Final Assignment
Final Assignment
3
Company Address?
Date?
Inside Address?
Salutation?
Phoenix Advertising is a company established in North Carolina. According to the information given, it is evident that your branch is facing a number of challenges, which need to be attended to with immediate effect. Recently, two top management employees have left the company to join a competing firm; others are also threatening to leave the company.
Background
From the reports evaluated, there are factors that are leading to reassignment of the employees to rival companies. From the case scenario presented, it is evident that the top management fails to involve the junior employees as make most of the important decisions without consulting them. When the employees feel left out, they hardly perform, as they feel ignored most of the time. Secondly, the company focuses on increasing their levels of profitability. Hence, it is taking a lot of work from all potential clients without necessarily evaluating the accounts and the workload. This causes the employees responsible for working for ling hours with minimal compensation. In my opinion, this could be the reason for low morale and decrease in production.
Firstly, there is weak leadership, which fails to involve employees at all levels in the company. This can be seen from the way the management take lots work from all different clients without necessarily evaluating the accounts and workload. Secondly, there is poor communication between all levels. The top management does communicate with junior employees, and it fails to encourage their work and efforts. This is the reason they end up editing their work without consulting them. Further, the company is contracting more clients than it can handle with the current personnel.
The top management of the company should embrace real leadership and administration. To be precise, the management should and must effectively communicate with employees on all their levels. This could be achieved best by outlining their roles and responsibilities. It should also provide better means of evaluation and reporting of every employee. The heads of various departments should also work closely with their employees at make any changes in their works with their consultations in order to value their efforts at different levels (Schein, 1985).
Further, due to the increased volumes of workload, the management should also offer enough compensation to all employees by paying them for any overtime work from them. This could be achieved by improving the terms of the contract. Additionally, the company should provide an excellent working environment where the employees are comfortable. The management should also aim at improving human capital through ore training and development. This is because in the world of advertising, technology is changing the dynamics day by day. A specific timeline should be set in order to e ...
Sample job description (for format and content) job tiAKHIL969626
The supervisor plans goals and allocates resources to achieve them. They supervise employees, providing feedback and coaching to develop their skills. The supervisor must maintain accurate records and coordinate with others to optimize the use of organizational resources.
1 BUS B899F Assignment 1 Date due 28 November 2019.docxjeremylockett77
1
BUS B899F Assignment 1
Date due: 28 November 2019 (Thursday) 5 December 2019
Weighting: 5% of the total marks for this course
Length: You are advised to write no more than 3,000 words for this assignment.
Important note:
a. As a mechanism to maintain academic integrity, students are required to
submit both hard and soft copies of their assignments as below:
i. Submission of soft copy
Students should upload the Originality Report, which is downloaded after
processing by the Turnitin, to the OLE of the course by 6:00 pm on the
submission due date. The Originality Report uploaded to the OLE should
be in pdf format, contains the content of the student’s assignment, the
results of an originality check with highlight of matching text. The user
guide of Turnitin is available on the OLE for reference.
Students should upload a soft copy of the assignment to the OLE of the
course by 5:00 pm on the submission due date. Files uploaded to the OLE
should be prepared in Microsoft Word. Please refer to the quick start
guide for submission of assignments to Turnitin.
ii. Submission of hard copy
Students should put a hard copy of the Turnitin Originality Report, in the
collection box on 8/F in Block A or 7/F in Block B by 6:00 pm on the
assignment due date.
iii. 10% of the marks awarded to the assignment will be deducted for each
day it is overdue until both hard and soft copies are submitted the soft
copy is submitted.
Students are allowed to upload their work in Turnitin once per
assignment. Please don’t upload the work to Turnitin in the last minutes
as it takes time to generate the Originality Report. Students must ensure
that the content of both the hard and soft copy are identical. In case of
discrepancies between the two copies, only the hard copies of your
assignment with the Turnitin Originality Report will be graded and
returned.
b. Please include a word count at the end of your assignment. Please note that
the tutor is given the discretion to deduct marks for exceeding the word limit
2
or to disregard the content after the word limit is reached.
3
Tasks: (100 marks)
Before you write this assignment, please consider some issues relating to
business ideas, including formulating a business idea; exploring and clarifying
the possible problems associated with the idea; and evaluating the idea.
This assignment should include business proposal sections 2-4 (see the appendix
for details):
1. Introduction, including the reader to your business idea and preview of
content of the proposal; (20 marks)
2. Company overview, including company profile/proposed organization, and
the mission, vision and goals of the business; (30 marks)
3. Proposed business, including purposes and values of the business, proposed
product/service, target customer, core competences for achieving the
business goals etc. (50 marks)
Points of Ad ...
Sapna Ramesh is seeking a position that allows her to utilize her 11 years of experience in operations, business analysis, project management, and reporting at Fidelity Investments. She has a variety of skills including communication, analytical abilities, and project management. Her career at Fidelity has included roles in business analysis, program management, operations, and reporting where she has led projects, developed reports and dashboards, and ensured compliance.
This position is responsible for leading a team of business analysts in solution delivery. The role involves supervising the team and their talent development, ensuring project delivery according to expectations, and scheduling projects and resources. The position requires collaboration with internal and external stakeholders, and challenges include leading change, building relationships while managing scope, and influencing teams.
Formal Proposal Instructions—Part 2For Part 2 of the formal prop.docxhanneloremccaffery
Formal Proposal Instructions—Part 2
For Part 2 of the formal proposal, you must submit the corrected Part 1 along with the remainder of the required elements in a formal proposal. Follow the instructions below for the scenario you selected last week. Complete and compile approximately 10 pages as your formal proposal.
University-Related Proposal
You have already chosen from 3 of the following areas:
1. Operating procedures
1. Admissions
1. Academic advising
1. Curricula
1. Activities
1. Physical plant
1. Communication with online students
For Part 2 of this assignment, you must include changes or corrections recommended by your instructor in Part 1 and prepare the following:
· a letter of transmittal, using the example in your textbook
· a table of contents and list of illustrations (if appropriate)
· an executive summary
· no fewer than two full references to citations that support your recommendations
Part 2 of your formal proposal is due by 11:59 p.m. (ET) on Monday of Module/Week 7.
In your letter of transmittal, send your complete proposal to the provost of Liberty University and write as though you were an outside consultant for University Consultants at 12099 Center Road, San Antonio, Texas 78223-9310. Be sure that you include the complete formal proposal, including both parts 1 and 2.
OR
Consultant training course
Complete and compile a formal proposal recommending a one-week training course in an organization of your choosing. Assume you are a consultant offering to have your company present this training.
You have chosen a seminar topic familiar to you or one that you’re willing to learn about quickly through some research. Your formal proposal should reflect your understanding of the topic and your grasp of proposal-writing techniques.
For Part 2 of this assignment, you must include changes or corrections recommended by your instructor in Part 1 and prepare the following:
· a letter of transmittal, using the example in your textbook
· a table of contents and list of illustrations (if appropriate)
· an executive summary
· no fewer than two full references to citations that support your recommendations
Part 2 of your formal proposal is due by 11:59 p.m. (ET) on Monday of Module/Week 7.
In your transmittal letter, send your proposal to the Chief Operating Officer of Globtex International Inc., 800 Connecticut Avenue NW, Washington D.C. 20006-2709 as your audience for this proposal, and write as though you were an outside consultant working for Mar-Tek Consulting at 12099 Center Road, San Antonio, Texas 78223-9310. Be sure that you include the complete formal proposal, including both parts 1 and 2.
ENGL 103
Formal Proposal Grading Rubric—Part 2
Student:
Criteria
Advanced
Competent
Novice
Points Earned
Instructor Comments
Correct format for formal proposal
30-35 pts.
20-29 pts.
0-19 pts.
All formatting is correct and appropriate for formal proposals.
Most formatting is correct with some exceptions and generally ap ...
How do you get greater productivity out of your already existing workforce? The answer is education and learning. Learning is the equivalent of a software upgrade for the human mind, which makes your workforce capable of doing more tasks, or tasks faster because more people have the required skills to do different tasks. Deploying a Business Learning System therefore creates flexibility and is a great moral booster, and helps employee retention and succession planning alike. The presentation explains how to deploy a BLS, and why you should. If you like what you see, than don't be afraid to contact me at honestvalu@gmail.com, to either deploy a BLS at your work, produce a educational presentation for your company training needs, or other educational, promotional, or Consulting needs. Remember... We always give you an Honest Value!
This document provides information on developing an HR plan for a company, including job descriptions, recruitment, compensation, orientation, and staff development. It describes opening 3 senior analyst positions in business analytics at a development center in Bangalore, India. It outlines the job responsibilities, requirements, recruitment process including advertising, application screening, selection tests and interviews. It also details compensation including base salary, bonuses, benefits, and a staff orientation plan to onboard new employees. The document aims to develop a comprehensive HR plan to recruit and integrate new hires effectively.
Sample job description (for format and content) job tiAKHIL969626
The supervisor plans goals and allocates resources to achieve them. They supervise employees, providing feedback and coaching to develop their skills. The supervisor must maintain accurate records and coordinate with others to optimize the use of organizational resources.
1 BUS B899F Assignment 1 Date due 28 November 2019.docxjeremylockett77
1
BUS B899F Assignment 1
Date due: 28 November 2019 (Thursday) 5 December 2019
Weighting: 5% of the total marks for this course
Length: You are advised to write no more than 3,000 words for this assignment.
Important note:
a. As a mechanism to maintain academic integrity, students are required to
submit both hard and soft copies of their assignments as below:
i. Submission of soft copy
Students should upload the Originality Report, which is downloaded after
processing by the Turnitin, to the OLE of the course by 6:00 pm on the
submission due date. The Originality Report uploaded to the OLE should
be in pdf format, contains the content of the student’s assignment, the
results of an originality check with highlight of matching text. The user
guide of Turnitin is available on the OLE for reference.
Students should upload a soft copy of the assignment to the OLE of the
course by 5:00 pm on the submission due date. Files uploaded to the OLE
should be prepared in Microsoft Word. Please refer to the quick start
guide for submission of assignments to Turnitin.
ii. Submission of hard copy
Students should put a hard copy of the Turnitin Originality Report, in the
collection box on 8/F in Block A or 7/F in Block B by 6:00 pm on the
assignment due date.
iii. 10% of the marks awarded to the assignment will be deducted for each
day it is overdue until both hard and soft copies are submitted the soft
copy is submitted.
Students are allowed to upload their work in Turnitin once per
assignment. Please don’t upload the work to Turnitin in the last minutes
as it takes time to generate the Originality Report. Students must ensure
that the content of both the hard and soft copy are identical. In case of
discrepancies between the two copies, only the hard copies of your
assignment with the Turnitin Originality Report will be graded and
returned.
b. Please include a word count at the end of your assignment. Please note that
the tutor is given the discretion to deduct marks for exceeding the word limit
2
or to disregard the content after the word limit is reached.
3
Tasks: (100 marks)
Before you write this assignment, please consider some issues relating to
business ideas, including formulating a business idea; exploring and clarifying
the possible problems associated with the idea; and evaluating the idea.
This assignment should include business proposal sections 2-4 (see the appendix
for details):
1. Introduction, including the reader to your business idea and preview of
content of the proposal; (20 marks)
2. Company overview, including company profile/proposed organization, and
the mission, vision and goals of the business; (30 marks)
3. Proposed business, including purposes and values of the business, proposed
product/service, target customer, core competences for achieving the
business goals etc. (50 marks)
Points of Ad ...
Sapna Ramesh is seeking a position that allows her to utilize her 11 years of experience in operations, business analysis, project management, and reporting at Fidelity Investments. She has a variety of skills including communication, analytical abilities, and project management. Her career at Fidelity has included roles in business analysis, program management, operations, and reporting where she has led projects, developed reports and dashboards, and ensured compliance.
This position is responsible for leading a team of business analysts in solution delivery. The role involves supervising the team and their talent development, ensuring project delivery according to expectations, and scheduling projects and resources. The position requires collaboration with internal and external stakeholders, and challenges include leading change, building relationships while managing scope, and influencing teams.
Formal Proposal Instructions—Part 2For Part 2 of the formal prop.docxhanneloremccaffery
Formal Proposal Instructions—Part 2
For Part 2 of the formal proposal, you must submit the corrected Part 1 along with the remainder of the required elements in a formal proposal. Follow the instructions below for the scenario you selected last week. Complete and compile approximately 10 pages as your formal proposal.
University-Related Proposal
You have already chosen from 3 of the following areas:
1. Operating procedures
1. Admissions
1. Academic advising
1. Curricula
1. Activities
1. Physical plant
1. Communication with online students
For Part 2 of this assignment, you must include changes or corrections recommended by your instructor in Part 1 and prepare the following:
· a letter of transmittal, using the example in your textbook
· a table of contents and list of illustrations (if appropriate)
· an executive summary
· no fewer than two full references to citations that support your recommendations
Part 2 of your formal proposal is due by 11:59 p.m. (ET) on Monday of Module/Week 7.
In your letter of transmittal, send your complete proposal to the provost of Liberty University and write as though you were an outside consultant for University Consultants at 12099 Center Road, San Antonio, Texas 78223-9310. Be sure that you include the complete formal proposal, including both parts 1 and 2.
OR
Consultant training course
Complete and compile a formal proposal recommending a one-week training course in an organization of your choosing. Assume you are a consultant offering to have your company present this training.
You have chosen a seminar topic familiar to you or one that you’re willing to learn about quickly through some research. Your formal proposal should reflect your understanding of the topic and your grasp of proposal-writing techniques.
For Part 2 of this assignment, you must include changes or corrections recommended by your instructor in Part 1 and prepare the following:
· a letter of transmittal, using the example in your textbook
· a table of contents and list of illustrations (if appropriate)
· an executive summary
· no fewer than two full references to citations that support your recommendations
Part 2 of your formal proposal is due by 11:59 p.m. (ET) on Monday of Module/Week 7.
In your transmittal letter, send your proposal to the Chief Operating Officer of Globtex International Inc., 800 Connecticut Avenue NW, Washington D.C. 20006-2709 as your audience for this proposal, and write as though you were an outside consultant working for Mar-Tek Consulting at 12099 Center Road, San Antonio, Texas 78223-9310. Be sure that you include the complete formal proposal, including both parts 1 and 2.
ENGL 103
Formal Proposal Grading Rubric—Part 2
Student:
Criteria
Advanced
Competent
Novice
Points Earned
Instructor Comments
Correct format for formal proposal
30-35 pts.
20-29 pts.
0-19 pts.
All formatting is correct and appropriate for formal proposals.
Most formatting is correct with some exceptions and generally ap ...
How do you get greater productivity out of your already existing workforce? The answer is education and learning. Learning is the equivalent of a software upgrade for the human mind, which makes your workforce capable of doing more tasks, or tasks faster because more people have the required skills to do different tasks. Deploying a Business Learning System therefore creates flexibility and is a great moral booster, and helps employee retention and succession planning alike. The presentation explains how to deploy a BLS, and why you should. If you like what you see, than don't be afraid to contact me at honestvalu@gmail.com, to either deploy a BLS at your work, produce a educational presentation for your company training needs, or other educational, promotional, or Consulting needs. Remember... We always give you an Honest Value!
This document provides information on developing an HR plan for a company, including job descriptions, recruitment, compensation, orientation, and staff development. It describes opening 3 senior analyst positions in business analytics at a development center in Bangalore, India. It outlines the job responsibilities, requirements, recruitment process including advertising, application screening, selection tests and interviews. It also details compensation including base salary, bonuses, benefits, and a staff orientation plan to onboard new employees. The document aims to develop a comprehensive HR plan to recruit and integrate new hires effectively.
The document discusses a project plan for managing call center operations during busy holiday periods like Christmas. It identifies four types of accounts based on whether they have staffing issues, call volume issues, or both. For each account type, it recommends an action plan to address issues like absenteeism, adherence, attrition, average handling time, and not ready time that could impact key performance indicators. The action plans focus on motivation, monitoring productivity metrics, managing overtime, and maintaining transparency with clients. The goal is to have the right workforce management strategies in place to absorb increased call volumes without additional costs and deliver expected service levels during busy times.
Bsc how to fill initiatives templates-14 june10Ajoy Jauhar
The document provides guidance on how to effectively plan projects and initiatives using templates. It outlines key elements to include such as objectives, organizational structure, budgets, milestones, risks, communication plans, and metrics to measure performance. Templates are included to help capture this essential information to ensure projects are well-planned and deliver desired results.
DeVry UniversityCourse ProjectBUSN278 Budgeting and Forecastin.docxduketjoy27252
DeVry University
Course Project
BUSN278 Budgeting and Forecasting
Student Project Activity – Week 2
A. Week 2: Budget ProposalSection 2.0 Sales Forecast
B. TCOs Addressed:
TCO 5: Given a new business startup or new product introduction and the need to make a forecast when historical data is not available, create the forecast for the organization.
TCO 10: Given a description of a new business, new product, service or project develop, present and defend the budget.
C. Project Activity Overview – Scenario / Summary:
Last week, you selected a business for which you’ll make a budget proposal. Your first step is to create a sales forecast (in sales dollars) when no historical data is available. Use methods such as historical analogy, expert judgment, consumer surveys, the Delphi method, or calculations based on population distributions, estimated growth rates, or expected market penetration rates to arrive at reasonable sales figures for your business for the next 5 years.
Use the Budget Proposal Workbook.xlsx and Budget Proposal Template.docx.
D. Deliverables:
Complete Section 2.0 (including sections 2.1 and 2.2) in the Budget Proposal Template.docx after doing research and performing calculations to arrive at your 5 year forecast. Also, provide calculations in the Budget Proposal Workbook.xlsx.
Add section 2.0 to your Budget Proposal Template and save it as YourName_Project_WK2.docx. Save your sales forecast in the worksheet tab labeled Section 2.1 and 2.2as YourName_Worksheet_WK2.xlsx and upload both files to the Week 2 Project Dropbox.
E.
Project Tasks:
Task 1:
Download Budget Proposal Workbook.xlsx from DocSharing.
Task 2:
Research the area in which your business is located, and do calculations in the Excel workbook which produce a reasonable dollar value forecast based on population size, growth rates, an estimate of the percent of the population expected to purchase your product, and the dollar value of the average sale over the 5 year planning horizon. Do these calculations in the Section 2.1 and 2.2 tab of the Budget Proposal Workbook.xlsx. Also, feel free to use other methods described in this course you feel are appropriate to estimate sales for your new business startup’s first five years.
Task 3:
Write section 2.1 and 2.2 of the Budget Proposal Template.docx document, summarizing your forecast in a table, and also describing and justifying your methodology for arriving at the sales forecast. Follow the instructions in section 2.0 of the Budget Proposal Template.docx when writing these sections. Also, update your works cited Section 6.0 in the template with any research you did.
Task 4:
Paste the first paragraph of the 1.0 Executive Summary template into the Budget Proposal Template.docx so your professor is reminded which business you’re doing.
Task 5:
Save the draft of the Budget Proposal Word document and Budget Proposal Excel calculation and submit it to the Week 2 Project Dropbox.
F. Grading Crit.
- The performance appraisal form used by CRB, Inc. evaluates employees on attributes like knowledge, communication skills, work results, work style, and service orientation. The form is completed by both the supervisor (Al Brown) and the employee (Bob Jared).
- Al gives Bob positive ratings for his technical skills and work results but notes issues with anger management and paperwork. Bob believes his performance exceeds requirements.
- An appropriate overall success rating for Bob would be a 2.5, as Al acknowledges Bob's valuable contributions but also weaknesses that occasionally impact performance.
- Performance appraisals should be conducted at least semi-annually to provide regular feedback and ensure goals are being met.
The document discusses best practices for engaging pricing consultants to achieve mutually successful project outcomes. It provides examples of pricing consulting projects, outlines factors for success like clear roles and senior management support, and shares insights from a practitioner survey. The survey found regular progress reporting and a pre-determined implementation plan were critical, while ownership and follow-through by the client were also important.
Performance pionts program Template by Florence Vorster 2016FLORENCE VORSTER
Each branding employee will begin the year with zero points in their "Points Wallet". Points can be deducted for counterproductive behaviors or added for productive behaviors. A progressive disciplinary process is tied to point balances. Supervisors will monitor point balances and provide feedback. Employees can dispute point deductions. Point balances will determine performance bonuses and eligibility for training opportunities at mid-year and year-end. The program aims to motivate high performance throughout the year.
This document provides an overview of key concepts in human resource management including human resource planning, job analysis, job descriptions, and job specifications. It discusses how human resource planning helps organizations forecast future staffing needs and how job analysis informs the creation of job descriptions that define roles and job specifications that outline required qualifications. Examples of each are also included to illustrate how they are developed and applied in practice.
i have my paper done already but i need someone.docxwrite4
1) The document provides guidelines for a capstone project consisting of a business implementation plan and audiovisual presentation.
2) The business implementation plan must include an executive summary, justification, implementation plan, financial analysis, discussion of key personnel and company, and assumptions/contingency planning.
3) The audiovisual presentation will allow the student to pitch their business concept to potential investors or executives and convince them to support the idea.
Chick-fil-A Training Program DevelopmentRunning head .docxchristinemaritza
Chick-fil-A Training Program Development
Running head: CHIK-FIL-A TRAINING PROGRAM DEVELOPMENT
1
CHIK-FIL-A TRAINING PROGRAM DEVELOPMENT
2
Chick-fil-A Training Program Development
Introduction
Chick-fil-A is an organization that continues to grow and expand nationwide and as a result, the organization must develop a training program that can be utilized at every location. As a consultant, one of the first steps to complete when starting a new project is to assemble a SWOT Analysis as well as to prepare a Balanced Scorecard and Casual Chain Score card.
SWOT analysis
To ensure a successful consulting project the consultants must conduct an in depth analysis of the company and where the training program will lead it. The analysis of strengths, weakness, opportunities and threats will provide guidance to develop the program and other tools to evaluate its performance. The consulting project strengths will attract new customers and maintain already existing fans. The consulting project will add to their current position in the industry by focusing on personalized customer service. The second strength is employee involvement. Involvement of all levels will provide higher approval and success percentages. The program will also provide employees a completion timeline, and require them to evaluate the training they received. Evaluation will provide feedback on the training programs pertinence to restaurant operations.
One of Chik-fil-A’s weaknesses is the public relations nightmare which occurred when the CEO, Dan Cathy, admitted to opposing same-sex marriage. As a result the company faced public scorn and a lost profits. Employees and customers alike also took this as acceptance of bigoted behavior towards LGBT employees or customers. The new training program will need to address the side effects of their CEOs comments. The consultant’s must ensure the program addresses a culture of inclusion and acceptance to counteract the CEO’s comments. Failure to do so could exacerbate the public’s view of the company’s attitude towards the communities they serve. The program’s second weakness will be the time required for each employee to complete the training program, learning the new procedures and standards of performance, and then any time spent afterwards providing an evaluation.
The company has various opportunities such as the increase of menu items, expansion and customer service improvement. The consulting project will develop a training program focused on adding to the customer experience. The biggest opportunity offered by the training program is the opportunity to develop a way to evaluate employee’s performance. Finding a way to evaluate performance is essential to evaluating overall productivity (Markham, 2005, p.33).
It will also allow the company to improve on operational processes affecting customer service. Re-enforcing the customer service experience by new training procedures will increase the market share and brand relevanc ...
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
More Related Content
Similar to Final Assignment Final Assignment .docx
The document discusses a project plan for managing call center operations during busy holiday periods like Christmas. It identifies four types of accounts based on whether they have staffing issues, call volume issues, or both. For each account type, it recommends an action plan to address issues like absenteeism, adherence, attrition, average handling time, and not ready time that could impact key performance indicators. The action plans focus on motivation, monitoring productivity metrics, managing overtime, and maintaining transparency with clients. The goal is to have the right workforce management strategies in place to absorb increased call volumes without additional costs and deliver expected service levels during busy times.
Bsc how to fill initiatives templates-14 june10Ajoy Jauhar
The document provides guidance on how to effectively plan projects and initiatives using templates. It outlines key elements to include such as objectives, organizational structure, budgets, milestones, risks, communication plans, and metrics to measure performance. Templates are included to help capture this essential information to ensure projects are well-planned and deliver desired results.
DeVry UniversityCourse ProjectBUSN278 Budgeting and Forecastin.docxduketjoy27252
DeVry University
Course Project
BUSN278 Budgeting and Forecasting
Student Project Activity – Week 2
A. Week 2: Budget ProposalSection 2.0 Sales Forecast
B. TCOs Addressed:
TCO 5: Given a new business startup or new product introduction and the need to make a forecast when historical data is not available, create the forecast for the organization.
TCO 10: Given a description of a new business, new product, service or project develop, present and defend the budget.
C. Project Activity Overview – Scenario / Summary:
Last week, you selected a business for which you’ll make a budget proposal. Your first step is to create a sales forecast (in sales dollars) when no historical data is available. Use methods such as historical analogy, expert judgment, consumer surveys, the Delphi method, or calculations based on population distributions, estimated growth rates, or expected market penetration rates to arrive at reasonable sales figures for your business for the next 5 years.
Use the Budget Proposal Workbook.xlsx and Budget Proposal Template.docx.
D. Deliverables:
Complete Section 2.0 (including sections 2.1 and 2.2) in the Budget Proposal Template.docx after doing research and performing calculations to arrive at your 5 year forecast. Also, provide calculations in the Budget Proposal Workbook.xlsx.
Add section 2.0 to your Budget Proposal Template and save it as YourName_Project_WK2.docx. Save your sales forecast in the worksheet tab labeled Section 2.1 and 2.2as YourName_Worksheet_WK2.xlsx and upload both files to the Week 2 Project Dropbox.
E.
Project Tasks:
Task 1:
Download Budget Proposal Workbook.xlsx from DocSharing.
Task 2:
Research the area in which your business is located, and do calculations in the Excel workbook which produce a reasonable dollar value forecast based on population size, growth rates, an estimate of the percent of the population expected to purchase your product, and the dollar value of the average sale over the 5 year planning horizon. Do these calculations in the Section 2.1 and 2.2 tab of the Budget Proposal Workbook.xlsx. Also, feel free to use other methods described in this course you feel are appropriate to estimate sales for your new business startup’s first five years.
Task 3:
Write section 2.1 and 2.2 of the Budget Proposal Template.docx document, summarizing your forecast in a table, and also describing and justifying your methodology for arriving at the sales forecast. Follow the instructions in section 2.0 of the Budget Proposal Template.docx when writing these sections. Also, update your works cited Section 6.0 in the template with any research you did.
Task 4:
Paste the first paragraph of the 1.0 Executive Summary template into the Budget Proposal Template.docx so your professor is reminded which business you’re doing.
Task 5:
Save the draft of the Budget Proposal Word document and Budget Proposal Excel calculation and submit it to the Week 2 Project Dropbox.
F. Grading Crit.
- The performance appraisal form used by CRB, Inc. evaluates employees on attributes like knowledge, communication skills, work results, work style, and service orientation. The form is completed by both the supervisor (Al Brown) and the employee (Bob Jared).
- Al gives Bob positive ratings for his technical skills and work results but notes issues with anger management and paperwork. Bob believes his performance exceeds requirements.
- An appropriate overall success rating for Bob would be a 2.5, as Al acknowledges Bob's valuable contributions but also weaknesses that occasionally impact performance.
- Performance appraisals should be conducted at least semi-annually to provide regular feedback and ensure goals are being met.
The document discusses best practices for engaging pricing consultants to achieve mutually successful project outcomes. It provides examples of pricing consulting projects, outlines factors for success like clear roles and senior management support, and shares insights from a practitioner survey. The survey found regular progress reporting and a pre-determined implementation plan were critical, while ownership and follow-through by the client were also important.
Performance pionts program Template by Florence Vorster 2016FLORENCE VORSTER
Each branding employee will begin the year with zero points in their "Points Wallet". Points can be deducted for counterproductive behaviors or added for productive behaviors. A progressive disciplinary process is tied to point balances. Supervisors will monitor point balances and provide feedback. Employees can dispute point deductions. Point balances will determine performance bonuses and eligibility for training opportunities at mid-year and year-end. The program aims to motivate high performance throughout the year.
This document provides an overview of key concepts in human resource management including human resource planning, job analysis, job descriptions, and job specifications. It discusses how human resource planning helps organizations forecast future staffing needs and how job analysis informs the creation of job descriptions that define roles and job specifications that outline required qualifications. Examples of each are also included to illustrate how they are developed and applied in practice.
i have my paper done already but i need someone.docxwrite4
1) The document provides guidelines for a capstone project consisting of a business implementation plan and audiovisual presentation.
2) The business implementation plan must include an executive summary, justification, implementation plan, financial analysis, discussion of key personnel and company, and assumptions/contingency planning.
3) The audiovisual presentation will allow the student to pitch their business concept to potential investors or executives and convince them to support the idea.
Chick-fil-A Training Program DevelopmentRunning head .docxchristinemaritza
Chick-fil-A Training Program Development
Running head: CHIK-FIL-A TRAINING PROGRAM DEVELOPMENT
1
CHIK-FIL-A TRAINING PROGRAM DEVELOPMENT
2
Chick-fil-A Training Program Development
Introduction
Chick-fil-A is an organization that continues to grow and expand nationwide and as a result, the organization must develop a training program that can be utilized at every location. As a consultant, one of the first steps to complete when starting a new project is to assemble a SWOT Analysis as well as to prepare a Balanced Scorecard and Casual Chain Score card.
SWOT analysis
To ensure a successful consulting project the consultants must conduct an in depth analysis of the company and where the training program will lead it. The analysis of strengths, weakness, opportunities and threats will provide guidance to develop the program and other tools to evaluate its performance. The consulting project strengths will attract new customers and maintain already existing fans. The consulting project will add to their current position in the industry by focusing on personalized customer service. The second strength is employee involvement. Involvement of all levels will provide higher approval and success percentages. The program will also provide employees a completion timeline, and require them to evaluate the training they received. Evaluation will provide feedback on the training programs pertinence to restaurant operations.
One of Chik-fil-A’s weaknesses is the public relations nightmare which occurred when the CEO, Dan Cathy, admitted to opposing same-sex marriage. As a result the company faced public scorn and a lost profits. Employees and customers alike also took this as acceptance of bigoted behavior towards LGBT employees or customers. The new training program will need to address the side effects of their CEOs comments. The consultant’s must ensure the program addresses a culture of inclusion and acceptance to counteract the CEO’s comments. Failure to do so could exacerbate the public’s view of the company’s attitude towards the communities they serve. The program’s second weakness will be the time required for each employee to complete the training program, learning the new procedures and standards of performance, and then any time spent afterwards providing an evaluation.
The company has various opportunities such as the increase of menu items, expansion and customer service improvement. The consulting project will develop a training program focused on adding to the customer experience. The biggest opportunity offered by the training program is the opportunity to develop a way to evaluate employee’s performance. Finding a way to evaluate performance is essential to evaluating overall productivity (Markham, 2005, p.33).
It will also allow the company to improve on operational processes affecting customer service. Re-enforcing the customer service experience by new training procedures will increase the market share and brand relevanc ...
Similar to Final Assignment Final Assignment .docx (9)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
The simplified electron and muon model, Oscillating Spacetime: The Foundation...RitikBhardwaj56
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
Executive Directors Chat Leveraging AI for Diversity, Equity, and InclusionTechSoup
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
How to Setup Warehouse & Location in Odoo 17 InventoryCeline George
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
1. Final Assignment
Final Assignment
3
Company Address?
Date?
Inside Address?
Salutation?
Phoenix Advertising is a company established in North
Carolina. According to the information given, it is evident that
your branch is facing a number of challenges, which need to be
attended to with immediate effect. Recently, two top
management employees have left the company to join a
competing firm; others are also threatening to leave the
company.
Background
From the reports evaluated, there are factors that are leading to
reassignment of the employees to rival companies. From the
case scenario presented, it is evident that the top management
fails to involve the junior employees as make most of the
important decisions without consulting them. When the
employees feel left out, they hardly perform, as they feel
ignored most of the time. Secondly, the company focuses on
increasing their levels of profitability. Hence, it is taking a lot
of work from all potential clients without necessarily evaluating
the accounts and the workload. This causes the employees
responsible for working for ling hours with minimal
compensation. In my opinion, this could be the reason for low
morale and decrease in production.
Firstly, there is weak leadership, which fails to involve
2. employees at all levels in the company. This can be seen from
the way the management take lots work from all different
clients without necessarily evaluating the accounts and
workload. Secondly, there is poor communication between all
levels. The top management does communicate with junior
employees, and it fails to encourage their work and efforts. This
is the reason they end up editing their work without consulting
them. Further, the company is contracting more clients than it
can handle with the current personnel.
The top management of the company should embrace real
leadership and administration. To be precise, the management
should and must effectively communicate with employees on all
their levels. This could be achieved best by outlining their roles
and responsibilities. It should also provide better means of
evaluation and reporting of every employee. The heads of
various departments should also work closely with their
employees at make any changes in their works with their
consultations in order to value their efforts at different levels
(Schein, 1985).
Further, due to the increased volumes of workload, the
management should also offer enough compensation to all
employees by paying them for any overtime work from them.
This could be achieved by improving the terms of the contract.
Additionally, the company should provide an excellent working
environment where the employees are comfortable. The
management should also aim at improving human capital
through ore training and development. This is because in the
world of advertising, technology is changing the dynamics day
by day. A specific timeline should be set in order to ensure that
all these goals and objectives are achieved on time. The
company also has to take considerations of the competitive
environment where it is operating on. Hence, losing their clients
to their competitors can be a threat, and the company should
look into this in time.
3. Proposal
In order to accomplish my plan at Roanoke, I will need a team
of people who will work with different divisions in order to
bring the best output. All the employees will be from the
company. Sales and marketing representatives of the enterprise,
customer relation’s officers, editors, ICT persons, and the
technical personnel have the right skills to carry out the tasks.
Most of them are in the middle stage of career development. For
this reason, they are aware of all their roles and responsibilities.
Every employee will be assigned a particular a role that he or is
supposed to achieve within the set timeline. Department's heads
are expected to oversee the implementation of each phase of the
project. Progress reports should also be done and evaluated on a
timely basis before the project is complete. My role in this task
is to supervise all operations and ensure that all the responsible
parties play their part well by ensuring that they perform
different functions and responsibilities in the right way.
Schedule
A schedule of how the project will be conducted and the
specific timelines will also be set in order to ensure that the
project is completed on time. Depending on the role and input
of different employees and departments, all the work will be
divided, and a deadline set in very case. Reports should be
availed in time in order to assess the level of progress of the
project and improve the evaluation process.
Staffing
All the employees involved in the project will come from the
company from different departments. However, in case there
will be a need for additional employees, the budget will take
care of their costs.
Budget
Item
Cost
Employees in concerned departments
4. - $4000
New and loss of employees
- $1500
Travelling expenses
- $2200
Advertising
- $5000
Labor and Equipment
- $7000
Miscellaneous expenses
- $2500
Request for Authorization
After the project has been completed, all the reports will be
assessed and evaluated before being handed over to the top
management. Later, the top management will authorize my
department to give the final project to the client.
Closing line?
Signature block?
Evaluation of 050024: “Final Examination”
Skill Realized
Skill Developing
Skill Emerging
Skill
Not
Evident
Introduction (Did you identify one problem, qualifications-
purpose?):
5
4.5
4
3.5
5. 2
1
0
Background (Did you provide detailed proof cause-effect,
bulleted objectives?):
15
14
13
12
11
4
0
Proposal (How complete and clear did you develop each
objective?):
20
19
18
17
16
5
0
Schedule (Is there a specific date/time period indicated for each
objective?):
5
4.5
4
3.5
3
1
0
Staffing (Are specific in-house personnel matched to each task-
objective and their qualifications described?):
10
9
8.5
8
6. 7.5
4
0
Budget (Is budget in columns, readable, cover all costs?):
5
4.5
4
3.5
2
1
0
Request for authorization (How well did you persuade team to
adopt plan within specific time frame?):
5
4.5
4
3.5
3
1
0
Audience, coherence, tone (Did you maintain a professional
tone as part of company team and develop information
logically?):
10
9
8.5
8
7.5
4
0Grammar, sentence structure, and mechanics (How well did
you edit and proofread to ensure correct application of standard
written conventions for American English?):
15
14
13
12
7. 11
8
0
Format (Did you correctly include/format the letter, headings,
font, justification, header info?):
10
9
8.5
8
7.5
2
0
EXAM GRADE, DATE, EVALUATOR: 35%, February 9, 2015,
J.D.
NOTE: The numbers on this scoring grid do not show points
awarded or deducted but reflect how well you met the criteria.
The numbers merely guide the instructor in calculating a final
score that fits appropriately within the Penn Foster grading
scale (which is given in your online Student Handbook).
· Skill Realized scores indicate grades in the A to high-B range.
· Skill Developing scores reflect grades in the mid-B to C
range.
· Skill Emerging scores designate grades in the D to F range.
�The Background section must persuade the executive team
that a dire need exists. Summarize the field investigation of
your chosen problem. Include specific numbers and percentages
(facts and figures) with explanations to show how you
determined each cause contributed to the problem. End this
section with a bulleted list of the key phases (stages) you’ll
develop in the proposal section to solve the causes. Phrase each
stage as a key action goal.
�Develop the steps needed to solve the problem. Use a phrase
8. or word for each goal and italicize it. (You’ll have to use the
same phrases or words in the Schedule and Budget sections.)
Then write at least one paragraph for each goal, outlining what
actions are involved in that phase. Develop detailed, clear-cut
solutions to the underlying issues and causes you identified in
the Background section. Describe how each phase will address
the issue.
�Using a column format, you need to mention the
schedule/deadline for each phase.
�Mention the people who would be held responsible for the
implementation of EACH phase of your proposal along with
their qualifications.
�You need to mention the cost phase-wise.
�The Authorization section must suggest a time frame for the
approval of your plan. Provide assurance that your proposal will
achieve your goal. Summarize the problems at the Roanoke
Branch and describe the benefits of your plan for Roanoke
branch, their clients, and Phoenix Advertising as a whole.
Final Examination Booklet
Business and
Technical Writing
9. 1
Business and
Technical Writing
FINAL EXAM:
AN INFORMAL PROPOSAL
Purpose
Your final project for the Business and Technical Writing
course is worth 30% of your course grade and requires you
to write an informal proposal in letter form. Your work must
be your own.
Important: Don’t submit your final draft for this project until
you’ve received the evaluations of all your previous written
exams, so you can make use of the evaluator’s comments to
improve your final project.
Preparation
Before you begin this project, review pages 8–16 in Proposals
and Special Projects, which is related to writing informal,
internal proposals. Also study the differences between
proposals and reports (like your field investigation report).
Figure 3 shows the general style and basic format you’ll
use for this final exam. Also review the formatting for a full-
block style business letter, covered in Writing Effective
Communications. Review the explanation provided in each
study unit related to writing style, tone, audience, word
choice, grammar, spelling, and punctuation.
Gather the brainstorming, freewriting, and graded exams
10. you’ve already prepared for previous assignments about
Phoenix Advertising. You’ll build on some of the details you
developed and incorporate suggestions from the instructors
evaluating your previous work. You’ll also have to brain-
storm further in order to create facts, figures, names,
numbers, analysis, and proof to support your plan of
action in your proposal.
Business and Technical Writing2
Background Information
Here’s a brief review of the scenario; also review the full
information provided in the exam section of Organizing,
Illustrating, and Researching Your Material. Phoenix
Advertising, with its main headquarters in Charlotte, North
Carolina, serves clients that include banks, insurance com-
panies, and retail chains. You’re vice president of human
resources management at Phoenix. You report directly to
Gregory S. Forest, the company president.
You’ve already investigated the branch and provided a report on
the problems there and your recommendations for managing
them (for study units Organizing, Researching, and Illustrating
Your Material and Writing the Report ). Mr. Forest has
reviewed
that report and now wants you to present to the executive team
a specific proposal developing one of the recommendations you
gave. Following are the primary problems covered in the
scenario but also carefully review the underlying causes you
discovered in your investigation (which you created from
your imagination).
In the last three months, two of the top management people—
an art director and an account executive—have left the branch.
11. Each left for a position with a competing agency.
Three of the graphic designers and four of the copywriters
are threatening to quit because they feel their creative efforts
are being rejected or revised without consultation. They want
to be part of a collaborative team, not produce work that the
art directors and account executives evaluate arbitrarily.
In an attempt to show increased profitability, the branch
is accepting all potential clients without evaluating the
accounts in terms of current project workload. As a result,
without being given any notice and without compensation for
the additional hours, all employees are working long hours
several days each week. Employee morale and productivity
seem to be decreasing with each passing day.
Final Examination 3
Process
Step 1
Choose one of the problems. Use your brainstorming notes
and the investigative report for the recommendations you
listed to solve that problem. Brainstorm further about the
reasons for and causes of that one problem by delving even
further into the “whys” of that problem. As you did previously,
list several questions and review the answers you’ve discovered.
Explore those answers in greater depth to determine the
fundamental causes of the problem. (Think of the problem
as a set of symptoms of an illness that you need to treat.
What disease is causing the symptoms? What areas of the
body are affected by the disease?)
12. Step 2
Freewrite further on each recommendation you made in your
investigative report for resolving this problem. Ask yourself
questions about what must change, what you must make
happen with the employees and departments at Roanoke to
solve the problem so it won’t reoccur. Remember that your
primary goal for the proposal is to revitalize the employees
and departments in order to restore the Roanoke branch to
full productivity. Use as a starting point any of the following
that apply to the problem you’ve chosen:
■ What can the executive team do to reverse the down-
ward spiral of employee morale and increased workload
requiring overtime?
■ How can the executive team help the Roanoke branch
retain its current clients and gain new ones?
■ Is training needed for employees and/or managers?
If so, what types of training are required? How can
the executive team accomplish training over time to
minimize impact on business?
■ What can be done to streamline or reorganize the office
procedures or to incorporate new technology to improve
productivity? What training/support will then be needed
to enable the office employees to embrace the changes
and succeed?
Business and Technical Writing4
Make sure you’ve done enough exploring in Step 1 to guide
your creative efforts toward the changes you’ll make in Step 2.
13. You want to ensure permanent change, so you must under-
stand the exact nature of the causes in order to develop a
detailed, logical solution.
Step 3
Wait a day or two before you review your prewriting, so you
can return with fresh eyes to the project. Mark the information
you’ll use in your proposal and freewrite as needed to develop
your ideas on resolving the situation and accomplishing your
goal. Break the overall plan into individual parts or actions so
you can develop each step in the process separately, organ-
izing a logical flow for each phase from beginning to end.
■ How much time is needed to accomplish each component
or stage of your plan?
■ Are there steps that must be completed before another
phase can begin?
■ How long will it take to complete each step?
■ How will it impact the daily operations of the branch
and headquarters?
Step 4
Now review the people at Roanoke and across Phoenix
Advertising who you’ll need to accomplish each part of
your plan. Your proposal must use people from within the
company—don’t hire outside personnel. Create names and
job titles as well as qualifications to fit your plan. Review
your list of steps and for ask yourself:
■ Who at Phoenix Advertising and/or the Roanoke branch
has the experience, training, and qualifications to achieve
14. this stage of my plan? What proves he or she is the one
for the particular phase?
■ What exactly do I want that person to do to accomplish
this step? When? How?
■ Who oversees the implementation of each phase?
■ What progress reports must be provided to the executive
team and when?
■ What’s my part in the proposed plan of action?
Step 5
Your next step is to itemize the costs involved in accomplishing
each component of your plan as you outlined it in Step 3. You
may need to research current costs of additional employees,
training/motivational programs, or technology. The Internet
or even phone calls to representative companies in the Yellow
Pages can provide useful information. Your figures should
have some realistic basis. Remember to factor in costs such
as the following:
■ The number of employees involved in each phase
■ The loss of employee time from completing regular
obligations of current job
■ Any travel or materials/workbooks needed for training
Create appropriate budgetary categories related to the stages
of your plan. Establish an overall cost for each phase and
within each phase itemize the different costs involved.
15. Itemizing
is important to provide clear support for your numbers and
line items the executive team can review if the total cost for
the proposal is too much for the company’s budget.
Step 6
Organize your prewriting from Steps 1–5 using the following
main headings:
Introduction
Background
Proposal
Schedule
Staffing
Budget
Request for Authorization
Final Examination 5
Business and Technical Writing
Step 7
Following the outline in Step 6, write a 2–5 page draft of
your proposal in letter format. Use single spacing (unless
the format requires more spacing), bold for headings, and
italics for subheadings.
16. Introduction. Your Introduction is the only section not
labeled with a heading. As your opening paragraph, it must
begin with an interesting hook, contain your qualifications to
prepare this proposal, and summarize the general problem
and the benefits of your plan.
Background. The Background section must persuade the
executive team that a dire need exists. Summarize the field
investigation of your chosen problem and describe the causes
of that problem. Include specific numbers and percentages
(facts and figures) with explanations to show how you deter-
mined each contributed to the problem. Your reasons must
be based on the facts you uncovered, not the feelings of
employees at the branch. End this section with a bulleted
list of the key phases (stages) you’ll develop in the proposal
section to solve the causes. Phrase each stage as a key
action goal.
Proposal. In your Proposal section, develop the steps needed
to solve the problem. Use a phrase or word for each goal you
listed in the Background section and italicize it. (You’ll use the
same phrases or words in the Schedule and Budget sections.)
Then write at least one paragraph for each goal, outlining
what actions are involved in that phase. Develop detailed,
clear-cut solutions to the underlying issues and causes you
identified in the Background section.
Schedule. Your Schedule section must use the italicized
words to outline the phases described in the Background
and Proposal. Use column format.
Staffing. The Staffing section describes, in paragraph form,
the specific people, their qualifications, and their assignments
as related to each phase of the proposed solution.
17. Budget. Your budget section must itemize the primary steps
of your plan. Use a table format with your own headings for
each column. The first column will use the phases from the
6
Final Examination 7
project outlined in the Proposal and Schedule sections. Be
sure to show under each major phase the related costs for
accomplishing it.
Request for Authorization. The Authorization section must
suggest a time frame for approval of your plan. Since this
section is also the last thing the executive team will read,
persuasively provide assurance that your proposal will
achieve your goal. Summarize the problems and describe
the benefits of your plan for Roanoke branch, their clients,
and Phoenix Advertising as a whole.
Step 8
As you write, follow the ABC’s for constructing your para-
graphs. Allow your first draft to sit for several days before
you revise it. During that time, review those sections of the
study units discussing various aspects of writing, revising,
and editing, such as
■ Correct, varied construction of sentences
■ Coherence
■ Appropriate word choice for purpose and audience
■ Grammar, spelling, and punctuation
18. After revising and editing your first draft as best as you can,
ask another person to read your proposal aloud. Listen for
awkward phrases, missing words, and unclear sentence flow.
Also ask for the reader’s feedback on clarity, logical flow, and
so on. Finally, refer to the evaluation criteria and Step 7 as
you give your work one final review before you complete your
final draft.
Evaluation Criteria
Your instructor will use the following criteria to evaluate
your proposal:
Introduction (5 points)
The introduction includes a brief statement of purpose for
the proposal and an overview of the writer’s qualifications
to make the proposal. It also grabs the reader’s attention.
Business and Technical Writing
Background (15 points)
This section details the various causes underlying the chosen
problem and convinces the reader that the need for action
exists. It ends with a bulleted list of goals showing the main
phases of your plan solution.
Proposal (15 points)
The proposal opens with a clear statement of purpose. Using
subheadings related to the Background’s list of goals, it
describes in persuasive fashion the detailed actions needed
to accomplish each phase.
Schedule (5 points)
19. The schedule establishes a realistic time frame for each stage
of the plan.
Staffing (10 points)
A specific in-house employee is assigned to each component of
the proposal and the description of that person’s credentials
convinces the reader that the employee is the best choice to
accomplish that part of the plan.
Budget (10 points)
In column/table format, the budget itemizes the realistic
costs for each phase/related step of the plan.
Request for Authorization (5 points)
A suggested time for approval is given. The reader is persuaded
the problem will be solved by the proposed plan. It closes in
a thoughtful, personal way.
Style, coherence, and tone (10 points)
The proposal reflects proper business tone and style. Through
the use of transitions and/or connective explanation, the
sections, paragraphs, and sentences flow clearly and logically.
Grammar and mechanics (20 points)
The proposal uses standard English grammar and word
usage appropriate for business context. A variety of sentence
types and length are used without any run-ons or fragments.
There are no spelling and punctuation errors.
8
Final Examination 9
Format (5 points)
20. The proposal uses the full-block, business letter format,
including company address/letterhead, date, return address,
salutation, and closing with a simulated signature above the
typed name and title. It’s formatted in Times New Roman
font, size 12, with correct page numbering and is 2-5 single-
spaced pages. All required student information is included.
Step 9
Prepare your final draft following the above formatting
requirements. If submitting online, save your work as a text
document. Include the following information at the top of
each page of your proposal. The best way to ensure the infor-
mation is on each page is to use the Header option (usually
located on the View or Insert menu).
Name, Student Number Exam number Page X of Y
Mailing Address
Example:
Jane Smith, 12345678 00000000 Page 1 of 4
111 Education Drive
Any Town, PA 18515
If you don’t include the above information at the top of each
page of your document, your exam may not be processed
for grading.
Business and Technical Writing
Submitting Your Exam
You may submit your examination in one of two ways:
By mail
21. Use the exam envelope provided. Type and print on 8½ x 11"
white paper.
Online: You may submit your exam online.Please save
your document in Rich Text Format (.rtf).
To submit exams online, use the online “Take an Exam”
feature. When you enter the full exam number, an e-mail for-
mat will appear and allow you to attach your text document
to submit the essay online (both memo and e-mail at the
same time in one word document). You’ll receive an auto-
reply confirmation e-mail within 24 hours that your exam has
entered the school system. Be sure to set your e-mail
browser to accept auto-replies.
10
NAME
_____________________________________________________
___________
ADDRESS
_____________________________________________________
___________
CITY
_____________________________________________________
___________
❐ Check if this is a new address
PHONE
22. PLEASE PRINT
—
FOR YOUR INSTRUCTOR’S USE
GRADE GRADED BY
ANSWER SHEET
STUDENT NUMBER:
STATE/PROVINCE ZIP/POSTAL CODE
EXAMINATION NUMBER 05002400
Final Examination
Business and Technical Writing
C
U
T
A
L
O
N
G
T
H
IS
L