1. 1 | K l e m m
Site-directed mutagenesis of K36 in global transcription factor
cAMP receptor protein
Lucas C. Klemm
Loyola University Chicago, Molecular Biology Lab, BIOL 390, Fall 2013
Abstract
cAMP receptor protein is a global transcription factor in Escherichia coli that activates
transcription for hundreds of promoters. Protein acetylation affects the structure/function
relationship of proteins. Acetylation can alter properties of proteins such as DNA binding
affinity, protein-protein interactions, protein stability, localization, and overall function.
Acetylation of lysine residues in cAMP receptor protein can provide insight as to how
acetylation affects the regulation of gene transcription within cells. cAMP receptor protein was
site-direct mutagenized at lysine residue 36 to alanine.
Introduction
Cyclic AMP receptor protein (CRP;
also known as catabolite activator protein,
CAP) is a global transcription factor found
in E. coli that activates transcription at more
than 100 promoters.1
CRP only functions in
the presence of cAMP, an allosteric effector
molecule which binds to CRP. When CRP is
functionally active, it binds to its DNA
recognition site that is in or near a target
promoter, facilitating the binding of RNA
polymerase (RNAP) to allow initiation of
transcription.3
CRP consists of two identical
subunits of 209 residues each that form a
dimer. The N-terminal domain is responsible
for dimerization and the binding of cAMP
while the C-terminal domain is involved in
DNA binding.3
The CRP dimer interacts
with DNA, binding to a 22 base pair
recognition sequence (5’-
AATGTGATCTAGATCACATTT-3’) with
a helix-turn-helix motif.1
There are two classes of simple
CRP-dependent promoters that are based on
the location of the DNA binding site for
CRP and mechanism of transcription
activation. In class I promoters, the CRP
binding site is located upstream of the core
promoter. Transcription is activated by a
single protein-protein interaction between
CRP and RNAP that leads to a recruitment
mechanism resulting in the RNAP-promoter
closed complex. In class II promoters, the
CRP binding site overlaps the core promoter
at the -35 element. There are three sets of
protein-protein interactions between CRP
and RNAP that lead to recruitment and post-
recruitment mechanisms. RNAP binds to the
promoter with the help of CRP and forms
the RNAP-promoter closed complex that is
isomerized to the RNAP-promoter open
complex.1
CRP is involved in regulating a
number of key processes in E. coli. One
important process is catabolite repression.2
Catabolite repression is a form of cellular
regulation that happens when the cell is
presented with two or more carbon sources
and one is preferentially used.4
CRP
mediates catabolite repression for many
operons that encode enzymes in central
carbon metabolic pathways such as the
Krebs cycle. It also mediates catabolite
repression for transporters and enzymes that
initiate carbon metabolism. CRP also
mediates strong catabolite repression of
cytoplasmic stress response proteins
including chaperone proteins and cold/heat
shock proteins among others.2
The
involvement of CRP in catabolite repression
makes it a crucial factor in helping regulate
central metabolism within the cell.

2. 2 | K l e m m
Protein acetylation is a post-
translational modification (PTM) where an
acetyl group is added to either the N-
terminus of a protein or the ε-amine of a
lysine residue. PTM to proteins is a crucial
part in regulating a wide range of processes.
PTMs are an important part in explaining
the diversity of protein function and defining
the structure/function relationship in
proteins. These modifications alter the
structure/function relationship, impact
protein complex formation, enzyme
catalysis, and other biomolecular
interactions.5
There are two types of protein
acetylation. The first is Nα
-acetylation in
which the acetyl group is transferred to the
amino terminus of a protein from an acetyl
donor. Nα
-acetylation is an irreversible
modification. The other type of acetylation
is Nε-acetylation in which the acetyl group is
transferred to the ε-amino group of a lysine
residue. In contrast to Nα
-acetylation, this is
considered to be a reversible and dynamic
modification that allows it to be used in a
regulatory capacity. Nε-acetylation may alter
the size, shape, or conformation of the
protein.6
A reduction in charge results from
the unreactive amide produced from
acetylation. The amide group loses its ability
to become protonated resulting in a loss of
charge.5
The changes in size, shape, or
conformation of the protein can alter DNA
binding affinity, protein-protein interactions,
and protein stability, localization, and
function.6
Protein acetylation plays a role in
metabolism. It is suggested that the flux of
carbon can be regulated via acetylation. Nε-
acetylation is a common modification of
many enzymes involved in central metabolic
processes. The profile of acetylated central
metabolic enzymes changes in the presence
of different carbon sources. This suggests
that acetylation regulates metabolic flux by
directing carbon down different pathways
depending upon the particular conditions a
cell is experiencing.
CRP has lysine residues meaning it
can be acetylated. Acetylation of CRP may
affect its function in a number of ways. Two
of the most important effects are a possible
change in DNA binding affinity and
alteration of protein-protein interactions.
Since CRP is a transcription factor, it binds
to DNA with protein-DNA interactions. If
CRP’s DNA binding affinity is changed, it
may not be as efficient in binding to target
promoters to help initiate transcription of
particular genes. Altered protein-protein
interactions may result in CRP not binding
RNAP as well or may even bind it too well
resulting in decreased efficiency of
transcription.
The effect of protein acetylation of
lysine residues can be investigated by
mutating those particular residues and
observing the effects on the protein function.
This can be done use site-directed
mutagenesis to change the lysine residues in
CRP to other amino acids. CRP was mutated
at lysine residues K36 to alanine using site-
directed mutagenesis. A mutation in alanine
will mimic the loss of lysine. Mutation of
CRP at this lysine residue will potentially
show changes in protein function and offer
insight into how protein acetylation may
affect transcription and thus gene regulation
within a cell.
Materials and Methods
Transformation protocols
Wild-type CRP was provided by the
Wolfe lab at Stritch School of Medicine as
pDCRP (plasmid pBR322 + wild-type CRP
insert; 5,454bp). pDCRP was transformed
into DH5α cells (Invitrogen) using heat
shock. Cells were incubated on ice for 30
minutes. This was followed by heat shock at
42˚C for 30 seconds, and two minute
incubation on ice. Cells were incubated in
250 μL of pre-warmed (37˚C) SOC

3. 3 | K l e m m
(Corning Cellgro) for one hour at 37˚C and
250 rpm. 20 and 200 μL dilutions were
plated on LB-amp and incubated at 37˚C
overnight.
Mutant strand CRP plasmid was
transformed into XL1-Blue Supercompetent
Cells (Agilent Technologies) according to
the protocol accompanying the QuikChange
II Site-Directed Mutagenesis Kit (Agilent
Technologies). SOC (Corning Cellgro) was
used in place of NZY+
broth. The
pWhitescript plasmid (Agilent
Technologies) control protocol was not
performed. LB-amp plates were incubated at
37˚C for 25 hours.
Cultures, Glycerol Stocks, and Minipreps
Liquid cultures of 1x LB/amp were
inoculated with colonies containing pDCRP
or mutant CRP. Cultures were incubated at
37˚C and 225 rpm for 12-18 hours. Post-
incubation, 500 μL of each bacterial culture
was put in a final concentration of 18.5%
glycerol and stored at -80˚C.
All minipreps were prepared
according to the protocol accompanying the
QIAprep Spin Miniprep Kit (Qiagen).
Optional step 7 was performed (addition of
Buffer PB, Qiagen) and 30 μL of Buffer EB
(Qiagen) was used to elute instead of 50 μL
in step 10.
DNA quantitation of minipreps
1:100 dilutions of minipreps were
prepared with ddH2O in UVettes
(Eppendorf). Spectrophotometer readings
were taken at 260nm and 280nm to
determine concentration and purity.
Verification for presence and size of
plasmids
Restriction enzyme digests with 20
units of PstI (New England BioLabs, 20,000
U/mL) were carried out in 1x bovine serum
albumin (New England BioLabs) and 1x
Reaction Buffer #3 (New England BioLabs).
Restriction digests were analyzed
with agarose gel electrophoresis. 1% agarose
(OmniPur) gels were prepared in 1x TAE
and ethidium bromide (GibcoBRL) at a final
concentration of 0.0002 mg/mL. Samples
were prepared with Gel Loading Dye Blue
(New England BioLabs) at a final
concentration of 1x. Gels were run for one
hour at 100V.
Site-directed mutagenesis
Site-directed mutagenesis was
performed according to the protocol
accompanying the QuikChange II Site-
Directed Mutagenesis Kit (Qiagen). The
primers used for mutant strand synthesis
were as follows for K36 to A (mutation
underlined):
forward, 5’-
GCACGCTTATTCACCAGGGTGAAGCG
GCGGAAACGCTGTAC-3’;
reverse, 5’-
GTACAGCGTTTCCGCCGCTTCACCCT
GGTGAATAAGCGTGC-3’. The PCR
cycling conditions used for mutant strand
synthesis were as follows: segment 1, 1
cycle, 95˚C, 30s; segment 2, 16 cycles,
95˚C, 30s; 55˚C, 1min; 68˚C 5.5min.
Sequencing
10 μL of each putative mutant
plasmid was mixed with the sequencing
primer at a final concentration of 5 μM. The
sequencing primer used is as follows: Crp
Upstream (sequencing): 5’-
AAGCGAGACACCAGGAGACACAAA-
3’. Samples were sent to Genewiz for
sequencing.
Results
Verification of pDCRP template
The presence and quality of the
pDCRP template had to be verified for use
in mutant strand synthesis reactions. The
pDCRP template was verified using a
restriction enzyme digest with PstI. PstI is a

4. 4 | K l e m m
one cutter of pDCRP that linearized the
plasmid to determine the size and presence
of plasmid DNA in the sample. The
restriction digest was analyzed with gel
electrophoresis and produced a band at the
desired size of about 5.4kb (Figure 1).
Verification of mutant pDCRP plasmid
Presence of mutant pDCRP was
verified using restriction enzyme digests
with PstI, a one-cutter of pDCRP. The
restriction digests were analyzed with gel
electrophoresis and produced bands at the
desired size of about 5.4kb in all six clones
(Figure 2, 3).
Figure 2. 1% agarose gel of PstI restriction enzyme
digests of mutant CRP clones 1, 2, and 3. Lane 1
contains the Quick-Load 1 kb DNA Ladder (New England
BioLabs). Lanes 3, 5, and 7 contain uncut K36A CRP
clones 1, 2, and 3. Lanes 4, 6, and 8 contain K36A CRP
mutant clones 1, 2, and 3 digested with PstI. All samples
were prepared with 1x Gel Loading Dye Blue (New
England BioLabs).
Figure 1. 1% agarose gel of PstI restriction enzyme
digest of wild-type pDCRP template. Lane 1
contains the Quick-Load 1 kb DNA Ladder (New
England BioLabs). Lane 3 and 5 contain uncut
miniprep of pDCRP. Lane 4 contains pDCRP digested
with PstI. All samples were prepared with 1x Gel
Loading Dye Blue (New England BioLabs).
3kb
4kb
5kb
6kb
1 3 4 5
1 3 4 5 6 7 8
3kb
4kb
5kb
6kb

5. 5 | K l e m m
Sequencing of mutant pDCRP clones
To be sure that only the desired
mutation (K36 to A) was induced, the
mutant pDCRP clones were sequenced.
Clones were sent to Genewiz for
sequencing. Sequencing data from Genewiz
was aligned against the wild-type CRP gene
(J01598.1) using BLAST. Codon 36 was
mutated from AAA to GCG in 5 of 6 clones
(Figure 4). The base at position 489 was a C
in all six clones versus a T in the wild-type
CRP gene (Figure 5). K36 was successfully
mutated to alanine in five of six mutant
pDCRP clones.
Discussion
Lysine residue K36 was successfully
mutated to alanine in five of six clones.
Mutation of K36 to arginine and glutamine
was unsuccessful. The successful mutation
of K36 to alanine can be used to explore the
effects of a loss of lysine at that position on
the function of CRP.
Based on information from Bob
Davis in the Wolfe lab, the base at position
489 in CRP could possibly be a C in the
plasmid pDCRP as opposed to the T found
in non-insert CRP. The sequencing data
Figure 4 (above). BLAST alignment of
sequencing results with wild-type
CRP gene (J01598.1). Codon 36
mutated from AAA to GCG.
Figure 5 (below). BLAST alignment of
sequencing results with wild-type
CRP. Base at position 489 is mutated
to a C versus the T found in wild-type.
Figure 3. 1% agarose gel of PstI restriction enzyme
digests of mutant pDCRP clones 4, 5, and 6. Lane 1
contains the Quick-Load 1 kb DNA Ladder (New England
BioLabs). Lanes 3, 5, and 7 contain uncut K36A CRP
clones 4, 5, and 6. Lanes 4, 6, and 8 contain K36A CRP
mutant clones 4, 5, and 6 digested with PstI. All samples
were prepared with 1x Gel Loading Dye Blue (New
England BioLabs).
3kb
4kb
5kb
6kb
1 3 4 5 6 7 8

6. 6 | K l e m m
showed a C to be present over T at position
489 in all six mutant clones. Based on this
finding, it is unlikely that this is an
extraneous mutation to the gene.
Initially, mutations of K36 to
alanine, arginine, and glutamine were
attempted. Mutations to K153 and K202
were not attempted. After the site-directed
mutagenesis protocol, bacteria were
transformed with the mutant plasmids
(K36A, K36R, K36Q). Incubation of the
transformed bacteria resulted in no colonies
present on any of the plates. This could have
been due to an experimental error (not
pipetting the mutant plasmid solution
directly into the cells) or a failed mutant
strand synthesis reaction. An error in
transformation would result in the bacteria
not having antibiotic resistance to
ampicillin, resulting in no colonies forming
on LB/amp plates. The mutant strand
synthesis PCR cycling conditions from the
protocol accompanying the QuikChange
XLII Site-Directed Mutagenesis Kit
(Qiagen) instead of the proper cycling
conditions found in the QuikChange II Site-
Directed Mutagenesis Kit (Qiagen). An error
in the mutant strand synthesis reaction may
entail something like a mutation to the
ampicillin resistance gene resulting in its
malfunction. That would render bacteria
transformed with it unable to survive
antibiotic selectivity on LB/amp plates.
Another possible problem is the
quality or condition of the template DNA
used for the site-directed mutagenesis
reaction. In the initial set of reactions, the
pDCRP template was not verified in any
manner. It is possible the pDCRP plasmid
DNA could have been nicked or linearized.
This would result in an unsuccessful mutant
strand synthesis reaction since it requires
double-stranded circular DNA (i.e.
plasmids). If the DNA is not circular, the
polymerase will run off of the template and
nothing will get amplified. Transforming
bacteria in the proceeding step with no
plasmid would result in no antibiotic
resistance and therefore, no growth.
Once the proper cycling conditions
were used and more care was exercised, the
site-directed mutagenesis reaction and
transformation led to a successful mutation.
Following the same procedure whilst
exercising more care could result in
successful mutations of K36 to arginine and
glutamine in addition to the already
successful alanine mutation.
The next step for the project would
be to induce the remaining eight mutations
in CRP using site-directed mutagenesis.
After inducing all of the mutations, the
Wolfe lab plans to introduce the mutant
CRP gene into bacteria. The acetylation
mimics will be used in conjunction with a
promoter-lacZ fusion that depends solely on
CRP for activation to monitor promoter
activity using β-galactosidase assays. This
will help determine if a particular
acetylation state will have an effect on the
transcription of lacZ, and therefore CRP
function. This information may lead to a
better understanding of how cells regulate
gene transcription through acetylation.
Acknowledgements
Thanks to Hamza El-Natour for sharing the lab work during the course of the project. Thanks to
Dr. Emma Feeney and Dr. James Lodolce for guidance and assistance in troubleshooting. Thanks
to Dr. Alan Wolfe and Bob Davis for providing the pDCRP sample used to start the project.
References

7. 7 | K l e m m
1) Lawson CL, Swigon D, Murakami KS, Darst SA, Berman HM, Ebright RH (2004). Catabolite
activator protein: DNA binding and transcription activation. Curr Opin Struct Biol. 14(1): 10-20.
2) Gosset G, Zhang Z, Nayyar S, Cuevas WA, Saier MH Jr (2013). Transcriptome analysis of
Crp-dependent catabolite control of gene expression in Escherichia coli. J Bacteriol. 186(11):
3516-24.
3) Busby S, Ebright RH (1999). Transcription Activation by Catabolite Activator Protein (CAP).
J. Mol. Biol. 293: 199-213.
4) Deutscher J (2008). The mechanisms of carbon catabolite repression in bacteria. Curr Opin
Microbiol. 11(2): 87-93.
5) Cain JA., et al (2013). Beyond gene expression: The impact of protein post-translational
modifications in bacteria. J Prot.
6) Hu LI, Lima BP, Wolfe AJ (2010). Bacterial protein acetylation: the dawning of a new age.
Mol Microbiol. 77(1): 15-21.