This document summarizes a research article that studied the role of p53 in daunorubicin (DNR)-induced lesions in the spleen. The key findings were:
1) DNR treatment caused more rapid cell death and weight loss in the spleens of wild type mice compared to p53-null mice.
2) While wild type mouse spleens recovered normal morphology 8 days after DNR treatment, p53-null mouse spleens still had large necrotic lesions.
3) DNR treatment increased p21 levels in wild type mice but not p53-null mice, indicating p53 is required for p21 induction.
4) The results suggest p53
Cholestasis induces reversible accumulation of periplakin in mouse liverEnrique Moreno Gonzalez
Periplakin (PPL) is a rod-shaped cytolinker protein thought to connect cellular adhesion junctional complexes to cytoskeletal filaments. PPL serves as a structural component of the cornified envelope in the skin and interacts with various types of proteins in cultured cells; its level decreases dramatically during tumorigenic progression in human epithelial tissues. Despite these intriguing observations, the physiological roles of PPL, especially in noncutaneous tissues, are still largely unknown. Because we observed a marked fluctuation of PPL expression in mouse liver in association with the bile acid receptor farnesoid X receptor (FXR) and cholestasis, we sought to characterize the role of PPL in the liver and determine its contributions to the etiology and pathogenesis of cholestasis.
CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1a...Enrique Moreno Gonzalez
Glioblastomas, the most common and malignant brain tumors of the central nervous system, exhibit high invasive capacity, which hinders effective therapy. Therefore, intense efforts aimed at improved therapeutics are ongoing to delineate the molecular mechanisms governing glioma cell migration and invasion.
Objective: Ischemia-reperfusion (I/R) leads to reactive oxygen species formation and cell death in kidney tissue with injury and organ transplantation. Simvastatin (SIM) is an antioxidant, anti-inflammatory, and anticoagulant agent. Alterations in I/R-induced acute kidney injury model with SIM treatment were analyzed.
Study Design: Wistar rats (n=28) were grouped into Sham, Ischemia, I/R, and I/R+SIM treated. Left rat kidney renal vessels were clamped for 60 minutes for ischemia, and the I/R group had 6 hours of reperfusion. 10 mg/kg SIM was given orally for 28 days. MDA, GSH, and MPO were analyzed. Kidney tissues were paraffin embedded, and primary antibodies TNF-α and caspase-3 were applied for immunohistochemistry.
Results: In the I/R group, intense inflammatory cell infiltration around the vessels and necrosis in the glomerular structures were observed. In the treated group, proximal and distal tubular cells were found to be close to normal. Immunoexpression of caspase-3 in the ischemia group was positive in degenerative glomeruli. In the treated group, TNF-α expression was negative in the glomerular structures. MDA and MPO levels were significantly increased in ischemia and I/R.
Conclusion: We suggest that SIM treatment improved kidney tissue structure and function in a model of I/R injury.
Keywords: caspase-3; immunohistochemistry; ischemia/reperfusion; kidney; MPO; simvastatin
ADAR2 editing activity in newly diagnosed versus relapsed pediatric high-grad...Enrique Moreno Gonzalez
High-grade (WHO grade III and IV) astrocytomas are aggressive malignant brain tumors affecting humans with a high risk of recurrence in both children and adults. To date, limited information is available on the genetic and molecular alterations important in the onset and progression of pediatric high-grade astrocytomas and, even less, on the prognostic factors that influence long-term outcome in children with recurrence. A-to-I RNA editing is an essential post-transcriptional mechanism that can alter the nucleotide sequence of several RNAs and is
mediated by the ADAR enzymes. ADAR2 editing activity is particularly important in mammalian brain and is impaired in both adult and pediatric high-grade astrocytomas.
Moreover, we have recently shown that the recovered ADAR2 activity in high-grade astrocytomas inhibits in vivo tumor growth. The aim of the present study is to investigate whether changes may occur in ADAR2-mediated RNA editing profiles of relapsed highgrade astrocytomas compared to their respective specimens collected at diagnosis, in four pediatric patients.
Cholestasis induces reversible accumulation of periplakin in mouse liverEnrique Moreno Gonzalez
Periplakin (PPL) is a rod-shaped cytolinker protein thought to connect cellular adhesion junctional complexes to cytoskeletal filaments. PPL serves as a structural component of the cornified envelope in the skin and interacts with various types of proteins in cultured cells; its level decreases dramatically during tumorigenic progression in human epithelial tissues. Despite these intriguing observations, the physiological roles of PPL, especially in noncutaneous tissues, are still largely unknown. Because we observed a marked fluctuation of PPL expression in mouse liver in association with the bile acid receptor farnesoid X receptor (FXR) and cholestasis, we sought to characterize the role of PPL in the liver and determine its contributions to the etiology and pathogenesis of cholestasis.
CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1a...Enrique Moreno Gonzalez
Glioblastomas, the most common and malignant brain tumors of the central nervous system, exhibit high invasive capacity, which hinders effective therapy. Therefore, intense efforts aimed at improved therapeutics are ongoing to delineate the molecular mechanisms governing glioma cell migration and invasion.
Objective: Ischemia-reperfusion (I/R) leads to reactive oxygen species formation and cell death in kidney tissue with injury and organ transplantation. Simvastatin (SIM) is an antioxidant, anti-inflammatory, and anticoagulant agent. Alterations in I/R-induced acute kidney injury model with SIM treatment were analyzed.
Study Design: Wistar rats (n=28) were grouped into Sham, Ischemia, I/R, and I/R+SIM treated. Left rat kidney renal vessels were clamped for 60 minutes for ischemia, and the I/R group had 6 hours of reperfusion. 10 mg/kg SIM was given orally for 28 days. MDA, GSH, and MPO were analyzed. Kidney tissues were paraffin embedded, and primary antibodies TNF-α and caspase-3 were applied for immunohistochemistry.
Results: In the I/R group, intense inflammatory cell infiltration around the vessels and necrosis in the glomerular structures were observed. In the treated group, proximal and distal tubular cells were found to be close to normal. Immunoexpression of caspase-3 in the ischemia group was positive in degenerative glomeruli. In the treated group, TNF-α expression was negative in the glomerular structures. MDA and MPO levels were significantly increased in ischemia and I/R.
Conclusion: We suggest that SIM treatment improved kidney tissue structure and function in a model of I/R injury.
Keywords: caspase-3; immunohistochemistry; ischemia/reperfusion; kidney; MPO; simvastatin
ADAR2 editing activity in newly diagnosed versus relapsed pediatric high-grad...Enrique Moreno Gonzalez
High-grade (WHO grade III and IV) astrocytomas are aggressive malignant brain tumors affecting humans with a high risk of recurrence in both children and adults. To date, limited information is available on the genetic and molecular alterations important in the onset and progression of pediatric high-grade astrocytomas and, even less, on the prognostic factors that influence long-term outcome in children with recurrence. A-to-I RNA editing is an essential post-transcriptional mechanism that can alter the nucleotide sequence of several RNAs and is
mediated by the ADAR enzymes. ADAR2 editing activity is particularly important in mammalian brain and is impaired in both adult and pediatric high-grade astrocytomas.
Moreover, we have recently shown that the recovered ADAR2 activity in high-grade astrocytomas inhibits in vivo tumor growth. The aim of the present study is to investigate whether changes may occur in ADAR2-mediated RNA editing profiles of relapsed highgrade astrocytomas compared to their respective specimens collected at diagnosis, in four pediatric patients.
Search for atoxic cereals: a single blind, cross-over study on the safety of...Enrique Moreno Gonzalez
Cereals of baking quality with absent or reduced toxicity are actively sought as alternative therapy to a gluten-free diet (GFD) for patients with coeliac disease (CD). Triticum monococcum, an ancient wheat, is a potential candidate having no toxicity in in-vitro and exvivo studies. The aim of our study was to investigate on the safety of administration of a single dose of gluten of Tm in patients with CD on GFD.
Présentation de Michel Pucéat réalisée durant le cours du réseau international des instituts Pasteur de "Médecine Génomique: du diagnostic à la thérapie " (17-21 octobre 2016)
Objective: To probe into the influence of miR-21 on the proliferation as well as apoptosis of oral squamous cell carcinoma (OSCC) and its causative role.
Study Design: We adopted microarray for detecting the differentially expressed genes in OSCC tumor tis-sues and paracancerous tissues. We assessed the link of miR-21 expression with tumor size, lymph node metastasis, and tumor differentiation. We employed CCK-8 and EdU assay for detecting the impact of miR-21 inhibitor and miR-21 mimic on Cal-27 cell proliferation, as well as TUNEL and AnnexinV-FITC/PI double staining for detecting miR-21 expression on cell apoptosis. We forecasted the possible target of miR-21 via TargetScan, as well as detected the interaction of miR-21 with PTEN via luciferase reporter experiment. The function of miR-21 expression in PTEN signaling pathway was monitored via western blot. We constructed PTEN overexpression plasmid and conducted rescue experiment to evaluate overexpressed PTEN on miR-21–induced proliferation.
Results: Microarray and RT-qPCR indicated that miR-21 expression increased demonstrably in OSCC. Subsequently, statistical analysis showed that miR-21 expression was plainly correlated with tumor size, lymph node metastasis, tumor differentiation, and smoking history. CCK-8 and EdU method exhibited that miR-21 mimics manifestly promoted Cal-27 cell proliferation, while miR-21 inhibitor blatantly inhibited Cal-27 cell proliferation. TUNEL and V-FITC/PI double staining assay showed that miR-21 inhibitor conspicuously promoted Cal-27 cell apoptosis. CCK-8 and EdU assay exhibited that overexpressed PTEN abolished the pro-proliferation influence of miR-21 mimic. TUNEL and V-FITC/PI experiments pointed out that knocking down PTEN abrogated the pro-apoptosis impact of miR-21 inhibitor.
Conclusion: miR-21 contributes to OSCC cell proliferation via targeting PTEN and inhibits its apoptosis.
Keywords: Akt/PKB signaling pathway; apoptosis; biomarkers, tumor; carcinoma, squamous cell; cell line, tumor; cell proliferation; microRNAs; miR-21; miRNA-21; mouth neoplasms; oral cancer; oral squamous cell carcinoma; proliferation; real time PCR
Objective: To investigate the changes in the retina due to deltamethrin toxicity and the process in cell inflammation and apoptosis.
Study Design: Sixteen Wistar albino rats were randomly divided into two groups as control (n=8) and deltamethrin (n=8) groups. Saline was given to the control group, and 0.5 mL of 5 mg/kg deltamethrin was given to the deltamethrin group for 14 days each. Blood was collected for biochemical analysis. Retinal tissue was processed for histological examination.
Results: Compared to the control group, MDA levels were high while GSH and CAT levels were low in the deltamethrin group. Histopathological analysis showed spaces between the pigment epithelium, irregularity in the delimiting membrane, degenerated ganglion, cone and bacillus cell, pyknotic nuclei, thinned inner limitation membrane, and thickened vascular wall. The control group showed FAS expression in the pigment layer limiting membranes, in the nuclei of many cone and bacillus cells, and ganglion cells in the control group sections. In the deltamethrin group, FAS expression was observed in the inner and outer limiting membranes of the pigment epithelium, cone and bacillus cells, and ganglion cell nuclei. In the control group, negative NOS expression in the pigment epithelium and outer limiting membranes, internal limitation membrane, and ganglion cells in the cone and bacillus cell nuclei were observed. In the deltamethrin group, NOS expression was positive in the pigment epithelium, cone and bacillus, and ganglion cell nuclei.
Conclusion: We suggest that deltamethrin toxicity induced apoptotic process due to increased inflammation in the retina and may cause visual impairment as a result of neural damage.
Keywords: deltamethrin, FAS, insecticides, NOS, nitric oxide synthase, retina
Impaired mitochondrial beta-oxidation in patients with chronic hepatitis C: r...Enrique Moreno Gonzalez
Hepatic steatosis is often seen in patients with chronic hepatitis C (CH-C). It is still unclear whether these patients have an impaired mitochondrial β-oxidation. In this study we assessed mitochondrial β-oxidation in CH-C patients by investigating ketogenesis during fasting.
Post-diagnosis hemoglobin change associates with overall survival of multiple...Enrique Moreno Gonzalez
Anemia refers to low hemoglobin (Hb) level and is a risk factor of cancer patient survival. The National Comprehensive Cancer Network recently suggested that post-diagnosis Hb change, regardless of baseline Hb level, indicates the potential presence of anemia. However, there is no epidemiological study evaluating whether Hb change has direct prognostic values for cancer patients at the population level.
Search for atoxic cereals: a single blind, cross-over study on the safety of...Enrique Moreno Gonzalez
Cereals of baking quality with absent or reduced toxicity are actively sought as alternative therapy to a gluten-free diet (GFD) for patients with coeliac disease (CD). Triticum monococcum, an ancient wheat, is a potential candidate having no toxicity in in-vitro and exvivo studies. The aim of our study was to investigate on the safety of administration of a single dose of gluten of Tm in patients with CD on GFD.
Présentation de Michel Pucéat réalisée durant le cours du réseau international des instituts Pasteur de "Médecine Génomique: du diagnostic à la thérapie " (17-21 octobre 2016)
Objective: To probe into the influence of miR-21 on the proliferation as well as apoptosis of oral squamous cell carcinoma (OSCC) and its causative role.
Study Design: We adopted microarray for detecting the differentially expressed genes in OSCC tumor tis-sues and paracancerous tissues. We assessed the link of miR-21 expression with tumor size, lymph node metastasis, and tumor differentiation. We employed CCK-8 and EdU assay for detecting the impact of miR-21 inhibitor and miR-21 mimic on Cal-27 cell proliferation, as well as TUNEL and AnnexinV-FITC/PI double staining for detecting miR-21 expression on cell apoptosis. We forecasted the possible target of miR-21 via TargetScan, as well as detected the interaction of miR-21 with PTEN via luciferase reporter experiment. The function of miR-21 expression in PTEN signaling pathway was monitored via western blot. We constructed PTEN overexpression plasmid and conducted rescue experiment to evaluate overexpressed PTEN on miR-21–induced proliferation.
Results: Microarray and RT-qPCR indicated that miR-21 expression increased demonstrably in OSCC. Subsequently, statistical analysis showed that miR-21 expression was plainly correlated with tumor size, lymph node metastasis, tumor differentiation, and smoking history. CCK-8 and EdU method exhibited that miR-21 mimics manifestly promoted Cal-27 cell proliferation, while miR-21 inhibitor blatantly inhibited Cal-27 cell proliferation. TUNEL and V-FITC/PI double staining assay showed that miR-21 inhibitor conspicuously promoted Cal-27 cell apoptosis. CCK-8 and EdU assay exhibited that overexpressed PTEN abolished the pro-proliferation influence of miR-21 mimic. TUNEL and V-FITC/PI experiments pointed out that knocking down PTEN abrogated the pro-apoptosis impact of miR-21 inhibitor.
Conclusion: miR-21 contributes to OSCC cell proliferation via targeting PTEN and inhibits its apoptosis.
Keywords: Akt/PKB signaling pathway; apoptosis; biomarkers, tumor; carcinoma, squamous cell; cell line, tumor; cell proliferation; microRNAs; miR-21; miRNA-21; mouth neoplasms; oral cancer; oral squamous cell carcinoma; proliferation; real time PCR
Objective: To investigate the changes in the retina due to deltamethrin toxicity and the process in cell inflammation and apoptosis.
Study Design: Sixteen Wistar albino rats were randomly divided into two groups as control (n=8) and deltamethrin (n=8) groups. Saline was given to the control group, and 0.5 mL of 5 mg/kg deltamethrin was given to the deltamethrin group for 14 days each. Blood was collected for biochemical analysis. Retinal tissue was processed for histological examination.
Results: Compared to the control group, MDA levels were high while GSH and CAT levels were low in the deltamethrin group. Histopathological analysis showed spaces between the pigment epithelium, irregularity in the delimiting membrane, degenerated ganglion, cone and bacillus cell, pyknotic nuclei, thinned inner limitation membrane, and thickened vascular wall. The control group showed FAS expression in the pigment layer limiting membranes, in the nuclei of many cone and bacillus cells, and ganglion cells in the control group sections. In the deltamethrin group, FAS expression was observed in the inner and outer limiting membranes of the pigment epithelium, cone and bacillus cells, and ganglion cell nuclei. In the control group, negative NOS expression in the pigment epithelium and outer limiting membranes, internal limitation membrane, and ganglion cells in the cone and bacillus cell nuclei were observed. In the deltamethrin group, NOS expression was positive in the pigment epithelium, cone and bacillus, and ganglion cell nuclei.
Conclusion: We suggest that deltamethrin toxicity induced apoptotic process due to increased inflammation in the retina and may cause visual impairment as a result of neural damage.
Keywords: deltamethrin, FAS, insecticides, NOS, nitric oxide synthase, retina
Impaired mitochondrial beta-oxidation in patients with chronic hepatitis C: r...Enrique Moreno Gonzalez
Hepatic steatosis is often seen in patients with chronic hepatitis C (CH-C). It is still unclear whether these patients have an impaired mitochondrial β-oxidation. In this study we assessed mitochondrial β-oxidation in CH-C patients by investigating ketogenesis during fasting.
Post-diagnosis hemoglobin change associates with overall survival of multiple...Enrique Moreno Gonzalez
Anemia refers to low hemoglobin (Hb) level and is a risk factor of cancer patient survival. The National Comprehensive Cancer Network recently suggested that post-diagnosis Hb change, regardless of baseline Hb level, indicates the potential presence of anemia. However, there is no epidemiological study evaluating whether Hb change has direct prognostic values for cancer patients at the population level.
Abnormal expression of Pygopus 2 correlates with a malignant phenotype in hum...Enrique Moreno Gonzalez
Pygopus 2 (Pygo2) is a Pygo family member and an important component of the Wnt signaling transcriptional complex. Despite this data, no clinical studies investigating Pygo2 expression in lung cancer have yet been reported.
Differentiation of irradiation and cetuximab induced skin reactions in patien...Enrique Moreno Gonzalez
In order to improve the clinical outcome of patients with locally advanced squamous cell carcinoma of the head and neck (LASCCHN) not being capable to receive platinum-based chemoradiation, radiotherapy can be intensified by addition of cetuximab, a monoclonal antibody that blocks the epidermal growth factor receptor (EGFR). The radioimmunotherapy with cetuximab is a feasible treatment option showing a favourable toxicity profile. The most frequent side effect of radiotherapy is radiation dermatitis, the most common side effect of treatment with cetuximab is acneiform rash. Incidence and severity of these frequent, often overlapping and sometimes limiting skin reactions, however, are not well explored. A clinical and molecular differentiation between radiogenic skin reactions and skin reactions caused by cetuximab which may correlate with outcome, have never been described before.
Cost-effectiveness of MRI for breast cancer screening in BRCA1/2 mutation car...Enrique Moreno Gonzalez
Women with mutations in BRCA1 or BRCA2 are at high risk of developing breast cancer and, in British Columbia, Canada, are offered screening with both magnetic resonance imaging (MRI) and mammography to facilitate early detection. MRI is more sensitive than mammography but is more costly and produces more false positive results. The purpose of this study was to calculate the cost-effectiveness of MRI screening for breast cancer in BRCA1/2 mutation carriers in a Canadian setting.
Overexpression of YAP 1 contributes to progressive features and poor prognosi...Enrique Moreno Gonzalez
Yes-associated protein 1 (YAP 1), the nuclear effector of the Hippo pathway, is a key regulator of organ size and a candidate human oncogene in multiple tumors. However, the expression dynamics of YAP 1 in urothelial carcinoma of the bladder (UCB) and its clinical/prognostic significance are unclear.
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
International Journal of Pharmaceutical Science Invention (IJPSI)inventionjournals
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online
Similar to Functional p53 is required for rapid restoration of daunorubicin-induced lesions of the spleen (20)
Incidence of pneumonia and risk factors among patients with head and neck can...Enrique Moreno Gonzalez
This study investigated the incidence and patient- and treatment-related risk factors related to pneumonia acquired during radiotherapy (PNRT) in head and neck cancer (HNC) patients.
Gene expression analysis of a Helicobacter pyloriinfected and high-salt diet-...Enrique Moreno Gonzalez
Helicobacter pylori (H. pylori) infection and excessive salt intake are known as important risk factors for stomach cancer in humans. However, interactions of these two factors with gene expression profiles during gastric carcinogenesis remain unclear. In the present study, we investigated the global gene expression associated with stomach carcinogenesis and prognosis of human gastric cancer using a mouse model.
Acute myeloid leukemia (AML) is a hematopoietic malignancy with a dismal outcome in the majority of cases. A detailed understanding of the genetic alterations and gene expression changes that contribute to its pathogenesis is important to improve prognostication, disease monitoring, and therapy. In this context, leukemia-associated misexpression of microRNAs (miRNAs) has been studied, but no coherent picture has emerged yet, thus warranting further investigations.
Recently, a phase II clinical trial in hepatocellular carcinoma (HCC) has suggested that the combination of sorafenib and 5-fluorouracil (5-FU) is feasible and side effects are manageable. However, preclinical experimental data explaining the interaction mechanism(s) are lacking. Our objective is to investigate the anticancer efficacy and mechanism of combined sorafenib and 5-FU therapy in vitro in HCC cell lines MHCC97H and SMMC-7721.
Differences in microRNA expression during tumor development in the transition...Enrique Moreno Gonzalez
The prostate is divided into three glandular zones, the peripheral zone (PZ), the transition zone (TZ), and the central zone. Most prostate tumors arise in the peripheral zone (70-75%) and in the transition zone (20-25%) while only 10% arise in the central zone. The aim of this study was to investigate if differences in miRNA expression could be a possible explanation for the difference in propensity of tumors in the zones of the prostate.
Multicentric and multifocal versus unifocal breast cancer: differences in the...Enrique Moreno Gonzalez
The aim of this study was to evaluate the expression of the cell adhesion-related glycoproteins MUC-1, β-catenin and E-cadherin in multicentric/multifocal breast cancer in comparison to unifocal disease in order to identify potential differences in the biology of these tumor types.
The life in sight application study (LISA): design of a randomized controlled...Enrique Moreno Gonzalez
It is widely recognized that spiritual care plays an important role in physical and psychosocial well-being of cancer patients, but there is little evidence based research on the effects of spiritual care. We will conduct a randomized controlled trial on spiritual care using a brief structured interview scheme supported by an e-application. The aim is to examine whether an assisted reflection on life events and ultimate life goals can improve quality of life of cancer patients.
Clinical and experimental studies regarding the expression and diagnostic val...Enrique Moreno Gonzalez
Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) is a multifunctional Ig-like cell adhesion molecule that has a wide range of biological functions. According to previous reports, serum CEACAM1 is dysregulated in different malignant tumours and associated with tumour progression. However, the serum CEACAM1 expression in nonsmall-cell lung carcinomas (NSCLC) is unclear. The different expression ratio of CEACAM1-S and CEACAM1-L isoform has seldom been investigated in NSCLC. This research is intended to study the serum CEACAM1 and the ratio of CEACAM1-S/L isoforms in NSCLC.
Assessment of preoperative exercise capacity in hepatocellular carcinoma pati...Enrique Moreno Gonzalez
Cardiopulmonary exercise testing measures oxygen uptake at increasing levels of work and predicts cardiopulmonary performance under conditions of stress, such as after abdominal surgery. Dynamic assessment of preoperative exercise capacity may be a useful predictor of postoperative prognosis. This study examined the relationship between preoperative exercise capacity and event-free survival in hepatocellular carcinoma (HCC) patients with chronic liver injury who underwent hepatectomy.
Intraepithelial lymphocyte distribution differs between the bulb and the seco...Enrique Moreno Gonzalez
Evaluation of intraepithelial duodenal lymphocytosis (IDL) is important in celiac disease (CD). There is no established cut-off value for increased number of IELs in the bulb. We therefore investigated the relation between IEL counts in the bulb and duodenal specimens in non-celiac subjects.
Sticky siRNAs targeting survivin and cyclin B1 exert an antitumoral effect on...Enrique Moreno Gonzalez
Melanoma represents one of the most aggressive and therapeutically challenging malignancies as it often gives rise to metastases and develops resistance to classical chemotherapeutic agents. Although diverse therapies have been generated, no major improvement of the patient prognosis has been noticed. One promising alternative to the conventional therapeutic approaches currently available is the inactivation of proteins essential for survival and/or progression of melanomas by means of RNA interference. Survivin and cyclin B1, both involved in cell survival and proliferation and frequently deregulated in human cancers, are good candidate target genes for siRNA mediated therapeutics.
Association between variations in the fat mass and obesity-associated gene an...Enrique Moreno Gonzalez
It is clear that genetic variations in the fat mass and obesity-associated (FTO) gene affect body mass index and the risk of obesity. Given the mounting evidence showing a positive association between obesity and pancreatic cancer, this study aimed to investigate the relation between variants in the FTO gene, obesity and pancreatic cancer risk.
The cysteinyl leukotriene 2 receptor contributes to all-trans retinoic acid-i...Enrique Moreno Gonzalez
Cysteinyl leukotrienes (CysLTs) are potent pro-inflammatory mediators that are increased in samples from patients with inflammatory bowel diseases (IBDs). Individuals with IBDs have enhanced susceptibility to colon carcinogenesis. In colorectal cancer, the balance between the pro-mitogenic cysteinyl leukotriene 1 receptor (CysLT1R) and the differentiation-promoting cysteinyl leukotriene 2 receptor (CysLT2R) is lost. Further, our previous data indicate that patients with high CysLT1R and low CysLT2R expression have a poor prognosis. In this study, we examined whether the balance between CysLT1R and CysLT2R could be restored by treatment with the cancer chemopreventive agent all-trans retinoic acid (ATRA).
Clinical features and outcome of cryptogenic hepatocellular carcinoma compare...Enrique Moreno Gonzalez
Cryptogenic hepatocellular carcinoma (HCC) is thought to arise due to non-alcoholic fatty liver disease (NAFLD). This study investigated the prevalence, clinical features, and outcomes of cryptogenic HCC and compared them with those of HCC related to hepatitis B virus infection (HBV-HCC), hepatitis C virus infection (HCV-HCC), and alcohol (ALCHCC) in Korea.
Fatty liver index correlates with non-alcoholic fatty liver disease, but not ...Enrique Moreno Gonzalez
Fatty liver index (FLI) was recently established to predict non-alcoholic fatty liver disease (NAFLD) in general population, which is known to be associated with coronary artery atherosclerotic disease (CAD).
This study aims to investigate whether FLI correlates with NAFLD and with newly diagnosed CAD in a special Chinese population who underwent coronary angiography.
Antibiotic exposure and the development of coeliac disease: a nationwide case...Enrique Moreno Gonzalez
The intestinal microbiota has been proposed to play a pathogenic role in coeliac disease (CD). Although antibiotics are common environmental factors with a profound impact on intestinal microbiota, data on antibiotic use as a risk factor for subsequent CD development are scarce.
Implication from thyroid function decreasing during chemotherapy in breast ca...Enrique Moreno Gonzalez
Thyroid hormones have been shown to regulate breast cancer cells growth, the absence or reduction of thyroid hormones in cells could provoke a proliferation arrest in G0-G1 or weak mitochondrial activity, which makes cells insensitive to therapies for cancers through transforming into low metabolism status. This biological phenomenon may help explain why treatment efficacy and prognosis vary among breast cancer patients having hypothyroid, hyperthyroid and normal function. Nevertheless, the abnormal thyroid function in breast cancer patients has been considered being mainly caused by thyroid diseases, few studied influence of chemotherapy on thyroid function and whether its alteration during chemotherapy can influence the respose to chemotherapy is still unclear. So, we aimed to find the alterations of thyroid function and non-thyroidal illness syndrome (NTIS) prevalence druing chemotherapy in breast cancer patients, and investigate the influence of thyroid hormones on chemotherapeutic efficacy.
Optimal schedule of Bacillus Calmette-Guerin for non-muscle-invasive bladder ...Enrique Moreno Gonzalez
To explore the necessity of maintenance, efficacy of low-dose and superiority of various combination therapies of Bacillus Calmette-Guérin (BCG) in treatment of superficial bladder cancer (BCa).
Environment inside even a small tumor is characterized by total (anoxia) or partial oxygen deprivation, hypoxia. It has been shown that radiotherapy and some conventional chemotherapies may be less effective in hypoxia, and therefore it is important to investigate how different drugs act in different microenvironments. In this study we perform a large screening of the effects of 19 clinically used or experimental chemotherapeutic drugs on four different cell lines in conditions of normoxia, hypoxia and anoxia.
263778731218 Abortion Clinic /Pills In Harare ,sisternakatoto
263778731218 Abortion Clinic /Pills In Harare ,ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group of receptionists, nurses, and physicians have worked together as a teamof receptionists, nurses, and physicians have worked together as a team wwww.lisywomensclinic.co.za/
The prostate is an exocrine gland of the male mammalian reproductive system
It is a walnut-sized gland that forms part of the male reproductive system and is located in front of the rectum and just below the urinary bladder
Function is to store and secrete a clear, slightly alkaline fluid that constitutes 10-30% of the volume of the seminal fluid that along with the spermatozoa, constitutes semen
A healthy human prostate measures (4cm-vertical, by 3cm-horizontal, 2cm ant-post ).
It surrounds the urethra just below the urinary bladder. It has anterior, median, posterior and two lateral lobes
It’s work is regulated by androgens which are responsible for male sex characteristics
Generalised disease of the prostate due to hormonal derangement which leads to non malignant enlargement of the gland (increase in the number of epithelial cells and stromal tissue)to cause compression of the urethra leading to symptoms (LUTS
Recomendações da OMS sobre cuidados maternos e neonatais para uma experiência pós-natal positiva.
Em consonância com os ODS – Objetivos do Desenvolvimento Sustentável e a Estratégia Global para a Saúde das Mulheres, Crianças e Adolescentes, e aplicando uma abordagem baseada nos direitos humanos, os esforços de cuidados pós-natais devem expandir-se para além da cobertura e da simples sobrevivência, de modo a incluir cuidados de qualidade.
Estas diretrizes visam melhorar a qualidade dos cuidados pós-natais essenciais e de rotina prestados às mulheres e aos recém-nascidos, com o objetivo final de melhorar a saúde e o bem-estar materno e neonatal.
Uma “experiência pós-natal positiva” é um resultado importante para todas as mulheres que dão à luz e para os seus recém-nascidos, estabelecendo as bases para a melhoria da saúde e do bem-estar a curto e longo prazo. Uma experiência pós-natal positiva é definida como aquela em que as mulheres, pessoas que gestam, os recém-nascidos, os casais, os pais, os cuidadores e as famílias recebem informação consistente, garantia e apoio de profissionais de saúde motivados; e onde um sistema de saúde flexível e com recursos reconheça as necessidades das mulheres e dos bebês e respeite o seu contexto cultural.
Estas diretrizes consolidadas apresentam algumas recomendações novas e já bem fundamentadas sobre cuidados pós-natais de rotina para mulheres e neonatos que recebem cuidados no pós-parto em unidades de saúde ou na comunidade, independentemente dos recursos disponíveis.
É fornecido um conjunto abrangente de recomendações para cuidados durante o período puerperal, com ênfase nos cuidados essenciais que todas as mulheres e recém-nascidos devem receber, e com a devida atenção à qualidade dos cuidados; isto é, a entrega e a experiência do cuidado recebido. Estas diretrizes atualizam e ampliam as recomendações da OMS de 2014 sobre cuidados pós-natais da mãe e do recém-nascido e complementam as atuais diretrizes da OMS sobre a gestão de complicações pós-natais.
O estabelecimento da amamentação e o manejo das principais intercorrências é contemplada.
Recomendamos muito.
Vamos discutir essas recomendações no nosso curso de pós-graduação em Aleitamento no Instituto Ciclos.
Esta publicação só está disponível em inglês até o momento.
Prof. Marcus Renato de Carvalho
www.agostodourado.com
Prix Galien International 2024 Forum ProgramLevi Shapiro
June 20, 2024, Prix Galien International and Jerusalem Ethics Forum in ROME. Detailed agenda including panels:
- ADVANCES IN CARDIOLOGY: A NEW PARADIGM IS COMING
- WOMEN’S HEALTH: FERTILITY PRESERVATION
- WHAT’S NEW IN THE TREATMENT OF INFECTIOUS,
ONCOLOGICAL AND INFLAMMATORY SKIN DISEASES?
- ARTIFICIAL INTELLIGENCE AND ETHICS
- GENE THERAPY
- BEYOND BORDERS: GLOBAL INITIATIVES FOR DEMOCRATIZING LIFE SCIENCE TECHNOLOGIES AND PROMOTING ACCESS TO HEALTHCARE
- ETHICAL CHALLENGES IN LIFE SCIENCES
- Prix Galien International Awards Ceremony
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
New Drug Discovery and Development .....NEHA GUPTA
The "New Drug Discovery and Development" process involves the identification, design, testing, and manufacturing of novel pharmaceutical compounds with the aim of introducing new and improved treatments for various medical conditions. This comprehensive endeavor encompasses various stages, including target identification, preclinical studies, clinical trials, regulatory approval, and post-market surveillance. It involves multidisciplinary collaboration among scientists, researchers, clinicians, regulatory experts, and pharmaceutical companies to bring innovative therapies to market and address unmet medical needs.
Acute scrotum is a general term referring to an emergency condition affecting the contents or the wall of the scrotum.
There are a number of conditions that present acutely, predominantly with pain and/or swelling
A careful and detailed history and examination, and in some cases, investigations allow differentiation between these diagnoses. A prompt diagnosis is essential as the patient may require urgent surgical intervention
Testicular torsion refers to twisting of the spermatic cord, causing ischaemia of the testicle.
Testicular torsion results from inadequate fixation of the testis to the tunica vaginalis producing ischemia from reduced arterial inflow and venous outflow obstruction.
The prevalence of testicular torsion in adult patients hospitalized with acute scrotal pain is approximately 25 to 50 percent
Lung Cancer: Artificial Intelligence, Synergetics, Complex System Analysis, S...Oleg Kshivets
RESULTS: Overall life span (LS) was 2252.1±1742.5 days and cumulative 5-year survival (5YS) reached 73.2%, 10 years – 64.8%, 20 years – 42.5%. 513 LCP lived more than 5 years (LS=3124.6±1525.6 days), 148 LCP – more than 10 years (LS=5054.4±1504.1 days).199 LCP died because of LC (LS=562.7±374.5 days). 5YS of LCP after bi/lobectomies was significantly superior in comparison with LCP after pneumonectomies (78.1% vs.63.7%, P=0.00001 by log-rank test). AT significantly improved 5YS (66.3% vs. 34.8%) (P=0.00000 by log-rank test) only for LCP with N1-2. Cox modeling displayed that 5YS of LCP significantly depended on: phase transition (PT) early-invasive LC in terms of synergetics, PT N0—N12, cell ratio factors (ratio between cancer cells- CC and blood cells subpopulations), G1-3, histology, glucose, AT, blood cell circuit, prothrombin index, heparin tolerance, recalcification time (P=0.000-0.038). Neural networks, genetic algorithm selection and bootstrap simulation revealed relationships between 5YS and PT early-invasive LC (rank=1), PT N0—N12 (rank=2), thrombocytes/CC (3), erythrocytes/CC (4), eosinophils/CC (5), healthy cells/CC (6), lymphocytes/CC (7), segmented neutrophils/CC (8), stick neutrophils/CC (9), monocytes/CC (10); leucocytes/CC (11). Correct prediction of 5YS was 100% by neural networks computing (area under ROC curve=1.0; error=0.0).
CONCLUSIONS: 5YS of LCP after radical procedures significantly depended on: 1) PT early-invasive cancer; 2) PT N0--N12; 3) cell ratio factors; 4) blood cell circuit; 5) biochemical factors; 6) hemostasis system; 7) AT; 8) LC characteristics; 9) LC cell dynamics; 10) surgery type: lobectomy/pneumonectomy; 11) anthropometric data. Optimal diagnosis and treatment strategies for LC are: 1) screening and early detection of LC; 2) availability of experienced thoracic surgeons because of complexity of radical procedures; 3) aggressive en block surgery and adequate lymph node dissection for completeness; 4) precise prediction; 5) adjuvant chemoimmunoradiotherapy for LCP with unfavorable prognosis.
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...i3 Health
i3 Health is pleased to make the speaker slides from this activity available for use as a non-accredited self-study or teaching resource.
This slide deck presented by Dr. Kami Maddocks, Professor-Clinical in the Division of Hematology and
Associate Division Director for Ambulatory Operations
The Ohio State University Comprehensive Cancer Center, will provide insight into new directions in targeted therapeutic approaches for older adults with mantle cell lymphoma.
STATEMENT OF NEED
Mantle cell lymphoma (MCL) is a rare, aggressive B-cell non-Hodgkin lymphoma (NHL) accounting for 5% to 7% of all lymphomas. Its prognosis ranges from indolent disease that does not require treatment for years to very aggressive disease, which is associated with poor survival (Silkenstedt et al, 2021). Typically, MCL is diagnosed at advanced stage and in older patients who cannot tolerate intensive therapy (NCCN, 2022). Although recent advances have slightly increased remission rates, recurrence and relapse remain very common, leading to a median overall survival between 3 and 6 years (LLS, 2021). Though there are several effective options, progress is still needed towards establishing an accepted frontline approach for MCL (Castellino et al, 2022). Treatment selection and management of MCL are complicated by the heterogeneity of prognosis, advanced age and comorbidities of patients, and lack of an established standard approach for treatment, making it vital that clinicians be familiar with the latest research and advances in this area. In this activity chaired by Michael Wang, MD, Professor in the Department of Lymphoma & Myeloma at MD Anderson Cancer Center, expert faculty will discuss prognostic factors informing treatment, the promising results of recent trials in new therapeutic approaches, and the implications of treatment resistance in therapeutic selection for MCL.
Target Audience
Hematology/oncology fellows, attending faculty, and other health care professionals involved in the treatment of patients with mantle cell lymphoma (MCL).
Learning Objectives
1.) Identify clinical and biological prognostic factors that can guide treatment decision making for older adults with MCL
2.) Evaluate emerging data on targeted therapeutic approaches for treatment-naive and relapsed/refractory MCL and their applicability to older adults
3.) Assess mechanisms of resistance to targeted therapies for MCL and their implications for treatment selection
NVBDCP.pptx Nation vector borne disease control programSapna Thakur
NVBDCP was launched in 2003-2004 . Vector-Borne Disease: Disease that results from an infection transmitted to humans and other animals by blood-feeding arthropods, such as mosquitoes, ticks, and fleas. Examples of vector-borne diseases include Dengue fever, West Nile Virus, Lyme disease, and malaria.
2. Functional p53 is required for rapid restoration of
daunorubicin-induced lesions of the spleen
Lars Herfindal1,2,*
Email: lars.herfindal@biomed.uib.no
Lene Myhren1
Email: lene.myhren@biomed.uib.no
Bjørn Tore Gjertsen3
Email: bjorn.gjertsen@med.uib.no
Stein Ove Døskeland1
Email: stein.doskeland@biomed.uib.no
Gro Gausdal1
Email: gro.gausdal@biomed.uib.no
1
Department of Biomedicine, University of Bergen, Jonas Lies vei 91, 5009
Bergen, Norway
2
Translational Signalling Group, Haukeland University Hospital, Jonas Lies vei
91, 5009 Bergen, Norway
3
Institute of Medicine, Hematology Section, University of Bergen, PO Box 7804,
5020 Bergen, Norway
*
Corresponding author. Department of Biomedicine, University of Bergen, Jonas
Lies vei 91, 5009 Bergen, Norway
Abstract
Background
The tumour suppressor and transcription factor p53 is a major determinant of the therapeutic
response to anthracyclines. In healthy tissue, p53 is also considered pivotal for side effects of
anthracycline treatment such as lesions in haematopoietic tissues like the spleen. We used a
Trp53null mouse to explore the significance of p53 in anthracycline (daunorubicin) induced
lesions in the spleen.
Methods
Mice with wild type or deleted tp53 were treated with the daunorubicin (DNR) for three
consecutive days. Spleens were collected at various time points after treatment, and examined
for signs of chemotherapy-related lesions by microscopic analysis of haematoxylin-eosin or
tunel-stained paraffin sections. Expression of death-inducing proteins was analysed by
immunoblotting. Changes between Trp53 wild type and null mice were compared by t-tests.
3. Results
Signs of cell death (pyknotic nuclei and tunel-positive cells) in the white pulp of the spleen
occurred earlier following DNR exposure in wt-mice compared to p53-null mice. While the
spleen of wt-mice recovered to normal morphology, the spleen of the Trp53-null animals still
had lesions with large necrotic areas and disorganised histologic appearance eight days after
treatment. Immunoblotting showed that only Trp53-wt mice had significant increase in p21
after DNR treatment. However, both wt and null mice had elevated p63 levels following
DNR exposure.
Conclusions
p53 protects against severe and enduring cellular damage of the spleen parenchyma after
DNR treatment, and initial DNR-induced apoptosis is not predictive of tissue lesions in the
spleen. Our data indicate that p53 induction following DNR treatment serves to protect rather
than to destroy normal tissue.
Keywords
Spleen, p53, p63, Daunorubicin, Lipofuscin, Apoptosis
Background
Numerous studies have demonstrated that the efficiency of DNA-damaging drugs in cancer
therapy is dependent on the cellular status of the tumour suppressor factor p53 [1-4]. The p53
pathway is often inactivated in human cancers, and deletions and mutations in p53are
associated with progressive and more aggressive disease, and with poor prognosis and
anthracycline resistance in several types of cancer [1,4-6]. In line with these results, there has
been an increased focus on developing new drugs aiming to restore p53 activity in tumours
[7-12]. However, the effect of p53 activation by drugs such as the anthracyclines on healthy
tissue has to be considered in this respect, as induction of cell death and tissue damage in
healthy tissue is an unwanted and severe side-effect of the anthracyclines.
It is known that anthracyclines cause lesions in haematopoietic tissues [13]. We therefore
addressed the role of p53 in the toxic activity of the anthracycline daunorubicin (DNR) in the
spleen, and compared the effect of DNR on the spleen in C57Bl/6 wild type (wt) and C57Bl6
Trp53-null mice. DNR induced more rapid cell death and loss of spleen weight in wild type
(wt) compared to p53-null mice. However, whereas the Trp53-null mice had severe lesions of
the spleen at day 4 after treatment, there was spleen structure recovery in Trp53wt animals.
Our data points to p53 as a protective factor in chemotherapy-induced normal tissue damage.
Methods
Mice
The Trp53-null mouse was generated by Jacks et al. [14], and was provided by Prof. Lozano,
MD Anderson Cancer Center, Houston, TX, USA. Trp53-wt and null mice (C57BL/6) were
4. generated by litter-mate inbreeding. Genotypes of weaned mice were determined by PCR
analysis of DNA from an ear biopsy [14].
The mice used were male, and age matched. DNR (Sanofi-Aventis, Lysaker, Norway,) was
administered intravenously (10 mg/kg) through the tail vein for three consecutive days.
Control animals received relevant vehicle. Health status and weight of the mice were
monitored daily. The mice experiments were approved by the Norwegian Animal Research
Authority and conducted according to the European Convention for the Protection of
Vertebrates Used for Scientific Purposes.
Preparation and analysis of histological specimens
Spleens were excised from euthanized mice and washed in ice-cold PBS. Formalin-fixed
tissues were embedded in paraffin, cut into 2-µm-thick sections and stained with
haematoxylin and eosin (H&E). Terminal deoxynucleotidyl transferase-mediated dUTP-
biotin nick end-labelling (TUNEL staining, In situ Cell Death Detection Kit, POD, Roche)
was used for in situ staining of apoptotic DNA fragmentation. Pyknotic nuclei and cells
containing lipofuscin-like pigments were assessed by microscopy of H&E-stained paraffin
sections. The number of pyknotic nuclei in all the white pulp areas was counted and then
divided by the number of white pulp regions.
The spleens were cut with scissors and cell suspensions were prepared by crushing the tissue
pieces between two glass slides in PBS. Cell suspensions were filtered through a nylon cell
strainer (40 µm), washed in PBS by centrifugation (160 × g, 6 min) and re-suspended at 0.5 ×
106
cells/ml in RPMI-1640 (Sigma-Aldrich Inc, St. Louis, MO) supplemented with 10% FCS
(Gibco, Grant Island, NY). Cell death was assessed by flow cytometry after AlexaFluor 647-
AnnexinV (Molecular Probes, Eugene, OR) and propidium iodide (PI) labelling. At least 30
000 non-gated live cell events were collected for each sample on an AccuriC6 cytometer
(Ann Arbor, MI). Cells positive for AnnexinV alone or together with PI were counted as dead
(apoptotic or necrotic). Untreated cells had less than 15% spontaneous cell death, and this
was subtracted from the data on anthracycline-treated cells.
The data was compared by one-way analysis of variance (ANOVA) using IBM SPSS
Statistics for Mac (version 19.0; IBM Corp.: Armonk, NY, 2010)
Immunoblotting
Protein lysates were prepared from excised spleens, snap-frozen in liquid N2 and stored at
−80°C. Tissue was grinded with a pestle and lysed in RIPA buffer supplemented with
Complete mini protease inhibitor (Roche Diagnostics, Mannheim, Germany). The relative
protein concentration was determined by Bradford and adjusted by Coomassie staining, and
immunoblotting was as described [15]. Primary antibodies were from Santa Cruz
Biotechology (Santa Cruz, CA, USA; p21, p63, Bax), and Imgenex (San Diego, CA, USA;
p73) and secondary alkaline-phosphatase-conjugated antibody (a-3687 and a-3562) were
from Sigma. CDP-Star substrate was from Tropix (Bedford, MA, USA). Chemiluminescence
was detected using a Luminescent Image Analyser Apparatus (LAS 3000, FujiFilm, Tokyo,
Japan) and Image Gauge Software (FujiFilm, Tokyo, Japan).
5. Results and discussion
Since p53 status is often coupled to therapy response to anthracyclines like daunorubicin
(DNR) and idarubicin (IDA) [5], we examined the effect of anthracyclines on splenocytes
and spleen histology. We first studied if p53-status affected the in vitro response to the
anthracyclines daunorubicin (DNR) and idarubicin (IDA) in cells isolated from the spleen,
since p53 deficiency is often coupled to anthracycline resistance [5]. Both DNR and IDA are
used as part of the standard treatment regime in leukaemia. We found that both drugs induced
cell death to a similar degree insplenocytes from both wt and TRp53-null mice (Figure 1A).
Hence, lack of p53 did not significantly seem to render the splenocytes resistant to
anthracycline-induced death in vitro.
Figure 1 DNR treatment reduces spleen weight in wt and p53-null mice. (A) Cells
isolated from the spleen of Trp53-wt and -null mice were treated for 7 h with DNR (10 µM)
or IDA (0.5 µM). Cells were stained with AnnexinV and PI, and analysed by flow cytometry.
Data are given as mean and SEM, n = 3. (B,C) Trp53-wt and -null mice were treated for 3
consecutive days with vehicle or 10 mg/kg DNR, and the spleen mass recorded and related to
total animal weight at the given time points. The plots show relative spleen weight in treated
animal to untreated animals. The arrowheads indicate days of DNR treatment. Diamonds
represent untreated animals, and dots represent DNR-treated animals. The plots to the right
show increase in spleen weight of DNR-treated animals 14 days after treatment. Note the
difference in the scale between the left and right vertical axes. Each symbol represents one
animal.
We next studied the in vivo effect of DNR treatment on the intact spleen in wt and Trp53-null
mice. A typical therapy regime for AML patients consists of multiple 1–3 hour infusions of
DNR during 3–6 days [16]. To study how p53 is involved in the drug-induced damage and
recovery of the spleen, we administered DNR (10 mg/kg) i.v. to the mice every day for three
days. Whereas spleen weight reduction was evident two days after onset of DNR-treatment in
wt-mice (Figure 1B), in the Trp53-null mice reduced spleen weight was not observed until
about five to six days after onset of treatment (Figure 1C). Also, weight reduction was more
prominent in the wt mice compared to Trp53-null animals. A p53-dependent decrease in
spleen mass has similarly been reported by others after ionising radiation [17]. Two weeks
after treatment, there was an increase in spleen weight in both wt- and Trp53-null mice
treated with DNR (Figure 1B,C; right plot).
We suspected that the early reduction in spleen weight could be due to cell death in the
spleen. Accordingly, we found two hallmarks of cell death in spleens from wt-mice: 4 hours
after the last treatment, the white pulps were scattered with i) pyknotic nuclei (Figure 2A, left
panel), which corresponded with an increase of ii) TUNEL-positive nuclei (Figure 2A, right
panels). The presence of both pyknotic and TUNEL-positive nuclei decreased during the next
20 hours (Figure 2A). Spleens from Trp53-null mice had no cells with pyknotic or TUNEL-
positive nuclei in the white pulp 4 or 24 hours after DNR treatment (Figure 2A), suggesting
that this early cell death was p53-dependent. Hence, a late onset of spleen weight reduction in
Trp53-null mice corresponds to lack of early induction of cell death.
Figure 2 DNR-induced apoptosis in the spleen is p53 dependent. Wt and p53-null mice
were treated with vehicle (ctrl) or 10 mg/kg DNR for 3 days. 4 and 24 h after the last DNR
injection, the spleens were removed, fixed and processed for paraffin sectioning for
6. histological examination as described in the Experimental section. (A) Presence of pyknotic
nuclei in the lymph nodules/white pulp in the spleen (bar diagram), or cell death visualised by
TUNEL staining (right panels). The data represent the average number of pyknotic
nuclei/lymph nodule. The data in the diagrams in (A,C,D) are mean ± SEM, n = 3-7 mice.
(B) Haematoxylin- and eosin (H&E) stained paraffin sections of the spleen from Trp53-wt
and -null mice four days after the last DNR injection. RP = red pulp, WT = white pulp,
arrowheads indicate pyknotic nuclei. (C) Presence of lipofuscin-like pigments in the red pulp
of the spleen. The diagram shows the average number of cells with lipofuscin-like pigments
per 400 µm2
of red pulp. H&E-stained sections from red pulp are shown in the panel to the
right. The arrowheads indicate cells with lipofuscin-like pigments. (D) Content of mature or
maturing granulocytes, identified by nuclear morphology in the spleen. The diagram
represents the average number of polymorphonuclear cells per 400 µm2
of red pulp. The right
panels show typical appearance of granulocytes (arrowheads) in the red pulp of wt and p53-
null mice. Asterisks indicate p < 0.05 (*), p < 0.01(**) or p <0.005 (***), one-way ANOVA.
However, when we studied spleens from 3 Trp53-wt and 4 -null mice 4 days after the last
DNR injection, we found pyknotic nuclei and gross pathological lesions in histological
sections in both red and white pulp of the spleen only in theTrp53-null mice (Figure 2B). At
this time, the wt mice had established normal spleen morphology with little or no signs of cell
death (Figure 2B). Thus a late wave of p53-independent cell death seems to appear in the
spleen of the Trp53-null mice. This later wave of cell death coincides with decreased spleen
weight (Figure 1C).
We also found signs of DNR-induced cell death in the red pulp of the wt-mice. An increasing
number of cells containing lipofuscin-like pigments were detected 4 hours after the last DNR
injection (Figure 2C). Elevated levels of lipofuscin-like pigments have been found in the
spleen of mice subjected to ionising radiation [18], and could be due to accumulation of non-
degradable debris in for instance macrophages [19]. The number of cells positive for
lipofuscin-like pigments decreased during the next 20 hours (Figure 2C), as was seen for
pyknosis and TUNEL-positive cells (Figure 2A). Interestingly, Trp53-null mice had high
numbers of cells containing lipofuscin-like pigments both in the red pulp (Figure 2C) and in
the white pulps (not shown), and treatment with DNR did not increase the number of cells
containing lipofuscin-like pigments (Figure 2C). This suggests that natural turnover of cells
in the spleen ofTrp53-null mice leave degradation products such as lipofuscin-like pigments.
Four hours after completed DNR treatment we also detected a 4–5 fold increase in the
number of mature and maturing polymorphonuclear cells in the red pulp both in Trp53-wt
and null mice (Figure 2D). Stem cells and progenitors have been reported to migrate between
bone marrow and spleen after induction of haematopoietic cell stress [20]. This migration
could be a response to bone marrow deprivation after DNR treatment, and indicate that the
spleen red pulp partly replaces haematopoietic functions after extensive DNR treatment.
The late wave of cell death that we observed in the Trp53-null mice (Figure 2B) has similarly
been reported to occur in the intestine of the Trp53-null mice after gamma-irradiation and has
been assigned to induction of mitotic catastrophe due to lack of p53-induced cell cycle arrest
[21]. We therefore analysed spleens from DNR-treated Trp53-wt and -null mice for p21
induction. Immunoblotting showed elevated expression of p21 in spleens from wt-mice at 24
and 48 hours after DNR treatment (Figure 3, left panel) similar to what is seen with other
DNA-damaging agents [22,23]. The Trp53 null mice had only modest increase in p21 levels
(Figure 3, right panel). The early elevation in p21 in the spleen from wt-mice could offer
7. protection against severe tissue damage by induction of transient cell cycle arrest that allows
the cells to repair drug-induced DNA damage and hence protect against mitotic catastrophe.
Figure 3 Expression of p21, p63 and Bax in the spleen after DNR treatment. Protein
extracts from spleens excised from animals before or after treatment with DNR at the
indicated time-points were analysed for levels of p21, p63 or Bax by immunoblotting, as
described in the methods section. Actin was used as loading control.
p63 is, together with p73, shown to be crucial for p53-meidated cell death after DNA damage
[24], and can increase Bax expression and sensitise cells to apoptotic stimuli [25]. We found
that p63 and to some degree Bax was elevated in spleens from wt-mice at 24 and 48 hours
after DNR treatment (Figure 3), the same time points where there was an increase in
apoptotic nuclei and lipofuscin-like pigments (Figure 2A and C). We did not find any change
in the expression of p73 neither in Trp53-wt nor null mice (data not shown). The Trp53-null
mice had a prolonged increase of p63 and Bax, which lasted until 96 hours after termination
of DNR treatment (Figure 3). This coincides with the late wave of p53-independent cell death
that appeared in the spleen of the Trp53-null mice. It thus appears that in addition to lack of
early p21-mediated cell cycle arrest (eventually resulting in mitotic catastrophe), the late
massive cell death seen in the spleen of Trp53-null mice (Figure 2B, right panel), but not in
Trp53 wt-mice (Figure 2B, left panel) could also be mediated by up-regulation of p63 and
Bax in the absence of p53.
Conclusion
This report indicates an anthracycline-induced early p53-dependent cell death in the spleen.
In the Trp53-wt mice, the spleen appeared to recover after DNR treatment with no
histopathological signs of cell death or tissue deterioration present four days after end of
treatment. However, Trp53-null mice suffered from large lesions in the spleen parenchyma
corresponding to a later induction of p53-independent cell death. These findings have clinical
implications for therapy aiming to restore p53-dependent cell death pathways in cancer cells
with non-functional p53. The efficacy of this therapy approach is debated [26], and the
response apparently varies between drugs [27]. We show here that restoration of p53 activity
does not damage the anthracycline-sensitive spleen, but may rather serve to protect this
during intensive chemotherapy.
Competing interests
The authors declare that there are no competing interests.
Authors’ contributions
LH and GG: Designed the study and executed mouse experiments, cell death study and
histopathological analyses. Prepared manuscript draft. LM: Designed and executed WB
analyses, drafted manuscript. SOD and BTG: Study design, data interpretation and drafted
manuscript. All authors read and approved the final manuscript.
8. Acknowledgements
This work was supported by the Norwegian Cancer Society, Lillemor Grobsoks Legat for
Cancer Research and Norwegian Western Regional Health Authorities. The authors wish to
thank Ing. Nina Lied Larsen for TUNEL staining, Ing. Wenche Eilifsen and Line Wergeland
for animal maintenance. Flow cytometry was at Flow Cytometry Core Facility, University of
Bergen, and histological sectioning and staining was performed at the Gade Institute and the
Molecular Imaging Center (Fuge, Norwegian Research Council), University of Bergen.
References
1. Wattel E, Preudhomme C, Hecquet B, Vanrumbeke M, Quesnel B, Dervite I, Morel P,
Fenaux P: p53 mutations are associated with resistance to chemotherapy and short
survival in hematologic malignancies. Blood 1994, 84(9):3148–3157.
2. Peller S: Clinical implications of p53: effect on prognosis, tumor progression and
chemotherapy response. Semin Cancer Biol 1998, 8(5):379–387.
3. McCubrey JA, Abrams SL, Ligresti G, Misaghian N, Wong EW, Steelman LS, Basecke J,
Troppmair J, Libra M, Nicoletti F, et al: Involvement of p53 and Raf/MEK/ERK pathways
in hematopoietic drug resistance. Leukemia 2008, 22(11):2080–2090.
4. Rucker FG, Schlenk RF, Bullinger L, Kayser S, Teleanu V, Kett H, Habdank M, Kugler
CM, Holzmann K, Gaidzik VI, et al: TP53 alterations in acute myeloid leukemia with
complex karyotype correlate with specific copy number alterations, monosomal
karyotype, and dismal outcome. Blood 2012, 119(9):2114–2121.
5. Aas T, Borresen AL, Geisler S, Smith-Sorensen B, Johnsen H, Varhaug JE, Akslen LA,
Lonning PE: Specific P53 mutations are associated with de novo resistance to
doxorubicin in breast cancer patients. Nat Med 1996, 2(7):811–814.
6. Weller M: Predicting response to cancer chemotherapy: the role of p53. Cell Tissue
Res 1998, 292(3):435–445.
7. Kojima K, Konopleva M, Samudio IJ, Shikami M, Cabreira-Hansen M, McQueen T,
Ruvolo V, Tsao T, Zeng Z, Vassilev LT, et al: MDM2 antagonists induce p53-dependent
apoptosis in AML: implications for leukemia therapy. Blood 2005, 106(9):3150–3159.
8. Peterson LF, Mitrikeska E, Giannola D, Lui Y, Sun H, Bixby D, Malek SN, Donato NJ,
Wang S, Talpaz M: p53 stabilization induces apoptosis in chronic myeloid leukemia blast
crisis cells. Leukemia 2011, 25(5):761–769.
9. McCormack E, Haaland I, Venas G, Forthun RB, Huseby S, Gausdal G, Knappskog S,
Micklem DR, Lorens JB, Bruserud O, et al: Synergistic induction of p53 mediated
apoptosis by valproic acid and nutlin-3 in acute myeloid leukemia. Leukemia 2011,
26(5):910–917.
10. Yu X, Vazquez A, Levine AJ, Carpizo DR: Allele-specific p53 mutant reactivation.
Cancer Cell 2012, 21(5):614–625.
9. 11. Morandell S, Yaffe MB: Exploiting synthetic lethal interactions between DNA
damage signaling, checkpoint control, and p53 for targeted cancer therapy. Prog Mol
Biol Transl Sci 2012, 110:289–314.
12. Saha MN, Jiang H, Yang Y, Zhu X, Wang X, Schimmer AD, Qiu L, Chang H: Targeting
p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple
myeloma. PLoS One 2012, 7(1):e30215.
13. Buc-Calderon P, Praet M, Ruysschaert JM, Roberfroid M: Increasing therapeutic effect
and reducing toxicity of doxorubicin by N-acyl dehydroalanines. Eur J Cancer Clin
Oncol 1989, 25(4):679–685.
14. Jacks T, Remington L, Williams BO, Schmitt EM, Halachmi S, Bronson RT, Weinberg
RA: Tumor spectrum analysis in p53-mutant mice. Curr Biol 1994, 4(1):1–7.
15. Gausdal G, Gjertsen BT, Fladmark KE, Demol H, Vandekerckhove J, Doskeland SO:
Caspase-dependent, geldanamycin-enhanced cleavage of co-chaperone p23 in leukemic
apoptosis. Leukemia 2004, 18(12):1989–1996.
16. Mayer RJ, Davis RB, Schiffer CA, Berg DT, Powell BL, Schulman P, Omura GA, Moore
JO, McIntyre OR, Frei E 3rd: Intensive postremission chemotherapy in adults with acute
myeloid leukemia. Cancer and Leukemia Group B. N Engl J Med 1994, 331(14):896–903.
17. Komarova EA, Chernov MV, Franks R, Wang K, Armin G, Zelnick CR, Chin DM, Bacus
SS, Stark GR, Gudkov AV: Transgenic mice with p53-responsive lacZ: p53 activity varies
dramatically during normal development and determines radiation and drug sensitivity
in vivo. EMBO J 1997, 16(6):1391–1400.
18. Wilhelm J, Brzak P, Rejholcova M: Changes of lipofuscin-like pigments in
erythrocytes and spleen after whole-body gamma irradiation of rats. Radiat Res 1989,
120(2):227–233.
19. Crichton DN, Busuttil A, Price WH: Splenic lipofuscinosis in mice. J Pathol 1978,
126(2):113–120.
20. Goris H, Bungart B, Loeffler M, Schmitz S, Nijhof W: Migration of stem cells and
progenitors between marrow and spleen following thiamphenicol treatment of mice. Exp
Hematol 1990, 18(5):400–407.
21. Komarova EA, Kondratov RV, Wang K, Christov K, Golovkina TV, Goldblum JR,
Gudkov AV: Dual effect of p53 on radiation sensitivity in vivo: p53 promotes
hematopoietic injury, but protects from gastro-intestinal syndrome in mice. Oncogene
2004, 23(19):3265–3271.
22. Perez BA, Ghafoori AP, Lee CL, Johnston SM, Li Y, Moroshek JG, Ma Y, Mukherjee S,
Kim Y, Badea CT, et al: Assessing the radiation response of lung cancer with different
gene mutations using genetically engineered mice. Front Oncol 2013, 3:72.
10. 23. Yoshihara Y, Wu D, Kubo N, Sang M, Nakagawara A, Ozaki T: Inhibitory role of E2F-
1 in the regulation of tumor suppressor p53 during DNA damage response. Biochem
Biophys Res Commun 2012, 421(1):57–63.
24. Flores ER, Tsai KY, Crowley D, Sengupta S, Yang A, McKeon F, Jacks T: p63 and p73
are required for p53-dependent apoptosis in response to DNA damage. Nature 2002,
416(6880):560–564.
25. Gressner O, Schilling T, Lorenz K, Schulze Schleithoff E, Koch A, Schulze-Bergkamen
H, Lena AM, Candi E, Terrinoni A, Catani MV, et al: TAp63alpha induces apoptosis by
activating signaling via death receptors and mitochondria. EMBO J 2005, 24(13):2458–
2471.
26. Jackson JG, Pant V, Li Q, Chang LL, Quintas-Cardama A, Garza D, Tavana O, Yang P,
Manshouri T, Li Y, et al: p53-mediated senescence impairs the apoptotic response to
chemotherapy and clinical outcome in breast cancer. Cancer Cell 2012, 21(6):793–806.
27. Bunz F, Hwang PM, Torrance C, Waldman T, Zhang Y, Dillehay L, Williams J,
Lengauer C, Kinzler KW, Vogelstein B: Disruption of p53 in human cancer cells alters the
responses to therapeutic agents. J Clin Invest 1999, 104(3):263–269.