— NAC proteins are plant-specific transcription factors (TFs) and have been shown to function in plant development processes and abiotic and/or biotic stress responses. SECONDARY WALL-ASSOCIATED NAC DOMAIN PROTEIN1 (SND1) is one type of NAC TFs, which is a key regulator in the regulation network for secondary wall synthesis. In this study, the SND1 gene, named CpSND1 because it has a conservative N-terminal DNA-binding domain with AtSND1, was isolated from hawthorn (Crataegus pinnatifida). The full-length CDS of this gene was 1,203 bp, encoding 400 amino acids. The CpSND1 gene was transferred into tobacco (Nicotiana tobacum) by the Agrobacterium-mediated transformation method, and 20 transgenic lines were obtained. Tobacco plants overexpressing CpSND1 had typical phenotypes, including inhibited growth, upward-curling leaves. Our results provided functional information of CpSND1 for future genetic engineering.
— NAC proteins are plant-specific transcription factors (TFs) and have been shown to function in plant development processes and abiotic and/or biotic stress responses. SECONDARY WALL-ASSOCIATED NAC DOMAIN PROTEIN1 (SND1) is one type of NAC TFs, which is a key regulator in the regulation network for secondary wall synthesis. In this study, the SND1 gene, named CpSND1 because it has a conservative N-terminal DNA-binding domain with AtSND1, was isolated from hawthorn (Crataegus pinnatifida). The full-length CDS of this gene was 1,203 bp, encoding 400 amino acids. The CpSND1 gene was transferred into tobacco (Nicotiana tobacum) by the Agrobacterium-mediated transformation method, and 20 transgenic lines were obtained. Tobacco plants overexpressing CpSND1 had typical phenotypes, including inhibited growth, upward-curling leaves. Our results provided functional information of CpSND1 for future genetic engineering.
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
All manuscripts are subject to rapid peer review. Those of high quality (not previously published and not under consideration for publication in another journal) will be published without delay.
Avoidance of stochastic RNA interactions can be harnessed to control protein ...Paul Gardner
Presented at the Computational RNA Biology conference in Hinxton, 17-19th October, 2016.
https://coursesandconferences.wellcomegenomecampus.org/events/item.aspx?e=584
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
All manuscripts are subject to rapid peer review. Those of high quality (not previously published and not under consideration for publication in another journal) will be published without delay.
Avoidance of stochastic RNA interactions can be harnessed to control protein ...Paul Gardner
Presented at the Computational RNA Biology conference in Hinxton, 17-19th October, 2016.
https://coursesandconferences.wellcomegenomecampus.org/events/item.aspx?e=584
Study of anticonvulsant activity of quinidine in albino rats using pentylenet...iosrjce
IOSR Journal of Dental and Medical Sciences is one of the speciality Journal in Dental Science and Medical Science published by International Organization of Scientific Research (IOSR). The Journal publishes papers of the highest scientific merit and widest possible scope work in all areas related to medical and dental science. The Journal welcome review articles, leading medical and clinical research articles, technical notes, case reports and others.
The current slide focuses on different screening models for neurodegenerative diseases along with a brief description of the diseases where the slides are to the points and brief with detailed evaluation.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Subacute dermal toxicity investigation of nanosilver on serum chemical biomar...Nanomedicine Journal (NMJ)
Abstract
Objective(s):
Nanosilver is one of the most widely used nanomaterials due to its strong antimicrobial activity. Thus, because of increasing potential for exposure of human to nanosilver, there is an increasing concern about possible side effects of these nanoparticles. In this study, we tested the potential dermal toxicity of nanosilver bandage on serum chemical biomarkers in mice.
Materials and Methods:
In this study, 20 male BALB/c mice were randomly allocated into the treatment and control groups (n=10). After general anesthesia and shaving the back of all animals in near the vertebral column, in the nanosilver group, a volume of 50μl of 10 μg/ml of nanosilver solution (40 nm), and in the control group the same amount of distilled water was added to the sterile bandage of mice, then the bandages were fixed on the skin surface with cloth glue. After 3 and 7 days, the bandages were opened and serum levels of blood urea
nitrogen (BUN), creatinine (Cr), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured by using standard kits for two groups of mice.
Results:
In treatment group, a significant increase in ALT, AST and BUN levels were observed compared with control group during experiment periods (p<0.05),>0.05).
Conclusion:
The present results indicated that the dermal absorption of 10 μg/ml nanosilver (40 nm) can lead to hepatotoxicity and renal toxicity in mice.
Cognitive Improvement by Duloxetine Administration in demented adult APP/PS1 ...inventionjournals
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online.
Objective: To study the effects of resveratrol in neuronal structures in traumatic brain injury (TBI).
Study Design: Thirty rats were categorized as (1) control group (n=10), saline solution administered i.p. for 14 days, (2) TBI group (n=10), trauma induced by weight-drop model on brain, and (3) TBI+Resveratrol group (n=10), 15 minutes after injury the rats were given resveratrol (10 μmoL/kg/i.p.) for 14 days. At the end of the experiment the cerebellum was excised for routine paraffin tissue protocol. Blood samples were tested for serum biochemical markers (MDA, SOD, CAT, and GSH-x).
Results: SOD, GPx, and CAT values were lowest in the TBI group. MDA and histological scores of dilations in vessels, inflammation, degeneration in neurons, apoptosis in microglia, ADAMTS8, and GFAP expressions were highest in the TBI group. Sections of the control group showed normal cerebellar histology. The trauma group showed degenerated ganglion layer, pyknotic and apoptotic Purkinje cell nuclei. Vascular thrombus was seen in the substantia alba and substantia grisea. In the Trauma+Resveratrol group, most pa- thologies observed in the TBI group were improved. In the control group, GFAP protein was expressed in granular cells, axons, dendrites, Purkinje cells, and microglia cells. In the trauma group, increased GFAP expression was observed in glial processes, neurons, and Purkinje cells. In the Trauma+Resveratrol group, GFAP was expressed in molecular layer and glial processes. In the control group, ADAMTS-4 activity was observed in granulosa layer, glial cells, and Purkinje cells. In the trauma group, ADAMTS-4 expression was positive in Purkinje cells and glial cells. In the Trauma+ Resveratrol group, ADAMTS-4 was expressed in Purkinje cells, granular cells, and glial cells.
Conclusion: GFAP and ADAMTS-4 proteins may be involved in regeneration of damaged astroglial cells and other glial cells, Purkinje cells, and synaptic extensions. We suggest that antioxidative drugs such as resveratrol may be alternative target agents in neurological disease.
Keywords: ADAMTS-4, brain, cerebellum, GFAP, rat, resveratrol, traumatic brain injury
Dietary Administration of Diquat for 13 Weeks Does Not Result in a Loss of Do...EPL, Inc.
Dietary Administration of Diquat for 13 Weeks Does Not Result in a Loss of Dopaminergic Neurons in the Substantia Nigra Pars Compacta (SNpc) of C57BL/6J Mice
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
Basavarajeeyam is an important text for ayurvedic physician belonging to andhra pradehs. It is a popular compendium in various parts of our country as well as in andhra pradesh. The content of the text was presented in sanskrit and telugu language (Bilingual). One of the most famous book in ayurvedic pharmaceutics and therapeutics. This book contains 25 chapters called as prakaranas. Many rasaoushadis were explained, pioneer of dhatu druti, nadi pareeksha, mutra pareeksha etc. Belongs to the period of 15-16 century. New diseases like upadamsha, phiranga rogas are explained.
Ethanol (CH3CH2OH), or beverage alcohol, is a two-carbon alcohol
that is rapidly distributed in the body and brain. Ethanol alters many
neurochemical systems and has rewarding and addictive properties. It
is the oldest recreational drug and likely contributes to more morbidity,
mortality, and public health costs than all illicit drugs combined. The
5th edition of the Diagnostic and Statistical Manual of Mental Disorders
(DSM-5) integrates alcohol abuse and alcohol dependence into a single
disorder called alcohol use disorder (AUD), with mild, moderate,
and severe subclassifications (American Psychiatric Association, 2013).
In the DSM-5, all types of substance abuse and dependence have been
combined into a single substance use disorder (SUD) on a continuum
from mild to severe. A diagnosis of AUD requires that at least two of
the 11 DSM-5 behaviors be present within a 12-month period (mild
AUD: 2–3 criteria; moderate AUD: 4–5 criteria; severe AUD: 6–11 criteria).
The four main behavioral effects of AUD are impaired control over
drinking, negative social consequences, risky use, and altered physiological
effects (tolerance, withdrawal). This chapter presents an overview
of the prevalence and harmful consequences of AUD in the U.S.,
the systemic nature of the disease, neurocircuitry and stages of AUD,
comorbidities, fetal alcohol spectrum disorders, genetic risk factors, and
pharmacotherapies for AUD.
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists Saeid Safari
Preoperative Management of Patients on GLP-1 Receptor Agonists like Ozempic and Semiglutide
ASA GUIDELINE
NYSORA Guideline
2 Case Reports of Gastric Ultrasound
MANAGEMENT OF ATRIOVENTRICULAR CONDUCTION BLOCK.pdfJim Jacob Roy
Cardiac conduction defects can occur due to various causes.
Atrioventricular conduction blocks ( AV blocks ) are classified into 3 types.
This document describes the acute management of AV block.
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journeygreendigital
Tom Selleck, an enduring figure in Hollywood. has captivated audiences for decades with his rugged charm, iconic moustache. and memorable roles in television and film. From his breakout role as Thomas Magnum in Magnum P.I. to his current portrayal of Frank Reagan in Blue Bloods. Selleck's career has spanned over 50 years. But beyond his professional achievements. fans have often been curious about Tom Selleck Health. especially as he has aged in the public eye.
Follow us on: Pinterest
Introduction
Many have been interested in Tom Selleck health. not only because of his enduring presence on screen but also because of the challenges. and lifestyle choices he has faced and made over the years. This article delves into the various aspects of Tom Selleck health. exploring his fitness regimen, diet, mental health. and the challenges he has encountered as he ages. We'll look at how he maintains his well-being. the health issues he has faced, and his approach to ageing .
Early Life and Career
Childhood and Athletic Beginnings
Tom Selleck was born on January 29, 1945, in Detroit, Michigan, and grew up in Sherman Oaks, California. From an early age, he was involved in sports, particularly basketball. which played a significant role in his physical development. His athletic pursuits continued into college. where he attended the University of Southern California (USC) on a basketball scholarship. This early involvement in sports laid a strong foundation for his physical health and disciplined lifestyle.
Transition to Acting
Selleck's transition from an athlete to an actor came with its physical demands. His first significant role in "Magnum P.I." required him to perform various stunts and maintain a fit appearance. This role, which he played from 1980 to 1988. necessitated a rigorous fitness routine to meet the show's demands. setting the stage for his long-term commitment to health and wellness.
Fitness Regimen
Workout Routine
Tom Selleck health and fitness regimen has evolved. adapting to his changing roles and age. During his "Magnum, P.I." days. Selleck's workouts were intense and focused on building and maintaining muscle mass. His routine included weightlifting, cardiovascular exercises. and specific training for the stunts he performed on the show.
Selleck adjusted his fitness routine as he aged to suit his body's needs. Today, his workouts focus on maintaining flexibility, strength, and cardiovascular health. He incorporates low-impact exercises such as swimming, walking, and light weightlifting. This balanced approach helps him stay fit without putting undue strain on his joints and muscles.
Importance of Flexibility and Mobility
In recent years, Selleck has emphasized the importance of flexibility and mobility in his fitness regimen. Understanding the natural decline in muscle mass and joint flexibility with age. he includes stretching and yoga in his routine. These practices help prevent injuries, improve posture, and maintain mobilit
Explore natural remedies for syphilis treatment in Singapore. Discover alternative therapies, herbal remedies, and lifestyle changes that may complement conventional treatments. Learn about holistic approaches to managing syphilis symptoms and supporting overall health.
Report Back from SGO 2024: What’s the Latest in Cervical Cancer?bkling
Are you curious about what’s new in cervical cancer research or unsure what the findings mean? Join Dr. Emily Ko, a gynecologic oncologist at Penn Medicine, to learn about the latest updates from the Society of Gynecologic Oncology (SGO) 2024 Annual Meeting on Women’s Cancer. Dr. Ko will discuss what the research presented at the conference means for you and answer your questions about the new developments.
NVBDCP.pptx Nation vector borne disease control programSapna Thakur
NVBDCP was launched in 2003-2004 . Vector-Borne Disease: Disease that results from an infection transmitted to humans and other animals by blood-feeding arthropods, such as mosquitoes, ticks, and fleas. Examples of vector-borne diseases include Dengue fever, West Nile Virus, Lyme disease, and malaria.
263778731218 Abortion Clinic /Pills In Harare ,sisternakatoto
263778731218 Abortion Clinic /Pills In Harare ,ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group of receptionists, nurses, and physicians have worked together as a teamof receptionists, nurses, and physicians have worked together as a team wwww.lisywomensclinic.co.za/
2. 134 S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136
Table 1
Primer sequences used for semi-quantitative real-time PCR.
Gene Gene bank Primer sequences (5 –3 ) Amplification size
Hprt NM 012583.2 Fwd: GACCGGTTCTGTCATGTCG 61
Rev:ACCTGGTTCATCATCACTAATCAC
Drd2 NM 012547 Fwd AAGCGCCGAGTTACTGTCAT 111
Rev GGCAATGATACACTCATTCTGGT
2. Materials and methods
2.1. Animals
Experiments were carried out in male and female Wistar rats
(Laboratory of Pharmacology Casablanca), weighing 200–250 g.
Rats were housed three per cage and allowed free access to food and
water. Animals were handled daily for 7 days before each experi-
ment. Constant temperature (22 ± 1 ◦C) and lighting conditions (12
L:12 D cycle) were maintained in the housing room. All experiments
were approved by the Ethical Committee for biomedical research
of the Faculty of Medicine and Pharmacy of Casablanca, Morocco
(Comité d’Éthique pour la Recherche Biomédicale de Casablanca:
CERBC).
2.2. Drugs
Diazepam (Roche, Morocco), was obtained as solution
(1 g/100 ml) and diluted in 0.9% NaCl. Animals received saline (0.9%
NaCl) or drug (Diazepam: 2.5 mg/kg) injections, as appropriate in
a volume of 5 ml/kg body weight of animal.
2.3. Prenatal stress procedure
Prenatal stress was conducted as previously described [8]: Preg-
nant female rats were assigned randomly to prenatal stress (PS) and
control (Ctrl) groups. Stress was performed each day of the last ten
days of pregnancy in which the neural development of the fetus is
supposed to occur in rats [9].
Stressed dams were taken to an experimental box with a grid
floor that allowed delivering daily 80 electric shocks (0.5 mA, for
5 s, 1–2 min apart) on a random basis during 100-min sessions
carried out between 08:00 and 16:00 h. Control females were left
undisturbed in their home cages. After birth, the litter sizes were
recorded and adjusted to the same litter size (8 pups per litter).
All offspring were fostered by their own mothers. The pups were
weaned at 21 days of age and housed in groups of three per cage. A
total of 5 randomly selected litters per group was used in this study.
A maximum of three pups per litter was used for each experimental
group to avoid any litter effect [10]. The experiments were carried
out during the light phase of the light-dark cycle.
2.4. Injection treatments
Adult control (Ctrl) and PS offspring (80 days of age) were
weighed and randomly assigned to either a saline or diazepam
(DZP) group (n = 6 for each group). Saline groups received four daily
intraperitoneal (i.p) injections of NaCl 0.9%, while the DZP groups
received four daily i.p injections of diazepam (2.5 mg/kg).
2.5. Tissue collection
Adult treated and untreated rats were euthanized by decapita-
tion 24 h after the last injection. Brains were quickly removed and
placed on ice. The nucleus accumbens was dissected out from this
section, a rat brain atlas [11] being used for reference. Two coronal
cuts were made at right angles to the axis of the brain. The first
cut was made 1 mm anterior to the optic chiasma while the second
cut was 1.5 mm anterior to the first cut. The nucleus accumbens
(NAcc) was dissected, frozen on dry ice and stored at −80 ◦C until
molecular analysis.
2.6. Real-time PCR analysis
Total RNA was extracted from frozen tissues using Tri-
zol (Invitrogen) according to manufacturer’s instructions. RNA
concentration and quantified using the NanoVueTM Plus Spec-
trophotometer (GE Healthcare, UK). RNA extracts were kept frozen
until use.
For RT-PCR, cDNAs were obtained by reverse transcription from
2 g of RNA using 4 l of M-MLV reverse transcriptase (Invitrogen),
1 l random Examer (Invitrogen), 10 nM dNTP (Invitrogen) and 1 l
de RT Superscript at 200 U/l (Invitrogen, Morocco).
From resulting cDNAs (2 l per sample), each sequence of inter-
est was amplified in a final volume of 25 l of a commercial reaction
mixture, containing: 5× reaction buffer, 1.5 mM MgCl2, 50 M
primers, 0.25 U Taq polymerase (BIOLINE, LONDON, UK) and 50 ng
of cDNA.
Thermal cycling parameters were: 35 cycles of DNA denatura-
tion (5 min at 95 ◦C), primer hybridization (30 s at 95 ◦C), elongation
(30 s at 72 ◦C) and a final elongation step (7 min at 72 ◦C). PCR
products were separated by electrophoresis on 2% agarose gel and
visualized by ethidium bromide staining. Each sample was ana-
lyzed in triplicate and to ensure measurements form different PCR
runs were cross-comparable. Real time PCR was performed using
real time PCR Applied Biosystem FAST 7500 apparatus and Syber
Green according to manufacturer’s protocol.
Relative quantification was used to determine fold changes
(control vs PS), using the CT method. Primer sequences are
shown in Table 1. Hprt was used as a housekeeping gene.
2.7. Statistical analysis
Data were analyzed using parametric analysis of variance
(ANOVA), with group (control vs PS) and treatment (vehicle vs
diazepam) as between-subject variables, followed by student’s t-
test. Significance was set at p < 0.05.
3. Results
As shown in Table 2, no differences in litter sizes, number of
males and females per litter and male/female ratio were found
between prenatally stressed and non-stressed animals (p > 0.05).
Two-way analysis of variance showed a significant
stress/treatment interaction (Fig 1: F(3,20) = 32.108; p < 0.001).
Table 2
Litter parameters analyzed in control and prenatally stressed litters.
Parameter Control Prenatal stress
Litter size 9.6 ± 0.74 10.2 ± 0.37
Number of males per litter 5.2 ± 0.31 5.0 ± 0.22
Number of females per litter 4.4 ± 0.51 5.2 ± 0.37
Male/female ratio 1.17 ± 0.08 0.99 ± 0.11
Data are expressed as mean ± SEM of PS (n = 10) and control (n = 10) litters.
3. S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136 135
.0
.5
1.0
1.5
2.0
2.5
Ctrl-Saline PS-Saline Ctrl-DZP PS-DZP
***
** ≠≠≠
+
DRD2relaƟveFoldchange
Fig. 1. Real-time quantitative RT-PCR analysis of the effect of prenatal stress and
diazepam (2.5 mg/kg) injections on Drd2 mRNA level in the NAcc.
Data are expressed as mean ± SEM of Drd2 levels in the NAc (n = 6 for each
group). **p < 0.01 and ***p < 0.001 vs Ctrl-Saline. +p < 0.05 vs Ctrl-DZP group, /= /= /=
p < 0.001 vs PS-Saline group.
Statistical analyses of the group means revealed a significant
upregulation of Drd2 mRNA (p < 0.001) in the NAcc of PS animals
compared with Ctrl-Saline group. Moreover, repeated exposure
to diazepam in control and prenatally stressed adult rats led to a
significant decrease in the expression of Drd2 mRNA in the NAcc
in the control rats (p < 0.01, compared with Ctrl-saline group) and
the PS-DZP treated group (p < 0.001, compared with PS-Saline
group). Strikingly, a significant downregulation of Drd2 mRNA was
observed in the NAcc of PS group treated with DZP compared to
control rats treated with the same drug.
4. Discussion
Stress exposure during early life has long been considered as
an etiological factor in psychiatric disorders and enhanced drug-
seeking behavior later in life [12–16]. These effects are mediated
by exposure to elevated levels of glucocorticoids which can readily
traverse the placental barrier and influence brain development in
utero, leading to behavioral alterations and dysfunction of specific
neural substrates [17,18,14]. We previously showed that adult rats
that had been exposed to prenatal stress display increased place
preference for the diazepam-paired side and are more sensitive to
the anxiolytic actions of benzodiazepines compared with controls
[8]. Furthermore, many studies have shown that prenatal stress
influenced dopamine receptor expression in the nucleus accum-
bens of adult offspring [19,20], which were more responsive to
stress and cocaine [21,22,14,15], suggesting that early life events
can program the mesolimbic circuit.
Since the mesolimbic dopaminergic system is strongly impli-
cated in motivational and reward aspects of addictive behaviors
[23,24], the present investigation was undertaken to determine
the long-term effects of prenatal stress exposure on D2 receptors
expression.
Our results indicate that prenatal stress induced changes in the
nucleus accumbens (NAcc) of adult offspring. Drd2 mRNA expres-
sion levels were markedly upregulated in the NAcc of prenatally
stressed rats. Moreover, repeated diazepam exposure significantly
down-regulated Drd2 expression in adult PS rats compared with
controls.
These findings are in agreement with other studies which
reported a similar increase in D2 receptors and a decrease in D3
receptors in the nucleus accumbens of adult male offspring sub-
jected to prenatal restraint stress [12]. Another study has found
similar results in Drd2 overexpression following prenatal dexam-
ethasone exposure within the NAcc of adult offspring associated
with low intra-NAcc levels of dopamine and an impoverishment
in dopaminergic inputs in the NAcc indicating a hypodopamin-
ergic state [16]. Other investigators have reported that PS rats
had reduced neuronal numbers in the NAcc and fewer dopamine
inputs from the VTA [25]. In addition, PS rats displayed a higher
DA turnover in prefrontal cortex and a lower turnover in corpus
striatum and nucleus accumbens [26,27].
All these findings suggests that the increased mRNA levels of
Drd2 in the NAc of prenatal stress exposed animals may appear
as a compensatory mechanism due to the low dopamine levels
observed in this structure. The alteration of dopaminergic system
due to the prenatal stress may provide a biochemical basis for
the behavioral abnormalities previously reported in adult rats sub-
jected to prenatal stress which demonstrate that prenatal stress
enhanced the abuse potential of benzodiazepines in the offspring
during adulthood [8].
The mesolimbic dopaminergic system is known to be involved
in motivational and reward aspects of addictive behaviors [23,24].
Furthermore, chronic administration of benzodiazepine stimulated
dopamine levels in the NAcc by reducing the inhibition of dopamin-
ergic neurons [28]. Moreover, a previous study in rats suggested
that ventral tegmental area (VTA) DA neurons are disinhibited after
diazepam injection [29]. Besides, activation of GABAA receptors by
direct administration of muscimol (GABAA receptor agonist) into
the VTA significantly increased dopamine release in the NAcc [30].
High levels of dopamine within the nucleus accumbens mediate
the rewarding effects of drug of abuse [31].
The results of the present study showed that repeated diazepam
administration down-regulated Drd2 expression in the nucleus
accumbens of PS and control animals treated with diazepam.
This down-regulation seems to be an adaptive mechanism in
response to the potential increased dopamine levels following
such treatment. Moreover, the down-regulation of D2 receptors
following diazepam administration was more marked in adult
prenatally stressed animals compared with non-stressed ani-
mals, suggesting a hypersensitivity of dopamine receptors due to
the hypo-dopaminergic state induced by prenatal stress. There-
fore, prenatal stress exposure changed the sensitivity of the
mesencephalic dopaminergic transmission to benzodiazepine in
adulthood.
Interestingly, a recent study has shown that L-DOPA admin-
istration normalized the hypodopaminergic state and the Drd2
responses to subsequent morphine and ethanol exposure of
prenatal DEX exposed animals [16] suggesting that a simple rein-
statement of dopaminergic homeostasis may prevent drug abuse
in vulnerable individuals.
More studies are needed to determine the precise mechanisms
underlying the susceptibility to later substance abuse.
5. Conclusion
In summary, we demonstrate that prenatal stress has long last-
ing effects in prenatally stressed offsprings that extend into the
adulthood. Prenatally stressed rats displayed an increased Drd2
mRNA expression levels in the nucleus accumbens which was sig-
nificantly down-regulated after repeated adult administration of
diazepam.
References
[1] J.M. Beaulieu, R.R. Gainetdinov, The physiology, signaling, and pharmacology
of dopamine receptors, Pharmacol. Rev. 63 (2011) 182–217.
[2] H.S. Bateup, E. Santini, W. Shen, S. Birnbaum, E. Valjent, D.J. Surmeier, et al.,
Distinct subclasses of medium spiny neurons differentially regulate striatal
motor behaviors, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 14845–14850.
[3] S. Puglisi-Allegra, E. Kempf, C. Schleef, S. Cabib, Repeated stressful
experiences differently affect brain dopamine receptor subtypes, Life Sci. 48
(1991) 1263–1268.
4. 136 S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136
[4] S. Cabib, S. Puglisi-Allegra, F.R. D’Amato, Effects of postnatal stress on
dopamine mesolimbic system responses to aversive experiences in adult life,
Brain Res. 604 (1993) 232–239.
[5] J.M. Finlay, M.J. Zigmond, The effect of stress on central dopaminergic
neurons: possible clinical implications, Neurochem. Res. 22 (1997)
1387–1394.
[6] J.H. Woods, J.L. Katz, G. Winger, Benzodiazepines: use, abuse, and
consequences, Pharmacol. Rev. 4 (1992) 151–347.
[7] K.R. Tan, M. Brown, G. Labouèbe, C. Yvon, C. Creton, J.M. Fritschy, U. Rudolph,
C. Lüscher, Neural bases for addictive properties of benzodiazepines, Nature
463 (2010) 769–774.
[8] S. Lakehayli, N. Said, O. Battas, F. Hakkou, A. Tazi, Prenatal stress alters place
conditioning and sensitivity to benzodiazepines in adult rats, Neurosci. Lett.
591 (2015) 187–191.
[9] B. Clancy, R.B. Darlington, B.L. Finlay, Translating developmental time across
mammalian species, Neuroscience 105 (2001) 7–17.
[10] R. Chapman, J. Stern, Failure of severe maternal stress or ACTH during
pregnancy to affect emotionality of male rat offspring: implications of litter
effects for prenatal studies, Dev. Psychobiol. 12 (1979) 255–269.
[11] G. Paxinos, C. Watson, The Rat Brain, sixth ed., Elsevier academic Press,
Burlington, MA, USA, 2007.
[12] C. Henry, G. Guegant, M. Cador, E. Arnauld, J. Arsaut, M. Le Moal, J.
Demotes-Mainard, Prenatal stress in rats facilitates amphetamine-induced
sensitization and induces long lasting changes in dopamine receptors in the
nucleus accumbens, Brain Res. 685 (1995) 179–186.
[13] M. Vallée, S. Maccari, F. Dellu, H. Simon, M. Le Moal, Long term effects of
prenatal stress and postnatal handling on age-related glucocorticoid secretion
and cognitive performance: a longitudinal study in the rat, Eur. J. Neurosci. 11
(1999) 2906–2916.
[14] P.V. Piazza, M. Le Moal, Pathophysiological basis of vulnerability to drug
abuse: role of an interaction between stress, glucocorticoids, and
dopaminergic neurons, Annu. Rev. Pharmacol. Toxicol. 36 (1996) 359–378.
[15] R. Sinha, Chronic stress, drug use, and vulnerability to addiction, Ann. N.Y.
Acad. Sci. 1141 (2008) 105–130.
[16] A.J. Rodrigues, P. Leao, J.M. Pego, D. Cardona, M.M. Carvalho, M. Oliveira, et al.,
Mechanisms of initiation and reversal of drug-seeking behavior induced by
prenatal exposure to glucocorticoids, Mol. Psychiatry 17 (2012)
1295–1305.
[17] A.J. Rodrigues, P. Leao, M. Carvalho, O.F. Almeida, N. Sousa, Potential
programming of dopaminergic circuits by early life stress,
Psychopharmacology 214 (2010) 107–120.
[18] J.J. Cerqueira, J.M. Pego, R. Taipa, J.M. Bessa, O.F. Almeida, N. Sousa,
Morphological correlates of corticosteroid-induced changes in prefrontal
cortex-dependent behaviors, J. Neurosci. 25 (2005) 7792–7800.
[19] A.L. Jongen-Relo, G.J. Docter, A.J. Jonker, E. Vreugdenhil, H.J. Groenewegen, P.
Voorn, Differential effects of dopamine depletion on the binding and mRNA
levels of dopamine receptors in the shell and core of the rat nucleus
accumbens, Brain Res. Mol. Brain Res. 25 (1994) 333–343.
[20] M.A. Berger, V.G. Barros, M.I. Sarchi, F.I. Tarazi, M.C. Antonelli, Long-term
effects of prenatal stress on dopamine and glutamate receptors in adult rat
brain, Neurochem. Res. 27 (2002) 1525–1533.
[21] T.E. Kippin, K.K. Szumlinski, Z. Kapasova, B. Rezner, R.E. See, Prenatal stress
enhances responsiveness to cocaine, Neuropsychopharmacology 33 (2008)
769–782.
[22] P.V. Piazza, J.M. Deminiere, M. Le Moal, H. Simon, Factors that predict
individual vulnerability to amphetamine self-administration, Science 245
(1989) 1511–1513.
[23] G.F. Koob, N.D. Volkow, Neurocircuitry of addiction,
Neuropsychopharmacology 35 (2010) 217–238.
[24] M.J. Meaney, W. Brake, A. Gratton, Environmental regulation of the
development of mesolimbic dopamine systems: a neurobiological
mechanism for vulnerability to drug abuse? Psychoneuroendocrinology 27
(2002) 127–138.
[25] M. Carlsson, A. Carlsson, Interactions between glutamatergic and
monoaminergic systems within the basal ganglia implications for
schizophrenia and Parkinson’s disease, Trends Neurosci. 13 (1990) 272–276.
[26] S.J. Alonso, E. Navarro, C. Santana, M. Rodríguez, Motor lateralization
behavioral despair and dopaminergic brain asymmetry after prenatal stress,
Pharmacol. Biochem. Behav. 58 (2) (1997) 443–448.
[27] E. Fride, M. Weinstock, Prenatal stress increases anxiety related behavior and
alters cerebral lateralization of dopamine activity, Life Sci. 42 (1988)
1059–1065.
[28] K.R. Tan, U. Rudolph, C. Luscher, Hooked on benzodiazepines: GABAA receptor
subtypes and addiction, Trends Neurosci. 34 (4) (2011) 188–197.
[29] D.P. O’Brien, F.J. White, Inhibition of non-dopamine cells in the ventral
tegmental area by benzodiazepines: relationship to A10 dopamine cell
activity, Eur. J. Pharmacol. 142 (1987) 343–354.
[30] Z.X. Xi, E.A. Stein, Nucleus accumbens dopamine release modulation by
mesolimbic GABAA receptors-an in vivo electrochemical study, Brain Res. 798
(1998) 156–165.
[31] G.F. Koob, M. Le Moal, Drug addiction, dysregulation of reward, and allostasis,
Neuropsychopharmacology 24 (2) (2001) 97–129.