This study used gene expression profiling to identify novel cell surface marker genes that are specifically upregulated in glioblastoma stem-like cells (GSCs). They found 19 such genes upregulated in GSCs compared to normal brain tissue, neural stem cells, and glioblastoma tumor samples. Validation by qRT-PCR in additional GSC lines confirmed differential upregulation. Immunoblotting showed that the expression of cadherin-19 (CDH19) protein was restricted to minimally infiltrative GSCs, but not detected in other GSC lines, glioblastoma cell lines, or normal neural cells. This suggests CDH19 could serve as a feasible marker for identifying, isolating and developing drugs targeting GSCs.
This document describes research investigating the potential of human endometrial stem cells (EnSCs) to differentiate into neural cells. EnSCs were isolated from endometrial biopsies and characterized by flow cytometry, showing expression of stem cell markers and lack of hematopoietic/endothelial markers. The EnSCs were induced to differentiate into neural cells using growth factors like bFGF, PDGF, and EGF. After induction, the cells expressed neural markers like MAP2, β3-tubulin, and NF-L at the mRNA and protein levels based on RT-PCR and immunocytochemistry. The results demonstrate that EnSCs can respond to signaling molecules and differentiate into neuronal-like cells, suggesting their potential
Circular RNAs (circRNAs) are a class of non-coding RNAs that can regulate gene expression by interacting with microRNAs (miRNAs). This document reviews the roles of circRNAs in human disorders through circRNA-miRNA interactions. It discusses how specific circRNAs like CDR1as have been found to be dysregulated in neurological disorders, cancers, and cardiovascular diseases and can contribute to disease by sponging up certain miRNAs. The prospect of using circRNAs as biomarkers for disease diagnosis and prognosis is also mentioned.
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
Next generation sequencing (NGS) has revolutionized cancer treatment by enabling high throughput DNA sequencing. This document discusses several applications of NGS in cancer treatment including whole exome sequencing of tumors from 25 patients to identify genetic mutations, using avatar mouse models to test proposed treatment strategies, detecting mutations in liquid biopsies, and identifying somatic mutations in leukemia patients. Challenges of NGS include analyzing large amounts of data, accurately interpreting variants, and addressing ethical issues.
Objective: To probe into the influence of miR-21 on the proliferation as well as apoptosis of oral squamous cell carcinoma (OSCC) and its causative role.
Study Design: We adopted microarray for detecting the differentially expressed genes in OSCC tumor tis-sues and paracancerous tissues. We assessed the link of miR-21 expression with tumor size, lymph node metastasis, and tumor differentiation. We employed CCK-8 and EdU assay for detecting the impact of miR-21 inhibitor and miR-21 mimic on Cal-27 cell proliferation, as well as TUNEL and AnnexinV-FITC/PI double staining for detecting miR-21 expression on cell apoptosis. We forecasted the possible target of miR-21 via TargetScan, as well as detected the interaction of miR-21 with PTEN via luciferase reporter experiment. The function of miR-21 expression in PTEN signaling pathway was monitored via western blot. We constructed PTEN overexpression plasmid and conducted rescue experiment to evaluate overexpressed PTEN on miR-21–induced proliferation.
Results: Microarray and RT-qPCR indicated that miR-21 expression increased demonstrably in OSCC. Subsequently, statistical analysis showed that miR-21 expression was plainly correlated with tumor size, lymph node metastasis, tumor differentiation, and smoking history. CCK-8 and EdU method exhibited that miR-21 mimics manifestly promoted Cal-27 cell proliferation, while miR-21 inhibitor blatantly inhibited Cal-27 cell proliferation. TUNEL and V-FITC/PI double staining assay showed that miR-21 inhibitor conspicuously promoted Cal-27 cell apoptosis. CCK-8 and EdU assay exhibited that overexpressed PTEN abolished the pro-proliferation influence of miR-21 mimic. TUNEL and V-FITC/PI experiments pointed out that knocking down PTEN abrogated the pro-apoptosis impact of miR-21 inhibitor.
Conclusion: miR-21 contributes to OSCC cell proliferation via targeting PTEN and inhibits its apoptosis.
Keywords: Akt/PKB signaling pathway; apoptosis; biomarkers, tumor; carcinoma, squamous cell; cell line, tumor; cell proliferation; microRNAs; miR-21; miRNA-21; mouth neoplasms; oral cancer; oral squamous cell carcinoma; proliferation; real time PCR
This document summarizes a study that identified genes in the extracellular matrix that regulate the susceptibility of cultured cells to prion infection. The study compared gene expression in prion-susceptible and resistant cell lines. They identified 9 genes, including fibronectin 1 and integrin α8, that were upregulated in resistant cells. Knockdown of these genes increased susceptibility by altering the extracellular matrix structure and deposition of prion proteins. The results suggest the extracellular matrix plays a key role in controlling prion infection by influencing how prion proteins interact and convert forms.
This study used CRISPR Cas9 to knockout the KDM6A gene in human pancreatic cancer cell lines to investigate the clinical and biological impacts of KDM6A deficiency. The knockout of KDM6A led to increased cell proliferation, migration, and invasion compared to wild type cells. It also decreased the enrichment of H3K27ac at tumor suppressor genes. Therefore, KDM6A acts as a tumor suppressor in pancreatic cancer by activating tumor suppressor genes through H3K27 demethylation and acetylation. Targeting KDM6A deficiency with HDAC inhibitors may be a potential therapeutic strategy for this cancer subtype.
This study investigated the effects of Ginsenoside Rh2 on the STAT3 signaling pathway in human gastric cancer NCI-N87 cells. The results showed that Ginsenoside Rh2 treatment decreased phosphorylation of STAT3 and Jak2 proteins in NCI-N87 cells and inhibited IL-induced phosphorylation of these proteins. Ginsenoside Rh2 selectively inhibited phosphorylation of Tyr705 in the STAT3 molecule by downregulating phosphorylation of Jak2 protein specifically. Transfection of a CA-STAT3 plasmid reversed the G0/G1 phase arrest and apoptosis caused by Ginsenoside Rh2, indicating it acts by inhibiting the STAT3 pathway.
Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...Gul Muneer
We performed the first proteogenomic study on a prospectively collected colon cancer cohort. Comparative proteomic and phosphoproteomic analysis of paired tumor and normal adjacent tissues produced a catalog of colon cancer-associated proteins and phosphosites, including known and putative new biomarkers, drug targets, and cancer/testis antigens. Proteogenomic integration not only prioritized genomically inferred targets, such as copy-number drivers and mutation-derived neoantigens, but also yielded novel findings. Phosphoproteomics data associated Rb phosphorylation with increased proliferation and decreased apoptosis in colon cancer, which explains why this classical tumor suppressor is amplified in colon tumors and suggests a rationale for targeting Rb phosphorylation in colon cancer. Proteomics identified an association between decreased CD8 T cell infiltration and increased glycolysis in microsatellite instability-high (MSI-H) tumors, suggesting glycolysis as a potential target to overcome the resistance of MSI-H tumors to immune checkpoint blockade. Proteogenomics presents new avenues for biological discoveries and therapeutic development.
This document describes research investigating the potential of human endometrial stem cells (EnSCs) to differentiate into neural cells. EnSCs were isolated from endometrial biopsies and characterized by flow cytometry, showing expression of stem cell markers and lack of hematopoietic/endothelial markers. The EnSCs were induced to differentiate into neural cells using growth factors like bFGF, PDGF, and EGF. After induction, the cells expressed neural markers like MAP2, β3-tubulin, and NF-L at the mRNA and protein levels based on RT-PCR and immunocytochemistry. The results demonstrate that EnSCs can respond to signaling molecules and differentiate into neuronal-like cells, suggesting their potential
Circular RNAs (circRNAs) are a class of non-coding RNAs that can regulate gene expression by interacting with microRNAs (miRNAs). This document reviews the roles of circRNAs in human disorders through circRNA-miRNA interactions. It discusses how specific circRNAs like CDR1as have been found to be dysregulated in neurological disorders, cancers, and cardiovascular diseases and can contribute to disease by sponging up certain miRNAs. The prospect of using circRNAs as biomarkers for disease diagnosis and prognosis is also mentioned.
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
Next generation sequencing (NGS) has revolutionized cancer treatment by enabling high throughput DNA sequencing. This document discusses several applications of NGS in cancer treatment including whole exome sequencing of tumors from 25 patients to identify genetic mutations, using avatar mouse models to test proposed treatment strategies, detecting mutations in liquid biopsies, and identifying somatic mutations in leukemia patients. Challenges of NGS include analyzing large amounts of data, accurately interpreting variants, and addressing ethical issues.
Objective: To probe into the influence of miR-21 on the proliferation as well as apoptosis of oral squamous cell carcinoma (OSCC) and its causative role.
Study Design: We adopted microarray for detecting the differentially expressed genes in OSCC tumor tis-sues and paracancerous tissues. We assessed the link of miR-21 expression with tumor size, lymph node metastasis, and tumor differentiation. We employed CCK-8 and EdU assay for detecting the impact of miR-21 inhibitor and miR-21 mimic on Cal-27 cell proliferation, as well as TUNEL and AnnexinV-FITC/PI double staining for detecting miR-21 expression on cell apoptosis. We forecasted the possible target of miR-21 via TargetScan, as well as detected the interaction of miR-21 with PTEN via luciferase reporter experiment. The function of miR-21 expression in PTEN signaling pathway was monitored via western blot. We constructed PTEN overexpression plasmid and conducted rescue experiment to evaluate overexpressed PTEN on miR-21–induced proliferation.
Results: Microarray and RT-qPCR indicated that miR-21 expression increased demonstrably in OSCC. Subsequently, statistical analysis showed that miR-21 expression was plainly correlated with tumor size, lymph node metastasis, tumor differentiation, and smoking history. CCK-8 and EdU method exhibited that miR-21 mimics manifestly promoted Cal-27 cell proliferation, while miR-21 inhibitor blatantly inhibited Cal-27 cell proliferation. TUNEL and V-FITC/PI double staining assay showed that miR-21 inhibitor conspicuously promoted Cal-27 cell apoptosis. CCK-8 and EdU assay exhibited that overexpressed PTEN abolished the pro-proliferation influence of miR-21 mimic. TUNEL and V-FITC/PI experiments pointed out that knocking down PTEN abrogated the pro-apoptosis impact of miR-21 inhibitor.
Conclusion: miR-21 contributes to OSCC cell proliferation via targeting PTEN and inhibits its apoptosis.
Keywords: Akt/PKB signaling pathway; apoptosis; biomarkers, tumor; carcinoma, squamous cell; cell line, tumor; cell proliferation; microRNAs; miR-21; miRNA-21; mouth neoplasms; oral cancer; oral squamous cell carcinoma; proliferation; real time PCR
This document summarizes a study that identified genes in the extracellular matrix that regulate the susceptibility of cultured cells to prion infection. The study compared gene expression in prion-susceptible and resistant cell lines. They identified 9 genes, including fibronectin 1 and integrin α8, that were upregulated in resistant cells. Knockdown of these genes increased susceptibility by altering the extracellular matrix structure and deposition of prion proteins. The results suggest the extracellular matrix plays a key role in controlling prion infection by influencing how prion proteins interact and convert forms.
This study used CRISPR Cas9 to knockout the KDM6A gene in human pancreatic cancer cell lines to investigate the clinical and biological impacts of KDM6A deficiency. The knockout of KDM6A led to increased cell proliferation, migration, and invasion compared to wild type cells. It also decreased the enrichment of H3K27ac at tumor suppressor genes. Therefore, KDM6A acts as a tumor suppressor in pancreatic cancer by activating tumor suppressor genes through H3K27 demethylation and acetylation. Targeting KDM6A deficiency with HDAC inhibitors may be a potential therapeutic strategy for this cancer subtype.
This study investigated the effects of Ginsenoside Rh2 on the STAT3 signaling pathway in human gastric cancer NCI-N87 cells. The results showed that Ginsenoside Rh2 treatment decreased phosphorylation of STAT3 and Jak2 proteins in NCI-N87 cells and inhibited IL-induced phosphorylation of these proteins. Ginsenoside Rh2 selectively inhibited phosphorylation of Tyr705 in the STAT3 molecule by downregulating phosphorylation of Jak2 protein specifically. Transfection of a CA-STAT3 plasmid reversed the G0/G1 phase arrest and apoptosis caused by Ginsenoside Rh2, indicating it acts by inhibiting the STAT3 pathway.
Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...Gul Muneer
We performed the first proteogenomic study on a prospectively collected colon cancer cohort. Comparative proteomic and phosphoproteomic analysis of paired tumor and normal adjacent tissues produced a catalog of colon cancer-associated proteins and phosphosites, including known and putative new biomarkers, drug targets, and cancer/testis antigens. Proteogenomic integration not only prioritized genomically inferred targets, such as copy-number drivers and mutation-derived neoantigens, but also yielded novel findings. Phosphoproteomics data associated Rb phosphorylation with increased proliferation and decreased apoptosis in colon cancer, which explains why this classical tumor suppressor is amplified in colon tumors and suggests a rationale for targeting Rb phosphorylation in colon cancer. Proteomics identified an association between decreased CD8 T cell infiltration and increased glycolysis in microsatellite instability-high (MSI-H) tumors, suggesting glycolysis as a potential target to overcome the resistance of MSI-H tumors to immune checkpoint blockade. Proteogenomics presents new avenues for biological discoveries and therapeutic development.
Visualizing Human Stem Cell Dynamics by Multicolor, Multiday High-Content Mic...InsideScientific
Visualizing the complex spatiotemporal dynamics of human stem cells as they proliferate and make cell fate decisions is key to improve our understanding of how to robustly engineer differentiated tissues for therapeutic applications.
In this webinar, Dr. Rafael Carazo Salas describes multicolor, multiday high-content microscopy pipelines that his group has recently developed to visualize the dynamical cell fate changes of human Pluripotent Stem Cells (hPSCs). In particular, he reviews the integrated experimental and computational approaches that his group has established, including novel “live” reporters of cell fate and multi-reporter hPSC lines generated by CRISPR/Cas9 allowing multiplexed monitoring of cell proliferation and fate dynamics, and exemplify the biological discoveries they are enabling.
Key Topics Include:
- Visualizing how human Pluripotent Stem Cells (hPSCs) proliferate and undergo early differentiation in vitro, by high content microscopy
- Learning about experimental and computational pipelines that enable cell fate monitoring at the collective and single-cell level
- Learning about novel “live” reporters of hPSC cell fate
This study assessed the effects of compound A (CpdA) on bladder cancer cell growth. CpdA functions as both a glucocorticoid receptor (GR) modulator and androgen receptor (AR) antagonist. In GR/AR-positive bladder cancer cells, CpdA strongly inhibited cell proliferation, colony formation, migration and invasion. CpdA decreased the viability of control cells more than GR or AR silencing cells. In mouse xenograft models, CpdA more strongly suppressed tumor growth than dexamethasone or hydroxyflutamide. CpdA likely inhibits bladder cancer growth predominantly by inducing GR transrepression and partially through the AR pathway.
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...Gul Muneer
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neutrophils. Lung tumors disrupt bone homeostasis and increase osteoblast activity and bone formation. Osteoblasts amplify tumor-associated SiglecFhigh neutrophils that promote tumor growth through angiogenesis, immunosuppression and other mechanisms. Serum from tumor-bearing mice increases osteoblast activity through elevated sRAGE, which stimulates neutrophil maturation. SiglecFhigh neutrophils correlate with poor survival in lung cancer patients. Therefore, lung tumors communicate with bone through factors like sRAGE to modulate osteoblasts and promote neutrophil-driven tumor progression.
This document summarizes research on the role of NFAT5 deficiency in immunodeficiency and autoimmune enterocolopathy. The researchers identified a deletion of the NFAT5 gene in a patient with unexplained infections and chronic intestinal inflammation. Further analysis showed NFAT5 deficiency resulted in reduced natural killer cells and impaired T cell function and cytokine production. Studies in human cells and mouse models confirmed the link between immune cell dysfunction and NFAT5 deficiency. The research demonstrates how genetic analysis can help clinical diagnosis and provide novel insights into disease mechanisms.
This study examined the role of the long non-coding RNA MEG3 in retinal ganglion cell apoptosis in a mouse model of acute glaucoma and in an in vitro model of oxygen-glucose deprivation and reoxygenation. The study found that MEG3 expression was increased in retinal tissues from the mouse glaucoma model and in retinal ganglion cells treated with oxygen-glucose deprivation. Knockdown of MEG3 using siRNA reduced retinal ganglion cell apoptosis following oxygen-glucose deprivation. Further experiments revealed that MEG3 directly interacts with the microRNA miR-106b, which targets the pro-apoptotic gene caspase-8. Thus, MEG3 increases retinal ganglion cell
This study analyzed the diagnostic and prognostic value of CASC5 in lung adenocarcinoma. Bioinformatics analyses showed that CASC5 mRNA levels were increased in lung adenocarcinoma and correlated with poor survival. Immunohistochemistry also demonstrated increased CASC5 protein levels in lung adenocarcinoma compared to normal tissues. High CASC5 expression correlated with advanced T classification and poor prognosis, and was an independent prognostic indicator for lung adenocarcinoma patients.
This document summarizes a study that investigated the role of the long non-coding RNA SNHG7 in ovarian cancer. The study found that SNHG7 was significantly upregulated in ovarian cancer tissues and cell lines compared to normal tissues. Higher SNHG7 expression was associated with advanced clinical stage and lymph node metastasis. Knockdown of SNHG7 inhibited cell proliferation, invasion, and the epithelial-to-mesenchymal transition process. These results suggest that SNHG7 promotes ovarian cancer progression and may be a potential therapeutic target.
Invicta eshre-poster-pregnancy rate after frozen blastocystINVICTA GENETICS
Assessment of pregnancy rate after comprehensive chromosome screening using next-generation sequencing-based preimplantation genetic diagnosis (NGS PGD) of trophectoderm in frozen blastocyst transfer.
Nanodroplet processing platform for deep and quantitative proteome profiling ...Gul Muneer
Nanoscale or single-cell technologies are critical for biomedical applications. However, current mass spectrometry (MS)-based proteomic approaches require samples comprising a minimum of thousands of cells to provide in-depth profiling. Here, we report the development of a nanoPOTS (nanodroplet processing in one pot for trace samples) platform for small cell population proteomics analysis. NanoPOTS enhances the efficiency and recovery of sample processing by downscaling processing volumes to <200 nL to minimize surface losses. When combined with ultrasensitive liquid chromatography-MS, nanoPOTS allows identification of ~1500 to ~3000 proteins from ~10 to ~140 cells, respectively. By incorporating the Match Between Runs algorithm of MaxQuant, >3000 proteins are consistently identified from as few as 10 cells. Furthermore, we demonstrate quantification of ~2400 proteins from single human pancreatic islet thin sections from type 1 diabetic and control donors, illustrating the application of nanoPOTS for spatially resolved proteome measurements from clinical tissues.
This study examined the effects of prolonged simvastatin (SIM) treatment on ischemia-reperfusion (I/R) induced acute kidney injury in rats. Rats were divided into four groups: sham, ischemia, I/R, and I/R+SIM treated. The I/R group showed intense inflammation, necrosis, and apoptosis in kidney tissue. The I/R+SIM group showed reduced inflammation and tissue damage. Biochemical analysis found increased oxidative stress and inflammation markers in the ischemia and I/R groups compared to control, but levels in the I/R+SIM group were similar to control. Histological analysis also showed more damage in ischemia and I/R groups versus control, while the I/R+
Open Source Pharma /Genomics and clinical practice / Prof Hosur opensourcepharmafound
Genomics is increasingly being used in clinical practice to inform diagnosis and treatment. The document discusses several examples where genomics has identified disease-causing genes and mutations, leading to new treatments. It also describes methods for genome sequencing and variant calling. The author's studies on epilepsy found variants in genes related to brain function in drug-resistant epilepsy patients. A large number of variants were in the 3' UTR, suggesting expression level variations in these genes may cause epilepsy.
Paludisme grave : pourquoi doit-on développer des modèles in vitro sur le terrain ? - Conférence de la 8e édition du Cours international « Atelier Paludisme » - RAZAKANDRAINIBE Romy - Madagascar - romy@pasteur.mg
A putative mesenchymal stem cells population isolated from adult human testes◂ Justin (M) Gaines ▸
This document describes the isolation and characterization of a novel stem cell population from adult human testes termed gonadal stem cells (GSCs). Key findings:
1. GSCs were isolated from adult human testes biopsies and expressed markers characteristic of mesenchymal stem cells (MSCs) including CD105, CD166, CD73, CD90, while lacking hematopoietic markers.
2. GSCs also expressed pluripotent markers Oct4, Nanog, and SSEA-4 and were able to differentiate into adipogenic, osteogenic, and chondrogenic cell types.
3. GSCs exhibited growth and expansion properties similar to MSCs, being able to propagate
1. Researchers administered an AAV9 gene therapy vector expressing CLN3 to a mouse model of CLN3 disease via tail vein or retro-orbital injections.
2. Viral genome copy numbers were measured in various tissues 7 days later, ranging from 2.80x10^3 to 1.56x10^7 copies per microgram of DNA.
3. No significant differences were found between the injection methods, supporting the use of tail vein injections for future efficacy and toxicology studies in mice to enable human clinical trials for this fatal pediatric disease.
Sarcar B et al.,-Mol Cancer Ther-2011-Sarcar-Bhaswati Sarcar
This study examined the ability of the Wee-1 inhibitor MK-1775 to enhance the radiosensitivity of glioblastoma cell lines and modulate the radiation-induced G2 checkpoint. The results showed that MK-1775 abrogated the radiation-induced G2 checkpoint and increased radiosensitivity in established glioblastoma cell lines in vitro and in vivo, without affecting the radiation response of normal human astrocytes. MK-1775 appeared to attenuate the early-phase G2 checkpoint arrest in glioblastoma neural stem cell lines, but the arrest was not sustained and radiosensitivity was not increased. Further investigation is needed to understand the role of Wee-1 in the checkpoint response of glioblastoma neural stem cells
This study performed a genome-wide analysis of DNA methylation in colorectal carcinoma (CRC) tissue samples from 24 Bangladeshi patients. The researchers found a total of 627 differentially methylated loci covering 513 genes when comparing CRC tissue to normal adjacent tissue, with 535 loci covering 465 genes being newly identified. Gene set enrichment analysis showed hypermethylation in CRC of gene sets related to inhibition of adenylate cyclase activity, Rac guanyl-nucleotide exchange factor activity, regulation of retinoic acid receptor signaling, and estrogen receptor activity. Predictive models based on differentially methylated loci showed potential for CRC diagnosis with around 89% sensitivity and specificity.
This year's 3rd Annual TCGC: The Clinical Genome Conference, held June 10-12, 2014 in San Francisco, is a three-day event that weaves together the science of sequencing and the business of implementing genomics in the clinic. It uniquely illustrates the mutual influence of those areas and the need to therefore consider the needs, challenges and opportunities of both - from next-generation sequencing and variant interpretation to insurance reimbursement and electronic health records - throughout the entire research process.Learn more at http://www.clinicalgenomeconference.com
This document summarizes an experiment aiming to knockout the CTNNB1 gene in mouse embryonic stem cells using CRISPR-Cas9 genome editing. It describes designing a guide RNA targeting exon 10 of CTNNB1, cloning it into a vector, transforming E. coli, and testing primers for detecting knockout via PCR and qPCR. Prior studies showed CTNNB1 knockout embryos had defects in ectoderm and mesoderm development. The authors hypothesized knocking out CTNNB1 in stem cells would produce inviable embryos, similar to prior findings.
This document reviews microRNAs (miRNAs) related to the occurrence, diagnosis, and prognosis of non-small cell lung cancer (NSCLC). It discusses how some miRNAs act as oncogenes in NSCLC by promoting proliferation, migration, and invasion through targeting tumor suppressor genes. Other miRNAs act as tumor suppressors by inhibiting oncogenes. The expression levels of certain miRNAs have diagnostic and prognostic value for NSCLC. Some miRNAs show potential as biomarkers for early detection of NSCLC or for distinguishing NSCLC subtypes. Circulating miRNAs may also serve as biomarkers for cancer detection and prognosis. Single nucleotide polymorphisms in miRNA genes have been associated with survival in NSCLC patients.
La adivinanza describe una criatura con un cuello largo y manchas en la piel, sugiriendo que si se da más información se podrá adivinar de qué animal se trata.
Visualizing Human Stem Cell Dynamics by Multicolor, Multiday High-Content Mic...InsideScientific
Visualizing the complex spatiotemporal dynamics of human stem cells as they proliferate and make cell fate decisions is key to improve our understanding of how to robustly engineer differentiated tissues for therapeutic applications.
In this webinar, Dr. Rafael Carazo Salas describes multicolor, multiday high-content microscopy pipelines that his group has recently developed to visualize the dynamical cell fate changes of human Pluripotent Stem Cells (hPSCs). In particular, he reviews the integrated experimental and computational approaches that his group has established, including novel “live” reporters of cell fate and multi-reporter hPSC lines generated by CRISPR/Cas9 allowing multiplexed monitoring of cell proliferation and fate dynamics, and exemplify the biological discoveries they are enabling.
Key Topics Include:
- Visualizing how human Pluripotent Stem Cells (hPSCs) proliferate and undergo early differentiation in vitro, by high content microscopy
- Learning about experimental and computational pipelines that enable cell fate monitoring at the collective and single-cell level
- Learning about novel “live” reporters of hPSC cell fate
This study assessed the effects of compound A (CpdA) on bladder cancer cell growth. CpdA functions as both a glucocorticoid receptor (GR) modulator and androgen receptor (AR) antagonist. In GR/AR-positive bladder cancer cells, CpdA strongly inhibited cell proliferation, colony formation, migration and invasion. CpdA decreased the viability of control cells more than GR or AR silencing cells. In mouse xenograft models, CpdA more strongly suppressed tumor growth than dexamethasone or hydroxyflutamide. CpdA likely inhibits bladder cancer growth predominantly by inducing GR transrepression and partially through the AR pathway.
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...Gul Muneer
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neutrophils. Lung tumors disrupt bone homeostasis and increase osteoblast activity and bone formation. Osteoblasts amplify tumor-associated SiglecFhigh neutrophils that promote tumor growth through angiogenesis, immunosuppression and other mechanisms. Serum from tumor-bearing mice increases osteoblast activity through elevated sRAGE, which stimulates neutrophil maturation. SiglecFhigh neutrophils correlate with poor survival in lung cancer patients. Therefore, lung tumors communicate with bone through factors like sRAGE to modulate osteoblasts and promote neutrophil-driven tumor progression.
This document summarizes research on the role of NFAT5 deficiency in immunodeficiency and autoimmune enterocolopathy. The researchers identified a deletion of the NFAT5 gene in a patient with unexplained infections and chronic intestinal inflammation. Further analysis showed NFAT5 deficiency resulted in reduced natural killer cells and impaired T cell function and cytokine production. Studies in human cells and mouse models confirmed the link between immune cell dysfunction and NFAT5 deficiency. The research demonstrates how genetic analysis can help clinical diagnosis and provide novel insights into disease mechanisms.
This study examined the role of the long non-coding RNA MEG3 in retinal ganglion cell apoptosis in a mouse model of acute glaucoma and in an in vitro model of oxygen-glucose deprivation and reoxygenation. The study found that MEG3 expression was increased in retinal tissues from the mouse glaucoma model and in retinal ganglion cells treated with oxygen-glucose deprivation. Knockdown of MEG3 using siRNA reduced retinal ganglion cell apoptosis following oxygen-glucose deprivation. Further experiments revealed that MEG3 directly interacts with the microRNA miR-106b, which targets the pro-apoptotic gene caspase-8. Thus, MEG3 increases retinal ganglion cell
This study analyzed the diagnostic and prognostic value of CASC5 in lung adenocarcinoma. Bioinformatics analyses showed that CASC5 mRNA levels were increased in lung adenocarcinoma and correlated with poor survival. Immunohistochemistry also demonstrated increased CASC5 protein levels in lung adenocarcinoma compared to normal tissues. High CASC5 expression correlated with advanced T classification and poor prognosis, and was an independent prognostic indicator for lung adenocarcinoma patients.
This document summarizes a study that investigated the role of the long non-coding RNA SNHG7 in ovarian cancer. The study found that SNHG7 was significantly upregulated in ovarian cancer tissues and cell lines compared to normal tissues. Higher SNHG7 expression was associated with advanced clinical stage and lymph node metastasis. Knockdown of SNHG7 inhibited cell proliferation, invasion, and the epithelial-to-mesenchymal transition process. These results suggest that SNHG7 promotes ovarian cancer progression and may be a potential therapeutic target.
Invicta eshre-poster-pregnancy rate after frozen blastocystINVICTA GENETICS
Assessment of pregnancy rate after comprehensive chromosome screening using next-generation sequencing-based preimplantation genetic diagnosis (NGS PGD) of trophectoderm in frozen blastocyst transfer.
Nanodroplet processing platform for deep and quantitative proteome profiling ...Gul Muneer
Nanoscale or single-cell technologies are critical for biomedical applications. However, current mass spectrometry (MS)-based proteomic approaches require samples comprising a minimum of thousands of cells to provide in-depth profiling. Here, we report the development of a nanoPOTS (nanodroplet processing in one pot for trace samples) platform for small cell population proteomics analysis. NanoPOTS enhances the efficiency and recovery of sample processing by downscaling processing volumes to <200 nL to minimize surface losses. When combined with ultrasensitive liquid chromatography-MS, nanoPOTS allows identification of ~1500 to ~3000 proteins from ~10 to ~140 cells, respectively. By incorporating the Match Between Runs algorithm of MaxQuant, >3000 proteins are consistently identified from as few as 10 cells. Furthermore, we demonstrate quantification of ~2400 proteins from single human pancreatic islet thin sections from type 1 diabetic and control donors, illustrating the application of nanoPOTS for spatially resolved proteome measurements from clinical tissues.
This study examined the effects of prolonged simvastatin (SIM) treatment on ischemia-reperfusion (I/R) induced acute kidney injury in rats. Rats were divided into four groups: sham, ischemia, I/R, and I/R+SIM treated. The I/R group showed intense inflammation, necrosis, and apoptosis in kidney tissue. The I/R+SIM group showed reduced inflammation and tissue damage. Biochemical analysis found increased oxidative stress and inflammation markers in the ischemia and I/R groups compared to control, but levels in the I/R+SIM group were similar to control. Histological analysis also showed more damage in ischemia and I/R groups versus control, while the I/R+
Open Source Pharma /Genomics and clinical practice / Prof Hosur opensourcepharmafound
Genomics is increasingly being used in clinical practice to inform diagnosis and treatment. The document discusses several examples where genomics has identified disease-causing genes and mutations, leading to new treatments. It also describes methods for genome sequencing and variant calling. The author's studies on epilepsy found variants in genes related to brain function in drug-resistant epilepsy patients. A large number of variants were in the 3' UTR, suggesting expression level variations in these genes may cause epilepsy.
Paludisme grave : pourquoi doit-on développer des modèles in vitro sur le terrain ? - Conférence de la 8e édition du Cours international « Atelier Paludisme » - RAZAKANDRAINIBE Romy - Madagascar - romy@pasteur.mg
A putative mesenchymal stem cells population isolated from adult human testes◂ Justin (M) Gaines ▸
This document describes the isolation and characterization of a novel stem cell population from adult human testes termed gonadal stem cells (GSCs). Key findings:
1. GSCs were isolated from adult human testes biopsies and expressed markers characteristic of mesenchymal stem cells (MSCs) including CD105, CD166, CD73, CD90, while lacking hematopoietic markers.
2. GSCs also expressed pluripotent markers Oct4, Nanog, and SSEA-4 and were able to differentiate into adipogenic, osteogenic, and chondrogenic cell types.
3. GSCs exhibited growth and expansion properties similar to MSCs, being able to propagate
1. Researchers administered an AAV9 gene therapy vector expressing CLN3 to a mouse model of CLN3 disease via tail vein or retro-orbital injections.
2. Viral genome copy numbers were measured in various tissues 7 days later, ranging from 2.80x10^3 to 1.56x10^7 copies per microgram of DNA.
3. No significant differences were found between the injection methods, supporting the use of tail vein injections for future efficacy and toxicology studies in mice to enable human clinical trials for this fatal pediatric disease.
Sarcar B et al.,-Mol Cancer Ther-2011-Sarcar-Bhaswati Sarcar
This study examined the ability of the Wee-1 inhibitor MK-1775 to enhance the radiosensitivity of glioblastoma cell lines and modulate the radiation-induced G2 checkpoint. The results showed that MK-1775 abrogated the radiation-induced G2 checkpoint and increased radiosensitivity in established glioblastoma cell lines in vitro and in vivo, without affecting the radiation response of normal human astrocytes. MK-1775 appeared to attenuate the early-phase G2 checkpoint arrest in glioblastoma neural stem cell lines, but the arrest was not sustained and radiosensitivity was not increased. Further investigation is needed to understand the role of Wee-1 in the checkpoint response of glioblastoma neural stem cells
This study performed a genome-wide analysis of DNA methylation in colorectal carcinoma (CRC) tissue samples from 24 Bangladeshi patients. The researchers found a total of 627 differentially methylated loci covering 513 genes when comparing CRC tissue to normal adjacent tissue, with 535 loci covering 465 genes being newly identified. Gene set enrichment analysis showed hypermethylation in CRC of gene sets related to inhibition of adenylate cyclase activity, Rac guanyl-nucleotide exchange factor activity, regulation of retinoic acid receptor signaling, and estrogen receptor activity. Predictive models based on differentially methylated loci showed potential for CRC diagnosis with around 89% sensitivity and specificity.
This year's 3rd Annual TCGC: The Clinical Genome Conference, held June 10-12, 2014 in San Francisco, is a three-day event that weaves together the science of sequencing and the business of implementing genomics in the clinic. It uniquely illustrates the mutual influence of those areas and the need to therefore consider the needs, challenges and opportunities of both - from next-generation sequencing and variant interpretation to insurance reimbursement and electronic health records - throughout the entire research process.Learn more at http://www.clinicalgenomeconference.com
This document summarizes an experiment aiming to knockout the CTNNB1 gene in mouse embryonic stem cells using CRISPR-Cas9 genome editing. It describes designing a guide RNA targeting exon 10 of CTNNB1, cloning it into a vector, transforming E. coli, and testing primers for detecting knockout via PCR and qPCR. Prior studies showed CTNNB1 knockout embryos had defects in ectoderm and mesoderm development. The authors hypothesized knocking out CTNNB1 in stem cells would produce inviable embryos, similar to prior findings.
This document reviews microRNAs (miRNAs) related to the occurrence, diagnosis, and prognosis of non-small cell lung cancer (NSCLC). It discusses how some miRNAs act as oncogenes in NSCLC by promoting proliferation, migration, and invasion through targeting tumor suppressor genes. Other miRNAs act as tumor suppressors by inhibiting oncogenes. The expression levels of certain miRNAs have diagnostic and prognostic value for NSCLC. Some miRNAs show potential as biomarkers for early detection of NSCLC or for distinguishing NSCLC subtypes. Circulating miRNAs may also serve as biomarkers for cancer detection and prognosis. Single nucleotide polymorphisms in miRNA genes have been associated with survival in NSCLC patients.
La adivinanza describe una criatura con un cuello largo y manchas en la piel, sugiriendo que si se da más información se podrá adivinar de qué animal se trata.
El documento trata sobre completar figuras. Habla de un tema sobre completar figuras en una unidad. Proporciona instrucciones sobre cómo completar diferentes figuras.
El documento habla sobre el tema del rombo. Indica que se debe usar una crayola anaranjada para colorear las líneas punteadas de un dibujo de un rombo.
El documento habla sobre Don José de San Martín, el máximo héroe de la independencia de Perú. El 28 de julio de 1821, San Martín proclamó la independencia de Perú. Se pide delinear y colorear un retrato de Don José de San Martín.
El documento habla sobre el Domingo de Ramos y tres elementos clave de este episodio del evangelio: 1) Jesús entró en Jerusalén montado en un burro prestado mientras la gente agitaba palmas y mantos, 2) la gente lo recibió como a un rey aclamándolo alegre y entusiastamente, y 3) a pesar de ser el hijo del Dueño del mundo, Jesús no tenía ni siquiera un asno o camello para su entrada en la ciudad.
El documento trata sobre el tema de los círculos en geometría. Instruye al lector a delinear y colorear solo los círculos presentes usando una crayola roja.
The Scramble for Africa document summarizes the major events of European colonization and imperialism in Africa between the late 19th and 20th centuries. The Berlin Conference divided the continent among European powers without African input. Belgium's King Leopold oversaw one of the bloodiest massacres in Congo's history. The Boer War changed South Africa as the Zulu Kingdom was diminished. Europeans arbitrarily divided African ethnic groups, separating families and causing conflict. The legacy of exploitation and artificial borders has led to ongoing issues like civil wars, disease, and the Rwandan genocide. International aid now also enables continued resource exploitation.
Manuela la tortuga vivía en el zoológico y le gustaba comer lechuga. Un día escapó de su encierro y fue encontrada por un niño en el parque, quien la devolvió al zoológico.
Los derechos del niño, incluyendo el derecho a la educación, a la salud y a un nivel de vida adecuado. Este documento repite el tema de los derechos del niño cinco veces sin proporcionar más detalles.
La adivinanza describe una criatura con un cuello largo y manchas en la piel, sugiriendo que si se da más información se podrá adivinar de qué animal se trata.
El documento repite la misma información sobre San Martín de Porres varias veces sin proporcionar detalles. Solicita que el estudiante marque, delinee, encierre, pinte y pegue papelitos de color en los órganos de los sentidos de la vista, tacto, olfato, gusto y oído respectivamente.
El documento trata sobre un tema escolar sobre círculos rojos. Instruye a los estudiantes pegar papel abollado alrededor de un círculo rojo como parte de un proyecto o tarea.
El documento habla sobre el color morado y cómo se puede crear combinando los colores rojo y amarillo. Se instruye a los estudiantes a usar témperas para mezclar rojo y amarillo y descubrir el color anaranjado, y luego pintar una figura con ese color.
El documento describe tres regiones del Perú y proporciona instrucciones para una actividad manual relacionada con ellas. Se pide esparcir plastilina verde en el mapa del Perú para representar una región y pegar papel abolillado en el borde para representar otra, con el propósito de enseñar las características de las tres regiones del país a través de una práctica.
En la época navideña nos encanta decorar nuestras viviendas con elementos típicos del acontecimiento que vamos a celebrar, y como no podía ser de otro modo, las flores son elementos fundamentales en esta.
Gene expression profiling reveals molecularly and clinically distinct subtype...Yu Liang
This study used gene expression profiling to analyze molecular subtypes of glioblastoma multiforme (GBM), the most common and aggressive form of brain cancer. The analysis revealed:
1) Distinct gene expression patterns between GBM tumors and normal brain tissue, as well as between GBMs and lower-grade oligodendroglial tumors.
2) Significant differences in gene expression among individual GBM tumors, particularly in genes related to angiogenesis, immune response, and extracellular matrix remodeling.
3) Gene expression patterns of samples from the same GBM tumor were more similar to each other than to other tumors, even when the samples had divergent histologies.
4) A set of 70 genes associated
A micro-array is a tool for analyzing gene expression that consists of a small membrane or glass slide containing samples of many genes arranged in a regular pattern.
This was made by me while I was in Masters. I have made few animations. I hope it makes understanding better.
The content is made by searching through internet and referencing books. I do not claim any content in whole presentation except the animations made on the subject.
JTM-Functional characterization of human Cd33+ And Cd11b+ myeloid-derived sup...Karolina Megiel
This study examined the ability of human tumor cell lines to induce myeloid-derived suppressor cells (MDSC) from healthy donor peripheral blood mononuclear cells (PBMC) using in vitro co-cultures. Two distinct MDSC subsets were identified and characterized: CD33+ HLA-DRlow HIF1a+/STAT3+ MDSC and CD11b+ HLA-DRlow C/EBPb+ MDSC. The induction of CD33+ MDSC depended on overexpression of IL-1b, IL-6, TNFa, VEGF, and GM-CSF by tumor cells, while CD11b+ MDSC induction correlated with FLT3L and TGF
1) The study found that circ-LDLRAD3, STAT3 expression were upregulated while miR-876-3p expression was downregulated in pancreatic cancer tissues and cell lines compared to normal tissues/cells.
2) Knockdown of circ-LDLRAD3 suppressed pancreatic cancer cell proliferation, migration, and invasion.
3) Mechanistically, circ-LDLRAD3 was found to directly regulate miR-876-3p expression, and miR-876-3p targets STAT3. Downregulation of circ-LDLRAD3 inhibited cell proliferation, invasion and migration by regulating the miR-876-3p/STAT3 axis.
Tumor Microenvironment-Mediated Construction and Deconstruction of Extracellu...S KANDAKUMAR CUDDALORE
(1) Researchers developed a nanoparticle carrier called CS-NG that can assemble into microsized drug depots at tumor sites assisted by hyaluronidase, an overexpressed enzyme. (2) The drug depots gradually release tumor necrosis factor (TNF)-related apoptosis inducing ligand (TRAIL) and antiangiogenic drug cilengitide at acidic tumor sites to induce cancer cell and endothelial cell apoptosis. (3) In mouse models, the CS-NG formulation more effectively inhibited tumor growth compared to free drugs or non-transforming nanoparticles due to prolonged drug retention and membrane-targeted drug release.
This document summarizes a study investigating the role of microRNA-122 (miR-122) in regulating intrahepatic metastasis of hepatocellular carcinoma (HCC). The study found that miR-122 expression is significantly downregulated in HCC tumors with intrahepatic metastasis. Restoring miR-122 expression in metastatic HCC cell lines reduced in vitro migration, invasion, and tumor growth in vivo. Computational analysis identified multiple target genes of miR-122, including ADAM17, which was shown to be involved in metastasis. Silencing ADAM17 had similar effects as restoring miR-122, reducing in vitro and in vivo measures of metastasis. The study suggests that miR-122 acts as a tumor suppressor
Low expression of N-myc downstream-regulated gene 2 in oesophageal squamous c...Enrique Moreno Gonzalez
It is currently unclear whether a correlation exists between N-myc downstream-regulated gene 2 (NDRG2) expression and oesophageal squamous cell carcinoma (ESCC). The aim of this study was to examine the underlying clinical significance of NDRG2 expression in ESCC patients and to investigate the effects of NDRG2 up-regulation on ESCC cell growth in vitro and in vivo.
Applications of Next generation sequencing in Drug Discoveryvjain38
This presentation gives an overview of the Next generation Sequencing (NGS) technology and what are is current applications in the drug discovery process.
Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...Mohamed Khalid Ali Xundhur
The document summarizes a study that examined gene expression profiling in MCF-7 breast cancer cells infected with Newcastle disease virus (NDV). The study found that NDV infection changed the expression levels of many genes involved in tumor progression, cell cycle regulation, apoptosis, and other cellular processes. Specifically, the study used a gene expression kit to measure changes in 21 genes related to these processes in MCF-7 cells infected with NDV. It found that NDV infection altered the expression of genes like PUMA, Bcl-2, ESR1, and MYBL2. The results provide insight into the gene regulation mechanisms by which NDV selectively kills cancer cells.
Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...Mohamed Khalid Ali Xundhur
1) The document analyzes gene expression profiling in MCF-7 breast cancer cells infected with Newcastle disease virus (NDV). It finds that NDV infection changes the expression level of many genes involved in tumor progression, cell cycle regulation, apoptosis, and other processes.
2) Specifically, it finds that NDV down-regulates expression of genes like estrogen receptor 1 (ESR1) and up-regulates genes like Bcl-2 binding component 3 (BBC3), both of which are involved in apoptosis.
3) Cell cycle analysis shows that 11% and 41% of MCF-7 cells underwent apoptosis at 3 and 6 hours post-infection respectively, indicating NDV induces apoptosis in the cancer cells
The document summarizes a study that evaluated the expression of 11 genes in 32 surgically removed human lung cancer specimens. Ras family genes and c-myc were overexpressed in over 70% and 50% of cancerous tissues, respectively. More than 50% of adenocarcinoma cases showed moderate expression of TGF-α and HER2. Real-time RT-PCR was used to precisely quantify gene expression levels in the specimens. The results suggest that k-ras, c-myc and bcl-2 could be potential therapeutic targets for lung cancer.
DNA Amplification is a Ubiquitous Mechanism of Oncogene Activation in Lung an...Shryli Shreekar
Chromosomal translocation is the best-characterized
genetic mechanism for oncogene activation. However, there
are documented examples of activation by alternate
mechanisms, for example gene dosage increase, though
its prevalence is unclear. Here, we answered the fundamental question of the contribution of DNA amplification
as a molecular mechanism driving oncogenesis. Comparing
104 cancer lines representing diverse tissue origins
identified genes residing in amplification ‘hotspots’ and
discovered an unexpected frequency of genes activated by
this mechanism. The 3431 amplicons identified represent
B10 per hematological and B36 per epithelial cancer
genome. Many recurrently amplified oncogenes were
previously known to be activated only by disease-specific
translocations. The 135 hotspots identified contain 538
unique genes and are enriched for proliferation, apoptosis
and linage-dependency genes, reflecting functions advantageous to tumor growth. Integrating gene dosage with
expression data validated the downstream impact of the
novel amplification events in both cell lines and clinical
samples. For example, multiple downstream components of
the EGFR-family-signaling pathway, including CDK5,
AKT1 and SHC1, are overexpressed as a direct result of
gene amplification in lung cancer. Our findings suggest that
amplification is far more common a mechanism of
oncogene activation than previously believed and that
specific regions of the genome are hotspots of amplification.
The study found that a cell cycle progression (CCP) gene expression signature can differentiate indolent from aggressive prostate cancer and provide prognostic information beyond standard clinical parameters. Specifically:
1) Higher CCP scores, indicating more actively dividing cells, were associated with increased risk of biochemical recurrence after prostatectomy and death from prostate cancer in a conservatively managed cohort.
2) The CCP score was a strong univariate predictor of outcome and added significant prognostic information when combined with clinical factors like PSA and Gleason score in multivariate analyses.
3) The CCP score was robust across different patient populations and clinical settings and may help physicians select optimal treatment strategies at diagnosis.
This document describes a method for performing RNA sequencing on single nuclei. Key points:
1) The authors demonstrate that double-stranded cDNA can be synthesized from single mouse neural progenitor cell nuclei and hippocampal tissue nuclei, allowing for whole transcriptome sequencing.
2) On average, sequencing of single nuclei detected over 16,000 of the approximately 24,000 mouse protein-coding genes.
3) Analysis of single nuclei avoids issues with dissociating intact cells from complex tissues, is applicable across eukaryotic species, and provides insight into nuclear gene regulation.
4) RNA sequencing of single nuclei is a powerful new method for investigating gene expression at the single cell level without disrupting cells.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
This document describes a new multi-parametric assay being developed by IncellDx to simultaneously analyze genomic, proteomic, and cell cycle markers in breast cancer samples. The assay aims to measure 9 markers including ER, PR, HER2, E-cadherin, DNA content and proliferation. Initial studies mixing breast cancer cell lines expressing different markers demonstrated the ability to differentiate markers. Further studies on clinical breast cancer samples found the assay could simultaneously detect HER2 mRNA and protein levels that matched immunohistochemistry results. Future studies will evaluate the assay's clinical performance on 50 breast tumors and 10 normal samples compared to standard pathology.
1) The authors are using the CRISPR-Cas9 system to induce double-strand breaks near centromeres on chromosomes 3p and 8p in order to generate models of partial aneuploidy through homologous recombination.
2) They have successfully targeted and induced breaks on these chromosomes, and selected for cells that underwent recombination to replace the chromosome arm with an artificial telomere.
3) In the future, they aim to characterize the phenotypic and tumorigenic effects of specific chromosomal arm losses to further understand their role in cancer formation and progression.
2. M. Zorniak, P. A. Clark, and J. S. Kuo
J Neurosurg October 31, 2014
We used an unbiased gene expression profiling–based
approach to identify novel GSC-specific plasma mem-
brane markers. Two GSC lines were characterized us-
ing gene microarrays compared with human neural stem
cells (hNSCs), normal human brain, primary GBM, and
recurrent GBM tissue samples. After filtering for plasma
membrane transcripts, 19 GSC transcripts with multiple
probe sets were found upregulated in contrast to find-
ings in normal controls and whole GBM tumor samples.
Candidate genes were validated by quantitative reverse
transcription polymerase chain reaction (qRT-PCR)
with two additional GSC lines along with normal hu-
man astrocytes (NHAs), the U87 glioma cell line, and
the serum-cultured, patient-matched GBM lines 22T and
33T. Expression of cadherin-19 (CDH19) is restricted to
minimally infiltrative GSCs, with no detectable protein in
other GSCs, GBM cell lines, or normal neural cell lines
on immunoblotting. These findings suggest that CDH19
(a Type II atypical cadherin specific to myelinating cells
during development)31
could serve as a feasible marker for
GSC identification, isolation, and drug discovery.
Methods
GSC, GBM, and Control Cell Line Culture
All studies were performed with approval from the
University of Wisconsin–Madison Institutional Review
Board with informed consent obtained from patients, and
with approval from the Institutional Animal Care and Use
Committee. Glioblastoma stem-like cells were isolated by
following previously reported protocols,7,12,14,23,27
without
the use of surface markers. Briefly, after the histological
diagnosis was established based on WHO criteria, fresh
GBM tissue was directly collected according to institu-
tional review board–approved protocol, weighed, coarsely
minced with a scalpel blade, and subsequently chopped
twice at 200 μm using a tissue chopper (Sorvall Tissue
Chopper, model TC-2, Diversified Equipment). Chopped
tissue was directly plated in a suspension and cultured
in the following passaging medium: 70% DMEM–high
glucose, 30% Ham’s F12, 1× B27 supplement, 5 μg/ml
heparin, and penicillin-streptomycin-amphotericin, sup-
plemented with 20 ng/ml each of human recombinant epi-
dermal growth factor and bovine fibroblast growth fac-
tor.27
Sphere cultures were passaged approximately every
7 days by tissue chopping twice at 100 μm. Individual
patient-derived GSC lines 12.1, 22, 33, and 44 were cul-
tured in suspension, and they were rigorously validated
for self-renewal by neurosphere formation, expression of
stem cell markers (i.e., AC/CD133), multipotency, tumor
initiation, and serial implantation in nonobese diabetic/se-
vere combined immunodeficient (also called NOD-SCID)
mice (Harlan Sprague-Dawley).8,30
Standard serum condi-
tions were used to maintain patient-matched 22T and 33T
GBM bulk tumor lines and U87 and normal human astro-
cyte (NHA) lines (DMEM, 10% fetal bovine serum, 1%
antibiotics; Invitrogen). GSCs were compared with hN-
SCs and were maintained as previously described.27
Es-
tablishment and cryopreservation of cell cultures ranged
from Passages 1 to 10. Cells used for experiments ranged
from Passages 20 to 25.
Gene Expression Profiling
Pooled gene expression profiling of human GSC lines
12.1 and 22 (n = 2) (National Center for Biotechnology
Information Gene Expression Omnibus [NCBI GEO] ac-
cession nos. GSM1253303 and GSM1253304, respective-
ly) were compared with hNSCs M031 CTX (n = 2) (NCBI
GEO accession nos. GSM458064 and GSM458065), nor-
mal human brain tissue (n = 21), primary GBM tumors
(n = 21), and recurrent GBM tumors (n = 22) (Table 1).
Total RNA was extracted from GSCs with an RNeasy Kit
(Qiagen), and samples were then sent to LC Sciences for
final gene expression processing and analysis. In brief,
total RNA was reverse transcribed with T7-Oligo(dT)
primers. After cleanup of cDNA, cRNA was synthesized
using in vitro transcription (3′ IVT). cRNA was bioti-
nylated and fragmented before hybridization to a U133
Plus 2.0 Array (Affymetrix) that contained probes for
over 47,000 transcripts. Hybridized cRNA was labeled
with streptavidin-phycoerythrin for visualization. Hy-
bridization images were collected using a laser scanner
(GenePix 4000B, Molecular Devices) and digitized using
Array-Pro image analysis software (Media Cybernetics).
U133 Plus 2.0 Array gene expression profiles for hNSCs
were obtained from Dr. Clive Svendsen. Profiling data
of gross tissue samples of normal human brain, primary
GBM, and recurrent GBM were obtained from the Na-
tional Cancer Institute Repository of Molecular Brain
Neoplasia Database (NCI REMBRANDT) (Table 1).
All of the expression profiles were batch-normalized by
a robust multichip average algorithm using the Geospiza
GeneSifter (PerkinElmer) online microarray database
and analysis software. The data were then exported into
Microsoft Office Excel (2010) and organized for GSC
transcripts with raw intensity values 10-fold or higher
over normal brain, hNSC, primary GBM, and recurrent
GBM samples. The reverse-sorting algorithm was done to
obtain downregulated GSC transcripts (NCBI GEO ac-
cession no. GSE51822). This analysis provided a list of
upregulated plasma membrane transcripts in GSCs (Fig.
1). Since each transcript has multiple probes on U133 Plus
2.0 Arrays, all the probes for an upregulated transcript
are shown to demonstrate signal redundancy. The data
are represented as a heat map of raw intensity values with
the provided scale.
qRT-PCR Validation of mRNA Expression Profiles
Gene expression profiling was validated by quanti-
tative reverse transcription polymerase chain reaction
(qRT-PCR) to confirm differential upregulation of GSC
transcripts. RNA was isolated from the following cell
lines using the RNeasy Kit: GSCs 12.1, 22, 33, and 44;
hNSCs; NHAs; and serum cultured GBM tumor lines 22T
and 33T. Isolated RNA was reverse transcribed with the
Omniscript Reverse Transcription Kit (Qiagen) to create
a cDNA pool for each cell line. A nonadeoxyribonucleo-
tide random primer mixture (TaKaRa) and human pla-
cental optizyme ribonuclease inhibitor (Fisher Scientific)
were used for reverse transcription per the manufacturer’s
instructions. Quantitative PCR was performed with the
EXPRESS SYBR GreenER qPCR Supermix Universal
Kit (Invitrogen). Reactions were scaled down to 20 μl,
2
3. Cadherin-19 is a minimally infiltrative GSC marker
J Neurosurg October 31, 2014
combined in an ABI Prism 96-well optical reaction plate,
and loaded into an ABI Prism 7000 unit (Applied Biosys-
tems). Primers were designed according to online tools
at Integrated DNA Technologies (http://www.idtdna.com)
and only chosen if the predicted amplicon contained 2
exon regions and a melting temperature near 60°C (Table
2). Intron spanning and gene specificity were confirmed
by an NCBI BLAST search (http://blast.ncbi.nlm.nih.
gov). 18S rRNA was used as the reference gene. hNSC
cycle threshold, or C(t), values were used as the calibrator
for calculations. All other cell lines were set as the tar-
get. C(t) values were chosen during linear growth of the
produced sigmoidal curves. Gene expression was quanti-
fied by the DDC(t) method. In brief, the DC(t) value was
calculated by subtracting the C(t) of the target from the
reference values. The DDC(t) was calculated by subtract-
ing the DC(t) of the target from the calibrator. Finally, the
formula, 2^(- DDC(t)), was used to report fold change dif-
ferences over the calibrator value.
Immunoblotting Analysis
Immunoblotting was performed as described.30
Cells
were lysed using cell extraction buffer (catalog no.
FNN0011, Invitrogen) containing protease inhibitor cock-
tail (P8340, Sigma-Aldrich). Total protein was quantified
using an EZQ Protein Quantification assay (R33200, In-
vitrogen). Thirty micrograms of protein was resuspended
in 2× reducing sample buffer (LC2676, Invitrogen), elec-
trophoresed on 10%–20% tris-glycine gels (Invitrogen),
transferred using a semidry transfer system (Bio-Rad)
to polyvinylidene difluoride membranes (Millipore), and
probed with Ms-pAb-anti-CDH19 (H00028513-B01P,
Abnova) at 1:250, identified at approximately 114k kDa.
Rb-pAb-anti-ACTB (ab8227, abcam) at 1:2000 was used
as a loading control. Immunocomplexes were detected
using luminescence Supersignal West Pico Substrate
(Thermo Scientific) per manufacturer’s instructions.
Results
Differential Plasma Membrane Transcripts in GSCs
Gene expression profiles were sorted for differentially
upregulated (> 10-fold) GSC plasma membrane transcripts
compared with normal human (nontumor) brain, hNSCs,
and primary GBM and recurrent GBM (Fig. 1A). Nine-
teen distinct transcripts with multiple redundant probe
sets were found to be specifically upregulated in GSCs
(Fig. 1B). As expected, PROM1 (i.e., CD133) expression
in GSCs was not meaningfully upregulated (2.2-fold)
compared with hNSCs, thus demonstrating the validity of
our approach. Additionally, a set of downregulated GSC
transcripts was generated that included reduced expres-
sion of 3 different human leukocyte antigen (HLA) genes
(HLA-DRB1, HLA-DPA1, and HLA-DRA) in GSCs (Fig.
2).
CDH19 Is Upregulated in Minimally Infiltrative GSCs
qRT-PCR primers were designed for the signature of
TABLE 1. Gene expression profile file names downloaded from NCI REMBRANDT
No. Normal Human Brain GBM Primary GBM Recurrent
1 NT_HF0088_U133P2 1_E09233_U133P2 2_E09138_U133P2
2 NT_HF0120_U133P2 1_E09405_U133P2 2_E09139_U133P2
3 NT_HF0131_U133P2 1_E09451_U133P2 2_E09167_U133P2
4 NT_HF0137_U133P2 1_E09489_U133P2 2_E09192_U133P2
5 NT_HF0151_U133P2 1_E09511_U133P2 2_E09231_U133P2
6 NT_HF0163_U133P2 1_E09531_U133P2 2_E09483_U133P2
7 NT_HF0171_U133P2 1_E09654_U133P2 2_E09546_U133P2
8 NT_HF0178_U133P2 1_E09698_U133P2 2_E09601_U133P2
9 NT_HF0211_U133P2 1_E09704_U133P2 2_E09602_U133P2
10 NT_HF0232_U133P2 1_E09774_U133P2 2_E09606_U133P2
11 NT_HF0295_U133P2 1_E09782_U133P2 2_E09610_U133P2
12 NT_HF0303_U133P2 1_E09832_U133P2 2_E09624_U133P2
13 NT_HF0377_U133P2 1_E09846_U133P2 2_E09647_U133P2
14 NT_HF0383_U133P2 1_E09847_U133P2 2_E09649_U133P2
15 NT_HF0467_U133P2 1_E09857_U133P2 2_E09670_U133P2
16 NT_HF0512_U133P2 1_E09910_U133P2 2_E09787_U133P2
17 NT_HF0523_U133P2 1_E09917_U133P2 2_E09791_U133P2
18 NT_HF0526_U133P2 1_E09938_U133P2 2_E09802_U133P2
19 NT_HF0533_U133P2 1_E09964_U133P2 2_E09852_U133P2
20 NT_HF0593_U133P2 1_E09967_U133P2 2_E09868_U133P2
21 NT_HF0616_U133P2 1_E09998_U133P2 2_E09930_U133P2
22 NA NA 2_E09965_U133P2
NA = not applicable.
3
4. M. Zorniak, P. A. Clark, and J. S. Kuo
J Neurosurg October 31, 2014
19 upregulated GSC plasma membrane transcripts to val-
idate the mRNA expression profiles (Table 2). Additional
GSC lines 33 and 44 were added to this analysis along
with serum-cultured NHAs, the U87 glioma cell line, and
the patient-matched GBM lines 22T and 33T. GBM lines
are representative of the non–stem-like cancer cell popu-
lation. CDH19 demonstrated elevated transcript levels
across all GSC samples compared with hNSCs, NHAs,
the U87 cell line, and the GBM lines 22T and 33T (Fig.
3A). SLC1A1, TSPAN31, COL20A1, GPR17, and GPC3
also maintained similar expression profiles in qRT-PCR
compared with the mRNA microarrays; however, their
Fig. 1. Nineteen upregulated plasma membrane GSC-specific transcripts. A: Logic diagram showing how gene expression pro-
files were sorted to identify GSC-specific transcripts (asterisk). Normal human brain (n = 21), primary GBM (n = 21), and recurrent
GBM (n = 22) gene expression profiles were obtained from NCI REMBRANDT (see Table 1). GSCs (n = 2) were isolated from two
patients at the University of Wisconsin. hNSCs (n = 2) were isolated from two human fetal brains. B: Heat map with accompany-
ing color key of raw intensity values from gene expression profiles. Data were filtered for plasma membrane transcripts and gated
for GSC values greater than a 10-fold change above all other samples. Acronyms correspond to official gene symbols found online
at the NCBI. Multiple probe sets shown to demonstrate internal reproducibility.
4
5. Cadherin-19 is a minimally infiltrative GSC marker
J Neurosurg October 31, 2014
upregulation did not uniformly extend to GSC lines 33
and 44. Western blot analysis confirmed 12.1 and 22
GSC-specific expression of CDH19 (Fig. 3B). These two
GSC lines express oligodendrocyte and neural progeni-
tor markers and were previously profiled as minimally
infiltrative in xenograft studies.30
The GSC lines 33 and
44 did not express CDH19 at the protein level (data not
shown).
CDH19 Expression in Normal Human Tissues and GBM
Tumors
In human tissues, CDH19 transcript (probe ID:
206898_at) was expressed meaningfully in only two tis-
sues, olfactory bulb and dorsal root ganglion (Fig. 4),
but their respective raw intensity levels, approximately
700 and 500, were lower than the approximate 2000 we
observed in GSCs (Fig. 1B). Interestingly, patients with
tumors expressing elevated levels (> 2-fold, n = 27) of
CDH19 in the NCI REMBRANDT database had a signifi-
cantly higher survival probability than those expressing
intermediate levels (p = 0.03, log-rank test) (Fig. 5). Al-
though inclusion of downregulated samples provided no
statistically significant increase in survival probability (p
= 0.07, log-rank test), it still offered a robust trend toward
higher survival probability.
Discussion
We report the identification of CDH19 as a marker
for minimally infiltrative GSCs through gene expression
profiling, qRT-PCR, and immunoblot analysis correlated
to animal tumor xenograft studies. CDH19 expression is
restricted to cells responsible for myelination in the devel-
oping nervous systems of chickens and rats and maintains
low expression in the adult human olfactory bulb and dor-
sal root ganglia.15,28
Our understanding of atypical Type II
cadherin biology remains sparse,18
yet the little we know
about CDH19 has prompted further investigation into its
role in GBM tumorigenesis.
Crystallographic studies determined that Type II
cadherins mediate homodimeric adhesion through their
EC1 domain, similarly to Type I cadherins, yet structur-
al differences suggest the inability of Type II cadherins
to cross-interact with Type I cadherins, thereby confer-
ring confined functionality within tissues.18
CDH19 is
expressed developmentally in chicken Schwann cells
and oligodendrocytes15
and in rat Schwann cell precur-
sors and cranial ganglia.28
Restricted cellular expression
of Type II cadherins in the developing nervous system
and their functional isolation from other cadherin family
members make them ideal potential markers and targets
for GSC identification, isolation, and drug discovery.
CDH19-restricted expression in minimally infiltrative
GSCs and its potential role in enhancing survival prob-
ability in GBM patients may not be a coincidence. GSC
lines 12.1 and 22 morphologically resemble oligoden-
drocyte progenitor cells (OPCs) and express OPC mark-
ers such as 2′, 3′-cyclic-nucleotide 3′-phosphodiesterase
(CNP), a prognostically favorable immunohistochemical
marker for GBM.30
Likewise, CDH19 upregulation was
prognostically favorable in NCI REMBRANDT against
a subset of samples (Fig. 5). Since CDH19 expression is
limited to the GSCs, pooled mRNA transcripts from a
whole-tumor sample are likely diluted for this analytical
TABLE 2. qRT-PCR primers for gene expression profile validation
HGNC Forward (5′–3′) Reverse (5′–3′) CDS Exons
18S rRNA GTTGGTGGAGCGATTTGTCTGGTT TAGCATGCCAGAGTCTCGTTCGTT 1345–1401 NA
COL11A1 AATGGAGCTGATGGACCACAAGGA TCTCCAACACCACCAACTGAACCA 3580–3641 49–50
COL20A1 ACCTTGCAGATCTTCGAGCTCACT TCCTCAATCACAAACTCCCTCCGA 274–344 4–5
CDH19 AGTCATCACATCGGCCAGCTAAGA TACTTCCAGCTCCAGCTCCCAAA 178–265 2–3
FAM119B TGCTGACCATCACGCAGAACTTTG CCTTCTTGCCTCGGAAATCCACAT 116–235 1–2
FCRLA CAGCCACTGAGGACAACCAAGTTT AAGCACCCTGCACTCTGATCTCTA 776–841 4–5
FRZB TGCCTCTGCCCTCCACTTAATGTT TACCGAGTCGATCCTTCCACTTCT 727–825 4–5
GPC3 AACCAGCTCCTGAGAACCATGTCT TCATCATCACCGCAGTCTCCACTT 1408–1505 6–7
GPR17 AAACGGAGTTGGTGGGCTGGAT GCCACTTCAAGGCCATTCATGCTT 7–104 2–3
HAPLN1 CTGTTGTGGTAGCACTGGACTTAC CCCAGTCGTGGAAAGTAAGGGAATAC 446–503 3–4
KCNS3 CCATGAAGTTGGGCTTCTGCTTCT GGCTGGATGTGTGGTCATCTTTCT 963–1060 NA
KLRC2 GCCAGCATTTTACCTTCCTCA ACTGCACAGTTAAGTTCAGCAT 493–623 5–6
MAGEC2 TGCCAGACAGTGAGTCCTCTTTCA ACAGGCTCCTCTGCTTCGTATTTG 389–385 NA
NID2 GCCACAGCAGCATTGATGTTTCCT TTGGTGTGAGGATCCAAGGTGGAA 1013–1097 4–5
PLOD2 TGGACCCACCAAGATTCTCCTGAA AGTGCAGCCATTATCCTGTGTCCA 765–840 7–8
PPFIBP1 TGCCAGATCCCAGATTCAACAGCA TCCCTGGTAGGTGTCCATTTGTCA 214–292 4–5
PRSS12 TTCTGGACTGGGCCTTATTCCCAT TTTCTTCATCTCCTCGGCAACGGA 672–733 2–3
SLC1A1 GAAGCAGTGGCAGCGGTGTTTATT ATGTGGCCGTGATACTGATGGTGA 1120–1207 10–11
TMEM45A TGGAGCTATTGCGGTCAAGTCTCA TCCAATCTGAAAGAACCAGCTCCC 536–594 4–5
TSPAN31 TGCTGGTGAGCTTGTTGCTCATTG ATGATGTGGATGCTGGACACCAGA 62–137 1–2
CDS = coding sequence; HGNC = Human Gene Nomenclature Committee–approved gene symbol.
5
6. M. Zorniak, P. A. Clark, and J. S. Kuo
J Neurosurg October 31, 2014
marker. Immunohistochemical labeling seems to improve
GSC resolution, as we observed with pockets of CNP
expression in a clinically annotated GBM tissue micro-
array,30
yet CNP was not prognostically favorable in the
samples of NCI REMBRANDT.
Examination of recent work published in the literature
revealed a potential tumorigenic role for Type II cadher-
ins. Transcriptional regulation of CDH19 and CDH12
was reportedly targeted by monocyte chemotactic protein
1–induced protein (MCPIP), which promoted capillary-
like tube formation in human umbilical vein endothelial
cells.17
MCPIP knockdown occurred via small interfering
RNA-suppressed angiogenesis-related genes VEGF and
HIF1A, CDH19, and CDH12 and reduced capillary-like
tube formation. Pathologically, vascular endothelial pro-
liferation is observed in OPC-like minimally infiltrative
GSC xenografts, but not in tumor xenografts from highly
invasive GSCs that express abundant astrocyte progenitor
cell markers.30
Perhaps CDH19-related upregulation of
angiogenic signaling enables certain GSCs to grow into
focal tumors instead of invading the normal brain paren-
chyma. Conversely, another Type II cadherin was found
expressed as proteins in GBM and GSCs: cadherin-11
(CDH11). Knockdown of CDH11 in serum-cultured U87
Fig. 3. Cadherin-19 is specifically expressed in minimally infiltrative
GSCs. A: Heat map of qRT-PCR validation of all candidate GSC cell-
surface markers. Additional GSC lines, 33 and 44, were evaluated in
comparison with hNSCs, NHAs, U87 glioma cells, and patient-matched
serum-cultured GBM tumor cells 22T and 33T. Data are representa-
tive of 2 experimental repetitions normalized to hNSCs and reported
as a fold change value with accompanying color key. B: Western blot
analysis of CDH19 specifically expressed in GSC lines 12.1 and 22.
Ms-pAb-anti-CDH19 at 1:250, identified at approximately 114k kDa; Rb-
pAb-ACTB at 1:2000 was used as a loading control.
Fig. 2. Thirteen downregulated plasma membrane GSC-specific tran-
scripts. Heat map with accompanying color key of raw intensity values
from gene expression profiles. Data were filtered for plasma membrane
transcripts and gated for GSC values less than 10-fold change below
all other samples. Acronyms correspond to official gene symbols found
online at the NCBI. Multiple probe sets shown to demonstrate internal
reproducibility.
6
7. Cadherin-19 is a minimally infiltrative GSC marker
J Neurosurg October 31, 2014
and LN-229 GBM tumor cells reduced migration in a
scratch wound assay and shortened survival in a flank
xenograft model.13
Thus, each cadherin family member
exerts different properties and must be studied indepen-
dently to appreciate the extent of their involvement in
GBM tumorigenesis.
In addition to CDH19, other differentially expressed
transcripts associated with cancer and oligodendrocyte
biology were revealed in our studies. Glypican-3 (GPC3)
transcript was upregulated in minimally infiltrative GSCs
and confirmed by qRT-PCR; it was also described as a
bona fide marker and drug target for hepatocellular car-
cinoma,9
and it was highly correlated with CD90+
liver
cancer stem-like cells.11
This is the first report to establish
GPC3’s relationship to GBM. Likewise, upregulation of
oligodendrocyte-specific G protein–coupled receptor 17
(GPR17) mRNA was validated in GSC lines 12.1 and 22,
described as an intrinsic timer of myelination,6
thereby
strengthening the OPC-like resemblance of these GSCs.
Three downregulated transcripts of interest were HLA
Class II genes, HLA-DRB1, HLA-DPA1, and HLA-DRA,
also known as major histocompatibility complex (MHC)
proteins. Typically in these gene expression profiles, we
observe low levels in the human brain, higher levels in
GBM tumors, and downregulated expression in GSCs.
Most astrocytomas are infiltrated with immune-effector
cells, primarily consisting of cytotoxic T cells and mac-
rophages,20
presumably due to expression of HLA/MHC
Class II genes, as we have observed. This response can be
activated by cytokine-based immunotherapy that targets
HLA/MHC Class II molecules,22
but their eventual fail-
ure against GBMs may be due to the absence or low ex-
pression of HLA/MHC Class II molecules in GSCs that is
responsible for initiating and maintaining tumor growth.
Conclusions
Our data and analysis have shown that CDH19 may be
a suitable marker and drug target for minimally infiltra-
tive GSCs. Its low expression in developing neuroectoder-
mal tissue, specific upregulation in GSCs, and potential
angiogenic role in tumorigenesis have prompted further
development of research tools for study. Currently, no an-
tibodies exist for live cell surface labeling of CDH19 that
would help reveal possible associations with GSC tumor
initiation. Since CDH19 is typically a homodimerizing
plasma membrane protein, purified CDH19 conjugated
with corresponding visualization chemistries could po-
tentially be used as a research tool; however, potential
heteromeric cadherin-nectin complexes may complicate
this analysis.29
Future experiments are planned to address
CDH19’s potential involvement in GSC tumor initiation,
angiogenesis, migration, and proliferation. Moreover,
characterization of CDH19 in lower-grade gliomas and
oligodendrogliomas may provide more insights to glioma
biology.
Acknowledgments
We thank Priya Ezhilan, Daniel Treisman, Jonathan D. Ebben,
and Frank Hospod for expert technical assistance. Expert advice
was generously provided by C. Svendsen, R. Vemuganti, and S.
Zhang. We appreciate support from NIH (grant nos.T32GM007507,
UL1RR025011, RC4AA020476, NCI HHSN261201000130C, and
P30CA014520), the Wisconsin Partnership Program core grant
support of the Center for Stem Cell and Regenerative Medicine,
the University of Wisconsin (Graduate School, School of Medicine
and Public Health and Department of Neurological Surgery), the
HEADRUSH Brain Tumor Research Professorship, and Roger
Fig. 4. Cadherin-19 transcript found in olfactory bulb and dorsal root
ganglia from human tissue in BioGPS. Compiled from gene expression
profiles (probe ID: 206898_at). Accessed June 5, 2013 (http://biogps.
org). Figure is available in color online only.
7
8. M. Zorniak, P. A. Clark, and J. S. Kuo
J Neurosurg October 31, 2014
Loff Memorial Fund for GBM Research. The hNSCs were a kind
gift from Dr. C. Svendsen (Cedars-Sinai Medical Center, Los
Angeles, California).
References
1. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ,
Clarke MF: Prospective identification of tumorigenic breast
cancer cells. Proc Natl Acad Sci U S A 100:3983–3988,
2003
2. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland
AB, et al: Glioma stem cells promote radioresistance by
preferential activation of the DNA damage response. Nature
444:756–760, 2006
3. Bleau AM, Hambardzumyan D, Ozawa T, Fomchenko EI,
Huse JT, Brennan CW, et al: PTEN/PI3K/Akt pathway regu-
lates the side population phenotype and ABCG2 activity in
glioma tumor stem-like cells. Cell Stem Cell 4:226–235,
2009
4. Bonnet D, Dick JE: Human acute myeloid leukemia is orga-
nized as a hierarchy that originates from a primitive hemato-
poietic cell. Nat Med 3:730–737, 1997
5. Chen R, Nishimura MC, Bumbaca SM, Kharbanda S, Forrest
WF, Kasman IM, et al: A hierarchy of self-renewing tumor-
initiating cell types in glioblastoma. Cancer Cell 17:362–
375, 2010
6. Chen Y, Wu H, Wang S, Koito H, Li J, Ye F, et al: The oligo-
dendrocyte-specific G protein-coupled receptor GPR17 is a
cell-intrinsic timer of myelination. Nat Neurosci 12:1398–
1406, 2009
Fig. 5. Cadherin-19 upregulation in GBM tissue from NCI REMBRANDT showing higher survival probability. A: Kaplan-Meier
survival probability curve for CDH19 (probe ID: 206898_at, highest geometrical mean intensity). Upregulation and downregulation
were designated at a 2-fold difference in expression. B: Statistics generated using a log-rank test. Upregulated versus intermedi-
ate group is statistically significant for difference in survival (p = 0.03). Accessed June 5, 2013 (https://caintegrator.nci.nih.gov/
rembrandt). Figure is available in color online only.
8
9. Cadherin-19 is a minimally infiltrative GSC marker
J Neurosurg October 31, 2014
7. Clark PA, Iida M, Treisman DM, Kalluri H, Ezhilan S, Zor-
niak M, et al: Activation of multiple ERBB family receptors
mediates glioblastoma cancer stem-like cell resistance to
EGFR-targeted inhibition. Neoplasia 14:420–428, 2012
8. Clark PA, Treisman DM, Ebben J, Kuo JS: Developmental
signaling pathways in brain tumor-derived stem-like cells.
Dev Dyn 236:3297–3308, 2007
9. Feng M, Gao W, Wang R, Chen W, Man YG, Figg WD, et
al: Therapeutically targeting glypican-3 via a conformation-
specific single-domain antibody in hepatocellular carcinoma.
Proc Natl Acad Sci U S A 110:E1083–E1091, 2013
10. Hanahan D, Weinberg RA: Hallmarks of cancer: the next
generation. Cell 144:646–674, 2011
11. Ho DW, Yang ZF, Yi K, Lam CT, Ng MN, Yu WC, et al:
Gene expression profiling of liver cancer stem cells by RNA-
sequencing. PLoS ONE 7:e37159, 2012
12. Ignatova TN, Kukekov VG, Laywell ED, Suslov ON, Vrionis
FD, Steindler DA: Human cortical glial tumors contain neu-
ral stem-like cells expressing astroglial and neuronal markers
in vitro. Glia 39:193–206, 2002
13. Kaur H, Phillips-Mason PJ, Burden-Gulley SM, Kerstetter-
Fogle AE, Basilion JP, Sloan AE, et al: Cadherin-11, a
marker of the mesenchymal phenotype, regulates glioblas-
toma cell migration and survival in vivo. Mol Cancer Res
10:293–304, 2012
14. Lee J, Kotliarova S, Kotliarov Y, Li A, Su Q, Donin NM, et
al: Tumor stem cells derived from glioblastomas cultured in
bFGF and EGF more closely mirror the phenotype and geno-
type of primary tumors than do serum-cultured cell lines.
Cancer Cell 9:391–403, 2006
15. Lin J, Luo J, Redies C: Cadherin-19 expression is restricted to
myelin-forming cells in the chicken embryo. Neuroscience
165:168–178, 2010
16. Liu G, Yuan X, Zeng Z, Tunici P, Ng H, Abdulkadir IR, et al:
Analysis of gene expression and chemoresistance of CD133+
cancer stem cells in glioblastoma. Mol Cancer 5:67, 2006
17. Niu J, Azfer A, Zhelyabovska O, Fatma S, Kolattukudy PE:
Monocyte chemotactic protein (MCP)-1 promotes angiogen-
esis via a novel transcription factor, MCP-1-induced protein
(MCPIP). J Biol Chem 283:14542–14551, 2008
18. Patel SD, Ciatto C, Chen CP, Bahna F, Rajebhosale M, Arkus
N, et al: Type II cadherin ectodomain structures: implications
for classical cadherin specificity. Cell 124:1255–1268, 2006
19. Patru C, Romao L, Varlet P, Coulombel L, Raponi E, Cadus-
seau J, et al: CD133, CD15/SSEA-1, CD34 or side populations
do not resume tumor-initiating properties of long-term cul-
tured cancer stem cells from human malignant glio-neuronal
tumors. BMC Cancer 10:66, 2010
20. Plautz GE, Miller DW, Barnett GH, Stevens GH, Maffett S,
Kim J, et al: T cell adoptive immunotherapy of newly diag-
nosed gliomas. Clin Cancer Res 6:2209–2218, 2000
21. Reya T, Morrison SJ, Clarke MF, Weissman IL: Stem cells,
cancer, and cancer stem cells. Nature 414:105–111, 2001
22. Rosenberg SA: Progress in human tumour immunology and
immunotherapy. Nature 411:380–384, 2001
23. Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C,
Squire J, et al: Identification of a cancer stem cell in human
brain tumors. Cancer Res 63:5821–5828, 2003
24. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide
T, et al: Identification of human brain tumour initiating cells.
Nature 432:396–401, 2004
25. Son MJ, Woolard K, Nam DH, Lee J, Fine HA: SSEA-1 is an
enrichment marker for tumor-initiating cells in human glio-
blastoma. Cell Stem Cell 4:440–452, 2009
26. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher
B, Taphoorn MJ, et al: Radiotherapy plus concomitant and
adjuvant temozolomide for glioblastoma. N Engl J Med
352:987–996, 2005
27. Svendsen CN, ter Borg MG, Armstrong RJ, Rosser AE,
Chandran S, Ostenfeld T, et al: A new method for the rapid
and long term growth of human neural precursor cells. J
Neurosci Methods 85:141–152, 1998
28. Takahashi M, Osumi N: Identification of a novel type II clas-
sical cadherin: rat cadherin19 is expressed in the cranial gan-
glia and Schwann cell precursors during development. Dev
Dyn 232:200–208, 2005
29. Tanaka Y, Nakanishi H, Kakunaga S, Okabe N, Kawakatsu T,
Shimizu K, et al: Role of nectin in formation of E-cadherin-
based adherens junctions in keratinocytes: analysis with
the N-cadherin dominant negative mutant. Mol Biol Cell
14:1597–1609, 2003
30. Zorniak M, Clark PA, Leeper HE, Tipping MD, Francis
DM, Kozak KR, et al: Differential expression of 2′,3′-cyclic-
nucleotide 3′-phosphodiesterase and neural lineage markers
correlate with glioblastoma xenograft infiltration and patient
survival. Clin Cancer Res 18:3628–3636, 2012
Author Contributions
Conception and design: all authors. Acquisition of data: Zorniak,
Clark. Analysis and interpretation of data: all authors. Drafting
the article: Zorniak. Critically revising the article: all authors.
Reviewed submitted version of manuscript: all authors. Approved
the final version of the manuscript on behalf of all authors: Kuo.
Statistical analysis: Zorniak. Administrative/technical/material
support: Kuo, Clark. Study supervision: all authors.
Supplemental Information
Database Repository and Accession Numbers
GSC lines 12.1 (NCBI GEO accession no. GSM1253303) and 22
GSC (NCBI GEO accession no. GSM1253304); hNSCs M031
CTX (NCBI GEO accession nos. GSM458064 and GSM458065);
Normal Human Brain, GBM Primary, GBM Recurrent (NCI
REMBRANDT; Table 1).
Correspondence
John S. Kuo, Department of Neurological Surgery, University
of Wisconsin School of Medicine and Public Health, Box 8660
Clinical Science Center, 600 Highland Ave., Madison, WI 53792-
8660. email: j.kuo@neurosurgery.wisc.edu.
9