Final Examination
2
BAM 317 Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
1) Which doctrine was overturned in the case of Brown v. Board of Education?
a. the legality of poll taxes
b. the permissibility of separate but equal facilities
c. allowing only white males to vote
d. the acceptability of paying women less than men for comparable work
e. different working hours for male and female factory workers
2) Documents such as the U.S. Constitution, the Magna Carta, and the United Nations Charter
reflect what legal theory?
a. the Natural Law school
b. the Historical school
c. the Sociological school
d. the Analytical school
3) Proponents of which school(s) of jurisprudential thought are unlikely to adhere to precedent in
making decisions?
a. the Sociological school only
b. the Critical Legal Studies school only
c. both the Sociological school and the Critical Legal Studies school
d. neither the Sociological school nor the Critical Legal Studies school
4) Which of the following is most consistent with the Natural Law School of jurisprudence?
a. Law is based on moral and ethical principles of what are right, and it is the job of men
and women, through study, to discover what these principles are.
b. The law is a reflection of society, thus the law must change naturally as society
changes over time.
c. The laws of man are secondary to the laws of nature, and thus the laws of nature take
precedence whenever the laws of man are in conflict with the laws of nature.
d. By applying the rules of logic to specific cases, the logical, or natural, result will be
obtained.
e. Laws must first and foremost respect, preserve, and promote the preservation of the
environment and life in all its forms.
5) What was the only remedy (relief) available in the law courts of England?
a. specific performance
b. fines and imprisonment
c. monetary awards for damages
d. returning the parties to their positions before the dispute arose
3
Final Examination
BAM 317 Business Law
6) Which court was eventually combined with the regular court system?
a. law courts
b. equity courts
c. criminal courts
d. merchant courts
7) What is an equity court’s function?
a. To deal with just the law of merchants.
b. To issue opinions in cases that later set the precedent for similar cases.
c. To investigate the merits of a case and base its decisions on fairness.
d. To issue executive orders.
e. To set state or federal laws between two or more nations.
8) The ability of Native American Indians to conduct gambling operations on Indian reservations:
a. is determined solely by the respective Indian tribe
b. is determined through negotiation by the state and Native Americans
c.is within the control of the federal government because of provisions in the U.S. Consti-
tution
d. has been found by the courts, in many ins ...
Business Law Multiple Choice Questions (Enter your answers on th.docxhumphrieskalyn
Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
1) The court's decision in Brown v. Board of Education had what effect on the decision
made in Plessy v. Ferguson?
a. It showed that precedent can be overruled and is not binding in every situation.
b. It applied the Doctrine of Stare Decisis.
c. It showed that the Constitution is not subject to interpretation.
d. It applied the principle of preemption.
e. It followed precedent.
2) Someone who believes that law is a reflection of those in power, believes in which
school of jurisprudential thought?
a. The Analytical School.
b. The Natural School.
c. The Command School.
d. The Historical School.
e. The Psychological School.
3) Which of the following is a false statement regarding the citizenship and immigration
policy of the United States?
a. Immigration quotas are different for each foreign country.
b. The first immigration quota policy was enacted in the 1920s.
c. The immigration quota policy was repealed after World War II.
d. There is an immigration quota policy in effect today in the United States.
e. Immigration laws are administered and enforced by the United States Customs and
Immigration Service.
4) The remedy, or relief, that was available in the law courts of England was:
a. specific performance.
b. monetary awards for damages.
c. fines and imprisonment.
d. returning the parties to their positions before the dispute arose.
e. Any of the above, and any other remedy determined to be fair in the particular case.
5) Chancery Courts were also known as:
a. Criminal Courts.
b. Equity Courts.
c. Legal Remedy Courts.
d. Merchant Courts.
e. Law Courts.
64
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21496,0);(0,0);(0,21487);(21496,21487)posrelh0posrelv0pib
Business Law
65
6) When statutes are organized by topic, the resulting compilation of law is known as:
a. precedent.
b. a code.
c. civil law.
d. topical presentation.
e. common law.
7) Which of the following is not empowered to establish administrative agencies?
a. A state executive branch.
b. Congress.
c. A federal or state judicial branch.
d. A state legislative branch.
e. The federal executive branch.
8) For which of the following in the U.S. Congress can the number to which a state is
entitled change over time?
a. All members of the u.s. Congress.
b. Senators.
c. Both Senators and representatives.
d. Neither senators nor representatives.
e. Representatives.
9) The power of the federal government to make treaties with Native American Nations
regarding land and land use is derived from the:
a. Privileges and Immunities Clause.
b. Supremacy Clause.
c. First Amendment.
d. Commerce Clause.
e. Equal Protection Clause.
10) If there is an area of interstate commerce that the federal government has chosen not
to regulate, the states can:
a. not regulate in that area because states cannot pass laws affecting interstate com-
merce.
b. ...
BAM 521 Publisher Pearson Prentice Ha II Business Law .docxikirkton
BAM 521
Publisher:
Pearson Prentice Ha II
Business Law
Text: Contemporary Business and Online Commerce Law
Sixth Edition, 2009
ISBN: 10: 0-13-601500-X
Author(s):
Henry R. Cheeseman
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21498,0);(0,0);(0,21482);(21498,21482)posrelh0posrelv0pib
Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
1) The court's decision in Brown v. Board of Education had what effect on the decision
made in Plessy v. Ferguson?
a. It showed that precedent can be overruled and is not binding in every situation.
b. It applied the Doctrine of Stare Decisis.
c. It showed that the Constitution is not subject to interpretation.
d. It applied the principle of preemption.
e. It followed precedent.
2) Someone who believes that law is a reflection of those in power, believes in which
school of jurisprudential thought?
a. The Analytical School.
b. The Natural School.
c. The Command School.
d. The Historical School.
e. The Psychological School.
3) Which of the following is a false statement regarding the citizenship and immigration
policy of the United States?
a. Immigration quotas are different for each foreign country.
b. The first immigration quota policy was enacted in the 1920s.
c. The immigration quota policy was repealed after World War II.
d. There is an immigration quota policy in effect today in the United States.
e. Immigration laws are administered and enforced by the United States Customs and
Immigration Service.
4) The remedy, or relief, that was available in the law courts of England was:
a. specific performance.
b. monetary awards for damages.
c. fines and imprisonment.
d. returning the parties to their positions before the dispute arose.
e. Any of the above, and any other remedy determined to be fair in the particular case.
5) Chancery Courts were also known as:
a. Criminal Courts.
b. Equity Courts.
c. Legal Remedy Courts.
d. Merchant Courts.
e. Law Courts.
64
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21496,0);(0,0);(0,21482);(21496,21482)posrelh0posrelv0pib
Business Law
65
6) When statutes are organized by topic, the resulting compilation of law is known as:
a. precedent.
b. a code.
c. civil law.
d. topical presentation.
e. common law.
7) Which of the following is not empowered to establish administrative agencies?
a. A state executive branch.
b. Congress.
c. A federal or state judicial branch.
d. A state legislative branch.
e. The federal executive branch.
8) For which of the following in the U.S. Congress can the number to which a state is
entitled change over time?
a. All members of the U.S. Congress.
b. Senators.
c. Both Senators and representatives.
d. Neither senators nor representatives.
e. Representatives.
9) The power of the federal government to make treaties with Native American Nations
regarding land and land use is derived from the:
a. Privileges and Immunities Clause.
b. Sup ...
Running head TITLE 1TITLE 6TitleStudent Name.docxagnesdcarey33086
Running head: TITLE
1
TITLE
6
Title
Student Name
University Name
Title
1) When statutes are passed only after considerable study, debate and public input, this is an example of which function of the law?
A. Keeping the peace.
B. Shaping moral standards.
C. Maintaining the status quo.
D. Facilitating orderly change.
2) What was the U.S. Supreme Court’s reaction to a case where a business executive was found guilty of aiding and abetting in the bribery of an Internal Revenue Service Agent even though the Internal Revenue Service agent had been found not guilty of the bribery in a separate trial?
A. Because of the inconsistent outcomes, a third combined trial was ordered to reconcile the different outcomes.
B. This simply underscores the fact that there is always the possibility that different juries might reach different results in a given situation.
C. Because one of the defendants had been found guilty, then both should have been found guilty.
D. Because one of the defendants had been found not guilty, they both should have been found not guilty.
3) Which of the following is most consistent with the Natural Law School of jurisprudence?
A. The laws of man are secondary to the laws of nature, and thus the laws of nature take precedence whenever the laws of man are in conflict with the laws of nature.
B. By applying the rules of logic to specific cases, the logical, or natural, result will be obtained.
C. Law is based on moral and ethical principles of what is right, and it is the job of men and women, through study, to discover what these principles are.
D. The law is a reflection of society, thus the law must change naturally as society changes over time.
4) Which of the following statements is true regarding the relationship of law and ethics?
A. In some cases the law will require a higher standard of conduct than ethics, but never vice versa.
B. Depending on the circumstances, the law can require a higher, lower, or the same standard of conduct as ethics demands.
C. The legal requirements will almost always be the same as the ethical requirement because the law is based on the ethical standards.
D. In some cases ethics will require a higher standard of conduct than the law, but never vice versa.
5) Which of the following is correct with regard to the relationship between law and ethics?
A. Lawful conduct is always ethical conduct.
B. Although much of law is based on ethical standards, not all ethical standards have been enacted as law.
C. The rule of law and the golden rule of ethics demand the same response.
D. The law may not .permit something that would be ethically wrong.
6) Which of the following is not one of the Caux Round Table Principles for International Business?
A. Promotion of Multiculturalism.
B. Respect for the Environment.
C. Avoidance of Illicit Operations.
D. Support for Multilateral Trade.
7) In a civil case, which of the following is true about the order of the prese.
The document provides information about the US judiciary system through a series of multiple choice questions and explanations. It covers topics like the Supreme Court's jurisdiction, nomination process, criteria for accepting cases, amicus briefs, and the relative levels of activism of different Chief Justices. The Warren Court is identified as the most activist in expanding civil rights, while the Rehnquist Court advocated more judicial restraint. Critics of each approach favor courts that align with their views on the judiciary's role in policymaking.
060468 rr law and the judicial system assignmentshomeworkecrater
This document contains a 20-question multiple choice test on various aspects of law and the judicial system. The questions cover topics like alternative dispute resolution methods, civil procedure, jurisdiction, precedents, constitutional law, and more. Sample questions ask about the differences between mediation, arbitration and mediation-arbitration (med-arb); when a case can be removed from state to federal court; what provision of the Constitution citizen rights are found in; and what type of ADR would be well-suited to a dispute between a factory and environmental group.
The document discusses various approaches to resolving the problem of anarchy in the international system by strengthening the relationship between international and domestic law. It examines theories of how international law can be incorporated into municipal legal systems, such as dualism and monism. It also explores puzzles around standing, enforcement, and the roles of international courts and domestic courts in applying international agreements. Key debates evaluated include the practice in international courts, how international law is treated in municipal courts, and the sources and scope of authority for the International Court of Justice.
For more course tutorials visit
uophelp.com is now newtonhelp.com
www.newtonhelp.com
1) The form of alternative dispute resolution wherein the parties hire someone to review the evidence and make a decision that is binding upon the
parties is called
A. negotiation
B. settlement conference
C. conciliation
D. arbitration
2) The Federal Trade Commission is an example of
A. a federal agency created by the federal government
B. a corporation subsidized by the federal government
C. a branch of the U.S. Supreme Court
D. a temporary commission created by executive order that has become permanent
This document provides answers to 30 multiple choice questions covering various topics in business law, including alternative dispute resolution, federal agencies, jurisdiction, contracts, torts, employment law, and intellectual property. The questions assess understanding of key concepts and their appropriate applications.
Business Law Multiple Choice Questions (Enter your answers on th.docxhumphrieskalyn
Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
1) The court's decision in Brown v. Board of Education had what effect on the decision
made in Plessy v. Ferguson?
a. It showed that precedent can be overruled and is not binding in every situation.
b. It applied the Doctrine of Stare Decisis.
c. It showed that the Constitution is not subject to interpretation.
d. It applied the principle of preemption.
e. It followed precedent.
2) Someone who believes that law is a reflection of those in power, believes in which
school of jurisprudential thought?
a. The Analytical School.
b. The Natural School.
c. The Command School.
d. The Historical School.
e. The Psychological School.
3) Which of the following is a false statement regarding the citizenship and immigration
policy of the United States?
a. Immigration quotas are different for each foreign country.
b. The first immigration quota policy was enacted in the 1920s.
c. The immigration quota policy was repealed after World War II.
d. There is an immigration quota policy in effect today in the United States.
e. Immigration laws are administered and enforced by the United States Customs and
Immigration Service.
4) The remedy, or relief, that was available in the law courts of England was:
a. specific performance.
b. monetary awards for damages.
c. fines and imprisonment.
d. returning the parties to their positions before the dispute arose.
e. Any of the above, and any other remedy determined to be fair in the particular case.
5) Chancery Courts were also known as:
a. Criminal Courts.
b. Equity Courts.
c. Legal Remedy Courts.
d. Merchant Courts.
e. Law Courts.
64
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21496,0);(0,0);(0,21487);(21496,21487)posrelh0posrelv0pib
Business Law
65
6) When statutes are organized by topic, the resulting compilation of law is known as:
a. precedent.
b. a code.
c. civil law.
d. topical presentation.
e. common law.
7) Which of the following is not empowered to establish administrative agencies?
a. A state executive branch.
b. Congress.
c. A federal or state judicial branch.
d. A state legislative branch.
e. The federal executive branch.
8) For which of the following in the U.S. Congress can the number to which a state is
entitled change over time?
a. All members of the u.s. Congress.
b. Senators.
c. Both Senators and representatives.
d. Neither senators nor representatives.
e. Representatives.
9) The power of the federal government to make treaties with Native American Nations
regarding land and land use is derived from the:
a. Privileges and Immunities Clause.
b. Supremacy Clause.
c. First Amendment.
d. Commerce Clause.
e. Equal Protection Clause.
10) If there is an area of interstate commerce that the federal government has chosen not
to regulate, the states can:
a. not regulate in that area because states cannot pass laws affecting interstate com-
merce.
b. ...
BAM 521 Publisher Pearson Prentice Ha II Business Law .docxikirkton
BAM 521
Publisher:
Pearson Prentice Ha II
Business Law
Text: Contemporary Business and Online Commerce Law
Sixth Edition, 2009
ISBN: 10: 0-13-601500-X
Author(s):
Henry R. Cheeseman
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21498,0);(0,0);(0,21482);(21498,21482)posrelh0posrelv0pib
Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
1) The court's decision in Brown v. Board of Education had what effect on the decision
made in Plessy v. Ferguson?
a. It showed that precedent can be overruled and is not binding in every situation.
b. It applied the Doctrine of Stare Decisis.
c. It showed that the Constitution is not subject to interpretation.
d. It applied the principle of preemption.
e. It followed precedent.
2) Someone who believes that law is a reflection of those in power, believes in which
school of jurisprudential thought?
a. The Analytical School.
b. The Natural School.
c. The Command School.
d. The Historical School.
e. The Psychological School.
3) Which of the following is a false statement regarding the citizenship and immigration
policy of the United States?
a. Immigration quotas are different for each foreign country.
b. The first immigration quota policy was enacted in the 1920s.
c. The immigration quota policy was repealed after World War II.
d. There is an immigration quota policy in effect today in the United States.
e. Immigration laws are administered and enforced by the United States Customs and
Immigration Service.
4) The remedy, or relief, that was available in the law courts of England was:
a. specific performance.
b. monetary awards for damages.
c. fines and imprisonment.
d. returning the parties to their positions before the dispute arose.
e. Any of the above, and any other remedy determined to be fair in the particular case.
5) Chancery Courts were also known as:
a. Criminal Courts.
b. Equity Courts.
c. Legal Remedy Courts.
d. Merchant Courts.
e. Law Courts.
64
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21496,0);(0,0);(0,21482);(21496,21482)posrelh0posrelv0pib
Business Law
65
6) When statutes are organized by topic, the resulting compilation of law is known as:
a. precedent.
b. a code.
c. civil law.
d. topical presentation.
e. common law.
7) Which of the following is not empowered to establish administrative agencies?
a. A state executive branch.
b. Congress.
c. A federal or state judicial branch.
d. A state legislative branch.
e. The federal executive branch.
8) For which of the following in the U.S. Congress can the number to which a state is
entitled change over time?
a. All members of the U.S. Congress.
b. Senators.
c. Both Senators and representatives.
d. Neither senators nor representatives.
e. Representatives.
9) The power of the federal government to make treaties with Native American Nations
regarding land and land use is derived from the:
a. Privileges and Immunities Clause.
b. Sup ...
Running head TITLE 1TITLE 6TitleStudent Name.docxagnesdcarey33086
Running head: TITLE
1
TITLE
6
Title
Student Name
University Name
Title
1) When statutes are passed only after considerable study, debate and public input, this is an example of which function of the law?
A. Keeping the peace.
B. Shaping moral standards.
C. Maintaining the status quo.
D. Facilitating orderly change.
2) What was the U.S. Supreme Court’s reaction to a case where a business executive was found guilty of aiding and abetting in the bribery of an Internal Revenue Service Agent even though the Internal Revenue Service agent had been found not guilty of the bribery in a separate trial?
A. Because of the inconsistent outcomes, a third combined trial was ordered to reconcile the different outcomes.
B. This simply underscores the fact that there is always the possibility that different juries might reach different results in a given situation.
C. Because one of the defendants had been found guilty, then both should have been found guilty.
D. Because one of the defendants had been found not guilty, they both should have been found not guilty.
3) Which of the following is most consistent with the Natural Law School of jurisprudence?
A. The laws of man are secondary to the laws of nature, and thus the laws of nature take precedence whenever the laws of man are in conflict with the laws of nature.
B. By applying the rules of logic to specific cases, the logical, or natural, result will be obtained.
C. Law is based on moral and ethical principles of what is right, and it is the job of men and women, through study, to discover what these principles are.
D. The law is a reflection of society, thus the law must change naturally as society changes over time.
4) Which of the following statements is true regarding the relationship of law and ethics?
A. In some cases the law will require a higher standard of conduct than ethics, but never vice versa.
B. Depending on the circumstances, the law can require a higher, lower, or the same standard of conduct as ethics demands.
C. The legal requirements will almost always be the same as the ethical requirement because the law is based on the ethical standards.
D. In some cases ethics will require a higher standard of conduct than the law, but never vice versa.
5) Which of the following is correct with regard to the relationship between law and ethics?
A. Lawful conduct is always ethical conduct.
B. Although much of law is based on ethical standards, not all ethical standards have been enacted as law.
C. The rule of law and the golden rule of ethics demand the same response.
D. The law may not .permit something that would be ethically wrong.
6) Which of the following is not one of the Caux Round Table Principles for International Business?
A. Promotion of Multiculturalism.
B. Respect for the Environment.
C. Avoidance of Illicit Operations.
D. Support for Multilateral Trade.
7) In a civil case, which of the following is true about the order of the prese.
The document provides information about the US judiciary system through a series of multiple choice questions and explanations. It covers topics like the Supreme Court's jurisdiction, nomination process, criteria for accepting cases, amicus briefs, and the relative levels of activism of different Chief Justices. The Warren Court is identified as the most activist in expanding civil rights, while the Rehnquist Court advocated more judicial restraint. Critics of each approach favor courts that align with their views on the judiciary's role in policymaking.
060468 rr law and the judicial system assignmentshomeworkecrater
This document contains a 20-question multiple choice test on various aspects of law and the judicial system. The questions cover topics like alternative dispute resolution methods, civil procedure, jurisdiction, precedents, constitutional law, and more. Sample questions ask about the differences between mediation, arbitration and mediation-arbitration (med-arb); when a case can be removed from state to federal court; what provision of the Constitution citizen rights are found in; and what type of ADR would be well-suited to a dispute between a factory and environmental group.
The document discusses various approaches to resolving the problem of anarchy in the international system by strengthening the relationship between international and domestic law. It examines theories of how international law can be incorporated into municipal legal systems, such as dualism and monism. It also explores puzzles around standing, enforcement, and the roles of international courts and domestic courts in applying international agreements. Key debates evaluated include the practice in international courts, how international law is treated in municipal courts, and the sources and scope of authority for the International Court of Justice.
For more course tutorials visit
uophelp.com is now newtonhelp.com
www.newtonhelp.com
1) The form of alternative dispute resolution wherein the parties hire someone to review the evidence and make a decision that is binding upon the
parties is called
A. negotiation
B. settlement conference
C. conciliation
D. arbitration
2) The Federal Trade Commission is an example of
A. a federal agency created by the federal government
B. a corporation subsidized by the federal government
C. a branch of the U.S. Supreme Court
D. a temporary commission created by executive order that has become permanent
This document provides answers to 30 multiple choice questions covering various topics in business law, including alternative dispute resolution, federal agencies, jurisdiction, contracts, torts, employment law, and intellectual property. The questions assess understanding of key concepts and their appropriate applications.
For more classes visit
www.snaptutorial.com
This Tutorial contains 2 Set of Final Exam Part 2 (All Questions Listed Below)
BUS 407 Final Exam Part 2
Question 1 Which kind of analysis compares the monetary cost of training with the intangible or nonmonetary results?
Question 2 According to the text, which of the following groups would be interested in “process evaluation” data?
BAM 521 Sixth Edition, 2009 ISBN 10 013-601500-X Busine.docxikirkton
BAM 521
Sixth Edition, 2009
ISBN: 10 013-601500-X
Business Law
Text: Contemporary Business and Online Commerce Law
Author(s):
Henry R Cheeseman
Publisher:
Pearson Prentice Hal
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21499,0);(0,0);(0,21487);(21499,21487)posrelh0posrelv0pib
a.
Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
~The courts decision in Brown v. Board of Education had what effect on the decision
L/ made in Plessy v. Ferguson?
b. It showed that precedent can be overruled and IS not binding in every situation.
c. It applied the Doctrine of Stare Decisis
d. It showed that the Constitution IS not subject to interpretation
e. It applied the principle of preemption
f. It followed precedent.
2) Someone who believes that law is a reflect on of those in power, believes in which
school of jurisprudential thought?
a. The Analytical School.
b. The Natural School.
c. The Command School.
d. The Historical School
e. The Psychological Schoo
1'1\ hich of the following is a false statement regarding the citizenship and immigration
~liCY of the United States?
a. Immigration quotas are different for each foreign country.
b. The first immigration quota policy was enacted in the 1920s.
c. The immigration quota policy was repealed after World War II.
d. There is an immigration quota policy in effect today In the United States.
e. Immigration laws are administered and enforced by the United States Customs and
Immigration Service.
4) The remedy, orelief that was available In the law courts of England was:
a. specific performance.
b. monetary awards for damages.
c. fines and imprisonment.
d. returning the parties to their positions before the dispute arose.
e. Any of the above, and any other remedy determined to be fair in the particular case.
5) Chancery Courts were also known as:
a. Criminal Courts
b. Equity Courts.
c. Legal Remedy Courts.
d. Merchant Courts.
e. Law Courts.
b4
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21500,0);(0,0);(0,21493);(21500,21493)posrelh0posrelv0pib
{1
Business
Law
65
6) When statutes are organized by tOPIC the
resulting compilation of law is known as:
a. precedent.
b. a code
c. civil law.
d. topical presentation
e. common law.
7) Which of the following IS not empowered to establish administrative agencies?
a. A state executive branch.
b. Concress
c. A federal or state judicial branch
d. A state leoislative branch.
e. The federal executive branch.
~ For which of the following in the U.S. Congress can the number to which a state is
~ entitled change over time?
a. All members of the U S. Congress.
b. Senators.
c. Both Senators and representatives.
d. Neither senators nor representatives
e. Representatives.
foi~he power of the federal government to make treaties with Native American Nations
~egarding land and land use s derived from the:
a. Privileqes and Immunities Clause.
b. Supremacy Clause.
...
click on the link, you will find what you were looking for:homeworkmye.com
Customer support is very important to us. Please use our online chat system in case you have any questions. Also, you can email them to us at homeworkmye@gmail.com. We will do our best to answer you!
Assignment 4BAnswer SheetPlease post the completed answer sh.docxssuser562afc1
Assignment 4B
Answer Sheet
Please post the completed answer sheet as an attachment through the Assignments section.
YOUR NAME:
Question
Number
Your Answer (Letter Only)
Question Number
Your Answer (Letter Only)
Question Number
Your Answer (Letter Only)
1
31
61
2
32
62
3
33
63
4
34
64
5
35
65
6
36
7
37
8
38
9
39
10
40
11
41
12
42
13
43
14
44
15
45
16
46
17
47
18
48
19
49
20
50
21
51
22
52
23
53
24
54
25
55
26
56
27
57
28
58
29
59
30
60
Assignment 4B
Use the answer sheet to respond to the following questions. When completed, post your answer
sheet as an attachment through the Assignments section. There is one correct answer per
question, and each answer is worth two points.
Example:
Which amendment protects against unreasonable searches and seizures?
a) First Amendment
b) Fourth Amendment
c) Fifth Amendment
d) Sixth Amendment
e) None of the above.
The correct answer is "B," so you would enter "B" on the answer sheet for this assignment. One
point would be awarded for this question as the question was answered correctly.
1. The prosecutor's discretion in determining which cases to prosecute impacts what laws the
police choose to focus on and enforce.
a) True
b) False
2. According to the text, an important role played by the victim is
a. to humanize the impact of crime.
b. to offer unbiased, reliable testimony.
c. to point out inconsistencies in the defense.
d. to pressure the jury to find the defendant guilty.
e. none of the above.
3. When making decisions in the courtroom, judges
a) must refrain from seeking the advice of others in order to protect the rights of the
accused.
b) rely on prosecutors and defense attorneys during essentially every phase of the trial.
c) typically disregard information from other judges as each case is different.
d) have little discretion in most decisions affecting cases.
e) none of the above.
4. The police chief implements the use of a drug courier profile for his department. Using the
profile, officers focus on their attention on stopping and searching cars with Florida license
plates. After a month, the chief reviews the statistics and finds that, indeed, most of the drug
arrests for the month were of drivers of cars with Florida license plates. According to the text,
this is an example of:
a. racial profiling.
b. self-fulfilling prophecy.
c. differential policing.
d. targeted enforcement.
e. none of the above.
5. Which of the following is not a white collar crime?
a. A stockbroker manipulates the price of a stock.
b. A car company sells vehicles it knows have a faulty brake system.
c. A manufacturing plant dumps toxic waste into a local creek.
d. A businessman shoplifts a tie from a prestige clothing store.
e. None of the above.
6. A subpoe ...
BAM 521 Publisher Pearson Prentice Hal, Business Law .docxikirkton
BAM 521
Publisher:
Pearson Prentice Hal,
Business Law
Text: Contemporary Business and Online Commerce Law
Sixth Edition, 2009
ISBN: 10 013-601500-X
Author(s):
Henry R Cheeseman
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21497,0);(0,0);(0,21487);(21497,21487)posrelh0posrelv0pib
a.
Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
~The court's decision in Brown v. Board of Education had what effect on the decision
~ made in Plessy v. Ferguson?
b. It showed that precedent can be overruled and IS not binding in every situation.
c. It applied the Doctrine of Stare Decisis
d. It showed that the Constitution IS not subject to interpretation.
e. It applied the principle of preemption
f. It followed precedent.
2) Someone who believes that law is a reflect on of those in power, believes in which
school of jurisprudential thought?
a, The Analytical School.
b. The Natural School.
c. The Command School.
d. The Historical School
e. The Psychological School
(""hiCh of the following is a false statement regarding the citizenship and immigration
~liCY of the United States?
a. Immigration quotas are different for each foreign country.
b. The first immigration quota policy was enacted in the 1920s.
c. The immigration quota policy was repealed after World War II.
d. There is an immigration quota policy in effect today In the United States.
e. Immigration laws are administered and enforced by the United States Customs and
Immigration Service.
4) The remedy, or relief that was available in the law courts of England was:
a. specific performance.
b. monetary awards for damages.
c. fines and imprisonment.
d. returning the parties to their positions before the dispute arose.
e. Any of the above, and any other remedy determined to be fair in the particular case.
5) Chancery Courts were also known as:
a. Criminal Courts
b. Equity Courts.
c. Legal Remedy Courts.
d. Merchant Courts.
e. Law Courts.
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21500,0);(0,0);(0,21493);(21500,21493)posrelh0posrelv0pib
P'
'Business
Law
65
6) When statutes are organized by topic the
resulting compilation of law is known as:
a. precedent.
b. a code.
c. civil law.
d. topical presentation
e. common law.
7) Which of the following IS not empowered to establish administrative agencies?
a. A state executive branch.
b. Concress.
c. A federal or state judicial branch
d. A state leoislative branch.
e. The federal executive branch.
f7:J For which of the following in the U.S. Congress can the number to which a state is
~ entitled change over time?
a. All members of the U.S. Congress.
b. Senators.
c. Both Senators and representatives.
d. Neither senators nor representatives
e. Representatives.
Ia? ~e power of the federal government to make treaties with Native American Nations
L/r~~arding land and land use IS derived from the:
a. Privileces and Immunities Clause.
b. Supremacy C ...
Andre is in 11th grade at his local public high school. He wants t.docxjustine1simpson78276
Andre is in 11th grade at his local public high school. He wants to take the school’s ballet class as one of his required electives but the school only allows girls to enroll in the class. Andre sues under the 14th Amendment. How will a court determine the result?
a. The court will apply strict scrutiny and the school will have to demonstrate that the rule is necessary to promote a compelling state interest
b. The court will apply intermediate scrutiny and the school will have to demonstrate that the rule is rationally related to a legitimate goal
c. The court will apply minimal scrutiny and the school will have to demonstrate that the rule is substantially related to an important government interest
d. The court will apply intermediate scrutiny and the school will have to demonstrate that the rule is substantially related to an important government interest
Marcel is picnicking in a crowded local park. He decides he would be more comfortable naked, so takes off all his clothes. He can only enjoy a few more bites of his lunch before he is arrested for violating city ordinances about public nudity. Marcel sues. If the court finds that Marcel’s actions do not warrant First Amendment protection, it is probably because:
a. His nudity was not intended to convey a particularized message.
b. There were children at the park.
c. He was not speaking while he was naked.
d. The Federal government does not regulate this issue, so state law controls.
Eloise plans to build an addition on her house that she will operate as a bed and breakfast. The town rejects her plans, on the grounds that she must first obtain an expensive commercial building permit. Eloise argues that she is just modifying her own residence that she owned the residence before the commercial permit legislation was passed, and therefore does not need the expensive permit. At the court hearing on her case, the town mayor serves as judge. This is:
a. proper procedural due process, because Eloise has a chance to be heard
b. a violation of the Commerce Clause
c. a violation of procedural due process requirements
d. a violation of substantive due process requirements
To protect Native Americans, the Federal government passes a law prohibiting their taxation. Oklahoma amends its own tax law, adding a small tax on Native Americans. Is the Oklahoma law constitutional?
a. No, the statute violates the Supremacy Clause.
b. Yes, police powers are reserved for the states.
c. Yes, because Congress does not have authority over state taxes.
d. No, the statute violates the dormant Commerce Clause.
You begin work at Everhappy Corp. at the beginning of November. On your second day at work, you wear a political button on your coat, supporting your choice for governor in the upcoming election. Your boss glances at it and says, “Get that stupid thing out of this office or you’re history.” You protest that his statement violates your constitutional r.
The primary purpose of a mediator is to facilitate settlement of a.docxssusera34210
The primary purpose of a mediator is to facilitate settlement of a dispute between the parties.
True
False
The two most common types of bankruptcy filed by business are a reorganization bankruptcy and a liquidating bankruptcy.
True
False
Section 402A of the Uniform Commercial Code governs the law of Strict Liability in a commercial setting.
True
False
Which of the following types of law are intended specifically to provide a system of compensation for injuries done by virtue of conduct deemed by the law to be inappropriate?
A) Substantive Law
B) Criminal Law
C) Procedural Law
D) Civil Law
The three primary theories of Product Liability are tortuous negligence, strict liability and contract warranty.
True
False
Burglary is the crime of stealing something from somebody.s house or building at night.
True
False
Litigation involving criminal law are typically initiated by legal counsel for the victim of the crime.
True
False
An automatic stay is in force upon filing of a bankruptcy and acts to stop a creditor from repossessing any collateral.
True
False
Courts represent the primary mechanism for the enforcement of law in the United States.
True
False
The concept of .observing corporate formalities. relates to failure to observe GAAP when reporting profit and loss to the Securities and Exchange Commission.
True
False
Baseball is specifically exempted from coverage under the Sherman Act, but not so with regard to Football.
True
False
Which of the following is not one of the general categories of torts?
A) Strict liability
C) Conversion
C) Negligence
D) Intentional.
The law of contracts in most states is entirely a matter of Common Law.
True
False
What differs in a defamation suit when the plaintiff is a public figure, as opposed to when the plaintiff is not a public figure?
A) The plaintiff need not prove actual injury to the reputation.-
B) The plaintiff can recover even when the statement is a mere opinion
C) The plaintiff must prove that the statement was made with malice
D) The plaintiff must prove that the statement was made in writing.
Laws of the United States are enforceable within foreign countries so long as United States companies or citizens are involved as one of the parties.
True
False
Any case in the United States may be automatically appealed directly to the United States Supreme Court if one of the litigants is unsatisfied with the outcome; the Supreme Court always has the final say in any litigation in the country.
True
False
C Corporations and S Corporations technically differ only with regard to the treatment of their net income with regard to sales taxation as administered by the International Revenue Service.
True
False
Which of the following terms pertains to the admission of evidence at a trial:
A) Eminent Domain
B) Full Faith and Credit
C) Probative Value
D) Revocation of Offer
Administrative Agencies often establish regulations pursuant to the legislative power de ...
The document provides information about the structure and purpose of the US judicial system. It discusses that the Supreme Court interprets laws and their constitutionality, and is appointed by the President and approved by the Senate. Two influential Supreme Court cases were discussed - Dred Scott v Sandford which upheld slavery and Brown v Board of Education which outlawed public school segregation. The President and Senate provide checks on the Supreme Court through judicial appointments. Lower federal courts were established by Congress and state courts by state governments.
Introduction to Law Final Exam Instructions Instructor .docxnormanibarber20063
Introduction to Law
Final Exam Instructions
Instructor: A. Jarmon
Final Exam
Page 1
EXAM DATE/TIME SELECTION-ONLY (1) OPTION
There are no re-take options. Your final exam is due Saturday, March 19, 2016 at 12:00 noon
via Canvas. It must be submitted via Canvas. I will not accept exams that are sent to me via
email.
PERMISSIBLE EXAM MATERIALS
This final exam is “open-book/open-notes.” While this exam is “open-book/open-notes,” it is not
group work. Each student is expected to independently complete and submit his/her exam. Any
appearance of plagiarism or similarity in submissions will automatically result in a zero
submitted for each submission. Submissions subject to a zero under this provision are not
eligible for re-take.
CONTENT DESCRIPTION OF FINAL EXAM
This exam is comprehensive. You are being evaluated on your understanding of the legal
principles and theories covered through the course, as well as your ability to apply those
principles and theories to various fact patterns or scenarios.
EXAM-POINT VALUE
This exam is worth 150 points.
Introduction to Law
Final Exam Instructions
Instructor: A. Jarmon
Final Exam
Page 2
SECTION I
The following True/False and Multiple Choice questions cover the material
introduced in Chapters 1-2; 4, 6, and 7-8. Each question is worth two (2) points.
Please indicate (T) for True or (F) for False for the True/False Statements. For
Multiple Choice, please select the letter that corresponds to the best response.
There are 50 questions in this section. This section is worth 50 points.
A. LEGAL SYTSTEM, COURTS, AND LEGISLATION
1. All but which of the following are examples of special courts in the federal
system:
a. U.S. Tax Court
b. U.S. Bankruptcy Court
c. U.S. Court of Federal Claims
d. Pierce County Superior Court
e. U.S. Court of Appeals for the Armed Forces
2. Which of the following statements IS NOT true as it relates to the authority
of the U.S. Supreme Court?
a. The U.S. Supreme Court is the final authority on all matters of federal
jurisdiction.
b. The primary function of the Supreme Court is one of review.
c. The key element in the Supreme Court’s authority is that a federal
issue must be at stake, either in the form of the parties (diversity
jurisdiction) or in the constitutionality of a state or federal law.
d. Every case may be submitted to the United States Supreme Court for
review.
e. All of the above statements are true.
3. Judicial review refers to the system by which each branch of government
can use its specially designated powers to make sure the other branches act
within their constitutionally prescribed limits.
4. The principle of stare decisis precludes the court from correcting erroneous
decisions that were previously issued.
Introduction to Law
Final Exam Instructions
Instructor: A. Jarmon
Final Exam
Page 3
B. INTRODUCTION TO CI.
Assignment 3 Ethics and Social Responsibility in Busine.docxaryan532920
Assignment 3: Ethics and Social Responsibility in Business Assignment
In this Assignment you will read the Cengage® Case Study: “Barclays Bank: Banking
on Ethics” and then respond to the checklist items in a critical essay based on the
scenario below.
Assignment Scenario:
As a new marketing associate with Barclays Bank, you are tasked with writing a critical
essay summarizing what transpired during the investigation conducted by the United
States Department of Justice into the abuse of the London Interbank Offered Rate
(LIBOR) interest rate regulated by the British Banker’s Administration. This essay, if
chosen by your new employer, will be the report presented to the Board of Directors.
Write a 2–3 page, (not including a title and references page), double-spaced, critical essay
responding to the checklist items. For assistance with your Assignment, please use your
textbook and library research resources. The instructions for you to execute this task are
as follows:
Directions for completing this Assignment:
1. Read the “Barclays Bank: Banking on Ethics” case study: Click Here
2. Learn how to write a critical essay: Click Here
3. Use APA format and citation style, provide a title page and references, and do not forget
to use in-text citations with their accompanying references so as to avoid plagiarism.
4. In your critical essay that includes your thesis, arguments, support, and conclusion,
respond to the following:
Checklist:
● Describe the level of ethical development the executives at Barclays demonstrated
when manipulating the LIBOR interest rates.
● Did Barclays Bank neglect social responsibility? What could they have done to be
more socially responsible?
● What actions regarding Corporate Social Responsibility (CSR) could Barclays have
engaged in after the scandal broke to set things right and ensure that such an event
would not happen again?
● Describe what level of morality would have been demonstrated if executives at
Barclays asked themselves, “Even though manipulating the LIBOR will increase
company profits, is it the right thing to do in the long run?”
● Explain the importance of ethics and social responsibility in marketing as a result of
your case study analysis.
http://extmedia.kaplan.edu/business/AB219/1501B/U3/Unit3_BarkleyStudy.pdf
http://extmedia.kaplan.edu/business/AB219/1501B/U3/Unit3_BarkleyStudy.pdf
http://extmedia.kaplan.edu/business/AB219/1403C/Assignment/U2/BarkleyStudy.pdf
http://extmedia.kaplan.edu/business/AB219/1501B/U3/Critical_Essay.pdf
Directions for Submitting this Assignment:
Review the grading rubric below before beginning this activity. For additional help with
your writing and APA citation, please visit the Kaplan University Writing Center accessed
in the home area of this course. Compose your Assignment as a Microsoft Word document
and save it as (Example: TAllen-MT219 Assignment-Unit 3.docx). Submit your file by
sel ...
1) The document outlines an arbitration clause referring disputes to the International Court of Arbitration of the International Chamber of Commerce to be settled under the ICC Rules of Arbitration.
2) The arbitration will take place in the named place, and the language will be both Chinese and English with acceptance of documents in English.
3) Key elements that must be included are the specific arbitration court, the rules that will be followed, designation of the place, and how the arbitrator will be selected. Failure to properly name the court or rules could invalidate the clause.
The document discusses the structure and jurisdiction of the U.S. federal court system. It outlines the dual court system of federal and state courts. It describes the different levels and types of federal courts, including the Supreme Court, appellate courts, district courts, and specialized courts. It also covers the appointment of judges, their terms, and types of jurisdiction that federal courts have.
The document discusses the U.S. court system, including state and federal structures. It explains that state courts have general jurisdiction over most cases within a state, while federal courts have more limited jurisdiction, primarily over federal questions and diversity cases. It also distinguishes between law and equity, noting that law aims for stability and damages, while equity promotes fairness through remedies like decrees.
South Western Federal Taxation 2011 Comprehensive 34th Edition Hoffman Test BankHoganner
Full download : http://alibabadownload.com/product/south-western-federal-taxation-2011-comprehensive-34th-edition-hoffman-test-bank/ South Western Federal Taxation 2011 Comprehensive 34th Edition Hoffman Test Bank
8) The process of critical legal thinking includes which of the fo.docxssuser774ad41
8) The process of critical legal thinking includes which of the following?
a.
A judge must specify the issue presented by the case.
b.
A judge must identify the applicable law for the case.
c.
A judge must identify the key facts in the case.
d.
A judge must apply the law to the facts to come to a conclusion that answers the issue presented.
All the above involve the process of critical legal thinking
20)
Which of the following is an example of concurrent jurisdiction shared by federal and state courts?
a.
Copyrights and trademarks.
b.
Bankruptcy.
c.
Federal questions.
d.
Patents.
e.
None of the above, each is considered exclusive federal jurisdiction.
21)
There will never be a dissenting opinion filed when the U.S. Supreme Court has issued atn).
a.
majority opinion.
b.
opinion written by the Chief Justice.
c.
unanimous opinion.
d.
tie opinion.
e.
plurality opinion.
23)
When parties to a contract agree upon which state court will have jurisdiction should litigation become necessary, that contract clause is called a:
a.
choice-of-law clause.
b.
jurisdiction selection clause.
c.
standings clause.
d.
venue selection clause.
e.
forum-selection clause.
25) Which of the following are in the proper order from first to last filed?
a.
Reply; cross-complaint; answer; complaint.
b.
Answer; complaint; reply; cross-complaint.
c.
Complaint; answer; cross-complaint; reply.
d.
Complaint; cross-complaint; reply; answer.
e.
Complaint; reply; cross-complaint; answer.
30)
Which of the following is an example of an executive power granted to an administrative agency?
a.
The power to investigate a violation of a statute or administrative rule.
b.
The responsibility to determine licensing requirements for pharmacists.
c.
The right to issue an interpretive rule.
d.
The right to adjudicate a case through an administrative proceeding.
e.
The right to issue a substantive rule.
34)
In Wilhelm v. Flores, involving a death from bee stings, which of the following sets forth the ruling of the Court of Appeals as to whether a defendant who hires a person to work with bees can be held liable for the failure to warn of the dangers involved?
a.
A defendant who had knowledge of the dangers of working with bees can be held liable on a negligence basis for the failure to warn of some dangers, but the danger of anaphylactic shock is too remote for there to be a danger to warn about that.
b.
There is no liability for negligence when the unpredictability of animals, birds or bees is involved.
c.
Liability would only exist if the defendant was aware that the plaintiff knew nothing about bees and intentionally kept the dangers a secret.
d.
There could be no liability whatsoever since it is assumed that if a person agrees to work with bees, they are aware of the dangers.
e.
A defendant who has knowledge of the dangers of working with bees can be held liable on a negligence basis for the failure to warn of da.
The document provides an overview of the US federal court system. It discusses that the Constitution created the Supreme Court and gave Congress the power to establish lower federal courts. It describes the structure of the federal court system, including the district courts, courts of appeals, and other constitutional courts. It also covers the jurisdiction of these courts, the appointment and roles of federal judges, and how cases make their way to the Supreme Court.
5Final ExaminationBCJ 240 Procedures in the Justice Sy.docxalinainglis
5
Final Examination
BCJ 240 Procedures in the Justice System
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
Typically, the lowest-level court(s) in a given state is/are: 1.
courts of general jurisdiction.a.
the state supreme court.b.
intermediate appellate courts.c.
courts of limited jurisdiction. d.
Each state has its own highest court, typically referred to as: 2.
superior courts.a.
intermediate appellate courts.b.
state supreme courts.c.
courts of limited jurisdiction. d.
At the federal level, the lowest-level trial court is referred to as: 3.
U.S. Supreme Court.a.
U. S. courts of appeals.b.
district courts.c.
trial courts. d.
When an appellate court reverses a lower court’s decision, it: 4.
nullifies or sets aside a trial verdict. a.
adjudicates the case.b.
sends the case to a higher court for reviewc.
sets the defendant free.d.
When an appellate court agrees with a lower court’s decision, it _____ that decision. 5.
reversesa.
affirmsb.
remandsc.
vacates d.
In order for a case to reach the Supreme Court, the court must decide whether it wants to 6.
hear the case. If the Supreme Court agrees that case is worth deciding, it issues what is
known as a:
lex loci.a.
jus cogens.b.
certiorari.c.
writ of certiorari.d.
6
Final Examination
BCJ 240 Procedures in the Justice System
Which of the following is NOT a reason a “bright-line” decision may be helpful? 7.
It promotes consistency.a.
It promotes clarity and predictability.b.
It is ambiguous. c.
It is subject to very little interpretation. d.
Police conduct that is considered reasonable by the police officer engaged in the conduct is 8.
referred to as:
subjective reasonableness.a.
objective reasonableness.b.
reasonable objectiveness.c.
unreasonable objectiveness. d.
The term “objective reasonableness” in criminal procedure refers to: 9.
what a single individual believes is reasonable.a.
what a reasonable person believes is reasonable.b.
what a jury believes is reasonable.c.
what a reasonable person would do or feel under the circumstances. d.
Judicial restraint refers to: 10.
limiting decisions to the facts of each case.a.
deciding cases based on additional, hypothetical situations.b.
interpreting complex legal issues.c.
relying on case law to determine outcomes. d.
The past Supreme Court requirement that a physical intrusion by authorities must have taken 11.
place to violate one’s privacy is referred to as the:
electronic communication protection doctrine.a.
privacy doctrine.b.
trespass doctrine.c.
physical protection doctrine. d.
7
Final Examination
BCJ 240 Procedures in the Justice System
In the Section 1983 context, the requirement that the plaintiff (i.e., the party suing) 12.
generally has to prove that the defendant officer intended for the violation to occur is
referred to as
liabilitya.
credibilityb.
accountability c.
culpability d.
.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
More Related Content
Similar to Final Examination2BAM 317 Business LawMultiple Cho.docx
For more classes visit
www.snaptutorial.com
This Tutorial contains 2 Set of Final Exam Part 2 (All Questions Listed Below)
BUS 407 Final Exam Part 2
Question 1 Which kind of analysis compares the monetary cost of training with the intangible or nonmonetary results?
Question 2 According to the text, which of the following groups would be interested in “process evaluation” data?
BAM 521 Sixth Edition, 2009 ISBN 10 013-601500-X Busine.docxikirkton
BAM 521
Sixth Edition, 2009
ISBN: 10 013-601500-X
Business Law
Text: Contemporary Business and Online Commerce Law
Author(s):
Henry R Cheeseman
Publisher:
Pearson Prentice Hal
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21499,0);(0,0);(0,21487);(21499,21487)posrelh0posrelv0pib
a.
Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
~The courts decision in Brown v. Board of Education had what effect on the decision
L/ made in Plessy v. Ferguson?
b. It showed that precedent can be overruled and IS not binding in every situation.
c. It applied the Doctrine of Stare Decisis
d. It showed that the Constitution IS not subject to interpretation
e. It applied the principle of preemption
f. It followed precedent.
2) Someone who believes that law is a reflect on of those in power, believes in which
school of jurisprudential thought?
a. The Analytical School.
b. The Natural School.
c. The Command School.
d. The Historical School
e. The Psychological Schoo
1'1\ hich of the following is a false statement regarding the citizenship and immigration
~liCY of the United States?
a. Immigration quotas are different for each foreign country.
b. The first immigration quota policy was enacted in the 1920s.
c. The immigration quota policy was repealed after World War II.
d. There is an immigration quota policy in effect today In the United States.
e. Immigration laws are administered and enforced by the United States Customs and
Immigration Service.
4) The remedy, orelief that was available In the law courts of England was:
a. specific performance.
b. monetary awards for damages.
c. fines and imprisonment.
d. returning the parties to their positions before the dispute arose.
e. Any of the above, and any other remedy determined to be fair in the particular case.
5) Chancery Courts were also known as:
a. Criminal Courts
b. Equity Courts.
c. Legal Remedy Courts.
d. Merchant Courts.
e. Law Courts.
b4
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21500,0);(0,0);(0,21493);(21500,21493)posrelh0posrelv0pib
{1
Business
Law
65
6) When statutes are organized by tOPIC the
resulting compilation of law is known as:
a. precedent.
b. a code
c. civil law.
d. topical presentation
e. common law.
7) Which of the following IS not empowered to establish administrative agencies?
a. A state executive branch.
b. Concress
c. A federal or state judicial branch
d. A state leoislative branch.
e. The federal executive branch.
~ For which of the following in the U.S. Congress can the number to which a state is
~ entitled change over time?
a. All members of the U S. Congress.
b. Senators.
c. Both Senators and representatives.
d. Neither senators nor representatives
e. Representatives.
foi~he power of the federal government to make treaties with Native American Nations
~egarding land and land use s derived from the:
a. Privileqes and Immunities Clause.
b. Supremacy Clause.
...
click on the link, you will find what you were looking for:homeworkmye.com
Customer support is very important to us. Please use our online chat system in case you have any questions. Also, you can email them to us at homeworkmye@gmail.com. We will do our best to answer you!
Assignment 4BAnswer SheetPlease post the completed answer sh.docxssuser562afc1
Assignment 4B
Answer Sheet
Please post the completed answer sheet as an attachment through the Assignments section.
YOUR NAME:
Question
Number
Your Answer (Letter Only)
Question Number
Your Answer (Letter Only)
Question Number
Your Answer (Letter Only)
1
31
61
2
32
62
3
33
63
4
34
64
5
35
65
6
36
7
37
8
38
9
39
10
40
11
41
12
42
13
43
14
44
15
45
16
46
17
47
18
48
19
49
20
50
21
51
22
52
23
53
24
54
25
55
26
56
27
57
28
58
29
59
30
60
Assignment 4B
Use the answer sheet to respond to the following questions. When completed, post your answer
sheet as an attachment through the Assignments section. There is one correct answer per
question, and each answer is worth two points.
Example:
Which amendment protects against unreasonable searches and seizures?
a) First Amendment
b) Fourth Amendment
c) Fifth Amendment
d) Sixth Amendment
e) None of the above.
The correct answer is "B," so you would enter "B" on the answer sheet for this assignment. One
point would be awarded for this question as the question was answered correctly.
1. The prosecutor's discretion in determining which cases to prosecute impacts what laws the
police choose to focus on and enforce.
a) True
b) False
2. According to the text, an important role played by the victim is
a. to humanize the impact of crime.
b. to offer unbiased, reliable testimony.
c. to point out inconsistencies in the defense.
d. to pressure the jury to find the defendant guilty.
e. none of the above.
3. When making decisions in the courtroom, judges
a) must refrain from seeking the advice of others in order to protect the rights of the
accused.
b) rely on prosecutors and defense attorneys during essentially every phase of the trial.
c) typically disregard information from other judges as each case is different.
d) have little discretion in most decisions affecting cases.
e) none of the above.
4. The police chief implements the use of a drug courier profile for his department. Using the
profile, officers focus on their attention on stopping and searching cars with Florida license
plates. After a month, the chief reviews the statistics and finds that, indeed, most of the drug
arrests for the month were of drivers of cars with Florida license plates. According to the text,
this is an example of:
a. racial profiling.
b. self-fulfilling prophecy.
c. differential policing.
d. targeted enforcement.
e. none of the above.
5. Which of the following is not a white collar crime?
a. A stockbroker manipulates the price of a stock.
b. A car company sells vehicles it knows have a faulty brake system.
c. A manufacturing plant dumps toxic waste into a local creek.
d. A businessman shoplifts a tie from a prestige clothing store.
e. None of the above.
6. A subpoe ...
BAM 521 Publisher Pearson Prentice Hal, Business Law .docxikirkton
BAM 521
Publisher:
Pearson Prentice Hal,
Business Law
Text: Contemporary Business and Online Commerce Law
Sixth Edition, 2009
ISBN: 10 013-601500-X
Author(s):
Henry R Cheeseman
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21497,0);(0,0);(0,21487);(21497,21487)posrelh0posrelv0pib
a.
Business Law
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
~The court's decision in Brown v. Board of Education had what effect on the decision
~ made in Plessy v. Ferguson?
b. It showed that precedent can be overruled and IS not binding in every situation.
c. It applied the Doctrine of Stare Decisis
d. It showed that the Constitution IS not subject to interpretation.
e. It applied the principle of preemption
f. It followed precedent.
2) Someone who believes that law is a reflect on of those in power, believes in which
school of jurisprudential thought?
a, The Analytical School.
b. The Natural School.
c. The Command School.
d. The Historical School
e. The Psychological School
(""hiCh of the following is a false statement regarding the citizenship and immigration
~liCY of the United States?
a. Immigration quotas are different for each foreign country.
b. The first immigration quota policy was enacted in the 1920s.
c. The immigration quota policy was repealed after World War II.
d. There is an immigration quota policy in effect today In the United States.
e. Immigration laws are administered and enforced by the United States Customs and
Immigration Service.
4) The remedy, or relief that was available in the law courts of England was:
a. specific performance.
b. monetary awards for damages.
c. fines and imprisonment.
d. returning the parties to their positions before the dispute arose.
e. Any of the above, and any other remedy determined to be fair in the particular case.
5) Chancery Courts were also known as:
a. Criminal Courts
b. Equity Courts.
c. Legal Remedy Courts.
d. Merchant Courts.
e. Law Courts.
shapeType75fBehindDocument1pWrapPolygonVertices8;4;(21500,0);(0,0);(0,21493);(21500,21493)posrelh0posrelv0pib
P'
'Business
Law
65
6) When statutes are organized by topic the
resulting compilation of law is known as:
a. precedent.
b. a code.
c. civil law.
d. topical presentation
e. common law.
7) Which of the following IS not empowered to establish administrative agencies?
a. A state executive branch.
b. Concress.
c. A federal or state judicial branch
d. A state leoislative branch.
e. The federal executive branch.
f7:J For which of the following in the U.S. Congress can the number to which a state is
~ entitled change over time?
a. All members of the U.S. Congress.
b. Senators.
c. Both Senators and representatives.
d. Neither senators nor representatives
e. Representatives.
Ia? ~e power of the federal government to make treaties with Native American Nations
L/r~~arding land and land use IS derived from the:
a. Privileces and Immunities Clause.
b. Supremacy C ...
Andre is in 11th grade at his local public high school. He wants t.docxjustine1simpson78276
Andre is in 11th grade at his local public high school. He wants to take the school’s ballet class as one of his required electives but the school only allows girls to enroll in the class. Andre sues under the 14th Amendment. How will a court determine the result?
a. The court will apply strict scrutiny and the school will have to demonstrate that the rule is necessary to promote a compelling state interest
b. The court will apply intermediate scrutiny and the school will have to demonstrate that the rule is rationally related to a legitimate goal
c. The court will apply minimal scrutiny and the school will have to demonstrate that the rule is substantially related to an important government interest
d. The court will apply intermediate scrutiny and the school will have to demonstrate that the rule is substantially related to an important government interest
Marcel is picnicking in a crowded local park. He decides he would be more comfortable naked, so takes off all his clothes. He can only enjoy a few more bites of his lunch before he is arrested for violating city ordinances about public nudity. Marcel sues. If the court finds that Marcel’s actions do not warrant First Amendment protection, it is probably because:
a. His nudity was not intended to convey a particularized message.
b. There were children at the park.
c. He was not speaking while he was naked.
d. The Federal government does not regulate this issue, so state law controls.
Eloise plans to build an addition on her house that she will operate as a bed and breakfast. The town rejects her plans, on the grounds that she must first obtain an expensive commercial building permit. Eloise argues that she is just modifying her own residence that she owned the residence before the commercial permit legislation was passed, and therefore does not need the expensive permit. At the court hearing on her case, the town mayor serves as judge. This is:
a. proper procedural due process, because Eloise has a chance to be heard
b. a violation of the Commerce Clause
c. a violation of procedural due process requirements
d. a violation of substantive due process requirements
To protect Native Americans, the Federal government passes a law prohibiting their taxation. Oklahoma amends its own tax law, adding a small tax on Native Americans. Is the Oklahoma law constitutional?
a. No, the statute violates the Supremacy Clause.
b. Yes, police powers are reserved for the states.
c. Yes, because Congress does not have authority over state taxes.
d. No, the statute violates the dormant Commerce Clause.
You begin work at Everhappy Corp. at the beginning of November. On your second day at work, you wear a political button on your coat, supporting your choice for governor in the upcoming election. Your boss glances at it and says, “Get that stupid thing out of this office or you’re history.” You protest that his statement violates your constitutional r.
The primary purpose of a mediator is to facilitate settlement of a.docxssusera34210
The primary purpose of a mediator is to facilitate settlement of a dispute between the parties.
True
False
The two most common types of bankruptcy filed by business are a reorganization bankruptcy and a liquidating bankruptcy.
True
False
Section 402A of the Uniform Commercial Code governs the law of Strict Liability in a commercial setting.
True
False
Which of the following types of law are intended specifically to provide a system of compensation for injuries done by virtue of conduct deemed by the law to be inappropriate?
A) Substantive Law
B) Criminal Law
C) Procedural Law
D) Civil Law
The three primary theories of Product Liability are tortuous negligence, strict liability and contract warranty.
True
False
Burglary is the crime of stealing something from somebody.s house or building at night.
True
False
Litigation involving criminal law are typically initiated by legal counsel for the victim of the crime.
True
False
An automatic stay is in force upon filing of a bankruptcy and acts to stop a creditor from repossessing any collateral.
True
False
Courts represent the primary mechanism for the enforcement of law in the United States.
True
False
The concept of .observing corporate formalities. relates to failure to observe GAAP when reporting profit and loss to the Securities and Exchange Commission.
True
False
Baseball is specifically exempted from coverage under the Sherman Act, but not so with regard to Football.
True
False
Which of the following is not one of the general categories of torts?
A) Strict liability
C) Conversion
C) Negligence
D) Intentional.
The law of contracts in most states is entirely a matter of Common Law.
True
False
What differs in a defamation suit when the plaintiff is a public figure, as opposed to when the plaintiff is not a public figure?
A) The plaintiff need not prove actual injury to the reputation.-
B) The plaintiff can recover even when the statement is a mere opinion
C) The plaintiff must prove that the statement was made with malice
D) The plaintiff must prove that the statement was made in writing.
Laws of the United States are enforceable within foreign countries so long as United States companies or citizens are involved as one of the parties.
True
False
Any case in the United States may be automatically appealed directly to the United States Supreme Court if one of the litigants is unsatisfied with the outcome; the Supreme Court always has the final say in any litigation in the country.
True
False
C Corporations and S Corporations technically differ only with regard to the treatment of their net income with regard to sales taxation as administered by the International Revenue Service.
True
False
Which of the following terms pertains to the admission of evidence at a trial:
A) Eminent Domain
B) Full Faith and Credit
C) Probative Value
D) Revocation of Offer
Administrative Agencies often establish regulations pursuant to the legislative power de ...
The document provides information about the structure and purpose of the US judicial system. It discusses that the Supreme Court interprets laws and their constitutionality, and is appointed by the President and approved by the Senate. Two influential Supreme Court cases were discussed - Dred Scott v Sandford which upheld slavery and Brown v Board of Education which outlawed public school segregation. The President and Senate provide checks on the Supreme Court through judicial appointments. Lower federal courts were established by Congress and state courts by state governments.
Introduction to Law Final Exam Instructions Instructor .docxnormanibarber20063
Introduction to Law
Final Exam Instructions
Instructor: A. Jarmon
Final Exam
Page 1
EXAM DATE/TIME SELECTION-ONLY (1) OPTION
There are no re-take options. Your final exam is due Saturday, March 19, 2016 at 12:00 noon
via Canvas. It must be submitted via Canvas. I will not accept exams that are sent to me via
email.
PERMISSIBLE EXAM MATERIALS
This final exam is “open-book/open-notes.” While this exam is “open-book/open-notes,” it is not
group work. Each student is expected to independently complete and submit his/her exam. Any
appearance of plagiarism or similarity in submissions will automatically result in a zero
submitted for each submission. Submissions subject to a zero under this provision are not
eligible for re-take.
CONTENT DESCRIPTION OF FINAL EXAM
This exam is comprehensive. You are being evaluated on your understanding of the legal
principles and theories covered through the course, as well as your ability to apply those
principles and theories to various fact patterns or scenarios.
EXAM-POINT VALUE
This exam is worth 150 points.
Introduction to Law
Final Exam Instructions
Instructor: A. Jarmon
Final Exam
Page 2
SECTION I
The following True/False and Multiple Choice questions cover the material
introduced in Chapters 1-2; 4, 6, and 7-8. Each question is worth two (2) points.
Please indicate (T) for True or (F) for False for the True/False Statements. For
Multiple Choice, please select the letter that corresponds to the best response.
There are 50 questions in this section. This section is worth 50 points.
A. LEGAL SYTSTEM, COURTS, AND LEGISLATION
1. All but which of the following are examples of special courts in the federal
system:
a. U.S. Tax Court
b. U.S. Bankruptcy Court
c. U.S. Court of Federal Claims
d. Pierce County Superior Court
e. U.S. Court of Appeals for the Armed Forces
2. Which of the following statements IS NOT true as it relates to the authority
of the U.S. Supreme Court?
a. The U.S. Supreme Court is the final authority on all matters of federal
jurisdiction.
b. The primary function of the Supreme Court is one of review.
c. The key element in the Supreme Court’s authority is that a federal
issue must be at stake, either in the form of the parties (diversity
jurisdiction) or in the constitutionality of a state or federal law.
d. Every case may be submitted to the United States Supreme Court for
review.
e. All of the above statements are true.
3. Judicial review refers to the system by which each branch of government
can use its specially designated powers to make sure the other branches act
within their constitutionally prescribed limits.
4. The principle of stare decisis precludes the court from correcting erroneous
decisions that were previously issued.
Introduction to Law
Final Exam Instructions
Instructor: A. Jarmon
Final Exam
Page 3
B. INTRODUCTION TO CI.
Assignment 3 Ethics and Social Responsibility in Busine.docxaryan532920
Assignment 3: Ethics and Social Responsibility in Business Assignment
In this Assignment you will read the Cengage® Case Study: “Barclays Bank: Banking
on Ethics” and then respond to the checklist items in a critical essay based on the
scenario below.
Assignment Scenario:
As a new marketing associate with Barclays Bank, you are tasked with writing a critical
essay summarizing what transpired during the investigation conducted by the United
States Department of Justice into the abuse of the London Interbank Offered Rate
(LIBOR) interest rate regulated by the British Banker’s Administration. This essay, if
chosen by your new employer, will be the report presented to the Board of Directors.
Write a 2–3 page, (not including a title and references page), double-spaced, critical essay
responding to the checklist items. For assistance with your Assignment, please use your
textbook and library research resources. The instructions for you to execute this task are
as follows:
Directions for completing this Assignment:
1. Read the “Barclays Bank: Banking on Ethics” case study: Click Here
2. Learn how to write a critical essay: Click Here
3. Use APA format and citation style, provide a title page and references, and do not forget
to use in-text citations with their accompanying references so as to avoid plagiarism.
4. In your critical essay that includes your thesis, arguments, support, and conclusion,
respond to the following:
Checklist:
● Describe the level of ethical development the executives at Barclays demonstrated
when manipulating the LIBOR interest rates.
● Did Barclays Bank neglect social responsibility? What could they have done to be
more socially responsible?
● What actions regarding Corporate Social Responsibility (CSR) could Barclays have
engaged in after the scandal broke to set things right and ensure that such an event
would not happen again?
● Describe what level of morality would have been demonstrated if executives at
Barclays asked themselves, “Even though manipulating the LIBOR will increase
company profits, is it the right thing to do in the long run?”
● Explain the importance of ethics and social responsibility in marketing as a result of
your case study analysis.
http://extmedia.kaplan.edu/business/AB219/1501B/U3/Unit3_BarkleyStudy.pdf
http://extmedia.kaplan.edu/business/AB219/1501B/U3/Unit3_BarkleyStudy.pdf
http://extmedia.kaplan.edu/business/AB219/1403C/Assignment/U2/BarkleyStudy.pdf
http://extmedia.kaplan.edu/business/AB219/1501B/U3/Critical_Essay.pdf
Directions for Submitting this Assignment:
Review the grading rubric below before beginning this activity. For additional help with
your writing and APA citation, please visit the Kaplan University Writing Center accessed
in the home area of this course. Compose your Assignment as a Microsoft Word document
and save it as (Example: TAllen-MT219 Assignment-Unit 3.docx). Submit your file by
sel ...
1) The document outlines an arbitration clause referring disputes to the International Court of Arbitration of the International Chamber of Commerce to be settled under the ICC Rules of Arbitration.
2) The arbitration will take place in the named place, and the language will be both Chinese and English with acceptance of documents in English.
3) Key elements that must be included are the specific arbitration court, the rules that will be followed, designation of the place, and how the arbitrator will be selected. Failure to properly name the court or rules could invalidate the clause.
The document discusses the structure and jurisdiction of the U.S. federal court system. It outlines the dual court system of federal and state courts. It describes the different levels and types of federal courts, including the Supreme Court, appellate courts, district courts, and specialized courts. It also covers the appointment of judges, their terms, and types of jurisdiction that federal courts have.
The document discusses the U.S. court system, including state and federal structures. It explains that state courts have general jurisdiction over most cases within a state, while federal courts have more limited jurisdiction, primarily over federal questions and diversity cases. It also distinguishes between law and equity, noting that law aims for stability and damages, while equity promotes fairness through remedies like decrees.
South Western Federal Taxation 2011 Comprehensive 34th Edition Hoffman Test BankHoganner
Full download : http://alibabadownload.com/product/south-western-federal-taxation-2011-comprehensive-34th-edition-hoffman-test-bank/ South Western Federal Taxation 2011 Comprehensive 34th Edition Hoffman Test Bank
8) The process of critical legal thinking includes which of the fo.docxssuser774ad41
8) The process of critical legal thinking includes which of the following?
a.
A judge must specify the issue presented by the case.
b.
A judge must identify the applicable law for the case.
c.
A judge must identify the key facts in the case.
d.
A judge must apply the law to the facts to come to a conclusion that answers the issue presented.
All the above involve the process of critical legal thinking
20)
Which of the following is an example of concurrent jurisdiction shared by federal and state courts?
a.
Copyrights and trademarks.
b.
Bankruptcy.
c.
Federal questions.
d.
Patents.
e.
None of the above, each is considered exclusive federal jurisdiction.
21)
There will never be a dissenting opinion filed when the U.S. Supreme Court has issued atn).
a.
majority opinion.
b.
opinion written by the Chief Justice.
c.
unanimous opinion.
d.
tie opinion.
e.
plurality opinion.
23)
When parties to a contract agree upon which state court will have jurisdiction should litigation become necessary, that contract clause is called a:
a.
choice-of-law clause.
b.
jurisdiction selection clause.
c.
standings clause.
d.
venue selection clause.
e.
forum-selection clause.
25) Which of the following are in the proper order from first to last filed?
a.
Reply; cross-complaint; answer; complaint.
b.
Answer; complaint; reply; cross-complaint.
c.
Complaint; answer; cross-complaint; reply.
d.
Complaint; cross-complaint; reply; answer.
e.
Complaint; reply; cross-complaint; answer.
30)
Which of the following is an example of an executive power granted to an administrative agency?
a.
The power to investigate a violation of a statute or administrative rule.
b.
The responsibility to determine licensing requirements for pharmacists.
c.
The right to issue an interpretive rule.
d.
The right to adjudicate a case through an administrative proceeding.
e.
The right to issue a substantive rule.
34)
In Wilhelm v. Flores, involving a death from bee stings, which of the following sets forth the ruling of the Court of Appeals as to whether a defendant who hires a person to work with bees can be held liable for the failure to warn of the dangers involved?
a.
A defendant who had knowledge of the dangers of working with bees can be held liable on a negligence basis for the failure to warn of some dangers, but the danger of anaphylactic shock is too remote for there to be a danger to warn about that.
b.
There is no liability for negligence when the unpredictability of animals, birds or bees is involved.
c.
Liability would only exist if the defendant was aware that the plaintiff knew nothing about bees and intentionally kept the dangers a secret.
d.
There could be no liability whatsoever since it is assumed that if a person agrees to work with bees, they are aware of the dangers.
e.
A defendant who has knowledge of the dangers of working with bees can be held liable on a negligence basis for the failure to warn of da.
The document provides an overview of the US federal court system. It discusses that the Constitution created the Supreme Court and gave Congress the power to establish lower federal courts. It describes the structure of the federal court system, including the district courts, courts of appeals, and other constitutional courts. It also covers the jurisdiction of these courts, the appointment and roles of federal judges, and how cases make their way to the Supreme Court.
5Final ExaminationBCJ 240 Procedures in the Justice Sy.docxalinainglis
5
Final Examination
BCJ 240 Procedures in the Justice System
Multiple Choice Questions (Enter your answers on the enclosed answer sheet)
Typically, the lowest-level court(s) in a given state is/are: 1.
courts of general jurisdiction.a.
the state supreme court.b.
intermediate appellate courts.c.
courts of limited jurisdiction. d.
Each state has its own highest court, typically referred to as: 2.
superior courts.a.
intermediate appellate courts.b.
state supreme courts.c.
courts of limited jurisdiction. d.
At the federal level, the lowest-level trial court is referred to as: 3.
U.S. Supreme Court.a.
U. S. courts of appeals.b.
district courts.c.
trial courts. d.
When an appellate court reverses a lower court’s decision, it: 4.
nullifies or sets aside a trial verdict. a.
adjudicates the case.b.
sends the case to a higher court for reviewc.
sets the defendant free.d.
When an appellate court agrees with a lower court’s decision, it _____ that decision. 5.
reversesa.
affirmsb.
remandsc.
vacates d.
In order for a case to reach the Supreme Court, the court must decide whether it wants to 6.
hear the case. If the Supreme Court agrees that case is worth deciding, it issues what is
known as a:
lex loci.a.
jus cogens.b.
certiorari.c.
writ of certiorari.d.
6
Final Examination
BCJ 240 Procedures in the Justice System
Which of the following is NOT a reason a “bright-line” decision may be helpful? 7.
It promotes consistency.a.
It promotes clarity and predictability.b.
It is ambiguous. c.
It is subject to very little interpretation. d.
Police conduct that is considered reasonable by the police officer engaged in the conduct is 8.
referred to as:
subjective reasonableness.a.
objective reasonableness.b.
reasonable objectiveness.c.
unreasonable objectiveness. d.
The term “objective reasonableness” in criminal procedure refers to: 9.
what a single individual believes is reasonable.a.
what a reasonable person believes is reasonable.b.
what a jury believes is reasonable.c.
what a reasonable person would do or feel under the circumstances. d.
Judicial restraint refers to: 10.
limiting decisions to the facts of each case.a.
deciding cases based on additional, hypothetical situations.b.
interpreting complex legal issues.c.
relying on case law to determine outcomes. d.
The past Supreme Court requirement that a physical intrusion by authorities must have taken 11.
place to violate one’s privacy is referred to as the:
electronic communication protection doctrine.a.
privacy doctrine.b.
trespass doctrine.c.
physical protection doctrine. d.
7
Final Examination
BCJ 240 Procedures in the Justice System
In the Section 1983 context, the requirement that the plaintiff (i.e., the party suing) 12.
generally has to prove that the defendant officer intended for the violation to occur is
referred to as
liabilitya.
credibilityb.
accountability c.
culpability d.
.
Similar to Final Examination2BAM 317 Business LawMultiple Cho.docx (17)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
The simplified electron and muon model, Oscillating Spacetime: The Foundation...RitikBhardwaj56
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
Physiology and chemistry of skin and pigmentation, hairs, scalp, lips and nail, Cleansing cream, Lotions, Face powders, Face packs, Lipsticks, Bath products, soaps and baby product,
Preparation and standardization of the following : Tonic, Bleaches, Dentifrices and Mouth washes & Tooth Pastes, Cosmetics for Nails.
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
Assessment and Planning in Educational technology.pptxKavitha Krishnan
In an education system, it is understood that assessment is only for the students, but on the other hand, the Assessment of teachers is also an important aspect of the education system that ensures teachers are providing high-quality instruction to students. The assessment process can be used to provide feedback and support for professional development, to inform decisions about teacher retention or promotion, or to evaluate teacher effectiveness for accountability purposes.
BÀI TẬP BỔ TRỢ TIẾNG ANH 8 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2023-2024 (CÓ FI...
Final Examination2BAM 317 Business LawMultiple Cho.docx
1. Final Examination
2
BAM 317 Business Law
Multiple Choice Questions (Enter your answers on the enclosed
answer sheet)
1) Which doctrine was overturned in the case of Brown v.
Board of Education?
a. the legality of poll taxes
b. the permissibility of separate but equal facilities
c. allowing only white males to vote
d. the acceptability of paying women less than men for
comparable work
e. different working hours for male and female factory workers
2) Documents such as the U.S. Constitution, the Magna Carta,
and the United Nations Charter
reflect what legal theory?
a. the Natural Law school
b. the Historical school
c. the Sociological school
d. the Analytical school
3) Proponents of which school(s) of jurisprudential thought are
unlikely to adhere to precedent in
making decisions?
2. a. the Sociological school only
b. the Critical Legal Studies school only
c. both the Sociological school and the Critical Legal Studies
school
d. neither the Sociological school nor the Critical Legal Studies
school
4) Which of the following is most consistent with the Natural
Law School of jurisprudence?
a. Law is based on moral and ethical principles of what are
right, and it is the job of men
and women, through study, to discover what these principles
are.
b. The law is a reflection of society, thus the law must change
naturally as society
changes over time.
c. The laws of man are secondary to the laws of nature, and
thus the laws of nature take
precedence whenever the laws of man are in conflict with the
laws of nature.
d. By applying the rules of logic to specific cases, the logical,
or natural, result will be
obtained.
e. Laws must first and foremost respect, preserve, and promote
the preservation of the
environment and life in all its forms.
5) What was the only remedy (relief) available in the law
courts of England?
a. specific performance
b. fines and imprisonment
c. monetary awards for damages
d. returning the parties to their positions before the dispute
arose
3. 3
Final Examination
BAM 317 Business Law
6) Which court was eventually combined with the regular court
system?
a. law courts
b. equity courts
c. criminal courts
d. merchant courts
7) What is an equity court’s function?
a. To deal with just the law of merchants.
b. To issue opinions in cases that later set the precedent for
similar cases.
c. To investigate the merits of a case and base its decisions on
fairness.
d. To issue executive orders.
e. To set state or federal laws between two or more nations.
8) The ability of Native American Indians to conduct gambling
operations on Indian reservations:
a. is determined solely by the respective Indian tribe
b. is determined through negotiation by the state and Native
Americans
c.is within the control of the federal government because of
provisions in the U.S. Consti-
tution
4. d. has been found by the courts, in many instances, to have
been improperly granted
9) The selling of goods or services to a country the United
States is at war with is prohibited:
a. by the U. S. Constitution
b. by a federal statute passed by Congress
c. by treaty
d. by executive order
10) The following are examples of limited jurisdiction trial
courts except:
a. small claims court
b. appellate court
c. family law court
d. traffic court
e. probate court
Final Examination
4
BAM 317 Business Law
11) The general jurisdiction trial court in the federal system is
called the:
a. United States Trial Court
b. United States Circuit Court
c. United States General Court
d. United States District Court
e. Federal Chancery Court
5. 12) Which federal court or courts is directly established by the
United States Constitution?
a. The Supreme Court only
b. Federal trial courts only
c. The Supreme Court and federal trial courts
d. The Supreme Court and federal courts of appeal
e. The Supreme Court, federal courts of appeal, and federal
trial courts
13) How are judges for the federal courts selected?
a. by nationwide election
b. by election by the voters within the state where they preside
c. by the President, subject to confirmation by the Senate
d. by the Supreme Court justices
e. by the sitting federal judges within the same circuit
14) What happens if the U.S. Supreme Court reaches a tie in a
decision?
a. The case will be reconsidered in the following year.
b. The decision will be held in abeyance until one of the
justices decides to change his or
her mind.
c. The case will be returned to the Circuit Court of Appeals to
reconsider the case in light
of the tie decision by the Supreme Court.
d. The lower court decision in the case is overturned.
e. The lower court decision in the case is affirmed.
15) Which of the following is true with regard to the appellate
process?
a. Very important cases are usually initially tried in the U.S.
6. Supreme Court.
b. When a case is appealed, the appellate court usually holds a
new trial.
c. In the federal court system, there are usually two levels of
appeal by right.
d. The U.S. Supreme Court chooses to review only a small
fraction of those cases that it is
asked to review.
e. The vote of only one justice is needed for the U.S. Supreme
Court to hear a case.
5
Final Examination
BAM 317 Business Law
16) Which of the following kinds of jurisdiction would be
necessary and sufficient for a court to
hear a case?
a. Subject matter and in personem and in rem.
b. Subject matter or in personem or in rem.
c. Subject matter and either in personem or in rem.
d. In rem and either subject matter or in personam.
17) Someone who is not a party to a lawsuit but has an interest
in the outcome and therefore
wants to become a party to the suit must:
a. await the outcome of this trial and then file a separate action
b. intervene
c. counter-sue
d. consolidate
7. e. file a cross-complaint
18) Tammi Tenant was a university student in Ohio who rented
a house from Loretta, who also
lived in Ohio. Upon graduation, Tammi moved to Nebraska.
Assuming that one party sued the
other in connection with the lease after Tammi had moved to
Nebraska, which of the following
correctly describes the court(s) with jurisdiction over the
defendant?
If Loretta sued, there would be If Tammi sued, there would be
personal jurisdiction over Tammi in: personal jurisdiction over
Loretta in:
a. Ohio only Ohio only
b. Nebraska only Ohio only
c. Nebraska or Ohio Nebraska only
d. Nebraska or Ohio Nebraska or Ohio
e. Nebraska or Ohio Ohio only
19) In a civil case, the party whom the complaint is filed
against is the:
a. defendant
b. district attorney
c. state
d. public defender
e. A, B, and C
20) Once a complaint has been filed with the court, the court
issues a:
a. judgment
b. motion for summary judgment
c. summons
8. d. both A and D
Final Examination
6
BAM 317 Business Law
21) Which of the following is one of the major purposes of a
settlement conference?
a. to try and make amends among the parties
b. licensees only
c. to facilitate the settlement of a case
d. to contest the local court rules
e. All of these are correct.
22) Which amendment guarantees the right to a jury trial in a
case in federal court?
a. the fifth amendment
b. the sixth amendment
c. the seventh amendment
d. the eleventh amendment
e. the fourteenth amendment
23) In general, an appellate court might typically reverse which
of the following?
a. the trial court’s findings of fact
b. the trial court’s conclusions of law
c. negligence
d. both A and B
9. 24) Which of the following is true with regard to arbitration?
a. Rules similar to those followed by federal courts are usually
applied at arbitration hear-
ings.
b. Arbitrators enter awards after reaching a decision.
c. The parties often agree to be bound by the arbitrator’s
decision and award.
d. All of these are correct.
25) Which of the following is true regarding mediation?
a. A mediator often meets with both parties at the same time.
b. A settlement agreement is never reached with a mediator.
c. A mediator does not make a decision or an award.
d. If a settlement agreement is not reached in mediation, then
the parties hire a new
mediator.
7
Final Examination
BAM 317 Business Law
26) George has served Mary with a complaint alleging that she
trespassed on his property. Mary
has never been sued before and as such, she seeks your advice
on what to do with the complaint.
You advise that she:
a. do not respond and maybe George will drop the lawsuit
b. write a letter the to judge saying that George is mistaken
c. answer George’s complaint by admitting or denying the
10. allegations George has asserted
against her
d. do not provide any affirmative defenses that George can use
against Mary
27) If Sam was on vacation in Mexico and forgot to serve the
lawsuit he wanted to bring against
Delia 1 month after the statute of limitations period, what is the
most likely result?
a. Sam will lose his right to sue Delia.
b. Sam can still sue Delia as Mexico’s law does not apply.
c. Sam can make a deal with Delia not to sue her for as much as
he originally intended.
d. None of these are correct.
28) The number of ________ to which a state is entitled can
change over time.
a. Senators
b. Representatives
c. both Senators and representatives
d. Supreme Court justices
29) What is the result of the “effects on interstate commerce”
test?
a. The federal government can regulate all interstate commerce
that actually crosses state
lines.
b. Prior to enacting laws, states are required to identify any
effects that the law might
have on interstate commerce.
c. The federal government can regulate a business activity that
takes place within a single
state if the activity has an effect on interstate commerce even
11. though the regulated
activity does not itself involve interstate commerce.
d. Commercial speech protections apply only to speech that has
an effect on interstate
commerce.
30) The Bill of Rights is another name for:
a. the Articles of Confederation
b. the U.S. Constitution
c. the document that explains the U.S. Constitution
d. the first ten amendments to the U.S. Constitution
e. the first seven articles of the U.S. Constitution
Final Examination
8
BAM 317 Business Law
31) Which of the following is true regarding obscene speech?
a. It cannot be prevented, but can be subject to time, place, or
manner restrictions.
b .Because the definition of obscene is so subjective, it cannot
be restricted or prevented.
c. Even though the definition of obscene speech is subjective,
if speech is determined to
be obscene, it loses all constitutional protection.
d. Obscene speech and offensive speech receive the same
degree of protection.
e. The U.S. Supreme Court has set out a clear definition of
what speech is defined as
obscene and therefore unprotected.
12. 32) In responding to a constitutional challenge to the Computer
Decency Act, the U.S. Supreme
Court ruled which of the following about the Act?
a. Computers and the Internet were not covered by the free
speech provisions of the U.S.
Constitution because they did not exist when the Constitution
was drafted.
b. The Act was constitutional because obscene speech receives
no protection.
c. Obscene materials could not be available between 6:00 a.m.
and 10:00 p.m. local
time.
d. The Internet deserves the “highest protection” from
government intrusion.
e. The Internet was similar to television and that restrictions
similar to those on television
programming were appropriate.
33) Which of the following is correct regarding freedom of
religion under the U.S. Constitution?
a. It comes from the Establishment Clause as well as the Free
Exercise Clause.
b. It applies only to those religions in existence on the date the
Constitution became
effective.
c. It gives practitioners of any religion absolute rights to take
part in actions that are
based on that religion.
d. It allows the government to establish an official religion or
religions so long as citizens
remain free to practice any other religion they choose.
34) Substantive due process requires that:
13. a. a notice and hearing be given before one is deprived of life,
liberty, or property
b. a criminal defendant has an attorney present at all times
c. res ipsa loquitur takes place
d. a law is sufficiently clear that a reasonable person can
understand it in order to comply
with it
e. a defendant not be tried twice for the same crime
9
Final Examination
BAM 317 Business Law
35) Assume that a law is passed that establishes airline security
screening requirements for male
passengers that differ from the requirements for female
passengers. In evaluating an equal protec-
tion challenge to this law, a court would use:
a. strict scrutiny
b. intermediate scrutiny
c. limited scrutiny
d. the rational basis test
36) Which of the following is true about intentional infliction
of emotional distress?
a. Recovery is allowed anytime there is a measurable amount of
mental distress.
b. There must be some physical contact with the plaintiff.
c. The defendant’s conduct must go beyond all possible bounds
14. of decency and be
regarded as atrocious and utterly intolerable in a civilized
society.
d. The plaintiff must have witnessed severe physical injury to a
relative or other
significant person in the plaintiff’s life.
37) The best statement of the test applied in determining if a
defendant was the proximate cause
of the plaintiff’s injuries is:
a. Was it foreseeable to the plaintiff that the defendant would
engage in this conduct?
b. Given this particular injury to the plaintiff, was it
foreseeable that the defendant was
the cause?
c. Should it have been foreseeable to the defendant that the
defendant’s conduct could
lead to this kind of injury?
d. Was the injury foreseeable to the plaintiff prior to the
injury’s occurrence?
e. Was it foreseeable to the plaintiff that this kind of injury
could occur under the
particular conditions that the injury did occur?
38) What does a guest statute provide?
a. that a driver who has voluntarily given a ride to a passenger
without compensation is
not liable to the passenger for ordinary negligence
b. that someone serving alcohol to guests in the home is liable
if the alcohol causes the
guest to become intoxicated and injure another person while
intoxicated
c. that tavern owners are strictly liable for alcohol related
injuries caused by tavern guests
15. who were served alcohol at the tavern
d. that homeowners cannot be sued by their social guests for
injuries incurred while the
guests were in the homeowner’s home with permission
Final Examination
10
BAM 317 Business Law
39) Which of the following is true about the case against
McDonald’s for serving very hot coffee?
a. The plaintiff was burned while driving her car.
b. McDonald’s coffee was found to be the same temperature as
that served by its
competitors.
c. McDonald’s had turned down a pretrial offer of settlement
which was much lower than
the amount awarded by the jury.
d. McDonald’s paid the amount to the plaintiff that the jury
awarded.
40) Cindy was riding her bicycle on a paved bike path and had
an accident with another cyclist.
Cindy’s $1,000 bicycle was destroyed in the accident. If the
jury determined that Cindy was 60
percent at fault and the other cyclist 40 percent at fault, under
which doctrines would Cindy be
entitled to recover $400 from the other cyclist?
a. contributory negligence only
b. pure comparative negligence only
16. c. partial comparative negligence only
d. either form of comparative negligence, but not contributory
negligence
e. either form of comparative negligence as well as under
contributory negligence
41) A reporter appears on television and declares that the head
coach of a professional sports
team is “the worst coach in the history of sports.” The coach
subsequently files a lawsuit against
the reporter. A court would most likely determine which of the
following?
a. The reporter is liable for a claim of slander.
b. The reporter is liable for a claim of libel.
c. The reporter is not liable because truth is an absolute
defense.
d. The reporter is not liable because the statement is an
expression of opinion.
42) Which of the following is true in a products liability case?
a. The plaintiff must prove the existence of a duty.
b. The plaintiff must have purchased the product from the
defendant.
c. The plaintiff must prove her case with a preponderance of
the evidence.
d. The plaintiff will lose if she cannot prove proximate
causation.
43) If a manufacturer produces a defective product, sells it to a
wholesaler, who sells it to a
retailer, who sells it to a consumer, who is injured, which
parties in the chain of distribution are
potentially liable under strict liability?
17. a. only the manufacturer
b. only the manufacturer and wholesaler
c. the manufacturer, wholesaler, and retailer
d. only the party at fault
11
Final Examination
BAM 317 Business Law
44) Who can recover for their injuries under product liability
law?
a. someone who purchases a product new
b. someone who uses a product with the owner’s permission
c. a nonuser such as a bystander
d. A and B only
e. A, B, and C
45) Which of the following best describes a defect in packaging
under products liability?
a. The packaging of a product, such as a bottle or can, causes
an injury to the user.
b. The packaging of a product is such that it allows the product
to spoil.
c. The packaging of a product contains misleading or deceptive
information about the
product contained inside.
d. The packaging of a product fails to contain necessary
warnings about the dangers asoc-
iated with a product.
e. The packaging of a product allows children to access a
18. product, such as drugs or
poisons, that is generally safe when used as directed, but can
be harmful if not used
properly.
46) A wholesale distributor who is named in a product liability
suit based on strict liability could
avoid liability if:
a. the plaintiff had purchased the product causing the injury
b. the distributor exercised reasonable care in all ways with
respect to the product
causing the injury
c. this product had been used for many years by other users
without injury
d. this defect which caused the injury occurred after the
product left the distributor
e. the product has been redesigned to eliminate the problem
which caused the injury in
this case
47) Dangerous Products, Inc. is currently the defendant in
several products liability cases. Which
of the following situations would provide the weakest defense
for the manufacturer?
a. The plaintiff had received a recall notice addressing the
defect which caused the injury,
but did not respond to the recall and continued to use the
product.
b. The plaintiff was misusing the product, an electric sander, to
remove the outer layer of
his facial skin in order to improve his facial complexion.
c. The plaintiff had taken one of the company’s lawn mowers
and modified it to be a
ceiling fan which he attached to his bedroom ceiling.
19. d. The injury occurred when a boy used a drill to drill a hole in
his younger brother’s arm
because the younger brother had broken the older brother’s toy
car.
e. The plaintiff was misusing an electric wood saw because the
owner’s manual said to
only use it to cut with (along) the grain of the wood and the
plaintiff was using it to cut
across the grain, causing it to kick up and injure the plaintiff.
Final Examination
12
BAM 317 Business Law
48) A doctrine that says a patent may not be granted if the
invention was used by the public for
more than a certain period of time prior to the filing of the
patent application is known as:
a. the public service doctrine
b. the public use doctrine
c. the unfair doctrine
d. the bar to patents doctrine
e. None of these are correct.
49) Which of the following was the most recently recognized as
a valid subject matter for a
patent?
a. machines
b. certain types of business plans
c. original ideas for community improvement
20. d. processes
e. designs
50) One of the provisions of the American Inventors Protection
Act of 1999 is that:
a. the power to regulate invention promoters was transferred to
the Department of Justice
b. the legal life of a patent was extended to 20 years
c. the Patent and Trademark Office must make a decision on a
patent application within
5 years after its filing
d. inventors are able to file a provisional application granting
provisional rights pending
the filing of a final application within three months
51) Will someone who uses a short section of a copyrighted
work in a critical review be subject to
copyright infringement?
a. No, because of the fair use doctrine.
b. No, if he obtained the original copyrighted work through
legitimate means.
c. Yes, if he did not pay the author for his use of the material.
d. Yes, if he did not obtain permission from the author for his
use of the material.
52) The fair use doctrine would allow the following types of
use of a copyrighted work without the
permission of the copyright holder, except:
a. quotation in a critical review
b. use in a parody
c. sales of a single chapter of a book that is the only chapter of
interest to most persons
in a particular locale
21. d. use by a teacher to illustrate a point in a class
13
Final Examination
BAM 317 Business Law
53) Seattle Paint Company developed a new exterior house
paint that can be properly applied
even in the rain. How can this formula be protected without
filing for a patent?
a. Without a patent, no protection is available.
b. If the company takes all reasonable steps to avoid discovery
of the secret, it can be
protected against some, but not all, methods of discovery of the
secret.
c. By putting a notice on the cans of paint that the formula is a
protected trade secret.
d. By registering a trademark for the product specifying that
the product is distinctive.
54) In a criminal trial, which of the following is true?
a. To be guilty, the defendant must have had a criminal intent
at the time of the crime.
b. The accused is presumed guilty once an indictment has been
issued.
c. The government must prove that the accused is guilty beyond
all possible doubt.
d. At the trial, the grand jury listens to evidence to determine
guilt or innocence.
22. 55) Which of the following is true about crimes?
a. Criminal liability exists only if there is a victim who
suffered damages.
b. A criminal defendant will be found guilty whenever the jury
believes it is more likely
than not that the defendant committed the crime.
c. Torts always accompany crimes, although the civil case is
often not brought.
d. Criminal law is based on the conduct or activities of the
defendant, rather than on
resultant harm.
56) Which is true about jury verdicts in criminal cases?
a. If the defendant is found guilty, the defendant may appeal.
b. If the defendant is found not guilty, the government may
appeal.
c. If the jury cannot agree on guilt or innocence, it is a hung
jury and the defendant goes
free just as if found not guilty.
d. In the case of a tie jury vote, the judge casts a vote to break
the tie.
e.Both A and B are true.
57) Someone who takes personal property from someone’s
home after entering without
authorization has committed:
a. extortion
b. burglary
c. embezzlement
d. robbery
23. Final Examination
14
BAM 317 Business Law
58) To find someone guilty of receiving stolen property, it is
sufficient to prove that the
defendant:
a. was in possession of stolen property
b. intended to keep the property himself
c. paid for the property and intends to keep it himself
d. knowingly received the stolen property and intended to
deprive the true owner of the
property
e. took part in the wrongful taking of the property and intended
to deprive the true owner
of the property
59) What does the Fourth Amendment do?
a. It protects the rights of the people from unreasonable search
and seizure by the
government.
b. It requires the police to obtain a search warrant in all search
and seizure cases.
c. It prohibits warrantless searches in connection with an
arrest.
d. It guarantees the defendant the right to an attorney.
60) Every contract has both:
a. a buyer and seller
b. an offeror and offeree
c. a breaching party and a nonbreaching party
24. d. an initiator and a responder
61) Which of the following is needed to impose a quasi-
contract?
a. a benefit having been conferred and injustice if the benefit
were not paid for
b. actions implying a contract and an agreement as to the price
c. a promise asking for action and the requested action having
been completed
d. a benefit having been conferred and objective intent that it
be conferred
62) Otto approaches Edie and says, “If you pick up my new suit
for me at the mall tomorrow, I’ll
pay you $20.” Edie replies, “I don’t know if I’ll have time to
get it, but I’ll see if I get a chance.”
As a result of this conversation, which of the following is true?
a. Otto and Edie have formed a bilateral contract.
b. Edie has a legal obligation to use her best efforts to pick up
the suit.
c. A contract will be formed only if Edie picks up the suit.
d. The contract which they have formed is voidable because
Edie did not obligate herself.
15
Final Examination
BAM 317 Business Law
63) Frank says to Mary, “If you wash every window in my
house today, I’ll pay you $200. I don’t
25. care if you do it, but there is $200 in it for you if you do.” Mary
washes 12 of the 20 windows in
Frank’s house by 2:00 p.m. At this point, which of the
following is true?
a. Frank can revoke his offer to pay Mary the $200 for washing
the windows.
b. There is a contract in this situation.
c. Mary has formed a contract by beginning to wash the
windows.
d. Mary is obligated to finish washing the windows in order to
receive $200.
64) Janet pulls her car into a line for a car wash. Janet says
nothing and her car is washed by
the employees there. Janet then refuses to pay for the car wash,
stating that there is no contract.
What would the results be in a lawsuit over this situation?
a. Janet wins; because she said nothing, there can be no
contract.
b. Car wash wins; this is an express, unilateral contract that has
been accepted.
c. Janet wins; because the car wash made no promise to wash
her car, there is no
contract.
d. Car wash wins; this is an implied-in-fact contract that has
been accepted.
65) Which of the following are necessary to meet the
requirements of a definite offer?
a. identification of the parties, subject matter, and quantity
b. consideration to be paid
c. time of performance
d. A, B, and C
26. e. A and B only
66) The communication of an offer can be made by:
a. the offeror only
b. the offeror or an agent of the offeror
c. the agent of the offeror only
d. the offeror, the offeror’s agent, or any other party who
learns of an offer
67) What is the legal effect of an auction being with reserve?
a. The seller has the right to reject all of the bids.
b. Certain bidders have reserved bids of specified amounts in
advance.
c. The bidders must be given an opportunity to inspect the
items prior to the bidding.
d. Bidders must make a cash deposit in advance to show the
financial ability to carry
through with the purchase of any item for which they are the
highest bidder.
Final Examination
16
BAM 317 Business Law
68) Silence will operate as acceptance in the following
circumstances EXCEPT:
a. when the offeree indicates that silence will operate as
acceptance
b. when the offeror indicates that silence will operate as
27. acceptance
c. when prior dealings between the parties indicate that silence
is acceptance
d. when the offeree signs an agreement that future shipments
would be accepted until
further notification
69) Pam offers a reward for the return of the pet snake that
escaped from her purse while she
was having dinner at a restaurant. Fred finds the snake and
returns it to her. Which of the follow-
ing is relevant in deciding whether Pam must pay the reward?
a. whether Fred is a minor
b. whether Fred knew about the reward when he returned the
snake
c. whether Fred intended to get the reward
d. whether the offer for the reward was in writing
70) A promise to deliver merchandise in the future:
a. is not consideration because the merchandise has not yet
been delivered
b. is not consideration because the person delivering the goods
does not necessarily
receive a benefit for doing so
c. is consideration because it involves a new legal duty
d. is consideration so long as the party to deliver the goods
received payment before they
were delivered
71) Two friends, Ann and Mary, are having margaritas at happy
hour. There had been no discus-
sion of who would pay for the drinks. After the third round of
drinks, Ann said, “I will pay for
everything tonight including your drinks.” A couple of minutes
28. later, Ann says, “I’ve changed my
mind. I just remembered that they might be having layoffs at my
job tomorrow.” Mary wants to
force Ann to perform on her promise and threatens to sue. In
this circumstance, a court would:
a. not require Ann to follow through on the promise because it
was a gratuitous promise
b. require Ann to follow through on the promise under the
doctrine of promissory estoppel
c. require Ann to follow through on the promise if Mary had
previously paid a comparable
amount for food or drinks consumed by Ann
d. require Ann to follow through on the promise if it would be
a hardship for Mary to pay
for her own drinks
e. not require Ann to follow through on the promise because it
would encourage Mary to
drink
17
Final Examination
BAM 317 Business Law
72) Caterer agrees with Bride to cater Bride’s wedding
reception for $12 per plate. On the wed-
ding day, Caterer calls Bride saying that some things have come
up, and she will have to charge
$16 a plate in order to do the catering. Bride agrees. Which is
true?
a. The $16 is not enforceable because the $12 per plate was
29. past consideration.
b. The $16 is not enforceable because of a preexisting duty.
c. The $16 is enforceable if the reason for it was beyond
Caterer’s control.
d. The $16 is not enforceable because it means the $12 was an
illusory promise.
e. The $16 is enforceable if Bride could have found another
caterer before the wedding.
73) Cheryl hired Golden Construction Co. to build a house for
her. The plans for the house were
complex, and expert workmanship was required. After the house
was completed, Cheryl liked it so
much that she promised to pay Golden a $4,000 bonus. Later,
Golden demanded the money, but
Cheryl refused to pay it. Golden sues. What is the most
probable result?
a. Golden wins; the promise was used to entice Golden to do an
outstanding job, which is
adequate consideration.
b. Cheryl wins; the promise is based on past consideration.
c. Golden wins; the promise is based on past consideration,
which is legally sufficient.
d. Golden wins; the promise is based on changed circumstances
which makes it
enforceable.
74) Frank is a loyal employee who has spent much time above
and beyond the call of duty pro-
moting his employer’s company on weekends. Frank’s boss says
to him, “Because of all this extra
work you have done, you’ll get a $1,000 bonus next month.”
Because of this statement, which of
the following is true?
30. a. The company is not obligated to pay him because the
consideration is past
consideration.
b. The company is not obligated to pay because there was a
preexisting duty.
c. The company is obligated to pay because Frank has
performed the extra work.
d. The company is obligated to pay because there is an implied-
in-law contract.
75) In order for someone to avoid a contract on the grounds of
intoxication, the level of intoxica-
tion must have been:
a. at or above the legal limit
b. only high enough that he was able to notice it
c. at least as high as that of the other party
d. so great that he didn’t comprehend the nature of the
agreement he was entering into
Final Examination
18
BAM 317 Business Law
76) Marsha bought a car from Indy Auto Sales when she was
16. Marsha’s parents had given
their consent for Marsha to purchase the car. However, in order
to buy the car, Marsha lied about
her age. A few months later, Marsha was intoxicated, driving
too fast, and caused an accident
with Mr. Jones. Marsha’s car was totally destroyed, and Mr.
Jones’ car was badly damaged. Marsha
31. wishes to minimize her liability for this accident. Which of the
following best describes this situa-
tion?
a. Marsha can disaffirm the auto sales contract, get back all her
money, and disaffirm any
damage done to Mr. Jones because she is a minor.
b. Marsha must place Indy Auto Sales in status quo to
disaffirm the contract.
c. Because Marsha’s parents consented to Marsha buying the
car, Marsha cannot
disaffirm the contract.
d. Because Marsha’s parents consented to Marsha buying the
car, they are liable to both
Indy Auto Sales and Mr. Jones.
77) Sally and Jeff are both minors. Sally buys Jeff’s
motorcycle for $1,000, its reasonable value.
Jeff spends $700 of this money. Later, Sally wrecks the
motorcycle and it is a total loss. Sally
wants her money back. Which of the following best describes
this situation?
a. Because Sally and Jeff are both minors, the contract is valid
and fully enforceable.
b. If Sally voids the contract, she must give Jeff back the
wrecked motorcycle and
$1,000.
c. If Sally voids the contract, she must give Jeff only the
wrecked motorcycle.
d. The court will determine the relative sophistication of Jeff
and Sally, and the one with
the lesser sophistication will be allowed to void the contract.
e. If Sally voids the contract, Jeff must return to her the entire
$1,000.
32. 78) At age 16, Phil bought a car from Acme Auto Co. for
$2,500. Phil drove the car for about six
months, and then he had an accident. The damage to the auto
was $1,500. In addition, the value
of the auto before the accident was only $2,000. The accident
was not Phil’s fault. Phil wishes to
disaffirm the contract. Which of the following best describes
this situation?
a. Because the car was damaged, Phil cannot disaffirm the
contract.
b. Phil can disaffirm the contract, but he can recover only $500
of his money.
c. Phil can disaffirm the contract, but he can recover only
$2,000 of his money.
d. Phil can disaffirm the contract and recover the entire $2,500.
e. Phil can disaffirm the contract, but he must first have the car
repaired.
19
Final Examination
BAM 317 Business Law
79) Arthur had been adjudicated insane. During his period of
insanity, Arthur sold some un-
improved real estate to Katrina for $5,000, its fair value.
Katrina did not know that Arthur was
insane. In fact, he acted perfectly normal in every way. Arthur
spends this $5,000. Arthur’s guard-
ian learns of this transaction and sues to void the contract and
recover the land. What results?
33. a. Because Arthur was acting normally, and because Katrina
did not know of his insanity,
the contract is valid.
b. The guardian can get the land back, but Arthur must pay
Katrina the $5,000.
c. The guardian can get the land back, but since Arthur has
spent the $5,000, Arthur
does not need to give anything back to Katrina.
d. Because Arthur received the fair value for his land, the
contract cannot be voided.
80) The case that involved two ships, both of which were
named “Peerless,” is:
a. Raffles v. Wichelhaus
b. Konic International Corp. v. Spokane Computer Services,
Inc.
c. Wilson v. Western National Life Insurance Co.
d. Lucy v. Zehmer
e. Fisher v. Bell
81) The knowledge that a misrespresentation is false is known
as:
a. duress
b. undue influence
c. scienter
d. fraud in the factum
e. res ipsa loquitur
82) A party who has been a victim of fraud in the inducement
can:
a. rescind the contract only
b. collect damages only
c. rescind the contract or collect damages
34. d. force the other party to live up to the agreement, but not
rescind the contract or collect
damages
83) Contracts involving fraud and misrepresentation are:
a. actionable only if in writing
b. void
c. valid
d. inadvisable
e. voidable
Final Examination
20
BAM 317 Business Law
84) Robert is a pastor at United Church. One of the members of
his congregation, Mrs. Smith, is
a very devout believer. Robert convinces Mrs. Smith to sell him
her farm for $5,000. The actual
value of the farm is $500,000. Mrs. Smith dies and her estate
sues to get her farm back. Which
of the following best describes this situation?
a. This is a case of fraud, so the estate can rescind the contract.
b. This is a case of undue influence, so the estate can rescind
the contract.
c. Unless Robert can prove that there was no undue influence,
the contract can be
rescinded.
d. This is not a case of undue influence because there is no
fiduciary relationship.
35. e. Mrs. Smith is a competent adult and may dispose of her
property in any way, and for
any price she sees fit.
85) A written contract in which one person agrees to answer for
the debts or duties of another
person is:
a. unenforceable under the Statute of Frauds
b. unenforceable under the Statute of Frauds because it cannot
possibly be performed
within one year
c. guaranty contract
d. A and C only
e. A and B only
86) A contract must be in writing under the Statute of Frauds
if:
a. according to its terms, it cannot be performed within 1 year
b. its actual performance is not completed within 1 year
c. no one could perform the duties within 1 year
d. it would take no one more than a year to perform
e. in the past, no one has performed a similar contract within 1
year
87) In order to satisfy the Statute of Frauds sufficiency of
writing requirement, generally a writing
must:
a. be a formal, written document
b. be any written memorandum containing the essential terms
of the parties’ agreement
c. be signed by the party against whom enforcement is sought
d. B and C
e. A and B
36. 88) Which of the following is not a general rule of contract
interpretation?
a. Ordinary words are given their ordinary dictionary
definition.
b. Specific terms qualify or override general terms.
c. Handwritten terms prevail over printed terms.
d. Ambiguities in a contract are resolved in favor of the party
who drafted the contract.
21
Final Examination
BAM 317 Business Law
89) If a contract is silent about assignment and delegation,
which of the following is generally
true?
a. The rights can be assigned and the duties can be delegated.
b. The rights can be assigned and the duties can be delegated,
but neither can occur
without the other also occurring.
c. The rights can be assigned, but the duties cannot be
delegated.
d. The rights cannot be assigned, but the duties can be
delegated.
e. The rights cannot be assigned, nor can the duties be
delegated.
90) Under a mutual rescission, the parties to a contract:
37. a. agree to new terms
b. involve a third party in the contract
c. agree to undo and cancel a contract
d. agree to perform a contract a second time under the same
terms as the original
91) Buyer and seller enter into an agreement to sell a mobile
home and lot. Before the deed can
be signed, the mobile home is destroyed by a tornado. Which of
the following doctrines would
most likely allow the buyer to avoid his contractual obligations?
a. impossibility
b. commercial impracticality
c. frustration of purpose
d. failure of a condition precedent
e. novation
92) ___________________ occurs if a contract becomes
impossible to perform.
a. frustration of purpose
b. commercial impracticability
c. impossibility of performance
d. failure of illegality
93) Specific performance is generally awarded:
a. in cases where nominal damages are also awarded
b. where the contract involves the sale of property that is
unique
c. only under the UCC
d. when the nonbreaching party requests it
e. only if provided for in a liquidated damages clause
38. Final Examination
22
BAM 317 Business Law
94) When a court rewrites a contract to express the parties’ true
intentions, what remedy has it
used?
a. reformation
b. restitution
c. specific performance
d. substituted contract
e. quasi-contract
95) Henry took his Porsche to the shop for repairs, but it was
not ready on Friday afternoon as
had been agreed to. Henry was then unable to rent the car to his
sister on Saturday for $400 to
use in her wedding. Henry paid $60 to rent a car on Sunday for
a trip to the mountains. The car
repair shop knew about neither of Henry’s planned uses of the
car that weekend. Which is true?
a. Henry can collect for neither amount because the car repair
shop was unaware of them.
b. Henry can collect for both amounts because the shop was the
cause of his losses.
c. Henry can collect for the car rental, but not for the money
his sister would have paid.
d. Henry can collect for both amounts and will likely recover
punitive damages as well.
e. Henry can collect nothing because his greediness with his
sister is against public
39. policy.
96) Michelle is hired as a corporate executive for a large
corporation. She signed a three-year
contract that will pay her $10,000 per month. Six months into
the contract, the company uni-
laterally terminates the contract due to concerns over the
company’s future. How much money
should Michelle be entitled to?
a. $10,000
b. $60,000
c. $300,000
d. $360,000
e. None. The contract was terminated in good faith.
97) Which of the following best describes how e-mail contracts
are viewed under the law?
a. E-mail contracts are not usually valid because of the ease of
deleting e-mail messages.
b. E-mail contracts for goods can be valid, but not e-mail
contracts for services.
c. E-mail contracts are valid only for contracts less than $500.
d. E-mail contracts are valid so long as both parties sign a
written copy printed out from
the e-mail.
e. E-mail contracts are generally treated similarly to contracts
negotiated by other means.
23
Final Examination
40. BAM 317 Business Law
98) In order to obtain a domain name, one must:
a. obtain clearance that the name is not confusingly similar to
another name, and pay the
appropriate fee
b. apply for the name and, if within the waiting period, there
are no objections to the
applicant taking the name, pay the appropriate fee
c. verify that the name is not already taken, directly notify
parties who might object to
obtain their waiver of objection, and pay the appropriate fee
d. verify that the name is not already taken and pay the
appropriate fee or, if already
taken, negotiate to purchase the name from its current owner
e. apply for the name, state the purpose for which the name will
be used, and if the use is
approved, pay the appropriate fee
99) A _______________ is a detailed and comprehensive
written agreement between a licensor
and a licensee that sets forth the express terms of their
agreement.
a. licensing agreement
b. remote site license
c. noncarrier software contract
d. periodic use site license
100) Under the Electronic Signature in Global and National
Commerce Act, electronic signatures
can be verified by the following methods except:
a. by a secret password known by the signatory
b. by a digitally encoded smart card belonging to the signatory
41. c. by the use of a device that electronically recognizes
fingerprints or parts of the eye
d. by the use of a notary public to check digital identifying
information