Parkinson's disease (PD) is a complex neurodegenerative disorder characterized by the progressive degeneration of dopaminergic neurons in the substantia nigra region of the brain. This degeneration results in a wide range of motor and non-motor symptoms, including bradykinesia, rigidity, tremors, and postural instability. PD not only affects motor function but also leads to cognitive and psychiatric impairments, significantly reducing the quality of life for those afflicted.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Protective Effects of Alpha Lipoic Acid (α -LA) Against Lead Neuro-Toxicity i...inventionjournals
Aim of the work: The present study was conducted to elucidate the possible protective effect of alpha lipoic acid (α-LA) against the deleterious effect perturbation induced in rat brain exposed to lead acetate. Methods: 32 Wistar male rats (weighing 130 ± 10 g) were divided into four groups (n=8): (1) normal control group (C); (2) Initiation group (Pb as lead acetate 20 mg/kg.b.wt, i.p. for 2 wks); (3) treatment group (α-LA 20 mg/kg.b.wt, i.p. for 3 wks); (4) post-initiation treatment group (Pb for 2 wks then followed by α-LA for 3 wks). Levels of monoamines (norepinephrine NE and dopamine DA), the level of Ache activity and finally adenosine triphosphate (ATP), were estimated in the hippocampus and cerebral cortex, in addition, a Morris water maze and the histological study were performed after completion of the experiments. Results: The results of the present work demonstrated that Pb inhibited neurotransmitters releases and decrease the level of Ache activity, as well as it inhibited energy production ATP. Pb impaired performance on Morris Water Maze of rats and histological degeneration. However, treatment with α-LA significantly attenuated the behavioral impairment and biochemical parameters in rat treated with Pb. And amelioration of histological changes. Conclusion: As a conclusion, treatment with α-LA can improve the Pb-induced toxicity via antioxidant activity.
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Genotoxicity of Goji Berry (Lyciumbarbarum) In Vivo Mammalian Cellsinventionjournals
Lyciumbarbarum (Gojji berry) belongs to family Salonaceae which is found in China and Himalayan. This herb is used to prevent various diseases and in medical treatments as an alternative medicine being widely used for its antioxidant and revitalizing potential effects. In recent years, Gojji has become increasingly popular in Europe and North America as a "superfruit" and dietary supplement. The belief that herbal products do not bring any risk to health, is part of popular culture. However the term "natural" assigned to many products cannot assure no health risk. The aim of this study was to evaluate the possible genotoxic effects of aqueous extract of Lyciumbarbarum (Gojji berry) by micronucleus test and comet assay. Thirty Rattus norvegicus were divided into three equal groups: 1) experimental group, submitted to Gojji berry (200mg/kg orally); 2) positive control group (cyclophosphamide), and; 3) negative control group (distilled water). Micronucleus Tests were done by smear method of bone marrow cells performed after 48h for acute, and 72h for chronic exposure. The comet assay was performed on peripheral blood taken from the tail of each animal 4h, and 24h after intervention. Cytotoxicity was assessed by observing the DNA damage measuring the percentage of DNA in the tail (% DNA- measurement of the proportion of the total DNA present in the tail) and the tail moment (TM-tail length times the percentage of DNA in the tail), calculated by 100 nucleoids per animal and the presence of micronuclei in 2,000 polychromatic erythrocytes per animal. Analysis of variance (ANOVA) followed by Tukey test at 5% significance was used comparing the results. The data showed no significant difference in the frequency of DNA damage and the number of micronuclei between the experimental group and the negative control group. The results also suggest that the aqueous extract of Lyciumbarbarum (Gojji berry) at the dose of 200 mg/kg showed no genotoxic effect, which could, to a certain point, justifies its use.
Protective Effects of Alpha Lipoic Acid (α -LA) Against Lead Neuro-Toxicity i...inventionjournals
Aim of the work: The present study was conducted to elucidate the possible protective effect of alpha lipoic acid (α-LA) against the deleterious effect perturbation induced in rat brain exposed to lead acetate. Methods: 32 Wistar male rats (weighing 130 ± 10 g) were divided into four groups (n=8): (1) normal control group (C); (2) Initiation group (Pb as lead acetate 20 mg/kg.b.wt, i.p. for 2 wks); (3) treatment group (α-LA 20 mg/kg.b.wt, i.p. for 3 wks); (4) post-initiation treatment group (Pb for 2 wks then followed by α-LA for 3 wks). Levels of monoamines (norepinephrine NE and dopamine DA), the level of Ache activity and finally adenosine triphosphate (ATP), were estimated in the hippocampus and cerebral cortex, in addition, a Morris water maze and the histological study were performed after completion of the experiments. Results: The results of the present work demonstrated that Pb inhibited neurotransmitters releases and decrease the level of Ache activity, as well as it inhibited energy production ATP. Pb impaired performance on Morris Water Maze of rats and histological degeneration. However, treatment with α-LA significantly attenuated the behavioral impairment and biochemical parameters in rat treated with Pb. And amelioration of histological changes. Conclusion: As a conclusion, treatment with α-LA can improve the Pb-induced toxicity via antioxidant activity.
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
ABSTRACT- The present study was conducted to investigate the effect of cadmium chloride on Histoarchiteceture of head kidney of fresh water fish Heteropneustes fossilis. The fishes were exposed to 0.5 ppm of cadmium chloride for 21 days. The most remarkable changes in head kidney, due to cadmium chloride were lysed condition of interrenal and chromaffin cells. The traces of cytoplasm had dark brown to black coloured cytoplasm. Most of cells are deformed and necrotic condition. Their size was significant at (P< 0.01 and 0.001) increased after cadmium chloride. All these changes will be recovered by herbal compound i.e. Ashwagandha. The damaged tissues were recovered in already treated group.
Key-words- Ashwagandha, Cadmium chloride, Chromaffin cells, Heteropneustes fossilis, Histopathology, Interrenal cells
Spermatotoxic impact of bonny light crude oil (BLCO) ingestion on adult male ...lukeman Joseph Ade shittu
Increasing concern has been expressed about the possible declining trend in the sperm quality and sperm count of man as a result of exposure to environmental estrogenic agents in the past few years now. There is a general paucity of knowledge of BLCO ingestion on the reproductive effect. Hence, we aim to evaluate the impact of sub-lethal dose of BLCO ingestion on semen parameters of adult male mice. Initial acute toxicity study was carried out to determine the lethal dose of BLCO, which was calculated to be 37.4 mg/Kg body wt. A sub-lethal dose of 20 mg/Kg bwt /day of BLCO were then given to 8 male mice in the experimental group. While, the control group of 7 animals received equal volume of 0.9% normal saline via oral garvage for 2 weeks. Data were analysed using SPSS 12 statistical software with P < 0.05 considered statistically significant. There was a significant (P < 0.05) weight gain in the treated group with a significant (P < 0.05) reduction in sperm motility in the treated compared with control. The sperm density of treated and control were 14.5 x 106 /ml and 20.5 x 106 /ml respectively. However, there were also no significant difference in the relative testicular weight and sperm density of treated from that of the control respectively. Thus, it was concluded that BLCO ingestion is spermatotoxic in the adult male Swiss mice
Protective Effects of Alpha Lipoic Acid (Α-LA) Against Lead Neuro-Toxicity in...inventionjournals
Aim of the work: The present study was conducted to elucidate the possible protective effect of alpha lipoic acid (α-LA) against the deleterious effect perturbation induced in rat brain exposed to lead acetate. Methods: 32 Wistar male rats (weighing 130 ± 10 g) were divided into four groups (n=8): (1) normal control group (C); (2) Initiation group (Pb as lead acetate 20 mg/kg.b.wt, i.p. for 2 wks); (3) treatment group (α-LA 20 mg/kg.b.wt, i.p. for 3 wks); (4) post-initiation treatment group (Pb for 2 wks then followed by α-LA for 3 wks). Levels of monoamines (norepinephrine NE and dopamine DA), the level of Ache activity and finally adenosine triphosphate (ATP), were estimated in the hippocampus and cerebral cortex, in addition, a Morris water maze and the histological study were performed after completion of the experiments. Results: The results of the present work demonstrated that Pb inhibited neurotransmitters releases and decrease the level of Ache activity, as well as it inhibited energy production ATP. Pb impaired performance on Morris Water Maze of rats and histological degeneration. However, treatment with α-LA significantly attenuated the behavioral impairment and biochemical parameters in rat treated with Pb. And amelioration of histological changes. Conclusion: As a conclusion, treatment with α-LA can improve the Pb-induced toxicity via antioxidant activity.
EDSPwebinar 4: The amphibian metamorphosis assayJim Regan
Amphibians are considered as being exceptionally vulnerable to endocrine disrupters, as they exhibit obvious effects on limb development and metamorphosis in wild populations following exposure. They have a high degree of sensitivity, whether in the tadpole stage or as adults, and respond to seemingly minimal changes in the environment.
This webinar discusses the metamorphosis assay, the selection of Xenopus Laevis, some aspects of the study design and where improvements could be made. We also discuss what the study means for you and how you can ensure that your contractor has all they need to conduct the study successfully.
More info at http://www.huntingdon.com/Chemical/Endocrinedisruptorscreeningprogram/Webinars
"Diarrhea can be a disruptive and uncomfortable gastrointestinal condition that affects individuals of all ages. Fortunately, there are effective anti-diarrhea drugs and treatments available to alleviate symptoms and restore digestive health.
Anti-diarrhea medications, such as loperamide and bismuth subsalicylate, work by slowing down the contractions of the intestinal muscles, reducing the frequency of bowel movements and helping to control loose stools. These over-the-counter options can provide quick relief from acute diarrhoea.
In this slideshare we gonna discuss about Mania Disorder, a key component of Bipolar Disorder, is a mental health condition characterized by extreme mood swings, with episodes of mania at one end and depressive states on the other. This comprehensive presentation delves into the complexities of Mania Disorder, shedding light on its symptoms, underlying causes, and the range of treatment options available.
More Related Content
Similar to screening model for Parkinson's disease.pptx
ABSTRACT- The present study was conducted to investigate the effect of cadmium chloride on Histoarchiteceture of head kidney of fresh water fish Heteropneustes fossilis. The fishes were exposed to 0.5 ppm of cadmium chloride for 21 days. The most remarkable changes in head kidney, due to cadmium chloride were lysed condition of interrenal and chromaffin cells. The traces of cytoplasm had dark brown to black coloured cytoplasm. Most of cells are deformed and necrotic condition. Their size was significant at (P< 0.01 and 0.001) increased after cadmium chloride. All these changes will be recovered by herbal compound i.e. Ashwagandha. The damaged tissues were recovered in already treated group.
Key-words- Ashwagandha, Cadmium chloride, Chromaffin cells, Heteropneustes fossilis, Histopathology, Interrenal cells
Spermatotoxic impact of bonny light crude oil (BLCO) ingestion on adult male ...lukeman Joseph Ade shittu
Increasing concern has been expressed about the possible declining trend in the sperm quality and sperm count of man as a result of exposure to environmental estrogenic agents in the past few years now. There is a general paucity of knowledge of BLCO ingestion on the reproductive effect. Hence, we aim to evaluate the impact of sub-lethal dose of BLCO ingestion on semen parameters of adult male mice. Initial acute toxicity study was carried out to determine the lethal dose of BLCO, which was calculated to be 37.4 mg/Kg body wt. A sub-lethal dose of 20 mg/Kg bwt /day of BLCO were then given to 8 male mice in the experimental group. While, the control group of 7 animals received equal volume of 0.9% normal saline via oral garvage for 2 weeks. Data were analysed using SPSS 12 statistical software with P < 0.05 considered statistically significant. There was a significant (P < 0.05) weight gain in the treated group with a significant (P < 0.05) reduction in sperm motility in the treated compared with control. The sperm density of treated and control were 14.5 x 106 /ml and 20.5 x 106 /ml respectively. However, there were also no significant difference in the relative testicular weight and sperm density of treated from that of the control respectively. Thus, it was concluded that BLCO ingestion is spermatotoxic in the adult male Swiss mice
Protective Effects of Alpha Lipoic Acid (Α-LA) Against Lead Neuro-Toxicity in...inventionjournals
Aim of the work: The present study was conducted to elucidate the possible protective effect of alpha lipoic acid (α-LA) against the deleterious effect perturbation induced in rat brain exposed to lead acetate. Methods: 32 Wistar male rats (weighing 130 ± 10 g) were divided into four groups (n=8): (1) normal control group (C); (2) Initiation group (Pb as lead acetate 20 mg/kg.b.wt, i.p. for 2 wks); (3) treatment group (α-LA 20 mg/kg.b.wt, i.p. for 3 wks); (4) post-initiation treatment group (Pb for 2 wks then followed by α-LA for 3 wks). Levels of monoamines (norepinephrine NE and dopamine DA), the level of Ache activity and finally adenosine triphosphate (ATP), were estimated in the hippocampus and cerebral cortex, in addition, a Morris water maze and the histological study were performed after completion of the experiments. Results: The results of the present work demonstrated that Pb inhibited neurotransmitters releases and decrease the level of Ache activity, as well as it inhibited energy production ATP. Pb impaired performance on Morris Water Maze of rats and histological degeneration. However, treatment with α-LA significantly attenuated the behavioral impairment and biochemical parameters in rat treated with Pb. And amelioration of histological changes. Conclusion: As a conclusion, treatment with α-LA can improve the Pb-induced toxicity via antioxidant activity.
EDSPwebinar 4: The amphibian metamorphosis assayJim Regan
Amphibians are considered as being exceptionally vulnerable to endocrine disrupters, as they exhibit obvious effects on limb development and metamorphosis in wild populations following exposure. They have a high degree of sensitivity, whether in the tadpole stage or as adults, and respond to seemingly minimal changes in the environment.
This webinar discusses the metamorphosis assay, the selection of Xenopus Laevis, some aspects of the study design and where improvements could be made. We also discuss what the study means for you and how you can ensure that your contractor has all they need to conduct the study successfully.
More info at http://www.huntingdon.com/Chemical/Endocrinedisruptorscreeningprogram/Webinars
"Diarrhea can be a disruptive and uncomfortable gastrointestinal condition that affects individuals of all ages. Fortunately, there are effective anti-diarrhea drugs and treatments available to alleviate symptoms and restore digestive health.
Anti-diarrhea medications, such as loperamide and bismuth subsalicylate, work by slowing down the contractions of the intestinal muscles, reducing the frequency of bowel movements and helping to control loose stools. These over-the-counter options can provide quick relief from acute diarrhoea.
In this slideshare we gonna discuss about Mania Disorder, a key component of Bipolar Disorder, is a mental health condition characterized by extreme mood swings, with episodes of mania at one end and depressive states on the other. This comprehensive presentation delves into the complexities of Mania Disorder, shedding light on its symptoms, underlying causes, and the range of treatment options available.
An idea which helps to know about both male and female sex hormones known as androgens, estrogens and progesterones and the differences between them. And basic information regarding sexual functionality helps us to know their necessity in our body
THE IMPORTANCE OF MARTIAN ATMOSPHERE SAMPLE RETURN.Sérgio Sacani
The return of a sample of near-surface atmosphere from Mars would facilitate answers to several first-order science questions surrounding the formation and evolution of the planet. One of the important aspects of terrestrial planet formation in general is the role that primary atmospheres played in influencing the chemistry and structure of the planets and their antecedents. Studies of the martian atmosphere can be used to investigate the role of a primary atmosphere in its history. Atmosphere samples would also inform our understanding of the near-surface chemistry of the planet, and ultimately the prospects for life. High-precision isotopic analyses of constituent gases are needed to address these questions, requiring that the analyses are made on returned samples rather than in situ.
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Sérgio Sacani
Since volcanic activity was first discovered on Io from Voyager images in 1979, changes
on Io’s surface have been monitored from both spacecraft and ground-based telescopes.
Here, we present the highest spatial resolution images of Io ever obtained from a groundbased telescope. These images, acquired by the SHARK-VIS instrument on the Large
Binocular Telescope, show evidence of a major resurfacing event on Io’s trailing hemisphere. When compared to the most recent spacecraft images, the SHARK-VIS images
show that a plume deposit from a powerful eruption at Pillan Patera has covered part
of the long-lived Pele plume deposit. Although this type of resurfacing event may be common on Io, few have been detected due to the rarity of spacecraft visits and the previously low spatial resolution available from Earth-based telescopes. The SHARK-VIS instrument ushers in a new era of high resolution imaging of Io’s surface using adaptive
optics at visible wavelengths.
Nutraceutical market, scope and growth: Herbal drug technologyLokesh Patil
As consumer awareness of health and wellness rises, the nutraceutical market—which includes goods like functional meals, drinks, and dietary supplements that provide health advantages beyond basic nutrition—is growing significantly. As healthcare expenses rise, the population ages, and people want natural and preventative health solutions more and more, this industry is increasing quickly. Further driving market expansion are product formulation innovations and the use of cutting-edge technology for customized nutrition. With its worldwide reach, the nutraceutical industry is expected to keep growing and provide significant chances for research and investment in a number of categories, including vitamins, minerals, probiotics, and herbal supplements.
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...Scintica Instrumentation
Intravital microscopy (IVM) is a powerful tool utilized to study cellular behavior over time and space in vivo. Much of our understanding of cell biology has been accomplished using various in vitro and ex vivo methods; however, these studies do not necessarily reflect the natural dynamics of biological processes. Unlike traditional cell culture or fixed tissue imaging, IVM allows for the ultra-fast high-resolution imaging of cellular processes over time and space and were studied in its natural environment. Real-time visualization of biological processes in the context of an intact organism helps maintain physiological relevance and provide insights into the progression of disease, response to treatments or developmental processes.
In this webinar we give an overview of advanced applications of the IVM system in preclinical research. IVIM technology is a provider of all-in-one intravital microscopy systems and solutions optimized for in vivo imaging of live animal models at sub-micron resolution. The system’s unique features and user-friendly software enables researchers to probe fast dynamic biological processes such as immune cell tracking, cell-cell interaction as well as vascularization and tumor metastasis with exceptional detail. This webinar will also give an overview of IVM being utilized in drug development, offering a view into the intricate interaction between drugs/nanoparticles and tissues in vivo and allows for the evaluation of therapeutic intervention in a variety of tissues and organs. This interdisciplinary collaboration continues to drive the advancements of novel therapeutic strategies.
Salas, V. (2024) "John of St. Thomas (Poinsot) on the Science of Sacred Theol...Studia Poinsotiana
I Introduction
II Subalternation and Theology
III Theology and Dogmatic Declarations
IV The Mixed Principles of Theology
V Virtual Revelation: The Unity of Theology
VI Theology as a Natural Science
VII Theology’s Certitude
VIII Conclusion
Notes
Bibliography
All the contents are fully attributable to the author, Doctor Victor Salas. Should you wish to get this text republished, get in touch with the author or the editorial committee of the Studia Poinsotiana. Insofar as possible, we will be happy to broker your contact.
Professional air quality monitoring systems provide immediate, on-site data for analysis, compliance, and decision-making.
Monitor common gases, weather parameters, particulates.
DERIVATION OF MODIFIED BERNOULLI EQUATION WITH VISCOUS EFFECTS AND TERMINAL V...Wasswaderrick3
In this book, we use conservation of energy techniques on a fluid element to derive the Modified Bernoulli equation of flow with viscous or friction effects. We derive the general equation of flow/ velocity and then from this we derive the Pouiselle flow equation, the transition flow equation and the turbulent flow equation. In the situations where there are no viscous effects , the equation reduces to the Bernoulli equation. From experimental results, we are able to include other terms in the Bernoulli equation. We also look at cases where pressure gradients exist. We use the Modified Bernoulli equation to derive equations of flow rate for pipes of different cross sectional areas connected together. We also extend our techniques of energy conservation to a sphere falling in a viscous medium under the effect of gravity. We demonstrate Stokes equation of terminal velocity and turbulent flow equation. We look at a way of calculating the time taken for a body to fall in a viscous medium. We also look at the general equation of terminal velocity.
This presentation explores a brief idea about the structural and functional attributes of nucleotides, the structure and function of genetic materials along with the impact of UV rays and pH upon them.
The ability to recreate computational results with minimal effort and actionable metrics provides a solid foundation for scientific research and software development. When people can replicate an analysis at the touch of a button using open-source software, open data, and methods to assess and compare proposals, it significantly eases verification of results, engagement with a diverse range of contributors, and progress. However, we have yet to fully achieve this; there are still many sociotechnical frictions.
Inspired by David Donoho's vision, this talk aims to revisit the three crucial pillars of frictionless reproducibility (data sharing, code sharing, and competitive challenges) with the perspective of deep software variability.
Our observation is that multiple layers — hardware, operating systems, third-party libraries, software versions, input data, compile-time options, and parameters — are subject to variability that exacerbates frictions but is also essential for achieving robust, generalizable results and fostering innovation. I will first review the literature, providing evidence of how the complex variability interactions across these layers affect qualitative and quantitative software properties, thereby complicating the reproduction and replication of scientific studies in various fields.
I will then present some software engineering and AI techniques that can support the strategic exploration of variability spaces. These include the use of abstractions and models (e.g., feature models), sampling strategies (e.g., uniform, random), cost-effective measurements (e.g., incremental build of software configurations), and dimensionality reduction methods (e.g., transfer learning, feature selection, software debloating).
I will finally argue that deep variability is both the problem and solution of frictionless reproducibility, calling the software science community to develop new methods and tools to manage variability and foster reproducibility in software systems.
Exposé invité Journées Nationales du GDR GPL 2024
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Sérgio Sacani
We characterize the earliest galaxy population in the JADES Origins Field (JOF), the deepest
imaging field observed with JWST. We make use of the ancillary Hubble optical images (5 filters
spanning 0.4−0.9µm) and novel JWST images with 14 filters spanning 0.8−5µm, including 7 mediumband filters, and reaching total exposure times of up to 46 hours per filter. We combine all our data
at > 2.3µm to construct an ultradeep image, reaching as deep as ≈ 31.4 AB mag in the stack and
30.3-31.0 AB mag (5σ, r = 0.1” circular aperture) in individual filters. We measure photometric
redshifts and use robust selection criteria to identify a sample of eight galaxy candidates at redshifts
z = 11.5 − 15. These objects show compact half-light radii of R1/2 ∼ 50 − 200pc, stellar masses of
M⋆ ∼ 107−108M⊙, and star-formation rates of SFR ∼ 0.1−1 M⊙ yr−1
. Our search finds no candidates
at 15 < z < 20, placing upper limits at these redshifts. We develop a forward modeling approach to
infer the properties of the evolving luminosity function without binning in redshift or luminosity that
marginalizes over the photometric redshift uncertainty of our candidate galaxies and incorporates the
impact of non-detections. We find a z = 12 luminosity function in good agreement with prior results,
and that the luminosity function normalization and UV luminosity density decline by a factor of ∼ 2.5
from z = 12 to z = 14. We discuss the possible implications of our results in the context of theoretical
models for evolution of the dark matter halo mass function.
Slide 1: Title Slide
Extrachromosomal Inheritance
Slide 2: Introduction to Extrachromosomal Inheritance
Definition: Extrachromosomal inheritance refers to the transmission of genetic material that is not found within the nucleus.
Key Components: Involves genes located in mitochondria, chloroplasts, and plasmids.
Slide 3: Mitochondrial Inheritance
Mitochondria: Organelles responsible for energy production.
Mitochondrial DNA (mtDNA): Circular DNA molecule found in mitochondria.
Inheritance Pattern: Maternally inherited, meaning it is passed from mothers to all their offspring.
Diseases: Examples include Leber’s hereditary optic neuropathy (LHON) and mitochondrial myopathy.
Slide 4: Chloroplast Inheritance
Chloroplasts: Organelles responsible for photosynthesis in plants.
Chloroplast DNA (cpDNA): Circular DNA molecule found in chloroplasts.
Inheritance Pattern: Often maternally inherited in most plants, but can vary in some species.
Examples: Variegation in plants, where leaf color patterns are determined by chloroplast DNA.
Slide 5: Plasmid Inheritance
Plasmids: Small, circular DNA molecules found in bacteria and some eukaryotes.
Features: Can carry antibiotic resistance genes and can be transferred between cells through processes like conjugation.
Significance: Important in biotechnology for gene cloning and genetic engineering.
Slide 6: Mechanisms of Extrachromosomal Inheritance
Non-Mendelian Patterns: Do not follow Mendel’s laws of inheritance.
Cytoplasmic Segregation: During cell division, organelles like mitochondria and chloroplasts are randomly distributed to daughter cells.
Heteroplasmy: Presence of more than one type of organellar genome within a cell, leading to variation in expression.
Slide 7: Examples of Extrachromosomal Inheritance
Four O’clock Plant (Mirabilis jalapa): Shows variegated leaves due to different cpDNA in leaf cells.
Petite Mutants in Yeast: Result from mutations in mitochondrial DNA affecting respiration.
Slide 8: Importance of Extrachromosomal Inheritance
Evolution: Provides insight into the evolution of eukaryotic cells.
Medicine: Understanding mitochondrial inheritance helps in diagnosing and treating mitochondrial diseases.
Agriculture: Chloroplast inheritance can be used in plant breeding and genetic modification.
Slide 9: Recent Research and Advances
Gene Editing: Techniques like CRISPR-Cas9 are being used to edit mitochondrial and chloroplast DNA.
Therapies: Development of mitochondrial replacement therapy (MRT) for preventing mitochondrial diseases.
Slide 10: Conclusion
Summary: Extrachromosomal inheritance involves the transmission of genetic material outside the nucleus and plays a crucial role in genetics, medicine, and biotechnology.
Future Directions: Continued research and technological advancements hold promise for new treatments and applications.
Slide 11: Questions and Discussion
Invite Audience: Open the floor for any questions or further discussion on the topic.
2. WHAT IS
ZEBRA FISH ?
• The zebrafish (Danio rerio) is a
small tropical freshwater fish that
has become a popular model
organism in scientific research,
notably in developmental biology,
genetics, and neuroscience.
Zebrafish are indigenous to South
Asia, mainly in the Ganges basin.
They are distinguished by their
striking blue and yellow stripes,
which resemble those of a zebra,
hence the name "zebrafish.”
3. GENDER BIAS:
CONTENTS MALE ZEBRA FISH FEMALE ZEBRA FISH
BODY SHAPE Slightly smaller Bloated and larger
COLOURISATION More vibrant and bold colour Less intense colour
FIN(DORSAL FIN) Long and pointed Short and rounded
GENITAL PAPILLIA Anal vent is modified and extended
(gonopodium )
Ovapositor(deposit eggs ) present
near to anal fin
SEXUAL BEHAIVOUR More active (chasing) Not much active as males
4. WHY
ZEBRA FISH
MODEL :
Like mammals, zebrafish possess a blood brain barrier, and permeability tests indicate
that its physiological properties are conserved between zebrafish and humans (Cuoghi
and Mola, 2007; Wager and Russell, 2013).
In addition to their physiological benefits, zebrafish also exhibit sophisticated cognitive
behaviours, such as learning and retaining associations, and they manifest well-
documented anxiety behaviours (Lieschke and Currie, 2007).
One of the key advantages of zebrafish is their suitability for genetic manipulation,
which has led to the development of thousands of mutant, transgenic and otherwise
genetically- altered strains (Ruzicka et al., 2019)
Zebrafish had been found to have similar dopaminergic signalling pathways to
mammals, and transcription factors have been shown to play evolutionarily conserved
roles in the development of zebrafish dopaminergic neurons (Xi et al., 2011).
Dopaminergic neurons in zebrafish are sensitive to oxidative stress, which is one of the
main causes of their death in PD (McCormack et al., 2006; Rappold et al., 2011; also
see above)
5. • Zebrafish are an essential model organism for several
reasons:
• 1. Genetic Similarities: Zebrafish share a high degree of
genetic similarity with humans, with many of their genes
having equivalents in humans. This makes them valuable for
studying genetic and developmental processes relevant to
human biology The dopaminergic system in embryonic
zebrafish is also well characterized. Dopaminergic neurons
are first detected at 18h post fertilization (hpf) in a cluster in
the ventral diencephalon, and by 72 hpf, the organization of
the central nervous system is complete and subsequent
development only adds increased numbers of neurons
(Kimmel et al., 1995; Wullimann and Rink, 2001).
• 2. Transparent Embryos: Zebrafish embryos are
transparent, which allows scientists to observe the
development of internal organs and tissues in real time. This
transparency makes them particularly useful for
developmental biology research.
ADVANTAGES OF SELECTING ZEBRA FISH
FOR STUDY
6. 3. Rapid Reproduction: Zebrafish reproduce quickly, with each pair of fish producing
hundreds of eggs per week. This rapid reproduction enables scientists to conduct
experiments on a large scale.
4. External Development: Zebrafish embryos develop externally, making it easy to
manipulate and study their development. Researchers can microinject substances or
modify genes during early embryonic stages.
5. Accessibility: Zebrafish are relatively easy to maintain in a laboratory setting and are
cost-effective to study compared to other animal models, such as mice or rats. zebrafish
are becoming increasingly popular for use in high-throughput screens due to their prolific
reproduction and cost-efficient size. Based on these factors, potential therapeutics and
genes can be quickly identified in a fraction of the time required for rodents
ANIMAL ZEBRA FISH
AGE 3-5 MONTHS
TEMPARATURE 28°C +/- 2°C
SURVIVAL TEMPARATURE 10 – 35 °C
pH 7.0 – 8.0
LIFE SPAN UPTO 5 YEARS
7. MY STUDY: ROTENONE INDUCED PARKINSON’S DISEASE
Rotenone is an isoflavone compound that naturally occurs in the jicama
vine plant as well as many Fabaceae plants. It has broad-spectrum
insecticide and pesticide activity and is also toxic to fish. Rotenone is
soluble in organic solvents such as ethanol, DMSO, and chloroform,
which should be purged with an inert gas. The solubility of rotenone in
ethanol is approximately 5 mg/ml and approximately 50 mg/ml in
DMSO and chloroform.
1. Inhibiting Mitochondrial Complex I: It disrupts the cell's energy
production by inhibiting a crucial component called
mitochondrial complex I.
2. Inducing Oxidative Stress: This inhibition leads to the production
of harmful reactive oxygen species (ROS) and free radicals that
damage cells.
3. Dopaminergic Neuron Degeneration: The selective loss of
dopaminergic neurons in the brain occurs, mirroring Parkinson's
disease.
4. Triggering Neuroinflammation: Rotenone causes an
inflammatory response in the brain, which is linked to
Parkinson's progression.
5. Behavioural and Motor Deficits: Animals exposed to rotenone
exhibit symptoms such as slowness of movement, tremors, and
postural instability, akin to human Parkinson's patients.
CHEMICAL FORMULA: C23H22O6
DOSE (2-3 micro gm/litre)
8. BEHAVIOURAL STUDY :
Examination tank was filled with fresh aerated tank water.
It consisted of a 5‐L tank (30 × 15 × 10 cm, length ×
height × width) with spacing of 5cm *5cm
All behavioural evaluations were done using a web
camera (Microsoft life cam). A behavioral study was done
for 1 h and parameters were measured at 15-minute time
intervals, viz., 0, 15, 30, 45, and 60. Since after 1 h all
fishes recovered from the effect of haloperidol, hence,
examination time was standardized to 1 h.
Recording was done for 5 min at every time interval and
average readings during 5 min were calculated for every
individual fish at each time point.
9. LOCOMOTOR ACTIVITY :
locomotor activity was monitored in a 2-L tank (18 × 9 ×
7 cm). A tower system was used to capture a video
recording of each fish for 5 min. Swimming activity was
categorized into three speeds: fast (>20 mm/s), slow (>2
mm/s and <20 mm/s), and freezing (<2mm/s). Movement
distance and duration at each speed were calculated using
software (Viewpoint Life Sciences, France)
LIGHT / DARK BOX TEST:
The light/dark box test was performed as previously
described (Gebauer et al. 2011). The tank (18 × 9 × 7 cm)
was separated into equally sized dark and light
compartments with a plastic barrier. The barrier was lifted
up 1 cm to allow fish to swim between compartments, and
the water level was kept at a depth of 3 cm. Fish were
individually placed into the light compartment and
allowed to swim freely for 6 min, during which a video
recording was obtained using the tower system. Latency
to enter the dark compartment, time spent in the light
compartment
10. OLFACTORY PRESENCE TEST :
Olfactory preference for a mixture of amino acids was assessed according to a previously described method
(Koide et al. 2009). Briefly, fish were individually placed in a tank (18 × 9 × 7 cm) and video recorded for 16
min using the tower system. After a 6-min pre-stimulation, 0.6 ml amino acid mixture (Cys and Met, 0.1
mM) was delivered into a corner of the tank at a rate of 1.5 ml/min. Time spent in the amino acid (TA) and
non-amino acid side (TC) was analyzed, and swim paths were tracked using software. Preference index (PI)
for each minute was calculated as: PI = (TA-TC)/(TA+TC).
11. WESTERN BLOTTING :
• Sample Preparation: They started by homogenizing the zebrafish brain tissue in a
lysis buffer containing specific components (150 mM NaCl, 25 mM Tris, 5 mM EDTA,
1% Nonidet P-40; pH 7.5) along with protease inhibitor cocktail tablets to prevent
protein degradation.
• Centrifugation: The homogenized brain samples were then centrifuged at 13,200 g
for 15 minutes at a temperature of 4 °C. This step separates the protein of interest
from other cellular components.
• Protein Quantification: The protein concentration in each resulting supernatant was
determined using a bicinchoninic acid assay (BCA assay). This helped in accurately
measuring the amount of TH protein.
• Gel Electrophoresis: 40 microgram aliquots of the protein samples were loaded onto
8% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE). This process separates
proteins by size.
CHEMICAL ASSESMENTS
12. • membrane Transfer: The separated proteins were then transferred from the gel onto
polyvinylidene fluoride (PVDF) membranes. This transfer step is crucial for further
analysis.
• Blocking and Antibody Incubation: The PVDF membranes were blocked using 5% fat-
free dry milk in a buffer solution. Subsequently, they were incubated with primary
antibodies: a rabbit anti-TH antibody (dilution 1:1000) and a mouse anti-β-actin antibody
(dilution 1:8000). This step allowed the specific proteins of interest to be "tagged" for later
detection.
• Secondary Antibody Binding: After incubation with primary antibodies, the membranes
were briefly washed and then exposed to a secondary antibody labeled with IRDye 680,
which can bind to the primary antibodies. This secondary antibody helps in detecting the
presence of the primary antibodies on the membrane.
• Imaging: Immunoreactive bands on the membranes, which correspond to the presence
of TH and β-actin, were visualized using an Odyssey CLx imaging system. This step
captures the signals generated by the antibodies, indicating the quantity of TH protein
present.
• Analysis: Finally, to quantify the amount of TH protein accurately, densitometric analysis
was performed using ImageJ software, a tool for analyzing digital images. This analysis
provides quantitative data regarding the protein levels in the zebrafish brain
samples.(Dongjun 2021)
13. QUANTITATIVE REAL POLYMERASE CHAIN REACTION :
Total RNA was extracted using Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), 1 μg RNA
was reverse transcribed into cDNA using a cDNA synthesis kit (Roche Diagnostics, Germany). Real‐time
PCR was conducted on the 7500 real‐time PCR system (Applied Biosystems, Foster City, CA, USA) with
the following primers: 18S (forward: 5′‐TCAACACGGGAAACCTCAC‐3′, reverse: 5′‐CGCTCCA
CCAACTAAGAAC‐3′), drd 1a (forward: 5′‐CTAAGGACTCATG ACACC CCC‐3′, reverse:
5′‐CAGTCACACCTCAGGTAGCAT‐3′), drd 1b (forward: 5′‐GACGGTGAACAAACTGCTGA‐3′, reverse:
5′‐CTTACACGTGAATCGG AGC
A ‐3′), drd 2a (forward: 5′‐AGTGCCGTAAACCCAATC‐3′, reverse: 5′‐ GTATCAT TTCCATCCCTTTCTG‐3′), drd
2b (forward: 5′‐GTCTCCATCT CCGTCCTCTC‐3′, reverse: 5′‐TTACCGAACACCACACAGAAG‐3′), drd 2c
(forward: 5′‐ATGCTCCT GACTCTCCTC‐3′, reverse: 5′‐ATCTGCCACCG CCAAG‐3′), drd 3 (forward: 5′‐TT
CAGACCACCACCAACTACC‐3′, re- verse: 5′‐GCTCCGCCGACCACTTC‐3′). The results were normalized to 18S
RNA( Dongjun 2021).
Drd =dopa responsive dystonia (term used to describe specific dystonia disorders that respond to a
medication called levodopa)
cDNA = complementary DNA
14. REFERENCES:
Cuoghi, B., and Mola, L. (2007). Microglia of Teleosts: Facing a challenge in Neurobiology. Eur. J.
Histochem. 51, 231–239. Available at: https://search- proquest-
com.ezproxy.library.dal.ca/docview/876292801?accountid=10406 (Accessed November 21, 2018).
Lieschke, G. J., and Currie, P. D. (2007). Animal Models of Human Disease: Zebrafish Swim into
View. Nat. Rev. Genet. 8, 353–367. doi:10.1038/ nrg2091
Ruzicka, L., Howe, D. G., Ramachandran, S., Toro, S., Van Slyke, C. E., Bradford, Y. M., et al.
(2019). The Zebrafish Information Network: New Support for Non-coding Genes, Richer Gene
Ontology Annotations and the Alliance of Genome Resources. Nucleic Acids Res. 47, D867–D873.
doi:10.1093/nar/gky1090
Xi, Y., Noble, S., and Ekker, M. (2011). Modeling Neurodegeneration in Zebrafish. Curr. Neurol.
Neurosci. Rep. 11, 274–282. doi:10.1007/s11910-011-0182-2
McCormack, A. L., Atienza, J. G., Langston, J. W., and Di Monte, D. A. (2006). Decreased
Susceptibility to Oxidative Stress Underlies the Resistance of Specific Dopaminergic Cell
Populations to Paraquat-Induced Degeneration. Neuroscience 141, 929–937.
doi:10.1016/j.neuroscience.2006.03.069
15. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., and Schilling, T. F. (1995). Stages of
Embryonic Development of the Zebrafish. Dev. Dyn. 203, 253–310. doi:10.1002/aja.1002030302
Wullimann, M., and Rink, E. (2001). Detailed Immunohistology of Pax6 Protein and Tyrosine
Hydroxylase in the Early Zebrafish Brain Suggests Role of Pax6 Gene in Development of
Dopaminergic. Dev. Brain Res. 131, 173–191. Available at: http://
www.sciencedirect.com/science/article/pii/S016538060100270X (Accessed September 6, 2017).
doi:10.1016/s0165-3806(01)00270-x
Lv DJ, Li LX, Chen J, Wei SZ, Wang F, Hu H, Xie AM, Liu CF. Sleep deprivation caused a memory
defects and emotional changes in a rotenone-based zebrafish model of Parkinson’s disease.
Behavioural Brain Research. 2019 Oct 17;372:112031.