The document describes a study that used MALDI-TOF MS to identify mycobacterial isolates. It compared two protein extraction protocols (A and B) on reference strains and clinical isolates, finding protocol A identified 92.1% of isolates to the species level compared to 50% for protocol B. Protocol A was then used to identify 27 environmental mycobacterial isolates, with two isolates misidentified by PRA-hsp65 but correctly identified by MALDI-TOF MS. Sequencing of the hsp65 and 16S rRNA genes confirmed the MALDI-TOF MS identifications. The results support the use of MALDI-TOF MS as a rapid and valuable tool for identifying
This document describes the development of a new diagnostic method called ProteAl for the rapid detection of Proteus bacteria. 2-methylbutanal was identified as a volatile organic compound biomarker specifically produced by Proteus. A fluorescent assay was developed using the reagent 5-dimethylaminonaphthalene-1-sulfonylhydrazine to detect 2-methylbutanal. This ProteAl assay could identify Proteus within 7 hours of growth and differentiated it from other common uropathogens. The production of 2-methylbutanal by Proteus was found to be regulated by the isoleucine metabolic pathway. Rational design of growth medium with increased isoleucine enhanced the yield of
detect and identify common human bacterial pathogens in high purity water.Saad Farooqi
A rapid culture independent methodology toquantitatively detect and identify common human bacterial pathogens associated with contaminated high purity water
To form the basis of a respiratory disease model in rats by investigating the microbial distribution and composition in the lower respiratory tracts of normal rats. Methods: DNA was extracted from the intestine, trachea, bronchus and lung samples collected from healthy rats under sterile conditions. The 16S rDNA V4-V5 region was sequenced using Illumina high-throughput technology. Results: The sequencing results showed that there was no significant difference in abundance and species diversity of microbiota between the lower respiratory and the intestine. The microbiota structure analysis showed samples from lungs and intestinal shared similarity. However, the dominant species at the levels of phylum, family, and genus diverged. The similarity analysis showed that the lung microbiota were different from the intestines. The linear discriminant analysis showed significantly different species in different tissues; function prediction also showed different microbiota function in different tissues. Conclusions: These results suggest that bacterial colonization depends on the sample’s anatomical location. The human pathogen Acinetobacter lwoffii was also detected in the rat lower respiratory tract samples.
This document summarizes rapid detection methods for foodborne pathogen bacteria. It discusses how foodborne illnesses are a major public health problem and rapid detection of pathogens is needed. Several detection methods are outlined, including traditional culturing as well as newer techniques like PCR, real-time PCR, LAMP, and immunoassays. LAMP is highlighted as a new method that can rapidly detect pathogens under isothermal conditions. The document concludes that LAMP is a promising technique for pathogen detection due to its speed, simplicity and accuracy.
Johne's disease (JD) or Paratuberculosis (PTB) has gained a great attention by many industrial countries for its severing economic losses and possibly zoonotic concerns. In the current study conventional clinical and direct microscopic examination compared to real time polymerase chain reaction (RT-PCR) were used to diagnose JD in clinically suspected small ruminants. Clinical examination revealed 130 (8.7%) suspected cases that showed history of emaciation and diarrhea out of the total examined (1500) animals. Direct microscopy of Ziehl-Neelsen (ZN) stained smears (130) revealed 62 (47.7%) acid fast bacteria resembled Mycobacterium avium subsp. paratuberculosis (MAP). RT-PCR insertion sequence gene (IS900) detected MAP in 25 (65.8%) out of 38 fecal samples harbored acid fast bacilli. We concluded and recommended that RT-PCR considers the most rapid confirmatory method for screening and diagnosis of the MAP in comparison to low specific conventional phenotypic methods, which still remained valuable techniques in the diagnosis of JD in developing countries.
Key-words: Johne's disease, Paratuberculosis, Acid fast bacteria, Ziehl-Neelsen stain, IS900 gene
This document describes the development of a fluorescence-based assay called "ProteAl" to detect the volatile biomarker 2-methylbutanal produced by Proteus bacteria. Gas chromatography-mass spectrometry and Fourier transform infrared spectroscopy were used to identify 2-methylbutanal in the headspace of Proteus cultures. A fluorescent dye, 5-dimethylaminonaphthalene-1-sulfonylhydrazine, was found to react specifically with 2-methylbutanal, producing a distinct green fluorescence. Testing of 95 bacterial strains showed the ProteAl assay can identify Proteus with 100% specificity and sensitivity, providing a simple method for rapid surveillance of this pathogen.
Jianying Xiao has over 16 years of experience in pharmaceutical research. She has expertise in in vivo and in vitro drug discovery techniques related to drug metabolism, infectious diseases, immunology, and cardio-metabolic disorders. She is proficient in various research techniques including animal handling, molecular biology, cell culture, and data analysis software. Jianying has worked at Merck & Co. for over 18 years, leading numerous projects that resulted in publications, patents, and awards. Her work has advanced drug programs from research through clinical trials.
This document describes the development of a new diagnostic method called ProteAl for the rapid detection of Proteus bacteria. 2-methylbutanal was identified as a volatile organic compound biomarker specifically produced by Proteus. A fluorescent assay was developed using the reagent 5-dimethylaminonaphthalene-1-sulfonylhydrazine to detect 2-methylbutanal. This ProteAl assay could identify Proteus within 7 hours of growth and differentiated it from other common uropathogens. The production of 2-methylbutanal by Proteus was found to be regulated by the isoleucine metabolic pathway. Rational design of growth medium with increased isoleucine enhanced the yield of
detect and identify common human bacterial pathogens in high purity water.Saad Farooqi
A rapid culture independent methodology toquantitatively detect and identify common human bacterial pathogens associated with contaminated high purity water
To form the basis of a respiratory disease model in rats by investigating the microbial distribution and composition in the lower respiratory tracts of normal rats. Methods: DNA was extracted from the intestine, trachea, bronchus and lung samples collected from healthy rats under sterile conditions. The 16S rDNA V4-V5 region was sequenced using Illumina high-throughput technology. Results: The sequencing results showed that there was no significant difference in abundance and species diversity of microbiota between the lower respiratory and the intestine. The microbiota structure analysis showed samples from lungs and intestinal shared similarity. However, the dominant species at the levels of phylum, family, and genus diverged. The similarity analysis showed that the lung microbiota were different from the intestines. The linear discriminant analysis showed significantly different species in different tissues; function prediction also showed different microbiota function in different tissues. Conclusions: These results suggest that bacterial colonization depends on the sample’s anatomical location. The human pathogen Acinetobacter lwoffii was also detected in the rat lower respiratory tract samples.
This document summarizes rapid detection methods for foodborne pathogen bacteria. It discusses how foodborne illnesses are a major public health problem and rapid detection of pathogens is needed. Several detection methods are outlined, including traditional culturing as well as newer techniques like PCR, real-time PCR, LAMP, and immunoassays. LAMP is highlighted as a new method that can rapidly detect pathogens under isothermal conditions. The document concludes that LAMP is a promising technique for pathogen detection due to its speed, simplicity and accuracy.
Johne's disease (JD) or Paratuberculosis (PTB) has gained a great attention by many industrial countries for its severing economic losses and possibly zoonotic concerns. In the current study conventional clinical and direct microscopic examination compared to real time polymerase chain reaction (RT-PCR) were used to diagnose JD in clinically suspected small ruminants. Clinical examination revealed 130 (8.7%) suspected cases that showed history of emaciation and diarrhea out of the total examined (1500) animals. Direct microscopy of Ziehl-Neelsen (ZN) stained smears (130) revealed 62 (47.7%) acid fast bacteria resembled Mycobacterium avium subsp. paratuberculosis (MAP). RT-PCR insertion sequence gene (IS900) detected MAP in 25 (65.8%) out of 38 fecal samples harbored acid fast bacilli. We concluded and recommended that RT-PCR considers the most rapid confirmatory method for screening and diagnosis of the MAP in comparison to low specific conventional phenotypic methods, which still remained valuable techniques in the diagnosis of JD in developing countries.
Key-words: Johne's disease, Paratuberculosis, Acid fast bacteria, Ziehl-Neelsen stain, IS900 gene
This document describes the development of a fluorescence-based assay called "ProteAl" to detect the volatile biomarker 2-methylbutanal produced by Proteus bacteria. Gas chromatography-mass spectrometry and Fourier transform infrared spectroscopy were used to identify 2-methylbutanal in the headspace of Proteus cultures. A fluorescent dye, 5-dimethylaminonaphthalene-1-sulfonylhydrazine, was found to react specifically with 2-methylbutanal, producing a distinct green fluorescence. Testing of 95 bacterial strains showed the ProteAl assay can identify Proteus with 100% specificity and sensitivity, providing a simple method for rapid surveillance of this pathogen.
Jianying Xiao has over 16 years of experience in pharmaceutical research. She has expertise in in vivo and in vitro drug discovery techniques related to drug metabolism, infectious diseases, immunology, and cardio-metabolic disorders. She is proficient in various research techniques including animal handling, molecular biology, cell culture, and data analysis software. Jianying has worked at Merck & Co. for over 18 years, leading numerous projects that resulted in publications, patents, and awards. Her work has advanced drug programs from research through clinical trials.
This document describes the development and validation of a new quantitative PCR (qPCR) assay to estimate total bacterial load in stool samples.
1) The assay targets a conserved region of the 16S rRNA gene using new primers and a probe to generate a shorter amplicon compatible with clinical diagnostics.
2) Testing on 500 liquid and 50 solid stool samples showed the assay accurately measured total bacterial load compared to culture-based methods.
3) The new assay addresses previous issues with non-specific priming and amplification bias, and provides a standardized method for quantifying total bacteria in complex clinical samples.
Assessment of some cardiac biomarkers in adult hivAlexander Decker
This study assessed cardiac biomarkers in 300 adult HIV participants in Nnewi, Nigeria. The participants were grouped as 100 symptomatic HIV subjects on antiretroviral therapy (ART), 100 symptomatic HIV subjects not on ART, and 100 HIV seronegative controls. Blood samples were tested for HIV, CD4+ count, and serum levels of myoglobin, troponin, creatine kinase (CK), CK-MB, lactate dehydrogenase (LDH), and aspartate aminotransferase (AST). The results showed mean myoglobin and troponin levels were significantly higher in symptomatic HIV subjects not on ART compared to asymptomatic subjects. Mean total CK, CK-MB, LDH, and AST were
Paratuberculosis (PTB) remains one of the most obstacles limit animal breeding sector all over the world. The current study aimed to detect the etiology of PTB in tissues of clinically suspected small ruminants using histopathological and real-time polymerase chain reaction (RT-PCR) methods. Clinical examination showed 10 (26.4%) PTB suspected cases out of the total (38) examined animals. The suspected cases were euthanized, necropsied, gross lesions were recorded and tissue samples were collected for histopathological and molecular procedures. Grossly intestinal and mesenteric lymph nodes thickening, corrugations and edematous swellings were recorded. Semi-thin sections of the intestine and mesenteric lymph nodes stained with toluidine blue demonstrated MAP organism inside epithelium cells and macrophages. RT-PCR detected MAP IS900 gene in all suspected cases (100%), thus we recommend using RT-PCR as a rapid sensitive method in the diagnosis of PTB.
Key-words: Paratuberculosis, Mycobacterium, Semi thin sections, Toluidine blue, IS900 gene
Undergraduate Research Conference Poster 2015Kendra Liu
This study developed a method to quantify and detect the physiological state of bacterial and eukaryotic cells using fluorescent dyes and microchip-based flow cytometry on the Agilent 2100 Bioanalyzer System. Salmonella enterica and Madin-Darby Canine Kidney cells were stained with SYTO62 and SYTOX dyes to label live and dead cells, respectively, and counted on the instrument. Cell numbers determined with this method matched counts from traditional plating and microscopy methods. The assay takes 30 minutes to analyze 6 samples and distinguishes live from dead cells rapidly with low sample and reagent use.
Customizable pcr microplate array for differential identification of multiple...Tiensae Teshome
1. Customizable PCR-microplate arrays were developed that allow for the simultaneous identification of 10 foodborne pathogens and biothreat agents using pathogen-specific primers.
2. The arrays were tested using genomic DNA from 38 pathogen strains, and specifically identified all pathogens present.
3. In tests with food matrices, the arrays showed detection limits as low as 9 cfu/g for Salmonella Typhimurium in beef hot dogs and 78 cfu/ml in milk. Such microplate arrays could serve as tools for rapid identification of these pathogens during outbreak investigations or for confirmation purposes.
Gene transfer in the liver using recombinant adeno-associated virusJonathan G. Godwin
This document describes methods for delivering gene transfer vectors to the liver using recombinant adeno-associated virus (rAAV). It discusses that intravenous injection of rAAV serotypes results in efficient transduction of the liver. The document provides protocols for preparing rAAV vector samples and delivering the vectors to mouse liver through lateral tail vein injection, retro-orbital sinus injection, or portal vein injection. It notes that tail vein injection is the most common method but retro-orbital sinus injection can be used as an alternative for young or neonatal mice. Precise vector dosing and injection technique are emphasized for achieving effective liver-directed gene transfer.
Study of Glutathione Peroxidase GPX Activity Among Betel Quid Chewers of Indi...ijtsrd
"Introduction Betel quid BQ chewing, a habit practiced in Eastern and North Eastern part of India, has known to be associated with cancer of the oral or buccal cavity. BQ is also one of the common mood elevating substances among Indian population. The BQ is a mixture of areca nut Areca catechu , catechu Acacia catechu and slaked lime calcium oxide and calcium hydroxide wrapped in a betel leaf Piper betel .BQ products have been classified by the International Agency for Research on Cancer IARC as group I human carcinogens . Glutathione peroxidise GPx , one of the major enzymatic antioxidant defence system, responsible for scavenging free radicals. Antioxidant enzymes catalyze decomposition of ROS. Overall balance between production and removal of ROS may be more important in various cancers including OSCC Oral squamous cell carcinoma or oral cancer. Methods In this study subjects were screened from Department of Oral and Maxillofacial surgery andE.N.T. of Ramakrishna Mission Seva Pratishthan Hospital RKMSP , Kolkata and different areas of West Bengal and North Eastern states of India. Quantitative in vitro determination of glutathione peroxidase activities in whole blood were estimated manually with 0.05 ml whole blood. The samples were assayed by UV Visible Spectrophotometer SPECORD 50 PLUS at a wavelength of 340nm. Results Most of the subjects had betel quid chewing habit. Glutathione peroxidase values are higher in healthy control than Cancer cases and Pre cancer with betel quid chewing habit, which is statistically significant. Conclusion Reactive oxygen species are generated due to slaked lime, one of the important constituents of betel quid which can modulate the oral pathology and promote carcinogenesis. Aniket Adhikari | Madhusnata De ""Study of Glutathione Peroxidase (GPX) Activity Among Betel Quid Chewers of Indian Population"" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-3 , April 2019, URL: https://www.ijtsrd.com/papers/ijtsrd21619.pdf
Paper URL: https://www.ijtsrd.com/biological-science/biochemistry/21619/study-of-glutathione-peroxidase-gpx-activity-among-betel-quid-chewers-of-indian-population/aniket-adhikari"
Real time pcr assay for rapid detection and quantification of campylobacter j...Tiensae Teshome
The document describes the development of a real-time PCR (rtPCR) assay for rapid detection and quantification of Campylobacter jejuni on chicken rinses from poultry processing plants without an enrichment step. Eighty-four chicken rinse samples were collected from three processing plants and tested using both rtPCR and culture methods. Sixty-five samples were positive by rtPCR while 27 were positive by culture, with 27 samples positive by both methods. The rtPCR assay was able to detect C. jejuni with a limit of 1 CFU and provide results within 90 minutes, significantly faster than the 5-7 days required for culture.
Seshu K. Gudlavalleti has over 20 years of experience in vaccine development and microbial biochemistry. He received his PhD from Jawaharlal Nehru University and has held positions at the FDA, Emory University, and currently works as Chief Scientist at JN Medical Corporation developing meningococcal conjugate vaccines. He has authored over 15 publications and holds one US patent related to his work developing vaccines and characterizing microbial proteins and polysaccharides.
Comparative analysis between monophasic and biphasic methods of blood cultureAlexander Decker
This study compared the efficacy of biphasic blood culture bottles (BiPB) to conventional monophasic blood culture bottles (MPB) for isolating bacteria from blood cultures. 120 blood cultures were analyzed using each bottle type. The BiPB allowed for more rapid recovery of certain bacteria like E. coli, Staphylococcus, Klebsiella, Salmonella, and Proteus. The MPB isolated Pseudomonas and Enterococcus more readily. Overall, bacteria were recovered at a slightly higher but not statistically significant rate from the BiPB. Both bottle types are useful, but an anaerobic bottle should also be used for optimal recovery of all bacteria.
Colletotrichum causes anthracnose in crops around the world producing postharvest losses up to 60%. There are a great variety of Colletotrichum strains isolated from mango orchards. Thus, it is important to characterize their pathogenicity, as well as to perform a correct identification, in order to implement good strategies to eradicate the produced disease. The aim of this work is to identify Colletotrichum spp. and to determine the production of Pectate Lyase (PL) as a virulence factor in the pathogenicity process. Macroscopic characteristics of isolated colony vary from grey to salmon, sometimes showing luxuriant orange conidial masses with grey or white bottom. Conidia vary from 10.39 to 14.83 × 2.75 to 3.40 μm corresponding to C. gloeosporioides or C. acutatum according to Sutton. Growth rates vary from 0.1948 to 0.2239 day-1. The pectate lyase activity was induced by mango cells (240.81 VS 398U/L). According to CgInt and ITS4 PCR amplification M2V and SA correspond to C. gloeosporioides.
This document describes the isolation and characterization of a new giant virus called Cedratvirus. Key points:
- Cedratvirus was isolated from an environmental sample in Algeria using Acanthamoeba castellanii.
- It has an ovoid shape with a cork structure at each end, resembling Pithovirus sibericum but with a unique double cork feature.
- The 589kb genome is most closely related to the pithovirus genomes, sharing over 100 genes, but with only 21% of genes involved in best reciprocal hits, indicating genetic distance from known pithoviruses.
The Pesticides Peer Review evaluated the toxicological properties of glyphosate. They concluded glyphosate is unlikely to be genotoxic or carcinogenic based on animal and human studies. Some studies reported increased tumors in rats and mice, but the peer review determined these were not toxicologically relevant. Regarding developmental toxicity in rabbits, some studies reported effects like cardiac malformations, but these occurred at maternally toxic doses. The majority view was glyphosate does not require classification for developmental toxicity. The peer review set the acceptable daily intake and reference dose for glyphosate based on developmental toxicity observed in rabbits.
Wendy Cladman is a skilled laboratory professional with over 25 years of experience conducting experiments and managing laboratories. She has expertise in areas such as biochemical assays, cell culture, protein purification, and molecular biology techniques. Her career includes positions at several universities where she designed experiments, analyzed data, and contributed to publications in the fields of neuroscience, pharmacology, food science, and microbiology. She maintains a wide variety of technical skills and has experience training personnel.
Wendy Cladman is a skilled laboratory professional with over 25 years of experience conducting research in academic and industrial laboratories. She has expertise in areas such as experimental design, laboratory management, protein purification, molecular biology techniques, and data analysis. Her career includes positions at several universities where she designed experiments, analyzed results, and contributed to multiple publications in peer-reviewed journals. She possesses a wide range of technical skills applicable to research.
This document summarizes a study that evaluated the use of the Line Probe Assay (LPA) for rapid detection of Multi Drug Resistant Tuberculosis (MDR-TB) in Sudan. 300 smear-positive sputum samples were collected from TB patients and tested using LPA, culture-based drug susceptibility testing (DST), and conventional laboratory methods. Results found a high prevalence of MDR-TB in Sudan of 38% by DST and 37.3% by LPA. Comparison of LPA and DST results showed high accuracy of LPA for rapid detection of rifampin and isoniazid resistance with a sensitivity of 98.3% and specificity of 100%. LPA provided results within 2
Prevalence of Rota Virus Detection by Reverse TranscriptasePolymerase Chain R...IOSRJPBS
The present study was conducted for the period from 1/6/2016 to 20/1/2017 in Baquba city. The study aimed to detection of rotavirus in stool specimens of children fewer than five age and also explore the effects of certain demographic factors on the detection rates by revers transcriptase- polymerase chain reaction. The study included 49 patients with acute diarrhea, 32 were male and 17 were female. The age range was two months to 5 years. Demographic information on the patients regarding age, sex, residence, type of feeding and source of drinking water were collected from their parents. Stool specimens were collected from each patients and. Detection of rotavirus in stool specimens was done by conventional reverse transcriptase polymerase chain reaction (RT-PCR). The results of present study showed that the overall infection rate by rotavirus among patients with acute diarrhea by RT-PCR tests was 93.88%. The highest infection rate was recorded among those >10-≤15 months of age. None of the results showed significantly difference between female and male, PCR (88% vs 96.87%). Likewise, there was insignificantly difference between urban and rural residence, PCR (95.65% vs 92.30%). The results revealed insignificantly higher infection rate among patients (those below 2 years) feed mixing (91.66%) and bottled (100%) compared to that breast feeding (77.77%) by RT-PCR. The rotavirus infection rate was insignificantly higher among patients consuming municipal water for drinking (97.22%) compared to those consuming bottled water (84.61%) by the RT-PCR. The study concluded that rotavirus was detected in high rates among children less than 5 years old with acute diarrhea in Baquba city, particularly those less than 2 year old.
This document describes a new method for detecting Staphylococcus bacteria using a specific volatile organic compound (VOC) produced by Staphylococcus called 2-[3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl] propanoic acid (ATMAP). A simple colorimetric assay using methyl red as a pH indicator can specifically detect Staphylococcus by changing color from yellow to orange due to ATMAP production. The assay was tested on liquid cultures and plate cultures to detect various Staphylococcus and other bacterial strains, demonstrating 100% specificity and sensitivity. This new detection method could provide a low-cost and easy-to-use
DIAGNOSTIC ADVANCES IN HAEMOPROTOZOAN INFECTIONS OF LIVESTOCKrinkusarawade
The document discusses diagnostic advances for haemoprotozoan infections in livestock. It covers conventional parasitological diagnosis using blood smears as well as molecular diagnosis techniques like PCR, LAMP, and probes. Immunological diagnosis methods such as ELISA, IFAT, CATT, ICT are also summarized. Molecular tools allow specific and sensitive detection of parasites while serological assays are suitable for chronic infections when parasitemia is low. Advanced diagnostics combined with effective treatment can help control haemoprotozoan infections and drug resistance.
This study analyzed diagnostic records from the Taiwan National Laboratory Animal Center from 2004 to 2007 to assess the health status of rodent colonies in Taiwan. The key findings were:
1) Demand for pathogen diagnostic services increased steadily each year over the study period, indicating growing awareness of animal health issues.
2) Many mouse colonies tested positive for pathogens such as mouse parvovirus, mouse hepatitis virus, Theiler murine encephalomyelitis virus, and Mycoplasma pulmonis.
3) Nearly 40% of rat colonies tested positive for Mycoplasma pulmonis and rat parvovirus, and some also contained viruses like Kilham rat virus or intestinal parasites.
4
EU: Men's Or Boys' Clothing (Knitted Or Crocheted) - Market Report. Analysis ...IndexBox Marketing
IndexBox Marketing has just published its report: "EU: Men's Or Boys' Clothing (Knitted Or Crocheted) - Market Report. Analysis and Forecast to 2020". This report has been designed to provide a detailed analysis of the EU men's or boys' clothing market. It covers the most recent data sets of quantitative medium-term projections, as well as developments in production, trade, consumption and prices. The report also includes a comparative analysis of the leading consuming countries, revealing opportunities opened for producers and exporters across the globe. The forecast outlines market prospects to 2020.
El documento habla sobre el PLE (Personal Learning Environment) y cómo puede ser útil en el entorno educativo y la vida profesional. Menciona ejemplos de currículum 3.0 y cómo emprender como PLE. Finalmente anima a seguir aprendiendo de forma personalizada a través del PLE e identifica algunos usuarios de Twitter que comparten información sobre este tema.
This document describes the development and validation of a new quantitative PCR (qPCR) assay to estimate total bacterial load in stool samples.
1) The assay targets a conserved region of the 16S rRNA gene using new primers and a probe to generate a shorter amplicon compatible with clinical diagnostics.
2) Testing on 500 liquid and 50 solid stool samples showed the assay accurately measured total bacterial load compared to culture-based methods.
3) The new assay addresses previous issues with non-specific priming and amplification bias, and provides a standardized method for quantifying total bacteria in complex clinical samples.
Assessment of some cardiac biomarkers in adult hivAlexander Decker
This study assessed cardiac biomarkers in 300 adult HIV participants in Nnewi, Nigeria. The participants were grouped as 100 symptomatic HIV subjects on antiretroviral therapy (ART), 100 symptomatic HIV subjects not on ART, and 100 HIV seronegative controls. Blood samples were tested for HIV, CD4+ count, and serum levels of myoglobin, troponin, creatine kinase (CK), CK-MB, lactate dehydrogenase (LDH), and aspartate aminotransferase (AST). The results showed mean myoglobin and troponin levels were significantly higher in symptomatic HIV subjects not on ART compared to asymptomatic subjects. Mean total CK, CK-MB, LDH, and AST were
Paratuberculosis (PTB) remains one of the most obstacles limit animal breeding sector all over the world. The current study aimed to detect the etiology of PTB in tissues of clinically suspected small ruminants using histopathological and real-time polymerase chain reaction (RT-PCR) methods. Clinical examination showed 10 (26.4%) PTB suspected cases out of the total (38) examined animals. The suspected cases were euthanized, necropsied, gross lesions were recorded and tissue samples were collected for histopathological and molecular procedures. Grossly intestinal and mesenteric lymph nodes thickening, corrugations and edematous swellings were recorded. Semi-thin sections of the intestine and mesenteric lymph nodes stained with toluidine blue demonstrated MAP organism inside epithelium cells and macrophages. RT-PCR detected MAP IS900 gene in all suspected cases (100%), thus we recommend using RT-PCR as a rapid sensitive method in the diagnosis of PTB.
Key-words: Paratuberculosis, Mycobacterium, Semi thin sections, Toluidine blue, IS900 gene
Undergraduate Research Conference Poster 2015Kendra Liu
This study developed a method to quantify and detect the physiological state of bacterial and eukaryotic cells using fluorescent dyes and microchip-based flow cytometry on the Agilent 2100 Bioanalyzer System. Salmonella enterica and Madin-Darby Canine Kidney cells were stained with SYTO62 and SYTOX dyes to label live and dead cells, respectively, and counted on the instrument. Cell numbers determined with this method matched counts from traditional plating and microscopy methods. The assay takes 30 minutes to analyze 6 samples and distinguishes live from dead cells rapidly with low sample and reagent use.
Customizable pcr microplate array for differential identification of multiple...Tiensae Teshome
1. Customizable PCR-microplate arrays were developed that allow for the simultaneous identification of 10 foodborne pathogens and biothreat agents using pathogen-specific primers.
2. The arrays were tested using genomic DNA from 38 pathogen strains, and specifically identified all pathogens present.
3. In tests with food matrices, the arrays showed detection limits as low as 9 cfu/g for Salmonella Typhimurium in beef hot dogs and 78 cfu/ml in milk. Such microplate arrays could serve as tools for rapid identification of these pathogens during outbreak investigations or for confirmation purposes.
Gene transfer in the liver using recombinant adeno-associated virusJonathan G. Godwin
This document describes methods for delivering gene transfer vectors to the liver using recombinant adeno-associated virus (rAAV). It discusses that intravenous injection of rAAV serotypes results in efficient transduction of the liver. The document provides protocols for preparing rAAV vector samples and delivering the vectors to mouse liver through lateral tail vein injection, retro-orbital sinus injection, or portal vein injection. It notes that tail vein injection is the most common method but retro-orbital sinus injection can be used as an alternative for young or neonatal mice. Precise vector dosing and injection technique are emphasized for achieving effective liver-directed gene transfer.
Study of Glutathione Peroxidase GPX Activity Among Betel Quid Chewers of Indi...ijtsrd
"Introduction Betel quid BQ chewing, a habit practiced in Eastern and North Eastern part of India, has known to be associated with cancer of the oral or buccal cavity. BQ is also one of the common mood elevating substances among Indian population. The BQ is a mixture of areca nut Areca catechu , catechu Acacia catechu and slaked lime calcium oxide and calcium hydroxide wrapped in a betel leaf Piper betel .BQ products have been classified by the International Agency for Research on Cancer IARC as group I human carcinogens . Glutathione peroxidise GPx , one of the major enzymatic antioxidant defence system, responsible for scavenging free radicals. Antioxidant enzymes catalyze decomposition of ROS. Overall balance between production and removal of ROS may be more important in various cancers including OSCC Oral squamous cell carcinoma or oral cancer. Methods In this study subjects were screened from Department of Oral and Maxillofacial surgery andE.N.T. of Ramakrishna Mission Seva Pratishthan Hospital RKMSP , Kolkata and different areas of West Bengal and North Eastern states of India. Quantitative in vitro determination of glutathione peroxidase activities in whole blood were estimated manually with 0.05 ml whole blood. The samples were assayed by UV Visible Spectrophotometer SPECORD 50 PLUS at a wavelength of 340nm. Results Most of the subjects had betel quid chewing habit. Glutathione peroxidase values are higher in healthy control than Cancer cases and Pre cancer with betel quid chewing habit, which is statistically significant. Conclusion Reactive oxygen species are generated due to slaked lime, one of the important constituents of betel quid which can modulate the oral pathology and promote carcinogenesis. Aniket Adhikari | Madhusnata De ""Study of Glutathione Peroxidase (GPX) Activity Among Betel Quid Chewers of Indian Population"" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-3 | Issue-3 , April 2019, URL: https://www.ijtsrd.com/papers/ijtsrd21619.pdf
Paper URL: https://www.ijtsrd.com/biological-science/biochemistry/21619/study-of-glutathione-peroxidase-gpx-activity-among-betel-quid-chewers-of-indian-population/aniket-adhikari"
Real time pcr assay for rapid detection and quantification of campylobacter j...Tiensae Teshome
The document describes the development of a real-time PCR (rtPCR) assay for rapid detection and quantification of Campylobacter jejuni on chicken rinses from poultry processing plants without an enrichment step. Eighty-four chicken rinse samples were collected from three processing plants and tested using both rtPCR and culture methods. Sixty-five samples were positive by rtPCR while 27 were positive by culture, with 27 samples positive by both methods. The rtPCR assay was able to detect C. jejuni with a limit of 1 CFU and provide results within 90 minutes, significantly faster than the 5-7 days required for culture.
Seshu K. Gudlavalleti has over 20 years of experience in vaccine development and microbial biochemistry. He received his PhD from Jawaharlal Nehru University and has held positions at the FDA, Emory University, and currently works as Chief Scientist at JN Medical Corporation developing meningococcal conjugate vaccines. He has authored over 15 publications and holds one US patent related to his work developing vaccines and characterizing microbial proteins and polysaccharides.
Comparative analysis between monophasic and biphasic methods of blood cultureAlexander Decker
This study compared the efficacy of biphasic blood culture bottles (BiPB) to conventional monophasic blood culture bottles (MPB) for isolating bacteria from blood cultures. 120 blood cultures were analyzed using each bottle type. The BiPB allowed for more rapid recovery of certain bacteria like E. coli, Staphylococcus, Klebsiella, Salmonella, and Proteus. The MPB isolated Pseudomonas and Enterococcus more readily. Overall, bacteria were recovered at a slightly higher but not statistically significant rate from the BiPB. Both bottle types are useful, but an anaerobic bottle should also be used for optimal recovery of all bacteria.
Colletotrichum causes anthracnose in crops around the world producing postharvest losses up to 60%. There are a great variety of Colletotrichum strains isolated from mango orchards. Thus, it is important to characterize their pathogenicity, as well as to perform a correct identification, in order to implement good strategies to eradicate the produced disease. The aim of this work is to identify Colletotrichum spp. and to determine the production of Pectate Lyase (PL) as a virulence factor in the pathogenicity process. Macroscopic characteristics of isolated colony vary from grey to salmon, sometimes showing luxuriant orange conidial masses with grey or white bottom. Conidia vary from 10.39 to 14.83 × 2.75 to 3.40 μm corresponding to C. gloeosporioides or C. acutatum according to Sutton. Growth rates vary from 0.1948 to 0.2239 day-1. The pectate lyase activity was induced by mango cells (240.81 VS 398U/L). According to CgInt and ITS4 PCR amplification M2V and SA correspond to C. gloeosporioides.
This document describes the isolation and characterization of a new giant virus called Cedratvirus. Key points:
- Cedratvirus was isolated from an environmental sample in Algeria using Acanthamoeba castellanii.
- It has an ovoid shape with a cork structure at each end, resembling Pithovirus sibericum but with a unique double cork feature.
- The 589kb genome is most closely related to the pithovirus genomes, sharing over 100 genes, but with only 21% of genes involved in best reciprocal hits, indicating genetic distance from known pithoviruses.
The Pesticides Peer Review evaluated the toxicological properties of glyphosate. They concluded glyphosate is unlikely to be genotoxic or carcinogenic based on animal and human studies. Some studies reported increased tumors in rats and mice, but the peer review determined these were not toxicologically relevant. Regarding developmental toxicity in rabbits, some studies reported effects like cardiac malformations, but these occurred at maternally toxic doses. The majority view was glyphosate does not require classification for developmental toxicity. The peer review set the acceptable daily intake and reference dose for glyphosate based on developmental toxicity observed in rabbits.
Wendy Cladman is a skilled laboratory professional with over 25 years of experience conducting experiments and managing laboratories. She has expertise in areas such as biochemical assays, cell culture, protein purification, and molecular biology techniques. Her career includes positions at several universities where she designed experiments, analyzed data, and contributed to publications in the fields of neuroscience, pharmacology, food science, and microbiology. She maintains a wide variety of technical skills and has experience training personnel.
Wendy Cladman is a skilled laboratory professional with over 25 years of experience conducting research in academic and industrial laboratories. She has expertise in areas such as experimental design, laboratory management, protein purification, molecular biology techniques, and data analysis. Her career includes positions at several universities where she designed experiments, analyzed results, and contributed to multiple publications in peer-reviewed journals. She possesses a wide range of technical skills applicable to research.
This document summarizes a study that evaluated the use of the Line Probe Assay (LPA) for rapid detection of Multi Drug Resistant Tuberculosis (MDR-TB) in Sudan. 300 smear-positive sputum samples were collected from TB patients and tested using LPA, culture-based drug susceptibility testing (DST), and conventional laboratory methods. Results found a high prevalence of MDR-TB in Sudan of 38% by DST and 37.3% by LPA. Comparison of LPA and DST results showed high accuracy of LPA for rapid detection of rifampin and isoniazid resistance with a sensitivity of 98.3% and specificity of 100%. LPA provided results within 2
Prevalence of Rota Virus Detection by Reverse TranscriptasePolymerase Chain R...IOSRJPBS
The present study was conducted for the period from 1/6/2016 to 20/1/2017 in Baquba city. The study aimed to detection of rotavirus in stool specimens of children fewer than five age and also explore the effects of certain demographic factors on the detection rates by revers transcriptase- polymerase chain reaction. The study included 49 patients with acute diarrhea, 32 were male and 17 were female. The age range was two months to 5 years. Demographic information on the patients regarding age, sex, residence, type of feeding and source of drinking water were collected from their parents. Stool specimens were collected from each patients and. Detection of rotavirus in stool specimens was done by conventional reverse transcriptase polymerase chain reaction (RT-PCR). The results of present study showed that the overall infection rate by rotavirus among patients with acute diarrhea by RT-PCR tests was 93.88%. The highest infection rate was recorded among those >10-≤15 months of age. None of the results showed significantly difference between female and male, PCR (88% vs 96.87%). Likewise, there was insignificantly difference between urban and rural residence, PCR (95.65% vs 92.30%). The results revealed insignificantly higher infection rate among patients (those below 2 years) feed mixing (91.66%) and bottled (100%) compared to that breast feeding (77.77%) by RT-PCR. The rotavirus infection rate was insignificantly higher among patients consuming municipal water for drinking (97.22%) compared to those consuming bottled water (84.61%) by the RT-PCR. The study concluded that rotavirus was detected in high rates among children less than 5 years old with acute diarrhea in Baquba city, particularly those less than 2 year old.
This document describes a new method for detecting Staphylococcus bacteria using a specific volatile organic compound (VOC) produced by Staphylococcus called 2-[3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl] propanoic acid (ATMAP). A simple colorimetric assay using methyl red as a pH indicator can specifically detect Staphylococcus by changing color from yellow to orange due to ATMAP production. The assay was tested on liquid cultures and plate cultures to detect various Staphylococcus and other bacterial strains, demonstrating 100% specificity and sensitivity. This new detection method could provide a low-cost and easy-to-use
DIAGNOSTIC ADVANCES IN HAEMOPROTOZOAN INFECTIONS OF LIVESTOCKrinkusarawade
The document discusses diagnostic advances for haemoprotozoan infections in livestock. It covers conventional parasitological diagnosis using blood smears as well as molecular diagnosis techniques like PCR, LAMP, and probes. Immunological diagnosis methods such as ELISA, IFAT, CATT, ICT are also summarized. Molecular tools allow specific and sensitive detection of parasites while serological assays are suitable for chronic infections when parasitemia is low. Advanced diagnostics combined with effective treatment can help control haemoprotozoan infections and drug resistance.
This study analyzed diagnostic records from the Taiwan National Laboratory Animal Center from 2004 to 2007 to assess the health status of rodent colonies in Taiwan. The key findings were:
1) Demand for pathogen diagnostic services increased steadily each year over the study period, indicating growing awareness of animal health issues.
2) Many mouse colonies tested positive for pathogens such as mouse parvovirus, mouse hepatitis virus, Theiler murine encephalomyelitis virus, and Mycoplasma pulmonis.
3) Nearly 40% of rat colonies tested positive for Mycoplasma pulmonis and rat parvovirus, and some also contained viruses like Kilham rat virus or intestinal parasites.
4
EU: Men's Or Boys' Clothing (Knitted Or Crocheted) - Market Report. Analysis ...IndexBox Marketing
IndexBox Marketing has just published its report: "EU: Men's Or Boys' Clothing (Knitted Or Crocheted) - Market Report. Analysis and Forecast to 2020". This report has been designed to provide a detailed analysis of the EU men's or boys' clothing market. It covers the most recent data sets of quantitative medium-term projections, as well as developments in production, trade, consumption and prices. The report also includes a comparative analysis of the leading consuming countries, revealing opportunities opened for producers and exporters across the globe. The forecast outlines market prospects to 2020.
El documento habla sobre el PLE (Personal Learning Environment) y cómo puede ser útil en el entorno educativo y la vida profesional. Menciona ejemplos de currículum 3.0 y cómo emprender como PLE. Finalmente anima a seguir aprendiendo de forma personalizada a través del PLE e identifica algunos usuarios de Twitter que comparten información sobre este tema.
Differentiating instruction means creating multiple paths for students to learn based on their abilities, interests, and needs. This involves varying the content, process, and product of lessons. Teachers can differentiate by using leveled materials, flexible grouping, and anchoring activities. The goal is to appropriately challenge all students and get away from a "one size fits all" approach that does not meet the needs of diverse learners.
This document describes a 2-day leadership communication training program that uses Neuro-Linguistic Programming (NLP) techniques. The objective is to equip participants with knowledge and skills to become effective leaders. On day 1, topics include self-management, communication models, leadership communication techniques. On day 2, topics are leadership styles, coaching, and servant leadership. The program involves lectures, exercises, role-playing and discussions. It is recommended for supervisors, managers and team leaders.
Ready For Occupancy Units located right in the Heart of Makati Central Business District offering Rent To Own Payment Scheme with Bank Financing options for the
Balance upon 25th month. See more: http://www.dreamcityph.com/properties/rent-to-own-1-bedroom-makati-condo/
This document provides a summary of a report on youth in the Balkans region. It begins with an introduction highlighting the important role that youth play in peacebuilding efforts according to UN Security Council Resolution 2250. It then presents case studies on youth in Bosnia and Herzegovina (ethnic reconciliation), Kosovo (capacity building), Macedonia (youth unemployment), and Serbia (political participation). The document finds that while each country faces its own challenges, themes like a lack of opportunities for youth and vulnerability to radicalization are common across the Balkans. It concludes by calling for support from international actors and greater youth inclusion to address the needs of the region's large youth population and build a more prosperous future.
This document provides information about a 4-day PMP Fast Track program offered by Foster & Bridge Indonesia to help participants prepare for the PMP certification exam. The program covers the PMBOK guide, project management processes and knowledge areas, exam tips, and provides 12 months of access to an online test simulation system. It aims to provide a more cost-effective option for professionals and organizations looking to gain the PMP certification.
This document contains details of the PGCET-2013 exam administered by the Karnataka Examinations Authority. It includes the question numbers from 1-75 and the corresponding answers in a table format. The document also lists the date of the exam as 14-AUG-13 and the subject as Aglasem Admission.
El documento describe el funcionamiento del motor diesel de cuatro tiempos, el cual consiste en las carreras de admisión, compresión, potencia y escape. Durante la admisión se aspira aire a la cámara de combustión. En la compresión se comprimen las moléculas de aire y se inyecta combustible. Luego, en la potencia la combustión empuja el pistón generando energía mecánica. Finalmente, en la carrera de escape, los gases quemados son expulsados de la cámara.
This document discusses the key components of a balance sheet including assets, liabilities, and owner's equity. Assets are defined as economic resources owned by a business and include items like cash, inventory, and property. Liabilities represent obligations the business owes, such as accounts payable or bonds. Owner's equity is the residual claim on assets by shareholders. The balance sheet equation shows that assets must equal liabilities plus owner's equity. Various types of each component are also described.
Las bombas de inyección en línea son robustas y fiables, pero son grandes, pesadas y están limitadas a un número bajo de revoluciones, por lo que solo son adecuadas para vehículos pesados. Están constituidas por tantos elementos de bombeo como cilindros tenga el motor y también incluyen un regulador de velocidad y un variador de avance automático de inyección. El circuito de combustible que alimenta a la bomba incluye un depósito con boca de llenado y un tamiz que impide la entrada de impurezas
The current pandemic has generated the search for new reliable and economic alternatives for the detection of SARS-CoV-2, which produces the COVID-19 disease, one of the recommendations by the World Health Organization, is the detection of the virus by RT-qPCR methods from upper respiratory tract samples. The discomfort of the pharyngeal nasopharyngeal swab described by patients, the requirement of trained personnel, and the generation of aerosols, are factors that increase the risk of infections in this type of intake. It is known that the main means of transmission of SARS-CoV-2 is through aerosols or small droplets, which is why saliva is important as a relevant means of detecting COVID-19. In this study, a modified method based on SARS-CoV-2 RNA release from saliva is described, avoiding the isolation and purification of the genetic material and its quantification of viral copies; the results are compared with paired pharyngeal/nasopharyngeal swab samples (EF/EN). Results showed good agreement in saliva samples compared to EF/EN samples. On average, a sensitivity for virus detection of 80% was demonstrated in saliva samples competing with EF/EN samples. The use of saliva is a reliable alternative for the detection of SARS-CoV-2 by means of RT-PCR in the first days of infection, having important advantages over the conventional method. Saliva still needs to be studied completely to evaluate the detection capacity of the SARS-CoV-2 nucleic acid, however, the described process is viable, due to the decrease in materials and supplies, process times, the increment in the sampling and improvement of laboratory performance.
This document describes a study using a miniature mass spectrometer to rapidly discriminate between bacterial species based on their unique phospholipid profiles obtained through paper spray ionization. Mass spectra from eight bacterial species were analyzed and differentiated using multivariate analysis. The miniature mass spectrometer was able to produce phospholipid profiles and tandem mass spectra that were comparable to a benchtop linear ion trap mass spectrometer, demonstrating its capability to analyze meso-size biomolecules like phospholipids for bacterial discrimination. While there was some day-to-day variability, significant differences were observed between the lipid profiles of several bacterial species, showing potential for portable in situ analysis of microorganisms.
Abdominal Tuberculosis – How Far are Our Diagnostics Illuminating?Apollo Hospitals
1) Abdominal tuberculosis can involve many abdominal organs and sites, with the ileocaecal region being most common. Diagnosis is dependent on correct identification and drug sensitivity testing of Mycobacterium tuberculosis.
2) Various diagnostic methods are available including AFB smear, culture, molecular tests like PCR and NAAT, and antigen/antibody tests. Culture remains the gold standard but newer automated non-radiometric systems like MGIT960 can provide faster results.
3) Molecular tests like nested PCR and NAAT provide very rapid results within hours but are used as supplements to culture. IFN-γ release assays and ADA levels in ascitic fluid also provide supportive diagnostic information. Proper diagnostic method selection
Discovery and Mechanistic Study of Mycobacterium tuberculosis PafA Inhibitors...Dr.Shuaib Ahmad
The document describes research into discovering and characterizing inhibitors of the Mycobacterium tuberculosis protein PafA. Key points:
1. Researchers developed a high-throughput screening assay to identify inhibitors of PafA from a library of compounds. This identified two inhibitors, E-H8 and V-G3, and one activator, B-F2.
2. Further analysis found that E-H8 (called ST1926) selectively inhibited Mtb PafA, while V-G3 inhibited both Mtb and Corynebacterium glutamicum PafA. ST1926 did not work by binding the substrate PanB.
3. ST1926 was found to increase the
This research project aims to identify potential drug candidates for COVID-19 through computational molecular docking of secondary metabolites from natural products against SARS-CoV-2 viral proteins, followed by immunochemistry experiments. Over 100 secondary metabolites isolated from plants are being evaluated based on their known antiviral activities. Preliminary molecular docking and dynamics simulations have identified several compounds including Cordifolioside-A, Palmitoside-G and Tinosinenoside-A that show strong binding to SARS-CoV-2 spike and envelope proteins.
A single-reaction quadruplex qPCR assay was developed that can rapidly detect and differentiate Burkholderia mallei and Burkholderia pseudomallei. The assay uses three signature sequences - a multicopy transposase sequence common to both species for sensitive detection, and two unique sequences for species differentiation. It also incorporates an internal control for DNA extraction and amplification using Bacillus thuringiensis. The assay enables detection of less than 1 genome equivalent and differentiation of B. mallei and B. pseudomallei with high sensitivity and reliability for diagnostic and surveillance purposes.
This study compared microscopy and PCR techniques for diagnosing malaria in suspected patients in Nepal. Of 824 suspected malaria cases tested, 19.2% were confirmed by microscopy, with most being P. vivax (10.9%) or P. falciparum (7.7%) infections. PCR testing of 132 blood samples detected more cases than microscopy, including some microscopy-negative samples. PCR was better able to detect mixed infections and identified some samples to the species level that microscopy identified only as Plasmodium. While PCR is more sensitive for detection and useful for research, microscopy remains the standard for routine diagnosis due to its lower cost and feasibility.
Combining Metabolite-Based Pharmacophores with Bayesian Machine Learning Mode...Sean Ekins
Slides from SERMACS 2015 meeting in Memphis 2015 describing a collaborative project with SRI International and Rutgers. The work was published in PLOS ONE http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0141076
This document describes the development of a universal PCR method for the detection and identification of common bacterial pathogens in cerebrospinal fluid (CSF). The method uses a single set of primers to amplify a portion of the 16S rRNA gene which is conserved across many bacterial species. While the amplified products are all the same size, restriction enzyme digestion patterns differ between species, allowing identification. Testing on 150 CSF samples found the PCR method had a sensitivity of 92.3% compared to culture. The PCR-restriction enzyme analysis approach provides a rapid and accurate method for detecting and identifying bacteria in CSF.
The annual Research Poster Session at the conference features cutting-edge food safety research related to fresh and fresh-cut produce from researchers around the world. Posters will be on display during the conference and researchers will be available at their posters on June 21 from 2-4pm to discuss their research. The document then provides summaries of 4 research posters that will be presented on topics including the antimicrobial effects of haskap berry extracts on foodborne pathogens, using whole genome sequencing and genetic analysis to map contamination sources in produce packing facilities, developing alternative seed disinfection methods for sprouted vegetables, and developing methods to encapsulate ethylene to control fruit ripening.
pcr en temps réel et evolution biotecheDjamilaHEZIL
This document discusses the development and applications of real-time polymerase chain reaction (RT-PCR). Some key points:
- RT-PCR was developed in the 1990s and has revolutionized gene detection and expression analysis by allowing quantification during the reaction in real-time.
- It has widespread applications in medicine, including cancer diagnosis and monitoring treatment, as well as in plant pathology, forensics, and other fields by enabling sensitive detection of genes and genetic variations.
- Challenges include optimizing sampling and nucleic acid extraction methods for different sample types and developing multiplex assays and internal controls for accurate quantification. Overall, RT-PCR is a powerful and sensitive technique that has expanded biological research capabilities.
This study aimed to investigate the bactericidal potential of Mycobacterium tuberculosis targets under various in vivo simulated in vitro conditions and in vivo in mice. Using antisense RNA to inhibit five target genes, the study evaluated target cidality under six physiological conditions in vitro and in vivo. It identified aroK, which encodes shikimate kinase, as an in vivo bactericidal target based on correlations between in vitro and in vivo cidality data. The study suggests that the low pH in vitro model best predicts in vivo cidality and identifies targets with potential for anti-tuberculosis drug development.
The use of agrochemicals has increased considerably in recent years, and consequently, there has been increased exposure of ecosystems and human populations to these highly toxic compounds. The study and development of methodologies to detect these substances with greater sensitivity has become extremely relevant. This article describes, for the first time, the use of atomic force spectroscopy (AFS) in the detection of enzyme-inhibiting herbicides. A nanobiosensor based on an atomic force microscopy (AFM) tip functionalised with the acetolactate synthase (ALS) enzyme was developed and characterised. The herbicide metsulfuron-methyl, an ALS inhibitor, was successfully detected through the acquisition of force curves using this biosensor. The adhesion force values were considerably higher when the biosensor was used. An increase of ~250% was achieved relative to the adhesion force using an unfunctionalised AFM tip. This considerable increase was the result of a specific interaction between the enzyme and the herbicide, which was primarily responsible for the efficiency of the nanobiosensor. These results indicate that this methodology is promising for the detection of herbicides, pesticides, and other environmental contaminants.
This research article describes a novel method using high-density peptide microarrays and computational analysis to identify B-cell epitopes in patients with celiac disease. Overlapping peptide sequences from native and deamidated gliadin proteins were synthesized onto silicon wafers. Serum samples from celiac patients and controls were tested on the microarrays. Computational analysis identified distinct epitope sets that differentiated celiac patients from controls with high accuracy. The identified epitopes have potential for developing improved diagnostic tests for celiac disease.
MALDI-TOF MS is an emerging technique for microbial identification, characterization, and typing that provides protein fingerprints unique to each microorganism. This review discusses applications of MALDI-TOF MS in environmental microbiology, including its use for identifying environmental microorganisms, bacterial strain typing, and research in bioremediation. Some parameters that can influence the reproducibility of MALDI-TOF MS results are also discussed.
Tacking the menage of gram negative inf with novel bl bli.pptxaceforum
The case involves a 55-year-old woman admitted to the ICU with respiratory failure. She was started on vancomycin and meropenem empirically based on local susceptibility trends. Her condition worsened and BAL culture grew Klebsiella pneumoniae. Rapid molecular testing detected OXA-48 carbapenemase. Studies from India have found high rates of OXA-48 producing K. pneumoniae bloodstream isolates. OXA-48 is commonly co-produced with ESBLs and other carbapenemases, complicating treatment.
1) The study found that circ-LDLRAD3, STAT3 expression were upregulated while miR-876-3p expression was downregulated in pancreatic cancer tissues and cell lines compared to normal tissues/cells.
2) Knockdown of circ-LDLRAD3 suppressed pancreatic cancer cell proliferation, migration, and invasion.
3) Mechanistically, circ-LDLRAD3 was found to directly regulate miR-876-3p expression, and miR-876-3p targets STAT3. Downregulation of circ-LDLRAD3 inhibited cell proliferation, invasion and migration by regulating the miR-876-3p/STAT3 axis.
This document discusses molecular microbiology and some of its techniques. It begins by defining molecular microbiology as the study of the molecular basis of physiological processes in microorganisms and manipulation of DNA. It then discusses several molecular techniques used, including polymerase chain reaction (PCR) and its applications such as quantitative real-time PCR and multiplex PCR. The document also discusses uses of molecular microbiology such as detection of pathogens and its role in fields like environmental microbiology.
This document describes a study that evaluated the pharmacokinetic/pharmacodynamic (PK/PD) relationships of a novel biotin carboxylase inhibitor called PD-0162819 against Haemophilus influenzae 3113 using in vitro infection models. Static concentration time-kill and one-compartment chemostat experiments were conducted. AUC/MIC ratio best explained efficacy compared to Cmax/MIC and T>MIC. Static effects and 99.9% killing were achieved at AUC/MIC values of 500 and 600, respectively. A semi-mechanistic PK/PD model was developed to describe bacterial growth and drug effects over time.
2. C. P. de Paula Uzam et al.
621
1. Introduction
Currently, the genus Mycobacterium consists of 170 species and 13 subspecies
(www.bacterio.net/mycobacterium.html). Most species are considered potentially or rarely pathogenic and are
called nontuberculous mycobacteria (NTM). This group is widely found in environments shared by humans and
animals [1]-[4]. NTM has demonstrated a potential for the degradation of xenobiotic substances [5]-[8]. In the
medical field, they have gained interest due to the increased number of infections associated with invasive pro-
cedures, such as anesthetic treatments and surgeries, as well as numerous reports of infections associated with
pulmonary diseases such as cystic fibrosis [9]-[13]. NTM infections are also characterized by scarce treatment
options related to multidrug resistance.
Precise identification at the species level may be useful for the characterization of isolates with biotechnolog-
ical potential and for directing empiric antimicrobial therapy and choosing relevant drugs for susceptibility tests,
according to the American Thoracic Society. Classical identification of mycobacteria is based on phenotypic
characteristics and biochemical tests. Besides being time-consuming and laborious, this approach is also limited
in identifying all species, and often it has been associated with molecular techniques. PCR-restriction enzyme
analysis (PRA) using the hsp65 gene as the target, which encodes the 65-kDa heat shock protein, has been
widely used for the identification of mycobacteria [14]-[17]. One limitation of this technique is that different
species can share the same restriction profile and that a species may have more than one corresponding profile.
The gene encoding 16S rRNA is used for bacterial taxonomy studies, and the high interspecific similarity of the
genus Mycobacterium does not allow identification of all mycobacterial species by this method [18]. The joint
analysis of different fragments of essential genes (16S rRNA, hsp65, rpoB, sodA) increases the discriminatory
power for species identification [18]. These techniques require intensive work, and therefore, the rapid identifi-
cation of mycobacteria is still a challenge. Alternatively, some studies have proposed the use of matrix-assisted
laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) for the rapid identification of
mycobacteria [19]-[23]. Although several protocols for protein extraction have been proposed, there is no con-
sensus on the best protocol to be used for the identification of mycobacteria. Furthermore, the effect of micro-
organism inactivation by heat has been evaluated, and it has been shown that the quality of the spectrum de-
creases with increasing temperature [24]. It was also recently reported that the conditions of microorganism cul-
tivation also influence the spectrum [25] [26]. However, in another study, the effect of culture age, chilling or
freezing the lysates and freeze-thaw cycles did not have any impact on spectrum quality [27]. Furthermore, its
use of MALDI-TOF MS for environmental isolates remains to be further explored, since only one reported study
included two environmental isolates in their analysis [28].
In this paper, we compared two protein extraction protocols for preparing samples for MALDI-TOF MS
analysis (protocols A and B) using reference strains and clinical isolates. Furthermore, we evaluated the applica-
tion of MALDI-TOF MS for the identification of environmental mycobacteria and compared it with the results
obtained with PRA-hsp65.
2. Material and Methods
2.1. Bacterial Strains
Twenty reference strains from Instituto Adolfo Lutz (IAL Collection) and Universidade Federal do Rio de Ja-
neiro (UFRJ Collection) and also 18 clinical isolates previously identified by PRA-hsp65 at IAL were used in
the present study (Table 1). These strains were chosen because the species are represented in the Bruker Dal-
tonics database and also because of their availability in our laboratory. Additionally, 27 environmental myco-
bacterial isolates obtained in the period of November 2011 to May 2012 from four aquatic environments of São
Paulo Zoo Park Foundation (FPZSP) were included in this study: sewage treatment plant, Lake 70 and two
springs, called 1 and 2 (Figure 2, unpublished data). These isolates were deposited in the microbial collection of
FPZSP. Mycobacteria were grown on Middlebrook7H10-OADC (oleic acid-albumin-dextrose-catalase) at 30˚C
or 37˚C, depending on the optimum growth temperature of each species.
2.2. Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry
(MALDI-TOF-MS) and Analysis
All 65 mycobacterial isolates were analyzed by MALDI-TOF MS. The reference strains and clinical isolates
3. C. P. de Paula Uzam et al.
622
Table 1. Reference strains and clinical isolates used in this study for compara-
tive analysis between two protein extraction protocols for MALDI-TOF-MS.
Mycobacterium species Strain
M. abscessus 1 a
IAL 1554
M. abscessus 1 a
IAL 1616
M. abscessus 1 a
IAL 1669
M. abscessus b
ATCC 19,977
M. asiaticum 1 a
IAL 184
M. asiaticum b
ATCC 25,272
M. aurum b
ATCC 23,366
M. austroafricanum b
ATCC 33,464
M. avium 1 a
IAL 1550
M. brisbanense 1 a
IAL 935
M. chelonae 1 a
IAL 1717
M. chelonae b
ATCC 35,752
M. cosmeticum 1 a
IAL 954
M. diernhoferi b
ATCC 19,340
M. fortuitum 1 a
IAL 727
M. fortuitum 1 a
IAL 970
M. fortuitum b
ATCC 6841
M. gordonae 3 a
IAL 1523
M. gordonae 3 a
IAL 1732
M. gordonae 3 a
IAL 862
M. intracellulare b
ATCC 13,950
M. kansasii b
INCQS 07002
M. mucogenicum 1 a
IAL 1648
M. nonchromogenicum b
ATCC 19,530
M. parafortuitum b
ATCC 19,686
M. peregrinum 1 a
IAL 1319
M. peregrinum 1 a
IAL 196
M. phlei b
ATCC 11,758
M. porcinum b
ATCC 33776
M. pulveris b
ATCC 35154
M. rhodesiae b
ATCC 27024
M. scrofulaceum 1 a
IAL 1750
M. scrofulaceum b
ATCC 19,981
M. smegmatis b
ATCC 14,468
M. szulgai b
ATCC 35,799
M. terrae 2 a
IAL 1684
M. thermoresistibile b
ATCC 19,527
M. vaccae b
ATCC 15,483
a
Clinical isolates previously identified by PRA-hsp65; b
Reference collection isolate.
4. C. P. de Paula Uzam et al.
623
were used for comparative analysis between the two protein extraction protocols, one described by El Khéchine
et al. (2011) and the other by Balázová et al. (2014), recommended by Bruker Daltonics (inactivated mycobac-
teria bead preparation method inMbpm) and designated A and B, respectively. After protein extraction, 1μL of
the supernatant was placed on a Micro Scout Plate (MSP) 96 polished steel target plate (Bruker Daltonics GmbH,
Germany) in triplicate for each sample. The samples were allowed to dry at room temperature. Each sample was
overlaid with 1 μL of a saturated solution of a-cyano-4-hydroxy-cinnamic acid (Sigma, USA) in 50% acetoni-
trile—2.5% trifluoroacetic (Sigma, USA) and the samples were air-dried before being processed in the mass
spectrometer. Bacterial Test Standard (Escherichia coli protein extract; Bruker Daltonics) was used for equip-
ment calibration according to Bruker Daltonics. The analysis was performed using a Microflex LT mass spec-
trometer (Bruker Daltonics) at 337 nm with the FlexControl software (version 3.0, Bruker Daltonics). Positive
linear mode was used to record spectra (laser frequency, 40 HzA; ion source 1 voltage, 20 kV; ion source 2 vol-
tage, 18.6 kV; lens voltage, 7.5 kV; mass range, 2000 to 20,000 Da). For each spectrum, 240 shots in 50-shot
steps from different positions of the target spot (automatic mode) were collected. Each spectrum was compared
with the Bruker Daltonics database (Mycobacteria Library 1.0) using the BioTyper software (version 3.0, Bruker
Daltonics). Outcomes of the pattern-matching process were expressed with identification score value from 0 to 3.
According to the software manufacturer (Bruker Daltonics), scores were interpreted as follows: <1.700, unreli-
able identification; 1.7 to 1.999, probable genus identification; 2.000 to 2.299, probable species identification;
and equal to or greater than 2.300, reliable species identification. The spectra obtained for each sample were
transformed to “main spectra” (MSPs) for further analysis of similarity by BioNumerics 7.5 (Applied Maths,
Sint Martens Latem, Belgium). The similarity matrix between spectra was inferred on the basis of the MSPs
using Pearson’s method, with a positional tolerance of 2%, and a dendrogram was then constructed using
UPGMA.
2.3. PCR Restriction Enzyme Analysis (PRA-hsp65)
Nucleic acids were extracted by lysing bacterial cells. Briefly, colonies were transferred to a 1.5 mL microcen-
trifuge tube and incubated in 10 mMTris - 1 mM EDTA for 20 min at 80˚C to inactivate the mycobacteria. The
sample was centrifuged at 10,000 xg and 5 µL of the thermolysate was used for PCR. Twenty-seven environ-
mental mycobacterial isolates were analyzed by PRA-hsp65 [29]. Briefly, the 441-bp fragment of the hsp65
gene was amplified with primers TB11 (5’ ACCAACGATGGTGTGTCCAT) and TB12 (5’ CTTGTCGAACCGC
ATACCCT). Amplicons were digested separately with BstEII (Promega) and HaeIII (Invitrogen). Digestion
products were visualized after electrophoresis in agarose gels, and digestion fragment size was estimated by
visual analysis and using the BioNumerics v. 7.5 program (Applied Maths). The digestion patterns obtained
were compared to the PRASITE internet database (http://app.chuv.ch/prasite/index.html).
2.4. Sequencing of hsp65 and 16S rRNA
Isolates with discordant results between PRA-hsp65 and MALDI-TOF-MS and isolates grouped by PRA-hsp65
and MALDI-TOF-MS profiles but not identified were analyzed by sequencing of hsp65 and 16S rRNA genes.
Five microliters of the thermolysate were used for amplification of hsp65 and 16S rRNA genes by PCR. A
667-bp fragment of hsp65 gene was amplified with primers hsp667-forward (5’ GGCCAAGACAATTGCGTACG)
and hsp667-reverse (5’ GGAGCTGACCAGCAGGATG) [30], it was regarded as the internal fragment of 401
bp corresponding to the region analyzed by PRA-hsp65 without the sequences of the primers. Complete se-
quences of the 16S rRNA gene (1483 - 1489 bp) were amplified using primer pair fD1-rP2 [31]. The sequencing
reactions were performed with the same primers used for amplification of the hsp65 and 16S RNA genes. As for
the latter, six internal primers were used as described by Adekambi and Drancourt (2004). Products of sequenc-
ing reactions were recorded with an ABI Prism 3100 DNA sequence following the manufacturer’s standard
protocol (Perkin Elmer Applied Biosystems). The consensus sequences generated by BioNumerics v7.5
(trimmed from at both ends) and were identified by similarity analysis with the sequences in the GenBank data-
base by use of the BLAST program (Basic Local Alignment Search Tool; http://www.ncbi.nlm.nih.gov/BLAST).
The cutoff used for analysis of 16S rRNA and hsp65 genes for identification was equal to or greater than 99 and
97% identity, respectively [31] [32]. The consensus sequences obtained in this study were deposited in GenBank
under accession numbers KP76838 and, KR779818 (hsp65) and KP768388 and KR779819 (16S rRNA).
5. C. P. de Paula Uzam et al.
624
3. Results
The first goal of this study was to compare two protocols of protein extraction for the identification of myco-
bacteria by mass spectrometry (MALDI-TOF) to subsequently use the best method for identifying environmen-
tal isolates. To achieve these aims, 38 clinical and reference samples of mycobacteria representing 27 species
were chosen. Protocol A identified 35 (92.1%) isolates at the species level and three (7.9%) at the genus level,
while protocol B identified 19 (50%) isolates at the species level, 18 (47.3%) at the genus level and one isolate
(2.6%) could not be identified because it showed a score below 1.700, when compared to the database (Figure
1(a)). Protocol A generated the highest number of detectable peaks when compared to protocol B for all samples.
A comparative analysis of the spectra obtained by protocols A and B and the spectra deposited in the database
revealed greater similarity between the spectra obtained with protocol A and spectra in the database (Figure
1(b)). After comparing the protein extraction protocols, the collection of 27 environmental isolates was analyzed
by protocol A. Of the 27 environmental isolates tested, 12 (44.4%) were identified at the species level; although
the other 15 showed good-quality spectra, they could not be reliably identified using the Bruker Daltonics data-
base (no score values, Figure 2).
All environmental isolates were also analyzed by PRA-hsp65. Seventeen isolates (62.9%) were identified at
the species level by PRA-hsp65: M. alvei 1, M. aubagnense 1, M. chelonae 1, M. nebraskense 1, M. neoaurum 1,
M. parafortuitum 1 and M. peregrinum2/porcinum1/septicum1. Ten isolates were separated into four groups ac-
cording to the restriction profile generated by BstEII and HaeIII restriction enzymes. However their profiles were
not found in the PRASITE database, and therefore, we designated them as “new” (Figure 2). When comparing
the two methods, we noted that the isolates identified by PRA-hsp65 as M. nebraskense 1 and M. aubagnense 1,
were not identified by MALDI-TOF MS because matching spectrum was not represented within the Bruker
Daltonics Database. Three other isolates (MYC 78, 79 and 101) not identified by PRA-hsp65 or Maldi-TOF MS
were subjected to sequencing of hsp65 and 16S rRNA. Sequences from these isolates showed the same se-
quences for these genes, and only the sequences from isolate MYC78 were deposited in the GenBank database.
The hsp65 gene sequence was 96.7% identical to that of M. longobardum DSM45394 (access number
JN571199.1), and the 16S rRNA sequence showed 98.7% identity with M. senuense strain 05-832 (access num-
ber NR043905.1), it was not possible to complete the identification.
The identification of two isolates (MYC100 and 106) were in disagreement when considering PRA-hsp65 and
MALDI-TOF MS techniques. The identification by PRA-hsp65 generated a profile shared by three species, M.
peregrinum2/porcinum1/septicum1, and MALDI-TOF MS identified both isolates as M. brisbanense. The se-
quencing analysisof the hsp65 gene fragment from these two isolates showed sequences identical to each other,
with 99.5% identity with M. brisbanense DSM 44,680 sequence (access number JF491333.1), thus confirming
the identification obtained with MALDI-TOF MSand suggesting a new PRA-hsp65 profile for M. brisbanense.
The divergence between PRA-hsp65 and hsp65 gene sequence results was due to a mismatch of two nucleotides
at positions 307 (CT) and 310 (TC) of the 401 bp fragment from the hsp65 gene. The changes in these nucleo-
tides resulted in loss of the recognition site for the restriction enzyme BstEII, which is used in PRA-hsp65, and
generated a restriction profile compatible with that of other species (M. peregrinum2/septicum1/porcinum1)
when analyzed by PRASITE (http://app.chuv.ch/prasite/index.html), erroneously identifying these isolates. The
16S rRNA gene sequences also revealed that the MYC100 and 106 isolates were identical to each other and
showed 99.2% identity with the sequence of M. brisbanense, strain W6743 and access number NR029037.1,
thus confirming the identification obtained with MALDI-TOF MS. The sequences of isolate MYC100 were de-
posited in the GenBank database.
4. Discussion
The present study compared two protein extraction protocols for MALDI-TOF MS biotyping using reference
strains and clinical isolates, representing 27 mycobacteria species. We chose to test the protocols described by
El Khéchine (protocol A) and Bruker Daltonics (protocol B). The choice of protocol A was based on the as-
sumption that the mechanical disruption of the mycobacterial wall step, when carried out in a controlled manner
by equipment, it could be a determining factor in obtaining quality spectra for analysis. The reason for protocol
B was library availability for data comparison and inclusion of new spectra, expanding the database.
The results showed that protocol A was more successful than protocol B in identifying mycobacterial species
by MALDI-TOF MS. The comparative analysis between spectra obtained with the two protocols and the spectra
6. C. P. de Paula Uzam et al.
625
(a)
(b)
Figure 1. Identification of reference strains and clinical isolates by MALDI-TOF-MS. (a) Dendrogram of protein mass pro-
files grouped by Pearson coefficient with 2% tolerance, using the BioNumerics program v. 7.5, and score obtained with pro-
tocols A and B. (b) Comparative spectral fingerprint of M. abscessus IAL1669 (left) and M. smegmatis ATCC14468 (right)
obtained with Microflex LT mass spectrometer (Bruker Daltonics). m/z, mass-to-charge ratio.
deposited in the Brucker Daltonics database revealed that the spectra obtained with protocol A were more simi-
lar to those deposited in the database. Both protocols A and B used heat to inactivate the microorganisms at
95˚C for 1 h and 30 min, respectively. They also used beads for mechanical disruption of the mycobacterial wall.
In protocol A, disruption of the mycobacterial wall took place by controlled shaking in a Fastprep instrument,
whereas vortexing was used in protocol B. Shitikov and colleagues observed lower spectrum quality with great-
100
50
M. intracellulare ATCC 13950
M. smegmatis ATCC 14468
M. thermorresistibile ATCC 19527
M. scrofulaceum 1 IAL 1750
M. scrofulaceum ATCC 19981
M. fortuitum 1 IAL 727
M. fortuitum 1 IAL 970
M. fortuitum ATCC 6841
M. peregrinum 1 IAL 1319
M. peregrinum 1 IAL 196
M. porcinum ATCC 33776
M. aurum ATCC 23366
M. diernhoferi ATCC 19340
M. terrae 2 IAL 1684
M. vaccae ATCC 15483
M. austroafricanum ATCC 33464
M. mucogenicum 1 IAL 1648
M. phlei ATCC 11758
M. nonchromogenicum ATCC 19530
M. parafortuitum ATCC 19686
M. rhodesiae ATCC 27024
M. cosmeticum 1 IAL 954
M. gordonae 3 IAL 1732
M. gordonae 3 IAL 862
M. gordonae 3 IAL 1523
M. asiaticum 1 IAL 184
M. asiaticum ATCC 25276
M. abscessus 1 IAL 1554
M. abscessus 1 IAL 1616
M. abscessus 1 IAL 1669
M. abscessus ATCC 19977
M. chelonae 1 IAL 1717
M. chelonae ATCC 35752
M. avium 1 IAL 1550
M. brisbanense 1 IAL 935
M. kansasii INCQS 07002
M. pulveris ATCC 35154
M. szulgai ATCC 35799
>2,300
>2,300
>2,300
>2,300
>2,300
2,017
2,086
2,031
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
1,849
1,849
2,003
>2,300
>2,300
1,732
>2,300
2,218
>2,300
>2,300
<1,700
>2,300
>2,300
>2,300
2,150
2,167
>2,300
1,963
1,959
1,878
>2,300
2,252
2,169
2,232
2,245
2,140
>2,300
>2,300
1,800
>2,300
1,997
2,277
>2,300
7. C. P. de Paula Uzam et al.
626
Figure 2. Identification of environmental mycobacterial isolates by MALDI-TOF MS and PRA-hsp65. Dendrogram of pro-
tein mass profiles generated using bionumerics program v. 7.5. (Applied maths, belgium). L70 = Lake 70, STP = sewage
treatment plant, S1 = Spring 1, S2 = Spring 2.
er sample heating [24]. In protocol A, the samples were subjected to heating twice as long as in protocol, but this
observation was not confirmed by the samples studied. Our hypothesis was that the most important factor in ob-
taining quality spectra is the efficiency of disrupting the mycobacterial wall, which in protocol A, occurred
through controlled mechanical agitation using equipment [23]. It was shown in a previous study that changes in
the extraction protocol generated differences in the spectra [23]. Another work evaluated the effect of cultivation
time, cooling of the lysate and freezing cycles on the quality of the spectrum and found no adverse impact on
spectrum quality or identification [27]. These findings combined with our results suggest that the disruption of
the mycobacterial wall is a critical step for efficient protein extraction, quality spectrum and consequently iden-
tification. Still, our results suggest that samples prepared with protocol A, though different from the protocol
used to construct the Bruker Daltonics database, are amenable to analysis, and moreover, spectrum quality ob-
tained with protocol A was comparable to that deposited in the Bruker Daltonics database. However, other au-
thors tested the same protocols (A and B) and concluded that they were not amenable to analysis in the Bruker
Daltonics database [25]. We believe that the differences may be related to the mycobacterial cell wall break
down process. While we used the Fastprep at full speed for 3 min as described in the original protocol [23], Ba-
lazova and collaborators used a thermomixer at 1400 rpm for 2 min. The comparison between the resulting
spectra generated by protocols A and B using reference and clinical strains led us to choose protocol A for the
assessment of 27 unidentified environmental mycobacterial isolates by mass spectrometry. Concomitantly, the
environmental isolates were analyzed by PRA-hsp65.
Mass spectrometry identified, at the species level, 44.4% of the environmental isolates while the PRA-hsp65
technique identified 62.9%. This difference occurred because six isolates identified as M. nebraskense and M.
aubagnense by PRA-hsp65 were not identified by MALDI-TOF MS, since the database used for analysis does
not have a spectrum for these microorganisms in its records. These findings strongly suggest that it is important
to broaden the spectrum database. Most species of environmental mycobacteria identified in this study have
100
50
MYC043
MYC057
MYC116
MYC117
MYC129
MYC272
MYC078
MYC101
MYC079
MYC013
MYC127
MYC056
MYC062
MYC089
MYC055
MYC015
MYC026
MYC235
MYC238
MYC233
MYC215
MYC226
MYC061
MYC266
MYC269
MYC100
MYC106
L70
L70
STP
STP
STP
STP
STP
STP
STP
STP
STP
L70
L70
L70
L70
STP
STP
STP
STP
L70
STP
STP
STP
S2
S1
STP
STP
nov/2011
nov/2011
dec/2011
dec/2011
mar/2012
mar/2012
jan/2012
mar/2012
jan/2012
nov/2011
jan/2012
nov/2011
nov/2011
nov/2011
nov/2011
nov/2011
dec/2011
nov/2011
dec/2011
nov/2011
dec/2011
mar/2012
nov/2011
may/2012
may/2012
jan/2012
jan/2012
M. parafortuitum
M. parafortuitum
M. neoaurum
M. neoaurum
M. neoaurum
M. neoaurum
M. alvei
M. alvei
M. chelonae
M. chelonae
M. brisbanense
M. brisbanense
>2,300
>2,300
no score values
no score values
no score values
no score values
no score values
no score values
no score values
no score values
no score values
>2,300
>2,300
>2,300
>2,300
>2,300
>2,300
no score values
no score values
no score values
no score values
no score values
no score values
>2,300
>2,300
>2,300
>2,300
M. komossense 1/M. parafortuitum 1
M. komossense 1/M. parafortuitum 1
M. aubagnense 1
M. aubagnense 1
M. aubagnense 1
M. aubagnense 1
new 25 (235, 120, 100; 140, 115, 100)
new 25 (235, 120, 100; 140, 115, 100)
new 25 (235, 120, 100; 140, 115, 100)
new 105 (235, 120, 100; 140, 115, 60)
new 105 (235, 120, 100; 140, 115, 60)
M. neoaurum 1
M. neoaurum 1
M. neoaurum 1
M. neoaurum 1
M. alvei 1
M. alvei 1
new 130 (235, 120, 100; 140, 80, 60)
new 130 (235, 120, 100; 140, 80, 60)
new 130 (235, 120, 100; 140, 80, 60)
new 57 (235, 120, 100; 135, 100, 85)
new 57 (235, 120, 100; 135, 100, 85)
M. nebraskense 1
M. chelonae 1
M. chelonae 1
M. peregrinum 2/M. porcinum 1/M. septicum 1
M. peregrinum 2/M. porcinum 1/M. septicum 1
8. C. P. de Paula Uzam et al.
627
been described as being responsible for infections in humans and animals [12] [16] [33]-[37]. Ten environmen-
tal isolates (37%) could not be identified by any of these techniques. These results corroborate studies reporting
that 48% to 61% of environmental mycobacteria isolated from water cannot be identified by phenotypic and
molecular methods, demonstrating the importance of evaluating new identification techniques [1] [14] [38]. The
number of new species of mycobacteria has been increasing exponentially making identification a challenge
[39].
The joint analysis of the results obtained with MALDI-TOF and PRA-hsp65 revealed a disagreement in two
isolates identified as M. brisbanense and M. peregrinum2/porcinum1/septicum1, respectively. The sequencing of
the hsp65 gene fragment showed two nucleotide changes resulting in the loss of recognition site for the restric-
tion enzyme BstEII, which was used in the PRA-hsp65 method, erroneously identifying these isolates. The se-
quencing of the 16S rRNA gene showed that these two isolates shared 99.2% of identity to M. brisbanense se-
quence thus confirming the identification obtained with MALDI-TOF MS.
In conclusion, our results showed that MALDI-TOF MS and PRA-hsp65 had the potential for the identifica-
tion of environmental isolates, considering an available database with profiles for comparison. Mass spectrome-
try has the advantage of being a simpler and faster technique than PRA-hsp65.
In work we were able to test a fast and efficient method for protein extraction followed by mass spectrometry
biotyping of environmental mycobacterial isolates, as an answer to the growing need for a rapid and suitable
method for identification of the increasing number of new mycobacterial species to be characterized.
Acknowledgments
The authors would like to acknowledge Dr. Diego Assis for his assistance with MALDI-TOF MS and the staff
from São Paulo Zoo Park Foundation for technical help. This work was supported by Fundação de Amparo à
Pesquisa doEstado de São Paulo (FAPESP; process No. 2010/52641-1, 2011/13140-0, 2011/13271-7). Dr. A.
Leyva helped with English editing of the manuscript.
References
[1] Le Dantec, C., Duguet, J.P., Montiel, A., Dumoutier, N., Dubrou, S. and Vincent, V. (2002) Occurrence of Mycobacte-
ria in Water Treatment Lines and in Water Distribution Systems. Applied and Environmental Microbiology, 68,
5318-5325. http://dx.doi.org/10.1128/AEM.68.11.5318-5325.2002
[2] Parashar, D., Chauhan, D.S., Sharma, V.D., Chauhan, A., Chauhan, S.V. and Katoch, V.M. (2004) Optimization of
Procedures for Isolation of Mycobacteria from Soil and Water Samples Obtained in Northern India. Applied and Envi-
ronmental Microbiology, 70, 3751-3753. http://dx.doi.org/10.1128/AEM.70.6.3751-3753.2004
[3] Radomski, N., Cambau, E., Moulin, L., Haenn, S., Moilleron, R. and Lucas, F.S. (2010) Comparison of Culture Me-
thods for Isolation of Nontuberculous Mycobacteria from Surface Waters. Applied and Environmental Microbiology,
76, 3514-3520. http://dx.doi.org/10.1128/AEM.02659-09
[4] Kankya, C., Muwonge, A., Djonne, B., Munyeme, M., Opuda-Asibo, J., Skjerve, E., Oloya, J., Edvardsen, V. and Jo-
hansen, T.B. (2011) Isolation of Non-Tuberculous Mycobacteria from Pastoral Ecosystems of Uganda: Public Health
Significance. BMC Public Health, 11, 320. http://dx.doi.org/10.1186/1471-2458-11-320
[5] Heitkamp, M.A., Freeman, J.P., Miller, D.W. and Cerniglia, C.E. (1988) Pyrene Degradation by a Mycobacterium sp.:
Identification of Ring Oxidation and Ring Fission Products. Applied and Environmental Microbiology, 54, 2556-2565.
[6] Miller, C.D., Hall, K., Liang, Y.N., Nieman, K., Sorensen, D., Issa, B., Anderson, A.J. and Sims, R.C. (2004) Isolation
and Characterization of Polycyclic Aromatic Hydrocarbon-Degrading Mycobacterium Isolates from Soil. Microbial
ecology, 48, 230-238. http://dx.doi.org/10.1007/s00248-003-1044-5
[7] Maciel, H., Mathis, H., Lopes Ferreira, N., Lyew, D., Guiot, S., Monot, F., Greer, C.W. and Fayolle-Guichard, F.
(2008) Use of Mycobacterium austroafricanum IFP 2012 in a MTBE-Degrading Bioreactor. Journal of Molecular Mi-
crobiology and Biotechnology, 15, 190-198.
[8] Hennessee, C.T., Seo, J.S., Alvarez, A.M. and Li, Q.X. (2009) Polycyclic Aromatic Hydrocarbon-Degrading Species
Isolated from Hawaiian Soils: Mycobacterium crocinum sp. nov., Mycobacterium pallens sp. nov., Mycobacterium ru-
tilum sp. nov., Mycobacterium rufum sp. nov. and Mycobacterium aromaticivorans sp. nov. International Journal of
Systematic and Evolutionary Microbiology, 59, 378-387. http://dx.doi.org/10.1099/ijs.0.65827-0
[9] Hofling-Lima, A.L., de Freitas, D., Sampaio, J.L., Leao, S.C. and Contarini, P. (2005) In Vitro Activity of Fluoroqui-
nolones against Mycobacterium abscessus and Mycobacterium chelonae Causing Infectious Keratitis after LASIK in
Brazil. Cornea, 24, 730-734. http://dx.doi.org/10.1097/01.ico.0000154411.07315.0a
9. C. P. de Paula Uzam et al.
628
[10] Viana-Niero, C., Lima, K.V., Lopes, M.L., Rabello, M.C., Marsola, L.R., Brilhante, V.C., Durham, A.M. and Leao,
S.C. (2008) Molecular Characterization of Mycobacterium massiliense and Mycobacterium bolletii in Isolates Col-
lected from Outbreaks of Infections after Laparoscopic Surgeries and Cosmetic Procedures. Journal of Clinical Micro-
biology, 46, 850-855. http://dx.doi.org/10.1128/JCM.02052-07
[11] Duarte, R.S., Lourenco, M.C., Fonseca Lde, S., Leao, S.C., Amorim Ede, L., Rocha, I.L., Coelho, F.S., Viana-Niero,
C., Gomes, K.M., da Silva, M.G., et al. (2009) Epidemic of Postsurgical Infections Caused by Mycobacterium massi-
liense. Journal of Clinical Microbiology, 47, 2149-2155. http://dx.doi.org/10.1128/JCM.00027-09
[12] Strabelli, T.M., Siciliano, R.F., Castelli, J.B., Demarchi, L.M., Leao, S.C., Viana-Niero, C., Miyashiro, K., Sampaio,
R.O., Grinberg, M. and Uip, D.E. (2010) Mycobacterium chelonae Valve Endocarditis Resulting from Contaminated
Biological Prostheses. The Journal of Infection, 60, 467-473. http://dx.doi.org/10.1016/j.jinf.2010.03.008
[13] Candido, P.H., Nunes Lde, S., Marques, E.A., Folescu, T.W., Coelho, F.S., de Moura, V.C., da Silva, M.G., Gomes,
K.M., Lourenco, M.C., Aguiar, F.S., et al. (2014) Multidrug-Resistant Nontuberculous Mycobacteria Isolated from
Cystic Fibrosis Patients. Journal of Clinical Microbiology, 52, 2990-2997. http://dx.doi.org/10.1128/JCM.00549-14
[14] Bland, C.S., Ireland, J.M., Lozano, E., Alvarez, M.E. and Primm, T.P. (2005) Mycobacterial Ecology of the Rio
Grande. Applied and Environmental Microbiology, 71, 5719-5727.
http://dx.doi.org/10.1128/AEM.71.10.5719-5727.2005
[15] Leao, S.C., Bernardelli, A., Cataldi, A., Zumarraga, M., Robledo, J., Realpe, T., Mejia, G.I., da Silva Telles, M.A.,
Chimara, E., Velazco, M., et al. (2005) Multicenter Evaluation of Mycobacteria Identification by PCR Restriction En-
zyme Analysis in Laboratories from Latin America and the Caribbean. Journal of Microbiological Methods, 61, 193-
199. http://dx.doi.org/10.1016/j.mimet.2004.11.015
[16] Lee, C.H., You, H.L., Wang, J.W., Tang, Y.F. and Liu, J.W. (2011) Prosthetic Joint Infection Caused by Mycobacte-
rium alvei in an Elderly Patient. Journal of Clinical Microbiology, 49, 3096-3098.
http://dx.doi.org/10.1128/JCM.00603-11
[17] Chimara, E., Ferrazoli, L., Ueky, S.Y., Martins, M.C., Durham, A.M., Arbeit, R.D. and Leao, S.C. (2008) Reliable
Identification of Mycobacterial Species by PCR-Restriction Enzyme Analysis (PRA)-hsp65 in a Reference Laboratory
and Elaboration of a Sequence-Based Extended Algorithm of PRA-hsp65 Patterns. BMC Microbiology, 8, 48.
http://dx.doi.org/10.1186/1471-2180-8-48
[18] Devulder, G., de Montclos, M.P. and Flandrois, J.P. (2005) A Multigene Approach to Phylogenetic Analysis Using the
Genus Mycobacterium as a Model. International Journal of Systematic and Evolutionary Microbiology, 55, 293-302.
http://dx.doi.org/10.1099/ijs.0.63222-0
[19] Hettick, J.M., Kashon, M.L., Simpson, J.P., Siegel, P.D., Mazurek, G.H. and Weissman, D.N. (2004) Proteomic Pro-
filing of Intact Mycobacteria by Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry.
Analytical Chemistry, 76, 5769-5776. http://dx.doi.org/10.1021/ac049410m
[20] Pignone, M., Greth, K.M., Cooper, J., Emerson, D. and Tang, J. (2006) Identification of Mycobacteria by Matrix-
Assisted Laser Desorption Ionization-Time-of-Flight Mass Spectrometry. Journal of Clinical Microbiology, 44, 1963-
1970. http://dx.doi.org/10.1128/JCM.01959-05
[21] Lotz, A., Ferroni, A., Beretti, J.L., Dauphin, B., Carbonnelle, E., Guet-Revillet, H., Veziris, N., Heym, B., Jarlier, V.,
Gaillard, J.L., et al. (2010) Rapid Identification of Mycobacterial Whole Cells in Solid and Liquid Culture Media by
Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry. Journal of Clinical Microbiology, 48,
4481-4486. http://dx.doi.org/10.1128/JCM.01397-10
[22] Saleeb, P.G., Drake, S.K., Murray, P.R. and Zelazny, A.M. (2011) Identification of Mycobacteria in Solid-Culture Me-
dia by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry. Journal of Clinical Microbi-
ology, 49, 1790-1794. http://dx.doi.org/10.1128/JCM.02135-10
[23] El Khechine, A., Couderc, C., Flaudrops, C., Raoult, D. and Drancourt, M. (2011) Matrix-Assisted Laser Desorp-
tion/Ionization Time-of-Flight Mass Spectrometry Identification of Mycobacteria in Routine Clinical Practice. PloS
ONE, 6, e24720. http://dx.doi.org/10.1371/journal.pone.0024720
[24] Shitikov, E., Ilina, E., Chernousova, L., Borovskaya, A., Rukin, I., Afanas’ev, M., Smirnova, T., Vorobyeva, A., La-
rionova, E., Andreevskaya, S., et al. (2012) Mass Spectrometry Based Methods for the Discrimination and Typing of
Mycobacteria. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in
Infectious Diseases, 12, 838-845.
[25] Balazova, T., Makovcova, J., Sedo, O., Slany, M., Faldyna, M. and Zdrahal, Z. (2014) The Influence of Culture Condi-
tions on the Identification of Mycobacterium Species by MALDI-TOF MS Profiling. FEMS Microbiology Letters, 353,
77-84. http://dx.doi.org/10.1111/1574-6968.12408
[26] Mather, C.A., Rivera, S.F. and Butler-Wu, S.M. (2014) Comparison of the Bruker Biotyper and Vitek MS Ma-
trix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry Systems for Identification of Mycobacte-
ria Using Simplified Protein Extraction Protocols. Journal of Clinical Microbiology, 52, 130-138.
10. C. P. de Paula Uzam et al.
629
http://dx.doi.org/10.1128/JCM.01996-13
[27] Dunne Jr., W.M., Doing, K., Miller, E., Miller, E., Moreno, E., Baghli, M., Mailler, S., Girard, V., van Belkum, A. and
Deol, P. (2014) Rapid Inactivation of Mycobacterium and Nocardia Species before Identification Using Ma-
trix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry. Journal of Clinical Microbiology, 52,
3654-3659. http://dx.doi.org/10.1128/JCM.01728-14
[28] Balada-Llasat, J.M., Kamboj, K. and Pancholi, P. (2013) Identification of Mycobacteria from Solid and Liquid Media
by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry in the Clinical Laboratory. Journal
of Clinical Microbiology, 51, 2875-2879. http://dx.doi.org/10.1128/JCM.00819-13
[29] Telenti, A., Marchesi, F., Balz, M., Bally, F., Bottger, E.C. and Bodmer, T. (1993) Rapid Identification of Mycobacte-
ria to the Species Level by Polymerase Chain Reaction and Restriction Enzyme Analysis. Journal of Clinical Microbi-
ology, 31, 175-178.
[30] Selvaraju, S.B., Khan, I.U. and Yadav, J.S. (2005) A New Method for Species Identification and Differentiation of
Mycobacterium chelonae Complex Based on Amplified Hsp65 Restriction Analysis (AHSPRA). Molecular and Cel-
lular Probes, 19, 93-99. http://dx.doi.org/10.1016/j.mcp.2004.09.007
[31] Adekambi, T. and Drancourt, M. (2004) Dissection of Phylogenetic Relationships among 19 Rapidly Growing Myco-
bacterium Species by 16S rRNA, hsp65, sodA, recA and rpoB Gene Sequencing. International Journal of Systematic
and Evolutionary Microbiology, 54, 2095-2105. http://dx.doi.org/10.1099/ijs.0.63094-0
[32] McNabb, A., Eisler, D., Adie, K., Amos, M., Rodrigues, M., Stephens, G., Black, W.A. and Isaac-Renton, J. (2004)
Assessment of Partial Sequencing of the 65-Kilodalton Heat Shock Protein Gene (hsp65) for Routine Identification of
Mycobacterium Species Isolated from Clinical Sources. Journal of Clinical Microbiology, 42, 3000-3011.
http://dx.doi.org/10.1128/JCM.42.7.3000-3011.2004
[33] Beccati, M., Peano, A. and Gallo, M.G. (2007) Pyogranulomatous panniculitis Caused by Mycobacterium alvei in a
Cat. The Journal of Small Animal Practice, 48, 664. http://dx.doi.org/10.1111/j.1748-5827.2007.00502.x
[34] Hsiao, C.H., Lin, Y.T., Lai, C.C. and Hsueh, P.R. (2010) Clinicopathologic Characteristics of Nontuberculous Myco-
bacterial Lung Disease in Taiwan. Diagnostic Microbiology and Infectious Disease, 68, 228-235.
http://dx.doi.org/10.1016/j.diagmicrobio.2010.06.008
[35] Kim, C.K., Choi, S.I., Jeon, B.R., Lee, Y.W., Lee, Y.K. and Shin, H.B. (2014) Pulmonary Infection Caused by Myco-
bacterium neoaurum: The First Case in Korea. Annals of Laboratory Medicine, 34, 243-246.
http://dx.doi.org/10.3343/alm.2014.34.3.243
[36] Poh, M.E., Liam, C.K., Ng, K.P. and Tan, R. (2014) Mycobacterium brisbanense Species Nova Isolated from a Patient
with Chronic Cavitary Lung Infection. Chest, 145, 858-860. http://dx.doi.org/10.1378/chest.13-1952
[37] Puthalapattu, S. and Metersky, M.L. (2011) Mycobacterium nebraskense as a Cause of Nodular Pulmonary Disease.
Connecticut Medicine, 75, 527-529.
[38] Lee, E.S., Lee, M.Y., Han, S.H. and Ka, J.O. (2008) Occurrence and Molecular Differentiation of Environmental My-
cobacteria in Surface Waters. Journal of Microbiology and Biotechnology, 18, 1207-1215.
[39] Dai, J., Chen, Y. and Lauzardo, M. (2011) Web-Accessible Database of hsp65 Sequences from Mycobacterium Refer-
ence Strains. Journal of Clinical Microbiology, 49, 2296-2303. http://dx.doi.org/10.1128/JCM.02602-10.