This document discusses separating and characterizing DNA-binding proteins from rabbit seminal fluid using ion exchange chromatography. Seminal fluid was found to contain both DNase activity that degrades exogenous DNA, as well as a DNA retardation activity that binds and inhibits the movement of DNA during electrophoresis. Positively charged proteins were separated from seminal fluid using anion exchange chromatography. The positively charged fractions were found to contain DNA retardation activity but not DNase activity, indicating these are separate inhibitory mechanisms present in seminal fluid. This is the first study to separate and distinguish between different DNA-inhibiting activities in rabbit or other mammal seminal fluid using a non-radioactive method.
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
Objective: To investigate the changes in the retina due to deltamethrin toxicity and the process in cell inflammation and apoptosis.
Study Design: Sixteen Wistar albino rats were randomly divided into two groups as control (n=8) and deltamethrin (n=8) groups. Saline was given to the control group, and 0.5 mL of 5 mg/kg deltamethrin was given to the deltamethrin group for 14 days each. Blood was collected for biochemical analysis. Retinal tissue was processed for histological examination.
Results: Compared to the control group, MDA levels were high while GSH and CAT levels were low in the deltamethrin group. Histopathological analysis showed spaces between the pigment epithelium, irregularity in the delimiting membrane, degenerated ganglion, cone and bacillus cell, pyknotic nuclei, thinned inner limitation membrane, and thickened vascular wall. The control group showed FAS expression in the pigment layer limiting membranes, in the nuclei of many cone and bacillus cells, and ganglion cells in the control group sections. In the deltamethrin group, FAS expression was observed in the inner and outer limiting membranes of the pigment epithelium, cone and bacillus cells, and ganglion cell nuclei. In the control group, negative NOS expression in the pigment epithelium and outer limiting membranes, internal limitation membrane, and ganglion cells in the cone and bacillus cell nuclei were observed. In the deltamethrin group, NOS expression was positive in the pigment epithelium, cone and bacillus, and ganglion cell nuclei.
Conclusion: We suggest that deltamethrin toxicity induced apoptotic process due to increased inflammation in the retina and may cause visual impairment as a result of neural damage.
Keywords: deltamethrin, FAS, insecticides, NOS, nitric oxide synthase, retina
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
Objective: To investigate the changes in the retina due to deltamethrin toxicity and the process in cell inflammation and apoptosis.
Study Design: Sixteen Wistar albino rats were randomly divided into two groups as control (n=8) and deltamethrin (n=8) groups. Saline was given to the control group, and 0.5 mL of 5 mg/kg deltamethrin was given to the deltamethrin group for 14 days each. Blood was collected for biochemical analysis. Retinal tissue was processed for histological examination.
Results: Compared to the control group, MDA levels were high while GSH and CAT levels were low in the deltamethrin group. Histopathological analysis showed spaces between the pigment epithelium, irregularity in the delimiting membrane, degenerated ganglion, cone and bacillus cell, pyknotic nuclei, thinned inner limitation membrane, and thickened vascular wall. The control group showed FAS expression in the pigment layer limiting membranes, in the nuclei of many cone and bacillus cells, and ganglion cells in the control group sections. In the deltamethrin group, FAS expression was observed in the inner and outer limiting membranes of the pigment epithelium, cone and bacillus cells, and ganglion cell nuclei. In the control group, negative NOS expression in the pigment epithelium and outer limiting membranes, internal limitation membrane, and ganglion cells in the cone and bacillus cell nuclei were observed. In the deltamethrin group, NOS expression was positive in the pigment epithelium, cone and bacillus, and ganglion cell nuclei.
Conclusion: We suggest that deltamethrin toxicity induced apoptotic process due to increased inflammation in the retina and may cause visual impairment as a result of neural damage.
Keywords: deltamethrin, FAS, insecticides, NOS, nitric oxide synthase, retina
Objective: To identify interstitial cells of Cajal (ICC) in the common bile duct of Kunming mice.
Study Design: Common bile ducts obtained from the Kunming mice were prepared for immunohistochemical investigations using the c-kit antibody. Immunoelectron microscopy was used to detect the expression of c-kit in the ICC of the common bile duct. Transmission electron microscopy showed ultrastructure of ICC in the murine bile duct. Reverse transcription–polymerase chain reaction (RT-PCR) and western blot were used to confirm the expression of mRNA specific for the c-kit gene and production of c-kit protein in the Kunming mice common bile duct.
Results: Immunohistochemistry revealed that ICC in the murine common bile duct are c-kit positive and the ICC are located in the tela submucosa and the tunica muscularis of the murine common bile duct and do not connect with each other. Immunoelectron microscopy confirmed the expression of Kit by ICC in the murine common bile duct. Transmission electron microscopy showed that ICC in the murine common bile duct have long processes, abundant mitochondria, plenty of smooth endoplasmic reticulum (sER), a lot of lysosomes, and dense bodies. The caveolae of ICC are distinctive. At the same time, RT-PCR indicated that the Kunming mice common bile duct expressed mRNA specific for the c-kit gene, and western blot analysis showed the evidence of production of c-kit protein in the Kunming mice common bile duct.
Conclusion: ICC are found in the Kunming mice common bile duct, which is likely to lead to the development of motility study of the common bile duct.
Keywords: common bile duct; electron microscopy; immuno-electron microscopy; interstitial cells of Cajal; intestines; smooth muscle; tyrosine kinase receptor (c-kit)
Garvan Flow Cytometry Instrument talk. Given by Dr. Katharina Winnemöller, Research and Clinical Sales Manager (NSW, ACT) at the Garvan Instituteof Medical Research on the 15th October 2010.
AutoMacs Pro magnetic Cell Seapartion - "the faster way to ultra-pure, viable cells"
Radiation Response of Bacteria Associated with Human Cancellous BoneIOSR Journals
Cancellous bones from twenty five live tissue donors were tested for bacterial contamination and initial bioburden ranged from 4.1×101 to 3.1×103 cfu/g (average 9.0×102 cfu/g). Forty six representative bacterial isolates were characterized on the basis of morphological, cultural and biochemical characteristics. Staphylococcus spp. was found to be predominant contaminant in tissue samples (41.30%). To assess the radiation resistance all the bacterial isolates were exposed to 1 to 10 kGy gamma radiation from 60Co gamma source. The radiation decimal reduction dose values (D10) and twelve log reduction values (12 D value) of the isolates were calculated. D10 values of the isolates were ranged from 0.59 to 1.20 kGy. Among the studied bacterial isolates, Streptococcus spp. was the most radioresistant isolates (D10 value 0.93-1.20 kGy) and three of the Streptococcus spp. survived up to 8 kGy. All the bacterial isolates were killed at 9 kGy. Twelve log reduction value (12D value) of the most resistant isolate was 14.4 kGy. These results indicate that standard radiation sterilization dose (25 kGy) is satisfactory for the sterilization of the cancellous bone allografts
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...Robert (Rob) Salomon
"Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in Cytometry" was an Invited Tutorial given at the 2019 CYTO conference for the the International Society for the Advancement of Cytometry on the 22nd May 2019. This tutorial was recorded and we expect that it will be converted to a CYTOU webinar in the near future.
This tutorial will begin by explaining why the emerging field of Genomic Cytometry, i.e. the measurement of cells using genomic techniques (e.g. sequencing), in conjunction with more traditional cytometry techniques such as fluorescence, mass and imaging cytometry is becoming a standard tool for biologists looking to unravel complex cellular processes and to develop a deeper understanding of heterogeneity.
We will give a detailed overview of the various technologies that have allowed the emergence of Genomic Cytometry as well as those that continue to push the boundaries of cellular characterisation.
We will then provide a basic overview of the sequencing process such that both research cytometerists and the staff for the cytometry SRL are better equipped to understand the downstream genomic component of Genomic Cytometry.
Finally, we will wrap up the session with case studies that illustrate the power of the genomic cytometry approach and will give a brief outline of where we feel the field needs to go as it matures. We expect attendees will gain a better understanding of 1) the rapidly maturing field of Genomic Cytometry and 2) how Genomic Cytometry should be leveraged into more traditional cytometry workflows.
Genotoxicity Evaluation of Polystyrene Membrane with Collagen and Norbixin by...inventionjournals
The biocompatible membranes are widely applied in the medical field in order to stimulate tissue repair. The biological principle of this type of treatment is the repair and guided regeneration. In the literature, there are few reports of studies evaluating the effects and biological properties of norbixin in animal tissues. Thus, the present study was to evaluate the effect of polystyrene membrane with collagen and norbixin, through the micronucleus test and comet assay in rats, as part of the recommended test battery to evaluate the mutagenic potential. The research project was approved by CEP / FACID Protocol 069/2014. For this study, 15 rats were divided into 3 groups were used: A - the membrane was introduced into the peritoneum of the animals through a laparotomy; B - received cyclophosphamide at a dose of 50mg / kg intraperitoneally; C - were performed only one laparotomy. A peripheral blood sample was collected from the animals for conducting Comet assay and 72 hours after the start of the experiment were euthanized. It was collected bone marrow material of each rat to perform the micronucleus test. In conclusion, through the tests, the membrane is not genotoxic
Objective: To evaluate the antibacterial effects of 4 different cavity disinfectants on Streptococcus mutans, Lactobacillus acidophilus, and Enterococcus faecalis bacteria in different time periods.
Study Design: The antibacterial effects of Cavity Cleanser, Tubulicid Red Label, Chloraxid 2%, and Oxygenated Water cavity disinfectant solutions on E. faecalis (ATCC 29212), S. mutans (ATCC 25175), and L. acidophilus (RSKK 03037) bacterial strains were evaluated by disk diffusion method. In the study where vancomycin antibiogram disc constituted the positive control group, physiological saline solution was used as the negative control group. Standard, sterile, blank antibiogram discs of 5 mm in diameter, in which 15 μL of each material were added, were placed on agar plates at 2.5–3 cm intervals. The inhibition zone diameters formed around the discs that were left to incubate for 24–48 hours at 37°C were measured in millimeters. Statistical analysis of the data was performed using one-way analysis of variance, Kolmogorov-Smirnov, Levene, and Bonferroni tests.
Results: At the end of the study the solutions tested showed a statistically significant antibacterial effect on all bacterial strains used (p<0.05). Cavity Cleanser disinfectant containing 2% chlorhexidine showed the highest antibacterial effect on S. mutans and L. acidophilus, and benzalkonium-containing Tubulicid Red disinfectant on E. faecalis.
Conclusion: The antibacterial effect of all cavity disinfectants used in the study was found to be higher at the end of the 48th hour than at the end of the 24th hour, but there was no statistically significant difference (p>0.05).
Keywords: antibacterial agents; antibacterial effect; cavity disinfectants; chlorhexidine; contamination; dental caries; disinfection; disc diffusion; gram-negative bacteria; gram-positive bacteria
Objective: To identify interstitial cells of Cajal (ICC) in the common bile duct of Kunming mice.
Study Design: Common bile ducts obtained from the Kunming mice were prepared for immunohistochemical investigations using the c-kit antibody. Immunoelectron microscopy was used to detect the expression of c-kit in the ICC of the common bile duct. Transmission electron microscopy showed ultrastructure of ICC in the murine bile duct. Reverse transcription–polymerase chain reaction (RT-PCR) and western blot were used to confirm the expression of mRNA specific for the c-kit gene and production of c-kit protein in the Kunming mice common bile duct.
Results: Immunohistochemistry revealed that ICC in the murine common bile duct are c-kit positive and the ICC are located in the tela submucosa and the tunica muscularis of the murine common bile duct and do not connect with each other. Immunoelectron microscopy confirmed the expression of Kit by ICC in the murine common bile duct. Transmission electron microscopy showed that ICC in the murine common bile duct have long processes, abundant mitochondria, plenty of smooth endoplasmic reticulum (sER), a lot of lysosomes, and dense bodies. The caveolae of ICC are distinctive. At the same time, RT-PCR indicated that the Kunming mice common bile duct expressed mRNA specific for the c-kit gene, and western blot analysis showed the evidence of production of c-kit protein in the Kunming mice common bile duct.
Conclusion: ICC are found in the Kunming mice common bile duct, which is likely to lead to the development of motility study of the common bile duct.
Keywords: common bile duct; electron microscopy; immuno-electron microscopy; interstitial cells of Cajal; intestines; smooth muscle; tyrosine kinase receptor (c-kit)
Garvan Flow Cytometry Instrument talk. Given by Dr. Katharina Winnemöller, Research and Clinical Sales Manager (NSW, ACT) at the Garvan Instituteof Medical Research on the 15th October 2010.
AutoMacs Pro magnetic Cell Seapartion - "the faster way to ultra-pure, viable cells"
Radiation Response of Bacteria Associated with Human Cancellous BoneIOSR Journals
Cancellous bones from twenty five live tissue donors were tested for bacterial contamination and initial bioburden ranged from 4.1×101 to 3.1×103 cfu/g (average 9.0×102 cfu/g). Forty six representative bacterial isolates were characterized on the basis of morphological, cultural and biochemical characteristics. Staphylococcus spp. was found to be predominant contaminant in tissue samples (41.30%). To assess the radiation resistance all the bacterial isolates were exposed to 1 to 10 kGy gamma radiation from 60Co gamma source. The radiation decimal reduction dose values (D10) and twelve log reduction values (12 D value) of the isolates were calculated. D10 values of the isolates were ranged from 0.59 to 1.20 kGy. Among the studied bacterial isolates, Streptococcus spp. was the most radioresistant isolates (D10 value 0.93-1.20 kGy) and three of the Streptococcus spp. survived up to 8 kGy. All the bacterial isolates were killed at 9 kGy. Twelve log reduction value (12D value) of the most resistant isolate was 14.4 kGy. These results indicate that standard radiation sterilization dose (25 kGy) is satisfactory for the sterilization of the cancellous bone allografts
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...Robert (Rob) Salomon
"Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in Cytometry" was an Invited Tutorial given at the 2019 CYTO conference for the the International Society for the Advancement of Cytometry on the 22nd May 2019. This tutorial was recorded and we expect that it will be converted to a CYTOU webinar in the near future.
This tutorial will begin by explaining why the emerging field of Genomic Cytometry, i.e. the measurement of cells using genomic techniques (e.g. sequencing), in conjunction with more traditional cytometry techniques such as fluorescence, mass and imaging cytometry is becoming a standard tool for biologists looking to unravel complex cellular processes and to develop a deeper understanding of heterogeneity.
We will give a detailed overview of the various technologies that have allowed the emergence of Genomic Cytometry as well as those that continue to push the boundaries of cellular characterisation.
We will then provide a basic overview of the sequencing process such that both research cytometerists and the staff for the cytometry SRL are better equipped to understand the downstream genomic component of Genomic Cytometry.
Finally, we will wrap up the session with case studies that illustrate the power of the genomic cytometry approach and will give a brief outline of where we feel the field needs to go as it matures. We expect attendees will gain a better understanding of 1) the rapidly maturing field of Genomic Cytometry and 2) how Genomic Cytometry should be leveraged into more traditional cytometry workflows.
Genotoxicity Evaluation of Polystyrene Membrane with Collagen and Norbixin by...inventionjournals
The biocompatible membranes are widely applied in the medical field in order to stimulate tissue repair. The biological principle of this type of treatment is the repair and guided regeneration. In the literature, there are few reports of studies evaluating the effects and biological properties of norbixin in animal tissues. Thus, the present study was to evaluate the effect of polystyrene membrane with collagen and norbixin, through the micronucleus test and comet assay in rats, as part of the recommended test battery to evaluate the mutagenic potential. The research project was approved by CEP / FACID Protocol 069/2014. For this study, 15 rats were divided into 3 groups were used: A - the membrane was introduced into the peritoneum of the animals through a laparotomy; B - received cyclophosphamide at a dose of 50mg / kg intraperitoneally; C - were performed only one laparotomy. A peripheral blood sample was collected from the animals for conducting Comet assay and 72 hours after the start of the experiment were euthanized. It was collected bone marrow material of each rat to perform the micronucleus test. In conclusion, through the tests, the membrane is not genotoxic
Objective: To evaluate the antibacterial effects of 4 different cavity disinfectants on Streptococcus mutans, Lactobacillus acidophilus, and Enterococcus faecalis bacteria in different time periods.
Study Design: The antibacterial effects of Cavity Cleanser, Tubulicid Red Label, Chloraxid 2%, and Oxygenated Water cavity disinfectant solutions on E. faecalis (ATCC 29212), S. mutans (ATCC 25175), and L. acidophilus (RSKK 03037) bacterial strains were evaluated by disk diffusion method. In the study where vancomycin antibiogram disc constituted the positive control group, physiological saline solution was used as the negative control group. Standard, sterile, blank antibiogram discs of 5 mm in diameter, in which 15 μL of each material were added, were placed on agar plates at 2.5–3 cm intervals. The inhibition zone diameters formed around the discs that were left to incubate for 24–48 hours at 37°C were measured in millimeters. Statistical analysis of the data was performed using one-way analysis of variance, Kolmogorov-Smirnov, Levene, and Bonferroni tests.
Results: At the end of the study the solutions tested showed a statistically significant antibacterial effect on all bacterial strains used (p<0.05). Cavity Cleanser disinfectant containing 2% chlorhexidine showed the highest antibacterial effect on S. mutans and L. acidophilus, and benzalkonium-containing Tubulicid Red disinfectant on E. faecalis.
Conclusion: The antibacterial effect of all cavity disinfectants used in the study was found to be higher at the end of the 48th hour than at the end of the 24th hour, but there was no statistically significant difference (p>0.05).
Keywords: antibacterial agents; antibacterial effect; cavity disinfectants; chlorhexidine; contamination; dental caries; disinfection; disc diffusion; gram-negative bacteria; gram-positive bacteria
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online.
screening model for Parkinson's disease.pptxAHEMANTHBABU
Parkinson's disease (PD) is a complex neurodegenerative disorder characterized by the progressive degeneration of dopaminergic neurons in the substantia nigra region of the brain. This degeneration results in a wide range of motor and non-motor symptoms, including bradykinesia, rigidity, tremors, and postural instability. PD not only affects motor function but also leads to cognitive and psychiatric impairments, significantly reducing the quality of life for those afflicted.
Abstract
Objective(s):
Gold nanoparticles (GNPs) command a great deal of attention for biomedical applications nowadays. The data about the degree of toxicity and the accumulation of gold nanoparticles in-vivo is not enough to judge.
Materials and Methods:
A total of 32 healthy male Wistar rats were randomly divided into 4 including: three GNP-treated and one control group. Groups 1, 2 and 3 received 0.5 cc of a solution containing 5, 10, and 100 ppm Au daily via intraperitoneal (IP) injection for 7 days, respectively. The control group was treated with 0.5 cc normal saline with same procedure. Then, several biochemical parameters such as serum glutamate oxaloacetat transaminase (SGOT) and serum glutamate pyrvate transaminase (SGPT) were evaluated at 2, 7 and 14 days after the last injection. After 14 days, all the rats were sacrificed and liver, lung tissues were separated and evaluated.
Results:
SGOT two days after intervention was significantly greater in the group 2 than the control group. In liver histological assessment, in group 1, basophils were observed around the central veins, in group 2 fading and no observation of central veins was seen, and in group 3 hepatic damage was noticed. The lung histological results showed severe vascular hyperemia in group 1, air sacs damage in group 2, and complete air sacs destruction in group 3.
Conclusion:
The results showed extreme changes in the histopathology of lung and liver tissues caused by spherical nanogold with 5-10 nm size in all of three treatment groups.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Similar to Ion exchange fractionation of rabbits seminal fluid (20)
Dev Dives: Train smarter, not harder – active learning and UiPath LLMs for do...UiPathCommunity
💥 Speed, accuracy, and scaling – discover the superpowers of GenAI in action with UiPath Document Understanding and Communications Mining™:
See how to accelerate model training and optimize model performance with active learning
Learn about the latest enhancements to out-of-the-box document processing – with little to no training required
Get an exclusive demo of the new family of UiPath LLMs – GenAI models specialized for processing different types of documents and messages
This is a hands-on session specifically designed for automation developers and AI enthusiasts seeking to enhance their knowledge in leveraging the latest intelligent document processing capabilities offered by UiPath.
Speakers:
👨🏫 Andras Palfi, Senior Product Manager, UiPath
👩🏫 Lenka Dulovicova, Product Program Manager, UiPath
JMeter webinar - integration with InfluxDB and GrafanaRTTS
Watch this recorded webinar about real-time monitoring of application performance. See how to integrate Apache JMeter, the open-source leader in performance testing, with InfluxDB, the open-source time-series database, and Grafana, the open-source analytics and visualization application.
In this webinar, we will review the benefits of leveraging InfluxDB and Grafana when executing load tests and demonstrate how these tools are used to visualize performance metrics.
Length: 30 minutes
Session Overview
-------------------------------------------
During this webinar, we will cover the following topics while demonstrating the integrations of JMeter, InfluxDB and Grafana:
- What out-of-the-box solutions are available for real-time monitoring JMeter tests?
- What are the benefits of integrating InfluxDB and Grafana into the load testing stack?
- Which features are provided by Grafana?
- Demonstration of InfluxDB and Grafana using a practice web application
To view the webinar recording, go to:
https://www.rttsweb.com/jmeter-integration-webinar
Essentials of Automations: Optimizing FME Workflows with ParametersSafe Software
Are you looking to streamline your workflows and boost your projects’ efficiency? Do you find yourself searching for ways to add flexibility and control over your FME workflows? If so, you’re in the right place.
Join us for an insightful dive into the world of FME parameters, a critical element in optimizing workflow efficiency. This webinar marks the beginning of our three-part “Essentials of Automation” series. This first webinar is designed to equip you with the knowledge and skills to utilize parameters effectively: enhancing the flexibility, maintainability, and user control of your FME projects.
Here’s what you’ll gain:
- Essentials of FME Parameters: Understand the pivotal role of parameters, including Reader/Writer, Transformer, User, and FME Flow categories. Discover how they are the key to unlocking automation and optimization within your workflows.
- Practical Applications in FME Form: Delve into key user parameter types including choice, connections, and file URLs. Allow users to control how a workflow runs, making your workflows more reusable. Learn to import values and deliver the best user experience for your workflows while enhancing accuracy.
- Optimization Strategies in FME Flow: Explore the creation and strategic deployment of parameters in FME Flow, including the use of deployment and geometry parameters, to maximize workflow efficiency.
- Pro Tips for Success: Gain insights on parameterizing connections and leveraging new features like Conditional Visibility for clarity and simplicity.
We’ll wrap up with a glimpse into future webinars, followed by a Q&A session to address your specific questions surrounding this topic.
Don’t miss this opportunity to elevate your FME expertise and drive your projects to new heights of efficiency.
UiPath Test Automation using UiPath Test Suite series, part 4DianaGray10
Welcome to UiPath Test Automation using UiPath Test Suite series part 4. In this session, we will cover Test Manager overview along with SAP heatmap.
The UiPath Test Manager overview with SAP heatmap webinar offers a concise yet comprehensive exploration of the role of a Test Manager within SAP environments, coupled with the utilization of heatmaps for effective testing strategies.
Participants will gain insights into the responsibilities, challenges, and best practices associated with test management in SAP projects. Additionally, the webinar delves into the significance of heatmaps as a visual aid for identifying testing priorities, areas of risk, and resource allocation within SAP landscapes. Through this session, attendees can expect to enhance their understanding of test management principles while learning practical approaches to optimize testing processes in SAP environments using heatmap visualization techniques
What will you get from this session?
1. Insights into SAP testing best practices
2. Heatmap utilization for testing
3. Optimization of testing processes
4. Demo
Topics covered:
Execution from the test manager
Orchestrator execution result
Defect reporting
SAP heatmap example with demo
Speaker:
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
Key Trends Shaping the Future of Infrastructure.pdfCheryl Hung
Keynote at DIGIT West Expo, Glasgow on 29 May 2024.
Cheryl Hung, ochery.com
Sr Director, Infrastructure Ecosystem, Arm.
The key trends across hardware, cloud and open-source; exploring how these areas are likely to mature and develop over the short and long-term, and then considering how organisations can position themselves to adapt and thrive.
Accelerate your Kubernetes clusters with Varnish CachingThijs Feryn
A presentation about the usage and availability of Varnish on Kubernetes. This talk explores the capabilities of Varnish caching and shows how to use the Varnish Helm chart to deploy it to Kubernetes.
This presentation was delivered at K8SUG Singapore. See https://feryn.eu/presentations/accelerate-your-kubernetes-clusters-with-varnish-caching-k8sug-singapore-28-2024 for more details.
Epistemic Interaction - tuning interfaces to provide information for AI supportAlan Dix
Paper presented at SYNERGY workshop at AVI 2024, Genoa, Italy. 3rd June 2024
https://alandix.com/academic/papers/synergy2024-epistemic/
As machine learning integrates deeper into human-computer interactions, the concept of epistemic interaction emerges, aiming to refine these interactions to enhance system adaptability. This approach encourages minor, intentional adjustments in user behaviour to enrich the data available for system learning. This paper introduces epistemic interaction within the context of human-system communication, illustrating how deliberate interaction design can improve system understanding and adaptation. Through concrete examples, we demonstrate the potential of epistemic interaction to significantly advance human-computer interaction by leveraging intuitive human communication strategies to inform system design and functionality, offering a novel pathway for enriching user-system engagements.
Slack (or Teams) Automation for Bonterra Impact Management (fka Social Soluti...Jeffrey Haguewood
Sidekick Solutions uses Bonterra Impact Management (fka Social Solutions Apricot) and automation solutions to integrate data for business workflows.
We believe integration and automation are essential to user experience and the promise of efficient work through technology. Automation is the critical ingredient to realizing that full vision. We develop integration products and services for Bonterra Case Management software to support the deployment of automations for a variety of use cases.
This video focuses on the notifications, alerts, and approval requests using Slack for Bonterra Impact Management. The solutions covered in this webinar can also be deployed for Microsoft Teams.
Interested in deploying notification automations for Bonterra Impact Management? Contact us at sales@sidekicksolutionsllc.com to discuss next steps.
Securing your Kubernetes cluster_ a step-by-step guide to success !KatiaHIMEUR1
Today, after several years of existence, an extremely active community and an ultra-dynamic ecosystem, Kubernetes has established itself as the de facto standard in container orchestration. Thanks to a wide range of managed services, it has never been so easy to set up a ready-to-use Kubernetes cluster.
However, this ease of use means that the subject of security in Kubernetes is often left for later, or even neglected. This exposes companies to significant risks.
In this talk, I'll show you step-by-step how to secure your Kubernetes cluster for greater peace of mind and reliability.
Neuro-symbolic is not enough, we need neuro-*semantic*Frank van Harmelen
Neuro-symbolic (NeSy) AI is on the rise. However, simply machine learning on just any symbolic structure is not sufficient to really harvest the gains of NeSy. These will only be gained when the symbolic structures have an actual semantics. I give an operational definition of semantics as “predictable inference”.
All of this illustrated with link prediction over knowledge graphs, but the argument is general.
Leading Change strategies and insights for effective change management pdf 1.pdf
Ion exchange fractionation of rabbits seminal fluid
1. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
8
Ion Exchange Fractionation of Rabbits Seminal Fluid:
Recognizing a DNA Retardation Activity from the Main DNase
Activity
Mohammed Baqur Al-Shuhaib1
, Ali Al-Saadi2
, Mahanem Noor3
, Mufeed Ewadh4*
1. Department of Biology – College of science for Women – University of Babylon
2. Department of Biology – College of Science – University of Babylon
3. School of Biosciences and Biotechnology – Faculty of Science and Technology – University Kebangsaan Malaysia (UKM)
4. Department of Clinical BioChemistry – College of Medicine – University of Babylon
.
*
Email: mewadh@yahoo.com
Abstract
The role of seminal proteins charge on the nature of seminal fluid inhibitory effect that exerted against
exogenous DNA. Has been identified and an approach closely with more details to the nature of inhibitory
activities available in rabbit seminal fluid proteins that prevent the entry of exogenous DNA into the head of
sperm. After collection of rabbit’s ejaculate and removing sperm cells, seminal fluid was incubated with fixed
concentration of exogenous DNA. The seminal fluid – exogenous DNA mixture was analyzed by
electrophoresis. Ion exchange chromatography was used to separate seminal proteins on the basis of their charge.
Positively charged proteins were eluted, lyophilized, and their profile was characterized by SDS-PAGE and
native-PAGE. After incubation of this eluted group with the same source of DNA, the same electrophoretic
conditions were applied on this group.
According to our knowledge, this is the first paper in which ion exchange chromatography was used to separate
two DNA counterfeiting activities of the seminal fluid using non-radioactive method in rabbits and even in other
mammals. Thus, more than one inhibitory activity were identified and separated. DNA retardation activity (or
DNA binding activity) which repressed DNA electrophoretic migration was the only activity that found to be
available on the positively charged fractions while the DNase activity was found exclusively on the negatively
charged group.
Key words : Seminal fluid , transgenesis techniques , DNA electrophoretic migration , DNase
1.Introduction
In addition to the main line of elucidating transgenesis techniques through sperm mediated gene transfer
(SMGT), there was a parallel line of considerable importance with this field which was represented by the
understanding the molecular level of the protective mode taken from the seminal proteins to prevent the entry of
exogenous DNA .It was demonstrated that certain factor(s) in seminal fluid were found to be responsible about
inhibiting the internalization process of exogenous DNA (Zani et al., 2005). The fact which refers to the
existence of one or more factors in seminal fluid that able to block sperm permeability must be taken into
account. This means, extensive washing steps of ejaculate to remove seminal fluid is necessary and should be
made before incubating sperm with exogenous DNA. Lauria and Gandolfi reviewed that seminal fluid inhibitors
have two ways of inhibition to exogenous DNA, either directly or indirectly (Lauria & Gandolfi, 1993). These
seminal fluid inhibitory factors may prevent transfection of intact sperm by foreign DNA (Camaione et al.,
1992). Gandolfi showed that there is a consensus on the experiments made on seminal fluid of the ejaculated
spermatozoa of mammals in the impermeability of sperm cell to the aggression of foreign DNA as long as
seminal fluid is not removed (Gandolfi, 2000).We think that this route of research is not less important than the
main route since as much as researchers get more understanding to the nature of seminal proteins as much as
they will be more close to elucidate all the natural facts that hamper the enhancement of SMGT.
Aim of study : This work is to evaluate seminal fluid natural defense mechanisms equally with the transgene
entry mechanisms .
2. Materials & Methods
2.1 Materials
Kit; PCR SuperMix (Invitrogen – Cat. # 0572-014), PageSilver™ Silver Staining Kit (Fermentas - Cat
# K0681), Ladders; TrackIt™ 1 Kb Plus DNA Ladder (Invitrogen – Cat. #10488090), DNA size
2. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
9
marker; MassRuler™DNA Ladder Mix (Fermentas – Cat. # SM0403), Protein size Markers; PageRuler™
Unstained Broad Range Protein Ladder (Fermentas – Cat # 1881), Protein low molecular weight size marker
(Amersham – code: 17-0446-01), Oligos; Forward primer (5´–CCATGCCCGAAGGTTATGTA–3´)and reverse
primer (5´– GAAAGGGCAGATTGTGTGGA –3´) Invitrogen. Vector; gWiz-GFP (green fluorescent protein)
vector (Aldevron – Cat. # 5006).
2.2 Experimental Animals:
Eight New Zeeland sexually mature healthy white rabbits were included in this study. New Zeeland white
rabbits were raised in the animal house in the school of bioscience and biotechnology/FST/UKM. They were
individually housed under controlled conditions of temperature (19 – 21 ͦ C) and standard artificial light (12 hour
light and 12 hours dark). A diet of grower rabbits pellets (ad libitum) and fresh water was provided. Animals
were cared according to international standards management established for the care and use of laboratory
animals in facilities approved by the University Kebangsaan Malaysia Animal Ethics Committee (UKMAEC).
2.3 Methods
Collection of seminal fluid: Sperm was collected by home-made artificial vagina. Seminal fluid was separated
from sperm cells by single centrifugation step .
2.3.1 Exogenous DNA - seminal fluid incubation:
gWizGFP ( 6µg) vector was incubated with increasing concentrations of rabbit’s seminal fluid (ranging from 1
to 10µl) and completed to 30µl with sterile deionized water. The incubation was lasted for 60 min at room
temperature. Mixtures were analyzed by agarose gel electrophoresis (fig. 1).
2.3.2 Fractionation with ion exchange chromatography (IEC):
Seminal fluid proteins were fractionated according to Teixereira et al., 2006 and Villemure et al., 2003 with
modifications
2.3.2.1 Resin selection: DEAE cellulose (5 g) (Sigma Aldrich – USA) was applied as anion exchanger for rabbit
seminal fluid fractionation .
2.3.2.2 Regeneration of DEAE-cellulose: Preparative steps were conducted in 500ml capacity flask. DEAE-
cellulose (anion exchanger) was purchased from Sigma. 5 g DEAE-cellulose was slowly added to 300 ml 0.1M
sodium hydroxide with gentle stirrer for 30 min (pH reached to 13). The sodium hydroxide solution was
discarded and the resin was washed with double distilled water until pH reached to pH 8.0. Then the solution
was replaced with 0.1 M hydrochloric acid with stirring for 30 min (pH reached to 1.0). The resin was washed
with double distilled water until pH reached to 3.0. The distilled water was discarded and replaced with 500mM
10X tris buffer pH 8.0 with stirring for 30 min. The 10X buffer was discarded and then the resin was equilibrated
with 50 mM tris HCl pH 8.0. After removing more fines, the suspension of DEAE-cellulose resin was
transferred into a glass column (2x20 Bio-Rad – USA). Length of resin after its packing with 0.01M PBS was
only 4cm. the packed resin was stored in 4ºC until loading samples .
2.3.2.3 Loading sample: The pH of DEAE cellulose effluent was checked up before seminal fluid was applied.
Gravity flow was applied. One ml of seminal fluid containing 3mg of protein was dissolved in 0.02 M phosphate
buffer, pH 7.3, and loaded onto an ion exchange chromatography column (DEAE-cellulose, 2 x 20 cm), which
was previously equilibrated with the same buffer .
2.3.2.4 Elution of positively charged proteins: The column was washed and eluted with 0.01M phosphate buffer
pH 7.3. The column effluent was collected with manual fractionation, 3ml per fraction (fig. 2). Protein
concentrations were spectrophotometrically determined (Spectrophotometer – Shimadzu/Japan). According to
proteins concentration measurement data, the first three fractions were discarded. SDS – Polyacrylamide Gel
Electrophoresis (SDS – PAGE) of the other eluted positively charged proteins was taken place (fig. 3). Laemmli
3. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
10
discontinuous method (Laemmli, 1970) for protein electrophoresis was considered, gel dimensions were 10-cm
wide by 8-cm long and 0.1-cm thick (provided by Bio-Rad – USA). The resolving gel concentration used in
these experiments was 14%. While the stacking gel concentration was 4%. Silver Staining was taken place
according to Fermentas instruction manual (Cat # K0681). Picture was taken by 7.2 Mp digital camera (Sony –
China).
2.3.2.5 Elution of negatively charged proteins: After eluting of positively charged proteins, the other proteins
were eluted from the glass column with 100ml linear gradient of 0-1M NaCl in 0.01M phosphate buffered saline.
Protein concentrations were spectrophotometrically determined (fig. 2).
2.3.2.6 Lyophilization of positively charged rabbit’s seminal fluid protein fractions:
Each five fractions 1 to 5, 6 to 10, 11 to 15, and 16 to 20 were freeze dried (Lyotrap – UK) and SDS-PAGE
(figure 4) and native PAGE (figure 5) were performed for these fractions (fig. 3). Gels were stained by silver
nitrate. Pictures were taken by 7.2 Mp digital camera (Sony – China).
Incubation of eluted and lyophilized positively charged fractions with gWizGFP vector: Fixed concentration
(2µg) of gWizGFP DNA was incubated with variable concentrations of DEAE cellulose positively charged
fractions (ranging from 1µl to 10µl) for one hour at room temperature. After incubation, each sample was
analyzed by agarose gel electrophoresis (fig. 6). Picture was taken by photodocumentation unit (Alpha Innotech
– USA).
PCR primers design for gWizGFP gene: Two specific primers for the transgene green fluorescent protein (GFP)
in gWiz-GFP vector were designed according to Genamics Expression software. A PCR fragment of 364 bp was
chosen for amplification which extended within the open reading frame of the recombinant GFP; from 2156 bps
into 2520 bps. PCR amplification was taken place using conventional thermal cycler (Eppendorf Master Cycler -
USA). Upstream and forward primers and DNA template were added to the PCR Super Mix. The PCR tubes
were placed on ice and all the components were added to make 50µl final reaction volume. Thirty cycles
(denaturation at 95ºC, annealing at 52 ºC, extension at 75 ºC) of amplification were performed .
Incubation of eluted and lyophilized positively charged fractions with 364bp PCR fragment: Fixed concentration
of 364bp PCR fragment was incubated with different increasing concentrations of DEAE cellulose positively
charged fractions (through 1µg, 5µg, 10µg and 15µg) for one hour at room temperature. After incubation, each
sample was analyzed by agarose gel electrophoresis (fig. 7). Picture was taken by photo documentation unit.
3. Results & Discusion
Several papers were demonstrated the inhibitory role of seminal fluid against the entry of exogenous DNA
(Lavitrano et al., 1992 and 1997; Zani et al., 1995). Several proteins were involved in this inhibition.
Accordingly, the seminal proteins that inhibit the entry of exogenous DNA should somehow bind with it. This
interaction was detected usually using radioactively labeled isotopes or other cost effective labeling method such
as foot-printing in which the DNA bound protein was retarded during its migration through PAGE compared
with its natural unbound form. DNase activity profile of rabbit’s seminal fluid after its incubation with gWizGFP
vector: Although several results were focused on the DNase activity of seminal fluid that taken from several
mammals (Carballada & Esponda, 2001), no one mentioned the existence of another activity in the same fluid. In
this study, DNA binding or retardation activity of the seminal fluid was taken into consideration .
After simple incubation of gWizGFP vector with seminal fluid, two significant groups were identified easily in
seminal fluid. The first one; was the expected DNase activity, which was highlighted as a known exogenous
DNA counterfeiting mechanism in several mammals such as mice (Carballada & Esponda, 2001), hamster
(Sotolongo et al., 2005), bulls (Tanigawa et al., 1975), human (Singer et al., 1983), and even in birds (Sato et al.,
2003). This mechanism could be described as a natural defense barrier against the entry of gWizGFP vector – or
any exogenous DNA – into the sperm cells. DNase mechanism, as it was shown in figure 1, was increased
4. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
11
significantly as seminal fluid concentration increased with exogenous DNA. As long as DNase mechanism was
not specific one, it was not
necessary to change the type of exogenous DNA to be incubated with this fluid. Although, the exogenous DNA
used was hydrolyzed relatively with seminal fluid when the later used in low concentration, but this mean that
the seminal fluid – even with low concentration- was capable of commencing degradation of exogenous DNA.
The proportional increase in this hydrolysis was expected since some researches were indicated such activity
(Abdorrahman and Foster, 2005).
The second observed outstanding mechanism was a second group of seminal proteins owning a distinct
exogenous DNA counterfeiting mechanism. The action of this group of seminal proteins was observed even
when seminal fluid was used in low concentrations (fig. 1). This wasn’t reflecting the abundance of only DNase
activity of one seminal group, but, this reflecting the abundance of DNA binding activity of another seminal
group as well. According to our knowledge, this binding mechanism was never highlighted by any research
before this one. This could be attributed to many reasons; the first one could be represented by the field at which
seminal fluid was placed, in which, almost all researchers were concerning only on the reproduction aspects. Or,
nobody thought that simple DNA – seminal fluid incubation and direct agarose gel electrophoresis could not lead
to more than a DNA hydrolysis.
This research was not the only one demonstrated the presence of more than one activity in the seminal fluid of
mammals, since this data was demonstrated previously, without focusing on DNA incubation nature of the
positively charged seminal fractions (Carbellada & Esponda, 2001). Some papers was referred indirectly to the
occurrence of certain forms of polyamine molecules in seminal fluid (Setchell & Brooks, 1988), these molecules
were contributed somehow in the binding with exogenous DNA provided to explain how such binding was taken
place (Camaioni et al., 1992).
It was deserve to be noted that these results of clear DNase activity of seminal fluid were not in agreement with
the results obtained after incubation of porcine seminal fluid with DNA for the same time and conditions since
no significant DNase activity was observed in the seminal fluid after incubation (Horan et al., 1991). Moreover,
no DNA neutralizing ability was found in the same paper after studying the porcine seminal fluid – exogenous
DNA interaction. This may be attributed possibly to the fact that the difference in species may be responsible
about such vast different results obtained between this research and the research of Horan et al., (1991) or to
unknown reason. Since two seminal activities were identified according to figure 1, our efforts were directed
toward separation of these two activities according to their charge. It was simply speculated that the second
activity (the DNA binding activity) was represented by a positively charged group. Therefore, ion exchange
chromatography was applied to accomplish such purpose.
3.1 Ion-exchange chromatogram of rabbit seminal fluid on a DEAE-cellulose column
It was noticed that DNA binding to spermatozoa is not random process: since DNA molecules have a preferred
binding site localized in the post-acrosomal region of sperm head in most species. The main property that seems
to be regulated by the negative charge of the DNA molecule (Lavitrano et al., 1992). Although the speculated
DNA binding activity observed in rabbit’s seminal fluid was not necessary to be exclusively available only in
positively charged proteins, but, this activity was not far away from the charge aspects. It might be rational to
say that such activity was either sequence specific, or non-sequence specific. In the second case, it was possible
to include charge in this suggestion since seminal fluid, in general, was designed to prevent any outsider from
the entry inside the sperm cell. This activity, in turn, was not far away from the charge calculations because the
“natural defense” and “natural charge” characteristic features had generalized meaning instead of the specific
counterpart. DEAE cellulose ion exchanger was applied according to these aspects on seminal fluid as an
inevitable tool to separate seminal proteins on the basis of their charge (fig. 2).The direct application of the
eluted protein fractions on SDS-PAGE and the utilization of the highly sensitive silver nitrate on this gel was
answered several questions about the nature of the positively charged resolved fractions (fig. 3). This direct
application of the eluted fragments could be taken place without undergoing the classical pre-electrophoresis
spectrophotometric assay. This free-spectronic protocol was applied for several technical reasons; such as to sum
up time, which was however, a crucial factor.
5. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
12
The direct run of the eluted fractions was capable to give more elaborated information about the nature of the
electrophoresed proteins. Added to that, this protocol was much simpler. The direct run of the eluted fractions
was capable to give more elaborated information about the nature of the analyzed proteins (Bollag et al.,
1996).Therefore, to get much more accurate data about the nature and the number of bands of the eluted fraction,
direct SDS-PAGE and silver nitrate dye were applied (Bonner, 2007). In spite of the relative differences
obtained in the SDS-PAGE resolved positively charged fractions but such differences might not be exist because
this relative difference didn’t belong to the difference in the protein profile of the resolved fractions as much as
to the difference in the development time used in silver staining kit (Fermentas) to get the desired picture of the
resolved bands (fig. 3). This suggestion was supported by the absence of any clear differences in the band profile
of all the fractions after being lyophilized (fig. 4). After the elution of all positively charged fractions of the
seminal fluid, several low molecular weight bands were not eluted with the profile of the positively charged
fractions. This profile was clear in SDS-PAGE (fig. 4) and in native-PAGE (fig. 5).
3.2 SDS – Polyacrylamide Gel Electrophoresis (SDS – PAGE) of eluted and lyophilized positively charged
fractions:
It was found that is it was necessary to visualize the lyophilized positively charged seminal proteins on one
dimentional native PAGE in addition to SDSPAGE as well (Garvin, 1990). This was done in order to completely
characterize the positively charged fractions (Marques et al., 2000). Since SDS PAGE sometimes did not give
full electrophoretic information so the deformation taken place in the proteins conformations as a result of
denaturation (Laemmli, 1970). Add to that, as it was observed (fig. 4) that there were no clear distinctions
between the profile of the whole seminal fluid profile and the profile of the eluted positively charged proteins.
That’s why further data had to be provided by directly analyzing the same fraction on a gel without losing any of
deformation.
Nondenaturing – Polyacrylamide Gel Electrophoresis (Native – PAGE) of eluted and lyophilized positively
charged fractions: More data were found in figure 5, in which much more clear distinguishing between the
positively charged fractions and the seminal fluid. These differences were clearer than differences obtained in
figure 4. Since some low molecular weight bands observed between 15kd and 20 kd were found to be absent in
the positively charged fractions compared with the whole seminal fluid profile. In figure 4, it was found a certain
ambiguity in the profile of the analyzed proteins on native PAGE. This might be attributed to the obvious
positively charged characteristic feature observed in these fractions which made the electrophoresis much more
difficult because the fierce resistance of these positively charged fractions to the electrical current applied.
Several native PAGEs before this one were failure to run these fractions because all of these lanes were analyzed
in parallel and continuous electrical current. Accordingly, as it shown in figure 5, an empty lane (lane 4) was
placed between adjacent lanes and several on – off orders were used by power supply with time interval rests to
alleviate the fierce resistance of these fractions to the electrical current applied (Westernmeier et al., 2005).
DNA binding activity profile of rabbit DEAE cellulose positively charged seminal fractions after their
incubation with gWizGFP DNA. Although the same incubation experiments shown in figure 1 were repeated on
the positively charged fractions but the result in figure 6 was different in several interesting aspects. As long as
no DNA hydrolysis happened in all lanes even with the lanes that had high concentrations of the positively
charged fractions that incubated with the same DNA concentrations, so, there was no DNase activity in all the
positively charged fractions. But the observed low level of DNA binding activity of the positively charged
fractions (fig. 6) was less than what it was observed with the intact, non-fractionated seminal fluid (fig.1). This
could be attributed to several reasons such as the loss of considerable amount of DNA binding activity during the
process of ion exchange chromatography (Villemure et al., 2003), or during the process of lyophilization
(Matejtschuk, 2007). The other reason that might explain such phenomenon was the possibility of existing of
another significant DNA binding activity on the negatively charged fractions.
Unfortunately, this site of view was never focused on during undergoing such experiments for several reasons
such as the DNase activity was a classic and non-surprising activity observed usually observed in seminal fluid
and it was not necessary to rediscover it. The second important reason of not taking negatively charged fractions
in consideration with respect to new discovered seminal DNA binding activity was the apparent DNA binding
activity observed in another DNA – seminal fluid incubation experiment (fig. 7). The number of papers that dealt
with the DNA binding ability of the chromatography separated positively charged fractions of seminal fluid were
not exist, but it was suggested that factor(s) in seminal fluid might prevent potentially dangerous molecules such
as foreign DNA (which might not be present in the genital tracts from bacterial or viral sources) from gaining
access to spermatozoa (Camaioni et al., 1992).
6. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
13
3.3 DNA binding activity profile of rabbit DEAE cellulose positively charged seminal fractions after their
incubation with 364bp PCR fragment:
The significant DNA binding activity observed in figure 7 was very clear and don’t require extended discussion
since as much as the concentration of the positively charged fractions increase as much the retardation of the
electrophoretic movement of the bound DNA was observed. This was attributed to the electrostatic attractions or
ionic interactions taken place between DNA and proteins (Reece, 2004). But the only two things that deserve to
be mentioned was the absolute absence of any DNase activity even when very high concentrations (15µg) of the
positively charged fractions were used. The sort of
DNA retardation (fig. 7) that extended in high concentration of these fractions even to the right DNA marker
don’t represent any “specific” mode of DNA binding. This, in turn, affirms the general protective behavior
performed by such fractions as one of the inevitable barriers against the entry of any bacterial or viral agent into
the sperm cells (Camaioni et al., 1992).
Conclusion : In addition to the naturally available DNase activity of seminal fluid, there is an undiscovered
DNA binding activity available in positively charged seminal proteins. These two main activities could be
separated by ion exchange chromatography. Accordingly, exogenous DNA was not only hydrolyzed by seminal
proteins but its charge was largely neutralized by second group of seminal proteins have a positive charges in
physiological pH. According to ion exchange chromatography, seminal DNase activity is exclusive to the
negatively charged fractions.
Acknowledgements
We would like to thank Ms. Qumaria , Ms. Habiba ,and Mr.muhammed Ewadh for their support and
cooperation .
References
Alghamdi A. S., and Foster D. N. (2005). Seminal DNase Frees Spermatozoa Entangled in Neutrophil
Extracellular Traps. Biol.Reprod. 73, 1174–1181 .
Baccetti, B. and Spadafora, C, (2000). 'Conclusions'. Molecular Reproduction & Development, 56; 329-330.
Bollag D. M., Rozycki M. D., Edelstein S. J. (1996). Proteins Methods. Jhon Wiley and Sons Publications.
Bonner L R. (2007). Protein Purification (the basics). Taylor and Francis group.
Camaioni, A., Russo, M.A., Odorisio, T., Gandolfi, F., Fazio, V.M., and Siracusa, G. (1992). Uptake of
exogenous DNA by mammalian spermatozoa: Specific localization of DNA on sperm heads. Journal of
Reproduction & Fertility 961: 203-212.
Carballada R, Esponda P. (2001). Regulation of Foreign DNA Uptake by Mouse Spermatozoa. Experimental
Cell Research, 62, 104–113.
Coligan J, Kruisbeck A, Margulies D, Shevach E, Strober W. (2005). Current Protocols in Immunology. New
York: John Wiley and Sons, Inc.
Gandolfi F. (2000). Sperm-mediated transgenesis. Theriogenology, 53, 127-37.
Garvin D E. (1990). One-dimentional gel electrophoresis. From methods in enzymology, v 182, guide to protein
purification, edited by Murray P. Deutscher.
Horan R, Powell R, McQuaid S, Gannon F, Houghton J. A. (1991). Association of foreign DNA with porcine
spermatozoa. Arch Androl 26 :83-92.
Houdebine LM. (2003). Animal transgenesis and cloning. West Sussex, UK: Wiley & Sons.
8. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
15
Figure 1. DNase activity profile of rabbit’s seminal fluid after its incubation with gWizGFP vector .Lane 1: 20µl size marker (Invitrogen).
Lane 2: 2µg gWizGFP DNA. Lane 3 to lane 12:10µl taken from incubation of 6µg gWizGFP DNA with (1, 2, 3, 4, 5, 6, 7, 8, 9, & 10)µl
seminal fluid. Electrophoresis conditions: agarose concentration 1%, power applied: 4.1 V / cm, time of run: 1 hr.
Figure 2. Ion-exchange chromatography of rabbit seminal fluid on a DEAE-cellulose column. The 4cm length of DEAE cellulose was
washed with 0.02 M phosphate buffer, pH 7.3, at a flow rate of 3ml/fraction. The first 3 fractions were discarded. Thus no. 1 in this diagram
refers to first fraction submitted to SDS-PAGE. Once protein concentration was reduced, linear gradient of 0 to 1 M NaCl was used to elute
negatively charge fractions. Ion exchange chromatography conditions: column type: conventional glass column, flow force: gravity, flow rate
partitioning: 3ml/tube each.
9. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
16
Figure 3. Silver stained positively charged proteins of rabbit seminal fluid electrophoresed on SDS-PAGE after being fractionated by DEAE
anion exchanger. Lane a: protein size marker (Fermentas - 10µl). Lane b: rabbit seminal fluid (4.5µl). Lane 1 to 20: 15 µl from fraction 1 to
fraction no. 20. Lane c: protein low molecular weight marker (Amersham - 7µl). SDS PAGE electrophoresis conditions: polyacrylamide
concentration 14% separating gel and 4% stacking gel. Voltage applied: 11.54 V / cm.
run time: 75 min.
10. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
17
Figure 4. Silver stained lyophilized positively charged proteins of rabbit seminal fluid electrophoresed on SDS-PAGE after being
fractionated by DEAE anion exchanger. Lane 1: protein size marker (Fermentas - 10µl). Lane 2: rabbit seminal fluid (4.5µl).Lane 3: fraction
number 2-5 (1µg each). Lane 4: fraction number 6-10 (1 µg each). Lane 5: fraction number 11-15 (7 µl each). Lane 6: fraction number 16-20
(1 µg each). Lane 7: protein low molecular weight lyophilized marker (Amersham - 4µl). SDS-PAGE electrophoresis conditions:
polyacrylamide concentration 14% separating gel and 4% stacking gel. Voltage applied: 11.54 V / cm. run time: 90 min.
Figure 5. Silver stained lyophilized positively charged proteins of rabbit seminal fluid electrophoresed on native-PAGE after being
fractionated by DEAE anion exchanger. Lane 1: protein low molecular weight lyophilized marker (Amersham - 4µl). Lane 2: rabbit seminal
fluid (4.5µl). Lane 3: fraction number 2-5 (10µg). Lane 4: empty. Lane 5: fraction number 6-10 (7µg). Lane 6: fraction number 11-15 (7µg).
Lane 7: fraction number 16-20 (7µg) Native-PAGE electrophoresis conditions: polyacrylamide concentration 14% separating gel and 4%
stacking gel. Voltage applied: 11.54 V / cm. run time: 90 min.
Figure 6. DNA retardation activity profile of rabbit DEAE cellulose positively charged seminal fractions after incubation of variable
concentration of these fractions with gWizGFP DNA. Lane 1: 12µl DNA size marker (Invitrogen). Lane 2: 2µg gWizGFP vector. Lane 3 to
lane 12: 2µg gWizGFP vector with (1, 2, 3, 4, 5, 6, 7, 8, 9, 10) µg of DEAE seminal fractions. Electrophoresis conditions: agarose
concentration 1%, power applied: 4.1 V / cm, time of run: 1 hr.
11. Advances in Life Science and Technology www.iiste.org
ISSN 2224-7181 (Paper) ISSN 2225-062X (Online)
Vol.11, 2013
18
Figure 7. DNA retardation activity profile of rabbit DEAE cellulose positively charged seminal fractions after incubation of variable
concentrations of these fractions with 364bp PCR fragment. Lane 1: 1.5µg DNA size marker (Fermentas). Lane 2: 0.5 µg 364bp PCR
fragment. Lane 3 to lane 6: 6 µg 364bp PCR fragment incubated with (1, 5, 10, 15)µg DEAE cellulose eluted positively charged proteins
respectively. Electrophoresis conditions: agarose concentration 2%, power applied: 5.5 V / cm, time of run: 1 hr.
12. This academic article was published by The International Institute for Science,
Technology and Education (IISTE). The IISTE is a pioneer in the Open Access
Publishing service based in the U.S. and Europe. The aim of the institute is
Accelerating Global Knowledge Sharing.
More information about the publisher can be found in the IISTE’s homepage:
http://www.iiste.org
CALL FOR JOURNAL PAPERS
The IISTE is currently hosting more than 30 peer-reviewed academic journals and
collaborating with academic institutions around the world. There’s no deadline for
submission. Prospective authors of IISTE journals can find the submission
instruction on the following page: http://www.iiste.org/journals/ The IISTE
editorial team promises to the review and publish all the qualified submissions in a
fast manner. All the journals articles are available online to the readers all over the
world without financial, legal, or technical barriers other than those inseparable from
gaining access to the internet itself. Printed version of the journals is also available
upon request of readers and authors.
MORE RESOURCES
Book publication information: http://www.iiste.org/book/
Recent conferences: http://www.iiste.org/conference/
IISTE Knowledge Sharing Partners
EBSCO, Index Copernicus, Ulrich's Periodicals Directory, JournalTOCS, PKP Open
Archives Harvester, Bielefeld Academic Search Engine, Elektronische
Zeitschriftenbibliothek EZB, Open J-Gate, OCLC WorldCat, Universe Digtial
Library , NewJour, Google Scholar