hepatitis final pride pdf 1
Hepatitis final pride pdf 1Hepatitis final pride pdf 1
Hepatitis final pride pdf 1
 
Linezolid versus vancomycin MIC assay for the treatment of infections caused ...
Linezolid versus vancomycin MIC assay for the treatment of infections caused ...Linezolid versus vancomycin MIC assay for the treatment of infections caused ...
Linezolid versus vancomycin MIC assay for the treatment of infections caused ...
 
Veterinary Mycology ( PDFDrive ).pdf
Veterinary Mycology ( PDFDrive ).pdfVeterinary Mycology ( PDFDrive ).pdf
Veterinary Mycology ( PDFDrive ).pdf
 
Animal Disease Control Programs in India.ppt
Animal Disease Control Programs in India.pptAnimal Disease Control Programs in India.ppt
Animal Disease Control Programs in India.ppt
 
animaldiseasecontrolprogramsinindia-220420052030.pdf
animaldiseasecontrolprogramsinindia-220420052030.pdfanimaldiseasecontrolprogramsinindia-220420052030.pdf
animaldiseasecontrolprogramsinindia-220420052030.pdf
 
Dengue epidemiology 03.10.2017
Dengue epidemiology 03.10.2017Dengue epidemiology 03.10.2017
Dengue epidemiology 03.10.2017
 
Vaccination Programmes for cattles in Sri Lanka
Vaccination Programmes for cattles in Sri LankaVaccination Programmes for cattles in Sri Lanka
Vaccination Programmes for cattles in Sri Lanka
 
Estudio anual Rasff 2010 en inglés
Estudio anual Rasff 2010 en inglésEstudio anual Rasff 2010 en inglés
Estudio anual Rasff 2010 en inglés
 

More from Bhoj Raj Singh

Issues in Veterinary Disease Diagnosis.pptx
Issues in Veterinary Disease Diagnosis.pptxIssues in Veterinary Disease Diagnosis.pptx
Issues in Veterinary Disease Diagnosis.pptxBhoj Raj Singh
 
Epidemiological Approaches for Evaluation of diagnostic tests.pptx
Epidemiological Approaches for Evaluation of diagnostic tests.pptxEpidemiological Approaches for Evaluation of diagnostic tests.pptx
Epidemiological Approaches for Evaluation of diagnostic tests.pptxBhoj Raj Singh
 
Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...
Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...
Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...Bhoj Raj Singh
 
Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...
Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...
Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...Bhoj Raj Singh
 
Epidemiology of antigenic, genetic and biological diversity amongst pathogens...
Epidemiology of antigenic, genetic and biological diversity amongst pathogens...Epidemiology of antigenic, genetic and biological diversity amongst pathogens...
Epidemiology of antigenic, genetic and biological diversity amongst pathogens...Bhoj Raj Singh
 
Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...
Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...
Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...Bhoj Raj Singh
 
Lumpy skin disease (LSD) Globally and in India.pptx
Lumpy skin disease (LSD) Globally and in India.pptxLumpy skin disease (LSD) Globally and in India.pptx
Lumpy skin disease (LSD) Globally and in India.pptxBhoj Raj Singh
 
Molecular determinants of pathogenicity and virulence among pathogens.pptx
Molecular determinants of pathogenicity and virulence among pathogens.pptxMolecular determinants of pathogenicity and virulence among pathogens.pptx
Molecular determinants of pathogenicity and virulence among pathogens.pptxBhoj Raj Singh
 
Molecular epidemiology and Disease causation.pptx
Molecular epidemiology and Disease causation.pptxMolecular epidemiology and Disease causation.pptx
Molecular epidemiology and Disease causation.pptxBhoj Raj Singh
 
My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...
My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...
My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...Bhoj Raj Singh
 
Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...
Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...
Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...Bhoj Raj Singh
 
Causes of Disease and Preserving Health in Different systems of Medicine.pptx
Causes of Disease and Preserving Health in Different systems of Medicine.pptxCauses of Disease and Preserving Health in Different systems of Medicine.pptx
Causes of Disease and Preserving Health in Different systems of Medicine.pptxBhoj Raj Singh
 
AMR challenges in human from animal foods- Facts and Myths.pptx
AMR challenges in human from animal foods- Facts and Myths.pptxAMR challenges in human from animal foods- Facts and Myths.pptx
AMR challenges in human from animal foods- Facts and Myths.pptxBhoj Raj Singh
 
Herbal Antimicrobials to Counter AMR.pptx
Herbal Antimicrobials to Counter AMR.pptxHerbal Antimicrobials to Counter AMR.pptx
Herbal Antimicrobials to Counter AMR.pptxBhoj Raj Singh
 
Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...
Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...
Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...Bhoj Raj Singh
 
Veterinary Vaccines.pptx
Veterinary Vaccines.pptxVeterinary Vaccines.pptx
Veterinary Vaccines.pptxBhoj Raj Singh
 
Major flaws in Animal Disease Control Leading to Partial Success or Failure.pptx
Major flaws in Animal Disease Control Leading to Partial Success or Failure.pptxMajor flaws in Animal Disease Control Leading to Partial Success or Failure.pptx
Major flaws in Animal Disease Control Leading to Partial Success or Failure.pptxBhoj Raj Singh
 
Control and Eradication of Animal diseases.pptx
Control and Eradication of Animal diseases.pptxControl and Eradication of Animal diseases.pptx
Control and Eradication of Animal diseases.pptxBhoj Raj Singh
 
Clinical Microbiology in Laboratory
Clinical Microbiology in LaboratoryClinical Microbiology in Laboratory
Clinical Microbiology in LaboratoryBhoj Raj Singh
 
Concepts of Microbiology.pptx
Concepts of Microbiology.pptxConcepts of Microbiology.pptx
Concepts of Microbiology.pptxBhoj Raj Singh
 

More from Bhoj Raj Singh (20)

Issues in Veterinary Disease Diagnosis.pptx
Issues in Veterinary Disease Diagnosis.pptxIssues in Veterinary Disease Diagnosis.pptx
Issues in Veterinary Disease Diagnosis.pptx
 
Epidemiological Approaches for Evaluation of diagnostic tests.pptx
Epidemiological Approaches for Evaluation of diagnostic tests.pptxEpidemiological Approaches for Evaluation of diagnostic tests.pptx
Epidemiological Approaches for Evaluation of diagnostic tests.pptx
 
Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...
Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...
Types of Trials in Medicine, vaccine efficacy or effectiveness trials and rel...
 
Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...
Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...
Detection and Characterization of Pathotypes, Serotypes, Biotypes, Phenotypes...
 
Epidemiology of antigenic, genetic and biological diversity amongst pathogens...
Epidemiology of antigenic, genetic and biological diversity amongst pathogens...Epidemiology of antigenic, genetic and biological diversity amongst pathogens...
Epidemiology of antigenic, genetic and biological diversity amongst pathogens...
 
Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...
Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...
Differentiation of field isolates (wild) from vaccine strains (Marker, DIVA &...
 
Lumpy skin disease (LSD) Globally and in India.pptx
Lumpy skin disease (LSD) Globally and in India.pptxLumpy skin disease (LSD) Globally and in India.pptx
Lumpy skin disease (LSD) Globally and in India.pptx
 
Molecular determinants of pathogenicity and virulence among pathogens.pptx
Molecular determinants of pathogenicity and virulence among pathogens.pptxMolecular determinants of pathogenicity and virulence among pathogens.pptx
Molecular determinants of pathogenicity and virulence among pathogens.pptx
 
Molecular epidemiology and Disease causation.pptx
Molecular epidemiology and Disease causation.pptxMolecular epidemiology and Disease causation.pptx
Molecular epidemiology and Disease causation.pptx
 
My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...
My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...
My research proposals, to porotect holy cow, rejected by the ICAR-IVRI in the...
 
Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...
Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...
Animal Disease Control and Antimicrobial Resistance-A Message to Veterinary S...
 
Causes of Disease and Preserving Health in Different systems of Medicine.pptx
Causes of Disease and Preserving Health in Different systems of Medicine.pptxCauses of Disease and Preserving Health in Different systems of Medicine.pptx
Causes of Disease and Preserving Health in Different systems of Medicine.pptx
 
AMR challenges in human from animal foods- Facts and Myths.pptx
AMR challenges in human from animal foods- Facts and Myths.pptxAMR challenges in human from animal foods- Facts and Myths.pptx
AMR challenges in human from animal foods- Facts and Myths.pptx
 
Herbal Antimicrobials to Counter AMR.pptx
Herbal Antimicrobials to Counter AMR.pptxHerbal Antimicrobials to Counter AMR.pptx
Herbal Antimicrobials to Counter AMR.pptx
 
Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...
Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...
Epidemiological characterisation of Burkholderia cepacia complex (Bcc) from c...
 
Veterinary Vaccines.pptx
Veterinary Vaccines.pptxVeterinary Vaccines.pptx
Veterinary Vaccines.pptx
 
Major flaws in Animal Disease Control Leading to Partial Success or Failure.pptx
Major flaws in Animal Disease Control Leading to Partial Success or Failure.pptxMajor flaws in Animal Disease Control Leading to Partial Success or Failure.pptx
Major flaws in Animal Disease Control Leading to Partial Success or Failure.pptx
 
Control and Eradication of Animal diseases.pptx
Control and Eradication of Animal diseases.pptxControl and Eradication of Animal diseases.pptx
Control and Eradication of Animal diseases.pptx
 
Clinical Microbiology in Laboratory
Clinical Microbiology in LaboratoryClinical Microbiology in Laboratory
Clinical Microbiology in Laboratory
 
Concepts of Microbiology.pptx
Concepts of Microbiology.pptxConcepts of Microbiology.pptx
Concepts of Microbiology.pptx
 

Recently uploaded

Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service JaipurHigh Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipurparulsinha
 
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service CoimbatoreCall Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatorenarwatsonia7
 
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort ServiceCall Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Serviceparulsinha
 
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment BookingCall Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Bookingnarwatsonia7
 
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowKolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowNehru place Escorts
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableNehru place Escorts
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Miss joya
 
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safenarwatsonia7
 
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...CALL GIRLS
 
Hi,Fi Call Girl In Mysore Road - 7001305949 | 24x7 Service Available Near Me
Hi,Fi Call Girl In Mysore Road - 7001305949 | 24x7 Service Available Near MeHi,Fi Call Girl In Mysore Road - 7001305949 | 24x7 Service Available Near Me
Hi,Fi Call Girl In Mysore Road - 7001305949 | 24x7 Service Available Near Menarwatsonia7
 
Ahmedabad Call Girls CG Road 🔝9907093804 Short 1500 💋 Night 6000
Ahmedabad Call Girls CG Road 🔝9907093804  Short 1500  💋 Night 6000Ahmedabad Call Girls CG Road 🔝9907093804  Short 1500  💋 Night 6000
Ahmedabad Call Girls CG Road 🔝9907093804 Short 1500 💋 Night 6000aliya bhat
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Miss joya
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...Garima Khatri
 

Recently uploaded (20)

Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
 
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service JaipurHigh Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
 
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service CoimbatoreCall Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
 
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCREscort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
 
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Servicesauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
 
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort ServiceCall Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
 
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment BookingCall Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
 
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowKolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
 
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
 
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
 
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
 
Hi,Fi Call Girl In Mysore Road - 7001305949 | 24x7 Service Available Near Me
Hi,Fi Call Girl In Mysore Road - 7001305949 | 24x7 Service Available Near MeHi,Fi Call Girl In Mysore Road - 7001305949 | 24x7 Service Available Near Me
Hi,Fi Call Girl In Mysore Road - 7001305949 | 24x7 Service Available Near Me
 
Ahmedabad Call Girls CG Road 🔝9907093804 Short 1500 💋 Night 6000
Ahmedabad Call Girls CG Road 🔝9907093804  Short 1500  💋 Night 6000Ahmedabad Call Girls CG Road 🔝9907093804  Short 1500  💋 Night 6000
Ahmedabad Call Girls CG Road 🔝9907093804 Short 1500 💋 Night 6000
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
 
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
 
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
 

Peste des Petits Ruminants (PPR) in India Epidemiology and Control

  • 1. Jyotsna Chauhan Division of Veterinary Public Health & Bhoj R singh Division of Epidemiology Indian Veterinary Research Institute, Izatnagar, India Peste des Petits Ruminants (PPR) in India Epidemiology and Control
  • 2. Peste des Petits Ruminants (PPR) French name for “disastrous disease of small ruminants”. An acute or sub acute viral disease of goats and sheep By morbillivirus of the family Paramyxoviridae. Ovine Rinderpest Goat Plague Plague of Small Ruminants Kata
  • 3. History 1. 1942 - First reported in Ivory Coast in West Africa (Gargadennec & Lalanne, and subsequently in sub- Saharan Africa (Senegal, Ghana, Togo, Benin and Nigeria), the Arabian Peninsula, the Middle East and the Indian subcontinent (Shaila et al., 1996) 2. 1962 – PPRV first isolated in sheep cell culture 3. 1986 - First confirmed outbreak in India in sheep in village Arasur in Villapuram district of Tamil Nadu (Shaila et al., 1989). 4. First reported in North India from HP (1996). 5. Both the field strains were adapted in VERO cell and attenuated vaccines have been developed
  • 4. Can affect some wild ungulates, but there is very limited information on species susceptibility and the occurrence of disease Two severe outbreaks 1.Dorcas gazelles (Gazella dorcas) 2.Thomson's gazelles (Gazella thomsoni) in Saudi Arabia in 2002. Affected Buffalo in India in 1995. White-tailed deer (Odocoileus virginianus) infected experimentally. Captive Nubian ibex, Laristan sheep and gemsbok wild ruminants may be important in the epidemiology of this disease but exact role is unknown. Though Sheep and Goat are the main host but? Species affected :-  Sheep & Goat – primarily  Cattle & Buffalo  Wild ungulates ( Gazelles, White tailed deer )
  • 5. Symptomology Acute, contagious viral disease of small ruminants Mucopurulent nasal & ocular discharge Necrotising & Erosive stomatitis Enteritis Pneumonia Signs (Khan et al., 2007) 1. The severity of disease depends on Animal’s immunity to PPRV and animal breed/ strain. 2. Peracute cases can be seen when PPR first occurs in naïve populations of sheep or goats. In this form, the clinical signs are generally limited to high fever, severe depression and death 3. In acute cases: Initial signs include a sudden high fever, inappetence, marked depression and somnolence. 4. Serous nasal and ocular discharges appear soon after the onset of disease. Matting is common around the eyes and the nose may become obstructed. 5. Within a few days of the onset of fever, the gums become hyperaemic, and small, gray, necrotic foci, covering shallow erosions, begin to appear in the mouth. Lesions are most common on the lips and gums, but they can also be found on the dental pad, palate, cheeks and their papillae, and tongue. 6. In severe cases, the mouth may be completely covered in thick cheesy material. 7. The oral lesions are painful, and animals may resist opening their mouths
  • 6. 1. Necrotic lesions in nasal cavity, vulva and vagina. 2. Most animals develop profuse diarrhoea- blood-stained, and sometimes contain shreds of tissue. 3. Rapid respiration is common, and dyspnoea, coughing and other signs of pneumonia may be seen. 4. Abortion. 5. Sub-acute disease lasts for 10-15 days with variable signs including respiratory signs. 6. Deer may show disease similar to sheep and goats, but subclinical infections have also been reported. 7. PPR is highly contagious when it first occurs in a naïve population. 8. Periodic outbreaks may also be seen in endemic regions. 9. The morbidity and mortality rates can reach 100%, particularly in naïve herds but lower in endemic areas, as low as 20%. 10.High case fatality rates have been reported when PPRV affects exotic ungulates. 11.In an outbreak among buffalo in India, the case fatality rate was 96%. 12.In captive gazelles, the morbidity rate was 51% and the case fatality rate was 100%. 13.In a countrywide outbreak among camels in Ethiopia morbidity was ˃ 90% and mortality ranged between 5% to 70%. More Lesions
  • 7. Mode of Transmission Direct contact Respiratory route Oral route Conjunctival Cattle can be infected with PPRV but is unable to transmit the disease to another host (Khan et al., 2008)
  • 8. 1. Close contact. 2. Inhalation is thought to be an important route of spread. 3. PPRV is shed in nasal and ocular secretions, saliva, urine and feces. 4. Probably through milk of affected animals. 5. Animals are not expected to become long-term carriers. However, recent studies reported that viral antigens were shed in the faeces of clinically recovered goats for at least 11 to 12 weeks of recovery. 6. PPRV is relatively fragile in the environment thus long distance aerosol transmission is unlikely; in cool temperatures and in the dark (devoid of sunlight) Virus are shown to spread for approximately 10 meters. 7. Fomites such as water, feed troughs and bedding can probably transmit PPRV for a short time, but do not remain infectious for long periods. Transmission of PPR
  • 9. (Pronab et al., 2002) Four Lineages of Virus • East Africa • Arabia • Southern India • Middle East • Asia • India • West Africa• West Africa Lineage 1 Lineage 2 Lineage 3 Lineage 4
  • 10. Characteristic features of PPR virus Survive at 60° C for 60 minutes Stable at pH 4 - 10 Can be killed by alcohols, ethers, detergents Long survival time in chilled & frozen tissue 1. Virus is very similar to Rinderpest virus, which is inactivated by ultraviolet light and desiccation within four days. 2. Normally survives for very short periods in carcasses. 3. Temperatures above 70°C, as well as pH less than 5.6 or greater than 9.6, inactivate PPRV. 4. PPRV survives for a long time in refrigerated meat and for 5. Several months in salted or frozen meat.
  • 11. EPIDEMIOLOGY  Notifiable disease  Endemic in Africa, Turkey, Middle East and the Indian sub-continent (Banyard et al., 2010)  Economic losses due to PPR have been estimated to be 1,800 million INR annually in India (Singh et al., 2009)  The reported seroprevalence of PPRV in India :- Goats and sheep - 43.56 % (Balamurugan et al., 2011) Cattle and buffalos – 4.58% (Balamurugan et al., 2012)  Solitary report of PPR in Indian Buffalo in Tamil Nadu (Govindarajan et al., 1997)
  • 12. Mortality and Case Fatality Rate More severe in goats than sheep CFR in Goats : 55-85% CFR in Sheep : < 10% Highly fatal in young animals High mortality rates :- 90–100% in naive populations 20% in endemic areas (Roeder & Obi, 1999) Recovered animals have lifetime immunity No carrier state reported. In mixed populations, the serological prevalence rate is higher in sheep than in goats (Singh et al., 2009)
  • 13. Epidemiological determinants Host Agent Environment Species Breed Age Immune status Intercurrent infection PPRV lineage Stress Stocking density Nomadism
  • 14. Steps in PPR geographical distribution
  • 15. (Albina et al., 2013) Map showing the present PPRVdistribution
  • 16. Over all Global PPR situation 2015 (OIE WAHIS & FAO EMPRES)
  • 17. INTRODUCTION OF PPR VACCINE & Spread of Disease Year Outbreaks Diseased animals Animal vaccinated 1998-1999 5 85 Work initiated and vaccine developed1999-2000 6 699 2000-2001 15 1,242 2001-2002 0 0 2002-2003 148 7,293 196,218 2003-2004 70 1,620 859,346 2004-2005 184 4,370 1,612,692 2005-2006 169 3,448 3,480,409 2006-2007 27 683 4,621,871
  • 18. Trend of reduction of PPR outbreaks in Andhra Pradesh (a), Karnataka (b) and whole of India (c) from 2005-2012 based on reports from Gov. of India to OIE. (Singh & Bandyopadhyay, 2015)
  • 19. In early years of Vaccinations: Trends of outbreaks following PPR immunization changed 0 200 400 600 800 1000 1200 numberofoutbreaks 2002 2003 2005 year PPR outbreaks yearwise Series1
  • 20. Alignment Report of PPR Virus outbreaks and Vaccine strain AT CGCCT CGCAGGCT GGGGACGAAAGAACCGCXAGAGGGACT GGGCCT CGACAGGCGCAGGT CT CCT T CCT CCAGCACAAMajority 10 20 30 40 50 60 70 80 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80sungri 96.seq . . . . . . . . A. . . A. . . . . . . - - . . C. . . . . . T - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - 72AR 87.seq . . . . . . . . A. . . A. . . . . . . T . . . C. . . . . . T T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . 80DQ176753.1 PPRV TNLK 04 2.seq . . . . . . . . A. . . A. . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80DQ176754.1 PPRV TNVero 04 3.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80DQ176755.1 PPRV Ind TNSw ab 04 3.seq . . . . . . . . A. . . A. . . . . . . T . . . C. . . . . . T T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . 80DQ176756.1 PPRV Ind TNLK 04 3.seq - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . T . . A. . . . . . - . . . . . . . 29EF641263.1 PPRV Ind Mukthesw ar 07 Cattl . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80FJ750559.1 PPRV Revati UP05.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80FJ750560.1 PPRV Bhopal 03.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80GU014574.1 PPRV Revati UP 06.seq AACAGGAGAGGGAGAGT CGT CCGCACCAGCGACCAGAGAAGGGGT CAAGGCT GCGAT CCCAAACGGAT CT GAAGAGAGGGMajority 90 100 110 120 130 140 150 160 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160sungri 96.seq . . . . . A- - - . . . . . . . . . . C. T A. . . . . . . . . . . . . . . . . . AA. . . . . A. . . . . . . . . . . . . . T . . G. . C. . . . GA. . . . 149AR 87.seq . . . . . AT . . . . . . . . . . . . C. T A. . . . . . . . . . . . . . . . . . AA. . . . . A. . . . . . . . . . . . . . T . . G. . C. . . . GA. . . . 160DQ176753.1 PPRV TNLK 04 2.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . G. . . . . . . . . . G. . . . . . . . 160DQ176754.1 PPRV TNVero 04 3.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . G. . . . . . . . . . G. . . . . . . . 160DQ176755.1 PPRV Ind TNSw ab 04 3.seq . . . . . AT . . . . . . . . . . . . C. T A. . . . . . . . . . . . . . . . . . AA. . . . . A. . . . . . . . . . . . . . T . . G. . C. . . . GA. . . . 160DQ176756.1 PPRV Ind TNLK 04 3.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109EF641263.1 PPRV Ind Mukthesw ar 07 Cattl . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160FJ750559.1 PPRV Revati UP05.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160FJ750560.1 PPRV Bhopal 03.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160GU014574.1 PPRV Revati UP 06.seq ACAGAAAGCAAACACGCCCAGGAAGGCCCAXXXXXXXXXXXMajority 170 180 190 200 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190sungri 96.seq . . . C. . . . . G. . . . . . . T . . . . . . A. . . . . GAGGAGAAACT 190AR 87.seq . . . C. . . . . G. . . . . . . T . . . . . . A. . . . . 190DQ176753.1 PPRV TNLK 04 2.seq . . . . . . . . . . . . . . . . . A. . . A. . . . . T . . 190DQ176754.1 PPRV TNVero 04 3.seq . . . . . . . . . . . . . . . . . A. . . A. . . . . T . . 190DQ176755.1 PPRV Ind TNSw ab 04 3.seq . . . C. . . . . G. . . . . . . T . . . . . . A. . . . . 190DQ176756.1 PPRV Ind TNLK 04 3.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139EF641263.1 PPRV Ind Mukthesw ar 07 Cattl . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190FJ750559.1 PPRV Revati UP05.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190FJ750560.1 PPRV Bhopal 03.seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190GU014574.1 PPRV Revati UP 06.seq Decoration 'Decoration #1': Hide (as '.') residues that match the Consensus exactly.
  • 21. Alignment Report of PPR Virus outbreaks and Vaccine strain PercentIdentity 1 2 3 4 5 6 7 8 9 10 1 88.3 86.8 94.7 95.8 86.8 98.6 99.5 99.5 99.5 1 sungri96.seq 2 13.2 100.0 87.2 86.0 100.0 85.7 88.8 88.8 88.8 2 AR87.seq 3 15.0 0.0 86.3 85.3 100.0 84.9 87.4 87.4 87.4 3 DQ176753.1 PPRVTNLK 042.seq 4 5.5 14.6 15.6 98.9 86.3 93.5 95.3 95.3 95.3 4 DQ176754.1 PPRVTNVero04 3.seq 5 4.4 16.1 17.1 1.1 85.3 93.5 96.3 96.3 96.3 5 DQ176755.1 PPRVIndTNSwab04 3.seq 6 15.0 0.0 0.0 15.6 17.1 84.9 87.4 87.4 87.4 6 DQ176756.1 PPRVIndTNLK 043.seq 7 1.5 16.5 17.6 6.8 6.8 17.6 97.8 97.8 97.8 7 EF641263.1 PPRVInd Muktheswar07 Cattl 8 0.5 12.5 14.3 5.0 3.8 14.3 2.2 100.0 100.0 8 FJ750559.1 PPRVRevati UP05.seq 9 0.5 12.5 14.3 5.0 3.8 14.3 2.2 0.0 100.0 9 FJ750560.1 PPRVBhopal 03.seq 10 0.5 12.5 14.3 5.0 3.8 14.3 2.2 0.0 0.0 10 GU014574.1 PPRVRevati UP 06.seq 1 2 3 4 5 6 7 8 9 10
  • 22. Recovered animals have lifetime immunity and no carrier state reported. 1. Prior to the development of the PPR vaccine the RP vaccine was used for PPR. 2. In the RP Eradication programme too the RP vaccine was used for small animals (only in intensive rearing areas) and thus there was herd immunity in the animals for the PPR in sheep and Goats and PPR outbreaks were not reported in the country 3. With the introduction of the PPR vaccine in field trial and later intensive immunization , there was surge in the outbreaks of PPR in country Is spread of PPR outbreaks an outcome of wrong Policies?
  • 23. PPR outbreak in Sheep & Goat at I.V.R.I. Izzatnagar 1994 (Kumar et al., 1999) Percentage%
  • 24. 33 9.4 0 5 10 15 20 25 30 35 Goat Sheep Morbidity rate (%) 9.4 0 2 4 6 8 10 Goat Sheep Case fatality rate (%) Percentage% ( Nanda et al., 1996) Isolation of PPR Virus from Northern India - 1996 (96/291) (8/85) CFR% Species Species
  • 25. PPR among Gaddi sheep & goat in Himachal Pradesh- 1996 82.89 64.61 57.91 53.4 26.66 17.08 63.37 41.26 29.49 0 10 20 30 40 50 60 70 80 90 Flock 1 Flock 2 Flock 3 Morbidity rate Mortality rate Case fatality rate (Joshi et al., 1996) Rate (N= 208) (N= 390) (N= 480)
  • 26. Occurrence of PPR in Andhra Pradesh 1995-97 Period Outbreaks (N) Sera sample Tissue sample Number Positive Number Positive 1995 2 7 4 --- --- 1996 14 91 72 --- --- 1997 60 93 61 45 43 (Rao et al., 1998)
  • 27. Occurrence of PPR in small ruminants in Uttar Pradesh-1998 (Shankar et al., 1998) Rate District 0 10 20 30 40 50 Etawah Mathura 19.3 29.3 48.9 40.5 Attack rate Case fatality rate
  • 28. PPR outbreak in goats – CIRG Makhdoom (UP) 2000 Rate (Kumar et al., 2001) (4/45) (1/45) (20/30) (3/30)
  • 29. Animal affected Adult Young ones Flock size Affected Died Flock size Affected Died Goat 501 286 161 426 420 317 Sheep 100 25 8 32 28 25 Occurrence of PPR in Punjab-2002 (Dhand et al., 2002)
  • 30. Prevalence of antibodies to PPRV in sheep and goat in India 1998-2003 State Sheep serum Goat serum Jammu & Kashmir 11/27 (40.7%) 8/21 (38.1%) Himachal Pradesh 15/97 (15.5%) 34/84 (40.5%) Uttarakhand 12/44 (27.3%) 128/630 (20.3%) Uttar Pradesh 87/244 (35.7%) 252/1017 (24.8%) Chhattisgarh ------- 45/102 (44.1%) Maharashtra 216/428 (50.4%) 388/536 (72.4%) Andhra Pradesh 114/278 (41.1%) 20/56 (35.7%) (Singh et al., 2004)
  • 31. Prevalence of PPRV in small ruminants in India 1998-2003 (Singh et al., 2004)
  • 32. Temporal distribution of PPR in Andhra Pradesh 1998-2004Proportionofoutbreak (Rajasekhar, 2005) Month
  • 33. PPR among sheep & goat in Tamil Nadu 2006 Age wise mortality in Sheep & Goat 0 5 10 15 20 25 30 35 40 45 50 Lambs/Kids Young Adult 5.13 49.48 7.88 15.56 26.79 5.32 Sheep Goat (Soundararajan et al., 2006) Percentage%
  • 34. 0 5 10 15 20 25 30 35 2001-02 2002-03 2003-04 2004-05 2005-06 9 23 35 14 28 No. of Outbreaks Status of PPR outbreak in Maharashtra 2001-06 Surveillance Report (2007), Western Regional Disease Investigation Section, Pune, Maharashtra No.ofoutbreaks Year
  • 35. 30 55.33 27.8 42.76 0 10 20 30 40 50 60 Delhi Haryana Sheep Goat Prevalence% Prevalence of PPR antibodies in Sheep & Goat in Delhi & Haryana- 2006 (Singh et al., 2006) (3/10) (52/187) (192/347) (65/152)
  • 36. Species Adult Kids/ Lambs Total animals Morbidity (%) Mortality (%) CFR (%) Total animals Morbidity (%) Mortality (%) CFR(%) Goat 225 14.7 4.4 30.3 208 56.7 49 86.4 Sheep 158 1.3 0.6 50.0 54 16.7 13.0 77.8 PPR outbreaks in sheep and goats in Ludhiana Punjab - 2007 (Sharma et al., 2007)
  • 37. PPR outbreaks in Karnataka, April 1998 - March 2007 (Hegde et al., 2009) 5 6 15 0 148 70 184 169 27 0 20 40 60 80 100 120 140 160 180 200 Outbreaks Outbreaks Noofoutbreaks Year
  • 38. 0 10 20 30 40 50 60 Sheep Goat 52.99 51.47 13.5 8.53 Incidence Rate Mortality Rate PPR in sheep and goats: Pune, Maharashtra-2009 (Thombarea & Sinha, 2009) Rate Species
  • 39. Seroprevalence of PPR in sheep and goats in India (2003-2009) (Balamurugan et al., 2011) Year Sheep Goat Tested Positive Prevalence (%) Tested Positive Prevalence (%) 2003-04 567 169 31.47 456 187 43.77 2004-05 253 112 47.35 484 166 36.40 2005-06 580 323 59.90 610 334 58.87 2006-07 292 114 41.61 630 276 46.85 2007-08 256 101 42.06 184 87 50.66 2008-09 249 82 34.90 323 189 63
  • 40. Map showing the seroprevalence of PPR from 2003 to 2009 by state in India (Balamurugan et al., 2011) (a) Sheep (b) Goats
  • 41. Isolation of PPRV from Bhopal 2010 0 10 20 30 40 50 60 70 80 90 Morbidity (%) Mortality (%) Case fatality rate (%) 28.7 24.7 86 22 14 64 Bhadus, Bhopal (n=251 goats) Joulkheda, Bhopal (n=198 goats & n= 30 sheep) (Balamurugan et al., 2010) Percentage%
  • 42. PPR in Himachal Pradesh during 2003-2012 Year No. of outbreaks No. of deaths/ affected 2003-04 102 967/11018 2004-05 13 875/2885 2005-06 5 54/131 2006-07 10 509/3291 2007-08 7 777/4280 2010-11 4 167/968 2011-12 7 738/1461 (Disease surveillance report Himachal Pradesh)
  • 43. PPR in goats in Madhya Pradesh-2013 (Awase et al., 2013) (Rate%) 13.1 5.1 5.2 1.6 0 2 4 6 8 10 12 14 Indore Barwani Incidence rate Mortality rate (58/442) (23/442) (28/551) (9/551)
  • 44. Incidence of PPR in nomadic sheep & goat of Jammu-2013 (Mahajan et al., 2013)
  • 45. Detection of PPR virus antigen in Sheep and goat in Andhra Pradesh-2015 Prevalence of PPR virus antigen in tissues Prevalence of PPR virus antigen in nasal swabs Species Sheep Goat Tissue tested 39 18 Positivity (%) 19 (48.7) 9 (50) Species Sheep Goat Swab tested 72 66 Positivity (%) 18 (25) 20 (30.3) (Saritha et al., 2015)
  • 46. Incidence of PPR in India 2009-14 (Annual Reports, DAHD) 165 184 300 197 122 82 0 50 100 150 200 250 300 350 2009 2010 2011 2012 2013 2014 No. Of Outbreaks Year No.ofoutbreaks
  • 47. PPR disease outbreaks in different states of India 2011- 2015 0 5 10 15 12 8 7 4 3 No of outbreaks (Monthly Report, Deptt. Of Epidemiology) No.ofoutbreaks
  • 48. Distribution of PPR outbreaks in India 2005–2013 (Singh & Bandyopadhyay, 2015)
  • 49. Year State Species affected Outbreak / Seroprevalence Reference 1998 Andhra Pradesh Sheep Morbidity- 30.56% Mortality – 13.2% CFR – 43.2% Sreeramulu, 2000 1999 Dehradun & Etawah Sheep & Goat Mortality – 15-20% Singh et al., 1999 1999 West Bengal Sheep & Goat Morbidity- 18% Mortality- 35.3% Jana & Ghosh, 2002 1999 Himachal Pradesh Sheep & Goat (n=5205) Morbidity- 25.84% Mortality – 3.43% Katoch et al., 1999 Some PPR outbreaks in India
  • 50. Year State Species affected Outbreak / Seroprevalence Reference 2000 Himachal Pradesh Sheep Goat Morbidity- 11.7% Mortality – 4.1% Morbidity – 30.3% Mortality – 20.8% Jithendran et al., 2000 2001 Andhra Pradesh Sheep (n= 505) Morbidity – 16% Mortality – 25% Rao et al., 2001 2001 Gujarat Sheep Goat Buffaloes Seroprevalence- 55.29% Seroprevalence- 100% Seroprevalence- 4.76% Hinsu et al., 2001 2001 IVRI Izzatnagar U.P. Sheep Goat Mortality – 44.4% Mortality – 64.7% Kumar et al., 2001 Some PPR outbreaks in India
  • 51. Year State Species affected Outbreak / Seroprevalence Reference 2005 Kerala Sheep (n=166) Goat (n=536) Seroprevalence- 45.78% Seroprevalence – 0.93% Sunilkumar et al., 2005 2008 Chennai, Tamil Nadu Goat ( n=30) Morbidity – 66.7 % Mortality – 16.67 % Narayanan et al., 2008 2009 Maharashtra Goat Seroprevalence- 46.01% Chavan et al., 2009 2012 Rajasthan Goat Morbidity – 120 Mortality - 5 Tanwar, 2013 2012 Gujarat Camel Seroprevalence- 11.33% Chauhan et al., 2012 2014 Gujarat (2 outbreaks) Sheep (n=146) Goat (n=476) Morbidity- 100% Mortality – 73.68% 56.67% Sharma et al., 2015 Some PPR outbreaks in India
  • 52. Through Clinical signs Laboratory tests Immunocapture ELISA (ICE) counter immunoelectrophoresis (CIEP) or agar gel immunodiffusion (AGID) CEIP and ICE can distinguish PPRV from Rinderpest virus but the AGID test cannot differentiate these two viruses. Viral nucleic acids can be detected with RT-PCR or with other forms of PCR- multiplex RT-PCR and a RT-PCR-ELISA Serological tests as virus neutralization and competitive ELISA assays can distinguish PPR from Rinderpest Complement fixation test has also been used. Diagnosis
  • 53. Diagnosis Clinical Signs & Lesions Post mortem findings
  • 54. Differential Diagnosis Differentiation between PPR and a few similar diseases is important for instituting effective control programme. Differentiate it from: Pneumonic Pasteurellosis Rinderpest CCPP in goats Coccidiosis Contagious Ecthyma Helminthosis Heart water
  • 55. Treatment  Early stages of disease – Hyper immune serum  Supportive therapy :- Fluid therapy Antibiotics to prevent secondary infection  Lesions around eyes, nostrils & mouth should be cleaned No specific treatment is recommended
  • 56. Control 1. Not introducing flock from unknown sources. Combination of quarantines, isolation and movement control is required. 2. Immediate isolation of affected goats from clinically healthy goats. 3. Euthanasia of infected and exposed animals is important in eradication. Carcasses are generally buried or burned. 4. Disinfection of infected area. PPRV can be inactivated by many disinfectants including alkalis (sodium carbonate, sodium hydroxide), halogens (sodium hypochlorite), phenolic compounds, citric acid, alcohols and iodophores. 5. Kids & lambs vaccinated at 4-5 months age. 6. Ring vaccination and/or vaccination of high-risk populations can also be helpful. 7. Vaccination susceptible wildlife and captive wild animals such as gazelles. PPR Control Programme (Gov. of India) - 2010
  • 57. a. Sungri 96 : IVRI Mukteshwar (isolate of goat origin) b. Arasur 87 : TNUVAS (isolate of sheep origin) c. Coimbtore 97 : TNUVAS ( isolate of goat origin) (Muthuchelvan et al., 2015) Three live attenuated vaccines developed in India Vaccine Used for mass vaccination
  • 58. Conclusion 1. PPR is endemic in India in sheep & goats. 2. Mainly young stocks are more affected. 3. Disease occurs throughout the year but more common in October & March. 4. Though vaccination is the only method for control & eradication, even the institutes those developed the effective vaccine in India to control the disease fear to use it because many a time outbreaks ensue on vaccination. 5. The other important reason for persistence of disease is undeclared Policy of suppressed reporting of PPR outbreaks.