1. Spatial and temporal regulation of the microtubule cytoskeleton in interphase cells via motor
domain phosphorylation of the Kinesin13 KLP10A
Brian Kam
Edgemont High School
200 White Oak Lane, Scarsdale, NY 10583
February 24 , 2015
3. Kam 1
Spatial and temporal regulation of the microtubule cytoskeleton in interphase cells via motor
domain phosphorylation of the Kinesin13 KLP10A
Brian Kam
Edgemont High School, Scarsdale, NY
Kinesins comprise a superfamily of intracellular “motor” proteins that use force generated by
ATP hydrolysis to move cargoes along microtubule tracks. Interestingly, however, one
subfamily of kinesins, known as the kinesin-13s, is not involved in force generated movement
but instead uses ATP hydrolysis to locally depolymerize microtubules, which in turn affects cell
polarization, motility, and division. Of course, kinesin-13 mediated microtubule
depolymerization must be subject to tight spatiotemporal regulation. In this study, we use live
cell, 4-D spinning disk confocal microscopy to determine how the activity of a prominent
kinesin-13 protein, KLP10A, is regulated by phosphorylation of its catalytic core. Imaging was
performed on genetically modified cells expressing fluorescently labeled wild type KLP10A or
KLP10A mutants with a single amino acid substitution (S573E) that mimics phosphorylation of
a specific amino acid known to be important for KLP10A regulation. Our findings support the
hypothesis that phosphorylation of a specific residue within the KLP10A catalytic core, serine
573, spatially and temporally controls the activity of this depolymerase kinesin during
interphase.
4. Kam 2
INTRODUCTION
Microtubules are imperative for many cellular activities. They provide railways for cargo
transport, segregate chromosomes during cell division, and contribute to cellular polarization
(Plopper, Sharp, and Sikorski 515-567). Microtubules are comprised of alpha- and beta- tubulin
dimers which bind in a head-to-tail fashion to generate protofilaments. Generally, thirteen
protofilaments associate laterally to form a hollow cylinder that is a microtubule. Due to this
assembly, microtubules always show a polar conformation, with beta- tubulin oriented towards
the plus end and alpha-tubulin oriented towards the minus end. Microtubules work as highways
over which microtubule-based motors like kinesins and dyneins can travel (Walczak et al 2013).
Most kinesins use ATP hydrolysis to translocate along microtubules. However, there is a group
of kinesins, known as kinesin-13s, that does not progress on the microtubule lattice but instead
uses ATP hydrolysis to destabilize microtubules ends. Work over the last several decades has
made it clear that kinesin-13 mediates microtubule depolymerization which is essential to many
cellular activities. In mitosis, for example, microtubule depolymerization by kinesin-13s is used
to separate chromosomes to opposite sides of the spindle apparatus, thereby ensuring the equal
segregation of genetic material from mother to daughter cells. Kinesin-13s are also important for
organizing the microtubule arrays of non-mitotic cells, including neurons which use kinesin-13s
to control the growth of axons and dendrites.
However, in order to function correctly, kinesin-13s must be subjected to a strict
spatiotemporal control, and there is now a good deal of evidence to indicate that this occurs via
phosphorylation. In vivo phosphorylation of a Serine in the position 573 (S573) within the
internal motor domain of Drosophila melanogaster KLP10A is caused by Casein Kinase 1 α
(CK1α) (Mennella et al 2009). KLP10A S573 lies within the conserved motif α-helix 5, which is
required for microtubule binding. Molecular dynamic simulations indicate that the
5. Kam 3
phosphorylation of S573 induces important structural changes in the L2, L11, and L8 regions of
KLP10A that directly interact with tubulin dimers (Mennella et al 2009).
KLP10A S573 was the first kinesin-13 motor domain phosphorylation site to be
identified and phosphorylation of this site was shown to downregulate the depolymerization
activity of KLP10A without altering its affinity for the microtubule lattice (Mennella et al 2009).
It has been previously found that the kinesin13, KLP10A, has an important role for the mitotic
spindle assembly and chromosome segregation by controlling the rate of poleward flux, the
mechanism by which the depolymerization of microtubules drives the movement of spindle
microtubules towards the spindle poles (Rogers et al 2004). Also, the role of KLP10A has been
studied in S2 cells during interphase, when KLP10A targets polymerizing microtubules through
interaction with EB1 and controls dynamic instability parameters such as frequency of pause and
catastrophe (Mennella et al 2005).
In the present study, I want to explore in more detail, the effect of phosphorylation of
KLP10A S573 on the enzyme’s cellular distribution and interaction with microtubules. Toward
this end, I performed fixed and live cell imaging of Drosophila S2 cells transgenically induced to
co-express GFP-tubulin and either mRFP wild type KLP10A or a phosphomimetic mRFP-tagged
KLP10A S573E mutant.
GENERAL HYPOTHESIS
Drosophila melanogaster KLP10A is a kinesin-13 member that depolymerizes
microtubules. It has been previously found that KLP10A is localized on both ends of
microtubules and is an important component for segregation of chromosomes during mitosis.
KLP10A exerts its disassembling activity on microtubules by reaching the ends of microtubules
and altering the morphology of the protofilament from a straight to a curled configuration.
6. Kam 4
Because KLP10A plays a role in the dynamicity of microtubules, there should be mechanisms
that control the cellular localization and activity of KLP10A.
SPECIFIC HYPOTHESIS
We hypothesize that a phosphorylation of the previously identified Serine on 573 position
inside the motor domain of KLP10A will have an important impact on the enzyme’s cellular
distribution as well as the shape and arrangement of the cellular microtubule array.
MATERIALS AND METHODS
Preparation of Bottom Glass Dishes/ Attaching Coverslip for cell imaging
Bottom Glass Dishes were prepared using 35mm petri dishes, an electric drill with a ¾
drill bit, 25mm glass coverslips, and pliers. First, we placed the 35mm petri dish onto a large
piece of Styrofoam. We held the dish down using pliers while drilling a hole in the center of the
petri dish, making the edges as smooth as possible. Next we removed plastic debris from the
dishes by washing them in a beaker filled with water. The dishes then dried for a day. To attach
the 1.5 glass coverslip 25mm, an adhesive will be needed. To make the adhesive, a mixture of
Sylgard184 base and curing agent will be needed. The ratio of the adhesive is 10 Sylgard184 to 1
curing agent. We cut a 3ml transfer pipette to spread the adhesive onto the petri dish. Using the
pipette, we placed the adhesive around the hole on the bottom outside surface. Let the petri
dishes dry off for two days at room temperature.
Cell Culture, RNAi, and induction of expression of mRFP-KLP10A wild type and S573E
Schneider S2 cells were cultured in Schneider’s Drosophila medium (Gibco Brl)
supplemented with 10% heat-inactivated Fetal Calf Serum, and incubated at room temperature.
7. Kam 5
For microscopy, cells were plated on home-made glass bottom petri dishes containing complete
S2 medium. S2 cells were cotransfected with plasmids to constitutively express GFP-tubulin, and
mRFP-KLP10A (wt, S573E) (Figure 1). Expression of exogenous KLP10A was induced by
adding 300 µM CuSO4 to the S2 cell medium 12 hr before imaging. To deplete endogenous
KLP10A, DNA templates were amplified from S2 cell cDNA using the following primer
sequences: forward, CGAAACTAAAAAATTGTGTTGC, reverse,
CATGTCCATGATCCTTCCTC. The T7 promoter sequence
(TAATACGACTCACTATAGGG) was added to the 5’ end of each primer. Then, the double
stranded RNA was generated by in vitro transcription using the Megascript T7 lit (Ambion) and
following the manufacturer’s instruction (Clemens et al 2000, Nye et al 2014). Cells were treated
with 20 µg of dsRNA on day 0, and 40 µg on day 2, and 4 of the treatment period. On day 5,
cells were prepared for immunofluorescence microscopy as described below.
Figure 1. A schematic representation of the KLP10A wild type and mutant constructs used in this
study. Full length KLP10A contains a N-terminal domain, a neck, a motor domain located in the
middle , and a C-terminal domain. Phosphorylation of KLP10A occurred on the serine S573
located in the motor domain. Serine was replaced by glutamic acid (E) that mimics the
phosphorylation status. Monomeric red fluorescent protein (mRFP) was attached towards the
amino end of KLP10A.
8. Kam 6
Immunofluorescence and Imaging of Cultured Cells (Methanol Fixation)
We prepared anhydrous methanol in glass beaker and placed it in a -20 C freezer
overnight. We quickly discarded the medium and submerged the small dishes in cold methanol.
We then placed the beaker back in the -20 C freezer for thirty minutes. Then we discarded the
methanol and washed the glass cover slips two times with PBS. Next, we rehydrated and
permeabilized the cells in 0.1% Triton X-100 in PBS. Cells were incubated at room temperature
for 10 minutes. We washed the cells with PBS three times. We then blocked the cells with
Blocking buffer (5% Normal Goat Serum “NGS”, 0.1% Triton X-100,2mM NaN3, in PBS).
Cells were incubated at room temperature for 1 hour. We prepared the primary antibodies using
Rabbit-anti KLP10A (1:500 um) and Mouse anti-tubulin (1:500 um) in blocking buffer. Cells
were then put in an incubator at 37 C for 1 hour and 30 minutes. Primary antibody solution was
discarded and washed out every five minutes with PBS three times. Secondary antibodies were
prepared in blocking buffer, Cy2 (green) goat anti-mouse 1:800 dilution, Rhodamine (red) goat
anti-rabbit 1:800 dilution. We then added 200-300 µl to cover slips. Cells were incubated for 1
hour and 30 minutes at room temperature in the dark. Then we discarded secondary antibody
solution and washed the coverslips out with PBS ten times every two minutes. 15µl of mounting
medium was added (1% propyl gallate, 100mM Tris, pH 8.0, 50% glycerol) on to glass slides
and put right on the mounting medium the glass cover slip. Next, we removed the excess
mounting medium with a vacuum. Coverslips were sealed with nail polish or nail polish
hardener. Slides were stored in cold and dark area.
9. Kam 7
Confocal Microscopy
Imaging of fixed and live cells was performed using a Confocal Spinning –Disk System
(Ultra View RS3; Perkin Elmer) attached to an inverted microscope (TE-200S, Nikon). The
objectives used were Plan Apo 100X and 60X with 1.4 NA both of them). Images were captured
using a cooled charge-couple device (CCD) camera (OrcaER, Hamamatsu Photonics). The
camera was controlled by the Ultra View acquisition software.
RESULTS
Drosophila KLP10A localizes to microtubule ends and its distribution depends on the type of
microtubule array in S2 cells during interphase.
To start this study, we imaged the cellular distribution of endogenous KLP10A in fixed
S2 cells. Indirect immunofluorescent labeling of KLP10A using a previously characterized
affinity purified anti-Rabbit antibody (Rogers et al 2004). S2 cells were plated on Concanavalin
A coated glass coverslips which caused the cells to spread and flatten. This allowed the
microtubule cytoskeleton to be easily imaged.
The immunolocalization of microtubules showed the characteristic radial array of the
microtubule network (Figure 2A) or the extended arrangement of microtubules (Figure 2B). In
either case, individual plus ends of microtubules extend close to the cell cortex making them
easy to image (Figure 2A, and 2B, left column). Under these conditions, endogenous KLP10A
showed staining along the plus end of microtubules with the linear streaks on radial microtubules
(Figure 2A, middle and right columns), or the concentrated streaks towards the microtubule tips
of the extended arrangements of microtubules (Figure 2B, middle and right columns) as
previously observed (Mennella et al 2005).
10. Kam 8
Next we imaged the cellular distribution of KLP10A depleted cells to determine how the
loss of KLP10A impacts microtubules in interphase cells. We used RNAi to determine how the
loss of KLP10A impacts microtubules in interphase cells. The loss of KLP10A indicates that the
antibody staining is specific and that the KLP10A is gone after RNAi treatment. We also
noticed an evident change in microtubule morphology in KLP10A depleted S2 Cells. The
absence of KLP10A changed the morphology of the microtubules suggesting that KLP10A is
required to finely regulate the organization of microtubules close to the cortex (Figure 3A and
3B, left and right columns). The difference of morphology of microtubules in KLP10A depleted
cells could be a result in the change of microtubule dynamicity like in the reduction of
catastrophe as previously observed in S2 KLP10A depleted cells (Zhang et al 2011).
11. Kam 9
Figure 2. Immunofluorescent images of fixed wild type cells (A) An S2 cells with KLP10A
decorated along the ends of microtubules as indicated by the red arrows. Dotted lined boxes are
the relative zoom area. (B) Another wild type cell with KLP10A attached to the plus end of
microtubules
12. Kam 10
Figure 3. Immunofluorescent images of fixed S2 cells depleted of KLP10A The dotted line box
represents the relative area of the zoomed image (A) A S2 cell depleted of KLP10A. It is shown
in the zoomed images that there is an absence of localization of KLP10A on the microtubule
ends. (B) Another example of a fixed S2 cell depleted of KLP10A. Left and right columns show
microtubule bundling.
13. Kam 11
Effect of Phosphorylation on the intracellular localization and activity of KLP10A.
We examined the in vivo localization of KLP10A by generating S2 cell lines transfected
with plasmids encoding monomeric Red Fluorescent Protein (mRFP) tagged KLP10A wild type
or a phosphomimic KLP10A whose Serine at 573 position was replaced with Glutamic acid
(mRFP). Both KLP10A and phosphomimic KLP10A were under the control of a copper-
inducible promoter. These same cell lines expressed GFP-tagged tubulin were under the control
of an actin promoter. Only cells that expressed both GFP tubulin and mRFP KLP10A/S573E
were imaged and analyzed in this study.
Firstly, we determined the localization of mRFP KLP10A wild type in cells during
interphase. We focused our attention on the microtubules that extend along the lamella because
this region of the cell allows clear visualization of individual microtubules (Figure 4).
Microtubules grew in a straight fashion until they touched the cell cortex (Insets figure 4A and
4B). Once the microtubule plus ends reach the cortex, some microtubule tips paused. We
observed that KLP10A moved along the growing plus ends of microtubules.
Interestingly, we observed some microtubules depolymerizing from the minus end as
soon as they reached the cell cortex (Figure 5A, blue star). Short microtubule fragments were
often observed at the cell edge. The dynamics of these short microtubules ranged from complete
depolymerization (Figure 5B, red arrow) to polymerization and depolymerization (Figure 5A,
green star). KLP10A targeting to the plus end of microtubules (Figure 4A and 4B, middle and
right columns) is in agreement with what has been previously reported (Mennella V et Al 2005,
2009). The presence of short microtubule fragments at the periphery resembles the Patronin
depleted phenotype previously seen (Goodwin et al 2010), however, these cells did not show a
decrease in the density of microtubule cytoskeleton.
14. Kam 12
We next wanted to determine whether the expression of phosphomimic version of
KLP10A (referred to hereafter as S573E) impacts the cellular distribution of KLP10A and the
morphology of microtubules. Analysis of live S573E cells showed a striking change in the
cellular distribution of KLP10A S573E relative to wild type KLP10A. There is a strong and even
localization of S573E along microtubule segments close to the cortex instead of microtubule tip
localization seen in wild types KLP10A (Figure 6A and 6B, middle and right columns). Also, the
intensity of GFP tubulin suggests that there is more than one microtubule in the segments
decorated by the S573E mutant (Figure 6A and 6B left column). This result suggests that S573E
mutant promotes microtubule bundling. It has been previously reported that phosphorylation of
the motor domain of KLP10A lowered its depolymerizing activity without affecting its affinity
for the microtubule lattice. However, this result raises new questions about the local cellular
changes on phosphorylated KLP10A that would modify its distribution on microtubules. Another
interesting hypothesis is that phoshorylation of KLP10A somehow would affect its affinity and
interaction with other microtubule binding proteins. Some short microtubule fragments were also
seen, but these fragments did not show complete depolymerization, but instead displayed
growing and shrinking behavior which is probably due to the inactive depolymerization activity
of S573E. Endogenous KLP10A would contribute in some extent to depolymerization of
fragments of microtubules, but it might be that the activity of endogenous KLP10A was
overcome by the inactive S573E or the pool of endogenous KLP10A was also inactivated by
endogenous phosphorylation.
15. Kam 13
Figure 4. Localization of exogenous wild type KLP10A. (A) Live S2 cells during interphase
expressing mRFP, and GFP-tubulin. The dotted line box shows location of zoomed image.
Zoom 1 and Zoom 2 show that KLP10A is located on the tips of microtubules indicated by the
red arrows. (B) Image of another live S2 cell demonstrating the same localization. It is evident in
that KLP10A is located at the tips of the microtubules indicated by the red arrows.
16. Kam 14
Figure 5. Time-lapse fluorescence imaging of microtubules in S2 cells expressing mRFP-
KLP10A. (A) Sequence of images that show short microtubules under depolymerization. The
minus end is seen to depolymerize in a microtubule that depolymerized and regrew (red star)
while another microtubule kept depolymerizing (green star). (B)Another example of short
microtubules that completely depolymerized (red star).
17. Kam 15
Figure 6. Localization of phosphomimic KlP10A, Mutant E. (A) S2 Mutant E. Tubulin was
tagged with GFP. Mutant E was tagged with mRFP. Dotted lined box indicates relative area of
zoomed image. It is clear that mutant E binds along the microtubule lattice as indicated by the
red arrows. (B) Another example of an S2 Mutant E. Like figure 2A, mutant E binds along the
microtubule lattice as indicated by the red arrows.
18. Kam 16
DISCUSSION
In this study, we investigated the role of the phosphorylation of the internal motor
domain of KLP10A on its intracellular distribution and how it regulates the interphase
microtubule cytoskeleton of S2 cells. Spread and flattened S2 cells allowed us to image
individual and dispersed microtubules in fixed S2 cells. KLP10A was found to decorate discrete
regions of microtubules with preference for the tips of microtubules close to the cell cortex.
However, when using dsRNAi against KLP10A to deplete endogenous KLP10A, no KLP10A
was detected, and the microtubule cytoskeleton became dense and the individual microtubules
that reached the cell cortex switched to bundles of densely packed microtubules. This result
showed that the KLP10A depleted cells lose the capacity to regulate the abundance, size and
distribution of microtubules. Also, we noticed that while cells expressing wild type KLP10A,
microtubules grew in a straight manner perpendicular to the cells cortex, in the KLP10A
depleted cells the bundles of microtubules that reached the cells cortex tended to be bent. This
dramatic appearance of bent microtubules suggests that there is a lack of KLP10A
depolymerizing activity to stop microtubules growing close to the cell cortex.
Previous descriptions of the role of phosphorylation of motor domain of KLP10A noted
that KLP10A wild type is recruited on the plus ends of polymerizing microtubules, where it
promotes depolymerization by stimulating catastrophe. Taking advantage of live cell imaging of
S2 cells expressing wild type and S573E mutant of KLP10A, we found that the expression of a
wild type KLP10A favored the generation of short fragments of microtubules that might or might
not depolymerize.
Our time lapse imaging and still images revealed that KLP10A localizes primarily on the
plus end of microtubules. Phosphomimic KLP10A, on the other hand, was localized on long
19. Kam 17
segments of microtubules. This altered distribution indicates that endogenous KLP10A controls
the length and morphology of the plus ends of microtubules. It was also seen that the
microtubules seemed to bundle. These results lead us to believe that KLP10A could possibly
affect the interaction with other microtubule binding proteins.
CONCLUSION
In conclusion, our studies indicate that phosphorylation of KLP10A’s motor head domain
has profound effects on the shape and morphology of interphase microtubules. The
depolymerization activity of KLP10A is essential for microtubule organization and dynamics.
Phosphorylation of the motor domain at the right time and the right place ensures that KLP10A
could act locally where it is required. This phosphorylation could also be important to regulate
the localization of KLP10A on the microtubules, possibly controlling its interaction with other
proteins that are also important to control interphase microtubule dynamics. The results of this
study, opens new venues since the phosphorylation of the motor domain of depolymerizing
kinesins present on mammalian cells could be a mechanism to control the organization of
microtubules important for adhesion or migration.
20. Kam 18
ACKKNOWLEDGEMENTS
First and foremost I would like to thank my parents for supporting my research. I
especially like to thank my mom for driving me to the laboratory every weekday over the
summers. I would also like to thank Edgemont’s Science Scholars program for encouraging
students like me to pursue scientific research. That being said, I would like to thank my science
scholars teacher Maria Decandia and Dylan Prendergast for making the Science Scholars
Program possible. My thanks are also due to biology and chemistry teacher, Ms. Sharon Baylis,
for guiding and teaching me the fundaments of science. My thanks are also due to Brian
O’Rourke and Rabab Charafeddine for helping me in the lab. Last but not least I would like to
thank my mentors Juan Daniel Diaz Valencia and David James Sharp for supervising and
guiding me while I conducted my research.
21. Kam 19
References
Andrews, Paul D., Yulia Ovechkina, Nick Morrice, Michael Wagenbach, Karen Duncan, Linda
Wordeman, and Jason R. Swedlow. "Aurora B Regulates MCAK at the Mitotic
Centromere." Developmental Cell 6.2 (2004): 253-68. Web.
De Luca, Maria, Leticia T. Brunetto, Italia A. Asteriti, Maria Giubettini, Patrizia Lavia, and Giulia
Guarguaglini. "Aurora-A and Ch-TOG Act in a Common Pathway in Control of Spindle Pole
Integrity." Oncogene 27.51 (2008): 6539-549. Web.
Ganem, Neil J., Kristi Upton, and Duane A. Compton. "Efficient Mitosis in Human Cells Lacking
Poleward Microtubule Flux." Current Biology 15.20 (2005): 1827-832. Web.
Lan, Weijie, Susan L. Kline-Smith, Sara E. Rosasco, Gregory A. Barrett-Wilt, Jeffrey Shabanowitz,
Donald F. Hunt, Claire E. Walczak, and P.Todd Stukenberg. "Aurora B Phosphorylates
Centromeric MCAK and Regulates Its Localization and Microtubule Depolymerization
Activity." Current Biology 14.4 (2004): 273-86. Web.
Lewin, Benjamin, George Plopper, David Sharp, and Eric Sikorski. Lewin's Cells. Burlington: Jones &
Bartlett Learning, 2015. Print.
Mennella, Vito, Dong-Yan Tan, Daniel W. Buster, Ana B. Asenjo, Uttama Rath, Ao Ma, Hernando J.
Sosa, and David J. Sharp. "Motor Domain Phosphorylation and Regulation of the Drosophila
Kinesin 13, KLP10A." The Journal of Cell Biology186.4 (2009): 481-90. Web.
Mennella, Vito, Gregory C. Rogers, Stephen L. Rogers, Daneil W. Buster, Ronald D. Vale, and David
J. Sharp. "Functionally Distinct Kinesin-13 Family Members Cooperate to Regulate Microtubule
Dynamics during Interphase." Cell Biology 7.3 (2005): 235-45. Web.
Nye, Jonathan, Daniel W. Buster, and Gregory C. Rogers. "The Use of Cultured Drosophila Cells for
Studying the Microtubule Cytoskeleton." Springer Protocols 1136 (2014): 81-101. Web.
22. Kam 20
Rogers, Gregory C., Stephen L. Rogers, Tamara A. Schwimmer, Stephanie C. Ems-McClung, Claire E.
Walczak, Ronald D. Vale, Jonathan M. Scholey, and David J. Sharp. "Two Mitotic Kinesins
Cooperate to Drive Sister Chromatid Separation during Anaphase." Nature 427.6972 (2004):
364-70. Web.
Sharp, David. Mitosis: Methods and Protocols. Totowa: Humana, 2014. Print.
Tan, Dongyan, Ana B. Asenjo, Vito Mennella, David J. Sharp, and Hernando Sosa. "Kinesin-13s Form
Rings around Microtubules." The Journal of Cell Biology 175.1 (2006): 25-31. Web.
Walczak, Claire E., Sophia Gayek, and Ryoma Ohi. "Microtubule-Depolymerizing Kinesins."
Review. Annual Review of Cell and Developmental Biology 29 (2013): 417-41. Web.
Zhang, Dong, Kyle D. Grode, Shannon F. Stewman, Juan Daniel Diaz-Valencia, Emily Liebling,
Uttama Rath, Tania Riera, Joshua D. Currie, Daniel W. Buster, Ana B. Asenjo, Hernando J.
Sosa, Jeniffer L. Ross, Ao Ma, Stephen L. Rogers, and David J. Sharp. "Drosophila Katanin Is a
Microtubule Depolymerase That Regulates Cortical-microtubule Plus-end Interactions and Cell
Migration." Nature Cell Biology 13.4 (2011): 361-70. Web.
Zhang, Xin, Stephanie C. Ems-McClung, and Claire E. Walczak. "Aurora A Phosphorylates MCAK to
Control Ran-dependent Spindle Bipolarity." Molecular Biology of the Cell 19.7 (2008): 2752-
765. Web.
