The GOTCHA project aimed to address health disparities in rural Mississippi through a community-based participatory research (CBPR) approach using community health advisors (CHAs). An interdisciplinary team developed an innovative CHA training curriculum in response to identified needs from community discussions. The training included a 35-hour core skills component to equip CHAs with comprehensive outreach skills, followed by disease-specific modules. The training employed popular education techniques grounded in adult learning theory to raise consciousness and empower community members for social change. The goal was to transform community health through grassroots efforts led by indigenous CHAs.
Discussion 1 Marlon RodriguezPopulation and Community Health ProVinaOconner450
Discussion 1 Marlon Rodriguez
Population and Community Health Promotion
Health practitioners and the general public play a competitive role in population health prevention and promotion. Health care providers such as nurses and doctors sometimes have multifaceted roles as holistic healthcare providers to promote community health. They can organize public outreach programs and coordinate health education to enlighten the community about well-being. The paper explores specific actions health providers can take regardless of their professional practices to promote community health.
Health Education and Promotion Programs
Health education is an everyday social science used by health providers to promote health behaviors and well-being in the community. Health education initiatives focus on providing essential knowledge and information to the community members and practical skills that enable the public to adopt healthy behaviors (Whitehead, 2018). Health education increases health knowledge and influences the health attitudes of individuals. For instance, nurses can educate the public about the benefits of child immunization in preventing diseases and boosting immunity. Knowledge of immunization can influence individuals who have specific attitudes toward vaccination to seek these services, thus promoting the well-being of children. Health promotion is much broader since it is done by professionals while responding to health developments. It helps address concerns related to health inequities and access within the communities.
Community Assessment and Intervention Planning
Community diagnosis or assessment is an action that health practitioners conduct to identify factors that promote the health of a community and develop strategies to improve them. Health practitioners then design specific goals and programs that help solve particular health concerns identified (Lee et al., 2017). The nurse collaborates with community members to conduct a community assessment and diagnosis processes to help them plan community programs. A nurse must perform a community diagnosis for them to implement a nursing intervention that helps solve the problem. Nurses conduct the diagnosis process to ensure the interventions’ efficiency, promote standardization, and conduct follow-up activities, monitoring, and evaluation while assessing if they have achieved their goals. A nurse can also plan health activities and programs that entail fundamental behavior changes. For example, nurses can coordinate nutritional assessment or diagnosis to prevent concerns of being underweight, malnutrition, or overweight in the community.
Advocate Social Change
Social change initiatives focus on the interaction of humans and the transformation of institutions and functions. Nurses can promote social change by advocating for better policies that solve health inequities. Professional advocacy that orients towards better policies can address social conditions an ...
Foundational Learning in Social Determinants of Health for Health Professionals by Dr. Haydee Encarnacion Garcia. Presented at the Emerging Trends in Nursing Conference at Indiana Wesleyan University on June 1, 2017.
Building Capacity to Improve Population Health using a Social Determinants of...Practical Playbook
The Practical Playbook
National Meeting 2016
www.practicalplaybook.org
Bringing Public Health and Primary Care Together: The Practical Playbook National Meeting was at the Hyatt Regency in Bethesda, MD, May 22 - 24, 2016. The meeting was a milestone event towards advancing robust collaborations that improve population health. Key stakeholders from across sectors – representing professional associations, community organizations, government agencies and academic institutions – and across the country came together at the National Meeting to help catalyze a national movement, accelerate collaborations by fostering skill development, and connect with like-minded individuals and organizations to facilitate the exchange of ideas to drive population health improvement.
The National Meeting was also a significant source of tools and resources to advance collaboration. These tools and resources are available below and include:
Session presentations and materials
Poster session content
Photos from the National Meeting
The conversation started at the National Meeting is continuing in a LinkedIn Group "Working Together for Population Health" and Twitter. Use #PPBMeeting to provide feedback on the National Meeting.
The Practical Playbook was developed by the de Beaumont Foundation, the Duke University School of Medicine Department of Community and Family Medicine, the Centers for Disease Control and Prevention (CDC), and the Health Resources & Services Administration (HRSA).
Chapter 16 Community Diagnosis, Planning, and InterventionSergEstelaJeffery653
Chapter 16 Community Diagnosis, Planning, and Intervention
Sergio Osegueda Acuna MSN-FNP-BC
MRC
Nursing Process with communities
Population-focused health planning
Health planning is a continuous social process by which data about clients are collected and analyzed for the purpose of developing a plan to generate new ideas, meet identified client needs, solve health problems, and guide changes in health care delivery.
To date, you have been responsible primarily for developing a plan of care for the individual client.
History of U.S. Health Planning
The history of health planning in the United States has alternated between the federal and state governments.
Before the 1960s, health planning occurred primarily at the state level.
In the 1960s, health planning became a federal effort.
In 1966, the Comprehensive Health Planning and Public Health Service Amendment was passed to enable states and local communities to plan for better health resources.
In the 1980s, President Reagan aimed to reduce both the size of the federal government and the influence the federal government had on states. His administration eliminated the federal budget and planning requirements while encouraging states to make their own planning decisions.
History of U.S. Health Planning
In 1980, the Omnibus Budget Reconciliation Act encouraged the use of noninstitutional services, such as home health care, to fight escalating costs.
In 1983 the Prospective Payment System drastically changed hospital reimbursement, resulted in shorter hospital stays for patients, shifted care into the community, and placed greater responsibilities for care of relatives on family members
The federal Patient Protection and Affordable Care Act (Affordable Care Act) of 2010 requires access to health care for most Americans.
Rationale for Nursing Involvement in the Health Planning Process
Florence Nightingale and Lillian Wald pioneered health planning based on an assessment of the health needs of the communities they served
Both the American Nurses Association (ANA) (2007) and the American Public Health Association (APHA) (1996) state that the primary responsibility of community/public health nurses is to the community or population as a whole and that nurses must acknowledge the need for comprehensive health planning to implement this responsibility.
Nurses spend a greater amount of time in direct contact with their clients than do any other health care professionals.
Nursing Role in Program Planning
Planning for change at the community level is more complex than at the individual level.
Components to the client system have been increased, and more people and more complex organizations are involved.
Baccalaureate-prepared community/public nurses are expected to apply the nursing process with subpopulations or aggregates with limited supervision (American Association of Colleges of Nursing, 1986; ANA, 2007)
Planning for community change
To plan and implement programs at a commu ...
Discussion 1 Marlon RodriguezPopulation and Community Health ProVinaOconner450
Discussion 1 Marlon Rodriguez
Population and Community Health Promotion
Health practitioners and the general public play a competitive role in population health prevention and promotion. Health care providers such as nurses and doctors sometimes have multifaceted roles as holistic healthcare providers to promote community health. They can organize public outreach programs and coordinate health education to enlighten the community about well-being. The paper explores specific actions health providers can take regardless of their professional practices to promote community health.
Health Education and Promotion Programs
Health education is an everyday social science used by health providers to promote health behaviors and well-being in the community. Health education initiatives focus on providing essential knowledge and information to the community members and practical skills that enable the public to adopt healthy behaviors (Whitehead, 2018). Health education increases health knowledge and influences the health attitudes of individuals. For instance, nurses can educate the public about the benefits of child immunization in preventing diseases and boosting immunity. Knowledge of immunization can influence individuals who have specific attitudes toward vaccination to seek these services, thus promoting the well-being of children. Health promotion is much broader since it is done by professionals while responding to health developments. It helps address concerns related to health inequities and access within the communities.
Community Assessment and Intervention Planning
Community diagnosis or assessment is an action that health practitioners conduct to identify factors that promote the health of a community and develop strategies to improve them. Health practitioners then design specific goals and programs that help solve particular health concerns identified (Lee et al., 2017). The nurse collaborates with community members to conduct a community assessment and diagnosis processes to help them plan community programs. A nurse must perform a community diagnosis for them to implement a nursing intervention that helps solve the problem. Nurses conduct the diagnosis process to ensure the interventions’ efficiency, promote standardization, and conduct follow-up activities, monitoring, and evaluation while assessing if they have achieved their goals. A nurse can also plan health activities and programs that entail fundamental behavior changes. For example, nurses can coordinate nutritional assessment or diagnosis to prevent concerns of being underweight, malnutrition, or overweight in the community.
Advocate Social Change
Social change initiatives focus on the interaction of humans and the transformation of institutions and functions. Nurses can promote social change by advocating for better policies that solve health inequities. Professional advocacy that orients towards better policies can address social conditions an ...
Foundational Learning in Social Determinants of Health for Health Professionals by Dr. Haydee Encarnacion Garcia. Presented at the Emerging Trends in Nursing Conference at Indiana Wesleyan University on June 1, 2017.
Building Capacity to Improve Population Health using a Social Determinants of...Practical Playbook
The Practical Playbook
National Meeting 2016
www.practicalplaybook.org
Bringing Public Health and Primary Care Together: The Practical Playbook National Meeting was at the Hyatt Regency in Bethesda, MD, May 22 - 24, 2016. The meeting was a milestone event towards advancing robust collaborations that improve population health. Key stakeholders from across sectors – representing professional associations, community organizations, government agencies and academic institutions – and across the country came together at the National Meeting to help catalyze a national movement, accelerate collaborations by fostering skill development, and connect with like-minded individuals and organizations to facilitate the exchange of ideas to drive population health improvement.
The National Meeting was also a significant source of tools and resources to advance collaboration. These tools and resources are available below and include:
Session presentations and materials
Poster session content
Photos from the National Meeting
The conversation started at the National Meeting is continuing in a LinkedIn Group "Working Together for Population Health" and Twitter. Use #PPBMeeting to provide feedback on the National Meeting.
The Practical Playbook was developed by the de Beaumont Foundation, the Duke University School of Medicine Department of Community and Family Medicine, the Centers for Disease Control and Prevention (CDC), and the Health Resources & Services Administration (HRSA).
Chapter 16 Community Diagnosis, Planning, and InterventionSergEstelaJeffery653
Chapter 16 Community Diagnosis, Planning, and Intervention
Sergio Osegueda Acuna MSN-FNP-BC
MRC
Nursing Process with communities
Population-focused health planning
Health planning is a continuous social process by which data about clients are collected and analyzed for the purpose of developing a plan to generate new ideas, meet identified client needs, solve health problems, and guide changes in health care delivery.
To date, you have been responsible primarily for developing a plan of care for the individual client.
History of U.S. Health Planning
The history of health planning in the United States has alternated between the federal and state governments.
Before the 1960s, health planning occurred primarily at the state level.
In the 1960s, health planning became a federal effort.
In 1966, the Comprehensive Health Planning and Public Health Service Amendment was passed to enable states and local communities to plan for better health resources.
In the 1980s, President Reagan aimed to reduce both the size of the federal government and the influence the federal government had on states. His administration eliminated the federal budget and planning requirements while encouraging states to make their own planning decisions.
History of U.S. Health Planning
In 1980, the Omnibus Budget Reconciliation Act encouraged the use of noninstitutional services, such as home health care, to fight escalating costs.
In 1983 the Prospective Payment System drastically changed hospital reimbursement, resulted in shorter hospital stays for patients, shifted care into the community, and placed greater responsibilities for care of relatives on family members
The federal Patient Protection and Affordable Care Act (Affordable Care Act) of 2010 requires access to health care for most Americans.
Rationale for Nursing Involvement in the Health Planning Process
Florence Nightingale and Lillian Wald pioneered health planning based on an assessment of the health needs of the communities they served
Both the American Nurses Association (ANA) (2007) and the American Public Health Association (APHA) (1996) state that the primary responsibility of community/public health nurses is to the community or population as a whole and that nurses must acknowledge the need for comprehensive health planning to implement this responsibility.
Nurses spend a greater amount of time in direct contact with their clients than do any other health care professionals.
Nursing Role in Program Planning
Planning for change at the community level is more complex than at the individual level.
Components to the client system have been increased, and more people and more complex organizations are involved.
Baccalaureate-prepared community/public nurses are expected to apply the nursing process with subpopulations or aggregates with limited supervision (American Association of Colleges of Nursing, 1986; ANA, 2007)
Planning for community change
To plan and implement programs at a commu ...
Today, you are introduced to the Social Determinant of Health (SDOH) perspective. This assignment responds to two questions, firstly “What is a SDOH perspective?” which will be explored in detail providing two examples of a Social Worker role. The second question requiring a critical discussion surrounding SDOH including “What benefits does a social determinants of health perspective provide, and what are its limits?”.
Partnering with Patients, Families and Communities for Health: A Global Imper...EngagingPatients
Engagement is an essential tool to improving global health. This report introduces a new framework for engagement to help countries assess current programs and think strategically about future engagement opportunities. It spotlights barriers to engagement and offers concrete examples of effective engagement from around the globe.
Brandis M
YOU MATTER.
FAMILY MATTERS.
SECCION 1
Population: Divorce or Separated adults
Timing: 45-60 Minutes
Group size: 6-8 individuals
Materials: Pen, & Poem sheet, paper
START: EXPLAINING WHAT MENTAL HEALTH IS AND WHAT THE GOAL OF THE GROUP. 2 sentences of guidelines.
GOALS:
Introduce the concept of healthy relationships
· INTRODUCTION OF MYSELF
· INTRO OF MEMBERS
· INTRO ACTIVITY: READ POEM “THIS WAS ONCE A LOVE POEM” BY JANE HIRSHFIELD
This was once a love poem,
before its haunches thickened, its breath grew short,
before it found itself sitting,
perplexed and a little embarrassed,
on the fender of a parked car,
while many people passed by without turning their heads.
It remembers itself dressing as if for a great engagement.
It remembers choosing these shoes,
this scarf or tie.
Steps:
1. Hand everyone the poem. Have them read it. After, hand them a piece of paper, and ask them to write one word of the poem or in general that describes how they’re feeling.
2. Explain what the purpose of the poem is. Have everyone show and talk about what they wrote on the piece of paper. Validate their feelings. Re-Explain the purpose of the group.
Questions to consider:
1. What is love?
2. Define healthy, unhealthy, and abusive. Define a healthy/unhealthy relationship
3. What are your expectations in future relationships?
SECCION 2
Population: Divorce or Separated adults
Timing: 45-60 Minutes
Group size: 6-8 individuals
Materials: Activity paper, pen
START:
· EXPLAIN THE GOALS OF THE SECCION.
· ACTIVITY: START OFF WITH MOOD METER ACTIVITY.
Steps:
1. Define family. What does family mean to you?
2. Members will complete form (shorter version of course) of https://www.thebalancedlifellc.com/images/forms/Couples-Counseling-Initial-Intake-Form.pdf
3. Discuss with the members their answers. Get to know each other deeper.
Questions:
1.
Running head: GOALS AND OUTCOMES IN CONTEXT 1
GOALS AND OUTCOMES IN CONTEXT 4
WEEK3 PART 1
Goals and Outcomes in Context
Student Name
Institutional Affiliation
Course
Date
Goals and Outcomes in Context
The health need identified is the lack of access to healthcare in a systematic and preventive way by Riverbend City citizens. Access to healthcare is a glaring concern in the neighborhood. One qualitative theme from the interview is the problematic access to preventative healthcare. It shows that lack of access to healthcare is a problem since very few people feel like they have access to healthcare, especially preventive healthcare. The problem affects the people who work and those who do not. Some of the top concerns regarding preventive healthcare are the lack of sufficient programs and resources for obesity prevention and chronic disease. The other qualitative theme from the interview is structural barriers that impede individuals' access to long-term medical care. It indicates the need for the city to empower organizations ...
Task Force Project—Applying TheoryIn Module 1, you began.docxbriankimberly26463
Task Force Project—Applying Theory
In
Module 1
, you began your work as the head of the Maternal, Infant, and Reproductive Health Task Force in Centervale. You did this by learning more about adolescent pregnancy and the behavioral, cultural, and environmental risk factors associated with this health issue. In this assignment, your attention turns to community issues. Your task force has representatives from several community organizations. You know that in addition to your focus on an individual-level change, you will need to provide the group with information about community-level change to impact the adolescent pregnancy issue in Centervale.
Directions:
Read the editorial entitled “Community-based Intervention” in which the authors recommend four typologies or approaches to community-based projects (McLeroy, Norton, Kegler, Burdine, & Sumaya, 2003). Consider how each of these typologies might be applicable to adolescent pregnancy prevention in Centervale.
Download and review the “Demographic Background on Centervale.”
Prepare a memo for the task force on the following:
Compare and contrast the four categories of community-based interventions.
Select two typologies to present as options to the task force and explain in detail how these can be applied.
Identify one typology for recommendation, giving reasons in support.
Your final product will be in a MS Word document of approximately 3–4 pages. You should utilize at least 3 scholarly sources beyond the course readings in your research. Your paper should be written in a clear, concise, and organized manner; demonstrate ethical scholarship in accurate representation and attribution of sources; and display accurate spelling, grammar, and punctuation.
THIS THE REFERENCE THAT YOU NEED
Community-based interventions
McLeroy, Kenneth R
Author Information
;
Norton, Barbara L
Author Information
;
Kegler, Michelle C
Author Information
;
Burdine, James N
Author Information
;
Sumaya, Ciro V
Author Information
.
American Journal of Public Health
; Washington
93.4
(Apr 2003): 529-33.
Full text
Full text - PDF
Abstract/Details
References 25
Abstract
TranslateAbstract
McLeroy et al examine the four categories of community-based projects: community as setting, community as target, community as agent, and community as resource. The goal of community-based programs is to carefully work with naturally occurring units of solution as our units of practice. This necessitates a careful assessment of community structures and processes of any intervention.
Full Text
·
TranslateFull text
·
The article Reconsidering Community-Based Health Promotion: Promise, Performance, and Potential by Merzel and D'Afflitti1 in this issue of the Journal makes a valuable contribution to the literature on community approaches to health promotion. The breadth of studies covered in this review article, combined with the prominence the Journal is giving to the subject in this issue, sug.
Literary Analysis and Composition II (Sem1) Writing to a Promp.docxSHIVA101531
Literary Analysis and Composition II (Sem1) | Writing to a Prompt | Lesson 3
HW 425: Health and Wellness Programming: Design and Administration
Unit 1 Needs Assessment: The Big Picture
Lesson 3: Conducting Needs Assessments
Conducting a needs assessment entails the completion of a series of activities that are repeated to identify and prioritize the health needs of a target population. (Hodges & Videto, 2005, page 5, ¶3)
“Health educators gather, analyze, and prioritize information across and within groups of similar data to my systematic, well-informed decisions regarding the highest and most feasible health-related needs to be addressed” (Hodges & Videto, 2005, page 5, ¶3)
within a clearly defined, specific, target population.
Conducting needs assessments is the first step in “…the process of creating health education and health promotion programs” (Hodges and Videto, 2005, page 7, ¶3).
Hodges and Videto point out that while “Planning and conducting a needs assessment can seem like a daunting task…there are models and frameworks to help organize your planning” (2005, page 7, ¶3).
Models and Frameworks
Planned Approach to Community Health (PATCH)
The U.S. Department of Health and Human Services, Centers for Disease Control and Prevention (CDC) developed this approach for use in health education and health promotion situations. (Hodges & Videto, 2005, page 7, ¶3)
According to the Centers for Disease Control and Prevention (CDC)
PATCH, the acronym for Planned Approach to Community Health, is a cooperative program of technical assistance managed and supported by the Centers for Disease Control (CDC). PATCH is designed to strengthen state and local health departments' capacities to plan, implement, and evaluate community- based health promotion activities targeted toward priority health problems. (CDC, 2007)
The PATCH concept emerged in 1983 primarily as a CDC response to the shift in federal policy regarding categorical grants to states. One of those categorical grant programs was the Health Education-Risk Reduction (HERR) Grants Program. (CDC, 2007)
Basic Concept: Diffuse Effective Strategies
From its inception, the primary goal of PATCH was to create a practical mechanism through which effective community health education action could be targeted to address local-level health priorities. A secondary goal was to offer a practical, skills-based program of technical assistance wherein health education leaders in state health agencies would work with their local level counterparts to establish community health education programs. (Kreuter, 1984; Nelson, Kreuter, Watkins, & Stoddard, 1987). (CDC, 2007)
During the formative stages of PATCH, knowledge of what constituted effective community-based health education interventions was by no means complete and, of course, remains in a continuous state of development. However, as investigators directing community-based cardiovascular disease intervention programs began to describe resu ...
CHSJ focuses on health and gender justice, with the objective of enabling good governance and accountability from the
perspective of social justice. It seeks to strengthen accountability of public health systems and health governance through
community empowerment, resource support, capacity building for local Civil Society Organizations (CSOs), research and
advocacy. CHSJ also seeks to develop ways to engage men for gender justice
GUEST EDITORIALSocial Work and Implementation of theAffordable Care Ac.docxharrym15
GUEST EDITORIAL
Social Work and Implementation of the Affordable Care Act
Christina M. Andrews, Julie S. Darnell, Timothy D. McBride, and Sarah Gehlert
The Affordable Care Act (ACA) (full title: The Patient Protection and Affordable Care Act) (P.L. 111-148) will generate
sweeping changes in the financing, organization, and accessibility of health and social services in the United States. The expansion of Medicaid and the establishment of state health insurance exchanges (HIEs) will vastly expand insurance access in the United States, with an estimated 30 million Ameri- cans gaining coverage (Banthin et al., 2012). The emphasis on integrated models of care, including patient-centered medical homes and accountable care organizations, introduces new opportunities to improve care coordination, reduce unnecessary service use, and make health care more cost- effective. Realizing these changes relies on the work of many health care professions. In this edi- torial, we make a case for how the social work pro- fession can forge a leadership role in implementing this historic legislation.
SOCIALWORK EXPERTISE AND THE ACA Because the ACA is so bold and ambitious, it is important to consider how the unique skills and knowledge bases of social work and other health care professions align with its objectives and goals. An integrated approach is needed to maximize the ACA’s potential to improve the health of the pop- ulation.
Four central qualities of the social work profes- sion make it uniquely suited to advance a number of the objectives and goals of the ACA. First, social work situates individuals in the social contexts in which they live. Social workers understand that individuals are part of social networks, neighbor- hoods, and communities that influence their health choices and participation in health care. Under- standing these social relationships provides us with
insight into health behaviors and health outcomes that is necessary to achieve population health goals.
Social workers likewise understand the relation- ship between health, education, employment, and other systems that form the nexus from which resources can be drawn to protect, maintain, and restore health. Social workers are familiar with the complex and overlapping systems that must be negotiated to ensure that the social, psychological, and economic needs of individuals and groups are addressed in a way that underscores optimal health. For instance, social workers know how to ensure that patients have what they need from multiple systems upon discharge, that discharge instructions are understood, and that resources are in place to ensure that those instructions can be followed. This knowledge is essential for avoiding unneces- sary readmissions—events subject to financial penalties under the ACA.
In a related sense, social work is guided by an evidence base that is informed by rigorous research within communities and collective wisdom gleaned from over a century of social work p.
July 2002, Vol 92, No. 7 American Journal of Public Health E.docxcroysierkathey
July 2002, Vol 92, No. 7 | American Journal of Public Health Editorial | 1057
⏐ EDITORIAL
A Code of
Ethics for
Public Health
The mandate to ensure and pro-
tect the health of the public is an
inherently moral one. It carries
with it an obligation to care for
the well-being of communities,
and it implies the possession of an
element of power to carry out
that mandate. The need to exer-
cise power to ensure the health of
populations and, at the same time,
to avoid abuses of such power are
at the crux of public health ethics.
Until recently, the ethical na-
ture of public health has been im-
plicitly assumed rather than ex-
plicitly stated. Increasingly,
however, society is demanding ex-
plicit attention to ethics. This de-
mand arises from technological
advances that create new possibil-
ities and, with them, new ethical
dilemmas; new challenges to
health, such as the advent of HIV;
and abuses of power, such as the
Tuskegee study of syphilis.
Medical institutions have been
more explicit about the ethical
elements of their practice than
have public health institutions.
However, the concerns of public
health are not fully consonant
with those of medicine. Thus, we
cannot simply translate the princi-
ples of medical ethics to public
health. In contrast to medicine,
public health is concerned more
with populations than with indi-
viduals, and more with prevention
than with cure. The need to artic-
ulate a distinct ethic for public
health has been noted by a num-
ber of public health professionals
and ethicists.1–5
A code of ethics for public
health can clarify the distinctive
elements of public health and the
ethical principles that follow from
or respond to those elements. It
can make clear to populations and
communities the ideals of the pub-
lic health institutions that serve
them, ideals for which the institu-
tions can be held accountable.
THE PROCESS OF
WRITING THE CODE
The backgrounds and perspec-
tives of people who identify
themselves as public health pro-
fessionals are as diverse as the
multitude of factors affecting the
health of populations. Articulating
a common ethic for this diverse
group is a formidable challenge.
In the spring of 2000, the gradu-
ating class of the Public Health
Leadership Institute chose writing
a code of ethics for public health
as a group project. The institute
provides advanced leadership
training to people who are al-
ready in leadership roles in pub-
lic health. Because the fellows
bring a wealth of experience from
a wide variety of public health in-
stitutions, they are uniquely able
to represent diverse perspectives
and identify ethical issues com-
mon in public health.
At the 2000 meeting of the Na-
tional Association of City and
County Health Officers, the group
added a non-institute member
( J. C. Thomas) and charted a plan
for working toward a code. The
plan included receiving a formal
charge as the code of ethics work-
ing group at the annual meeting of
the American Public Health Asso-
c ...
July 2002, Vol 92, No. 7 American Journal of Public Health E.docxdonnajames55
July 2002, Vol 92, No. 7 | American Journal of Public Health Editorial | 1057
⏐ EDITORIAL
A Code of
Ethics for
Public Health
The mandate to ensure and pro-
tect the health of the public is an
inherently moral one. It carries
with it an obligation to care for
the well-being of communities,
and it implies the possession of an
element of power to carry out
that mandate. The need to exer-
cise power to ensure the health of
populations and, at the same time,
to avoid abuses of such power are
at the crux of public health ethics.
Until recently, the ethical na-
ture of public health has been im-
plicitly assumed rather than ex-
plicitly stated. Increasingly,
however, society is demanding ex-
plicit attention to ethics. This de-
mand arises from technological
advances that create new possibil-
ities and, with them, new ethical
dilemmas; new challenges to
health, such as the advent of HIV;
and abuses of power, such as the
Tuskegee study of syphilis.
Medical institutions have been
more explicit about the ethical
elements of their practice than
have public health institutions.
However, the concerns of public
health are not fully consonant
with those of medicine. Thus, we
cannot simply translate the princi-
ples of medical ethics to public
health. In contrast to medicine,
public health is concerned more
with populations than with indi-
viduals, and more with prevention
than with cure. The need to artic-
ulate a distinct ethic for public
health has been noted by a num-
ber of public health professionals
and ethicists.1–5
A code of ethics for public
health can clarify the distinctive
elements of public health and the
ethical principles that follow from
or respond to those elements. It
can make clear to populations and
communities the ideals of the pub-
lic health institutions that serve
them, ideals for which the institu-
tions can be held accountable.
THE PROCESS OF
WRITING THE CODE
The backgrounds and perspec-
tives of people who identify
themselves as public health pro-
fessionals are as diverse as the
multitude of factors affecting the
health of populations. Articulating
a common ethic for this diverse
group is a formidable challenge.
In the spring of 2000, the gradu-
ating class of the Public Health
Leadership Institute chose writing
a code of ethics for public health
as a group project. The institute
provides advanced leadership
training to people who are al-
ready in leadership roles in pub-
lic health. Because the fellows
bring a wealth of experience from
a wide variety of public health in-
stitutions, they are uniquely able
to represent diverse perspectives
and identify ethical issues com-
mon in public health.
At the 2000 meeting of the Na-
tional Association of City and
County Health Officers, the group
added a non-institute member
( J. C. Thomas) and charted a plan
for working toward a code. The
plan included receiving a formal
charge as the code of ethics work-
ing group at the annual meeting of
the American Public Health Asso-
c.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to F e a t u r eGetting on Target with CommunityHealth Advi.docx
Today, you are introduced to the Social Determinant of Health (SDOH) perspective. This assignment responds to two questions, firstly “What is a SDOH perspective?” which will be explored in detail providing two examples of a Social Worker role. The second question requiring a critical discussion surrounding SDOH including “What benefits does a social determinants of health perspective provide, and what are its limits?”.
Partnering with Patients, Families and Communities for Health: A Global Imper...EngagingPatients
Engagement is an essential tool to improving global health. This report introduces a new framework for engagement to help countries assess current programs and think strategically about future engagement opportunities. It spotlights barriers to engagement and offers concrete examples of effective engagement from around the globe.
Brandis M
YOU MATTER.
FAMILY MATTERS.
SECCION 1
Population: Divorce or Separated adults
Timing: 45-60 Minutes
Group size: 6-8 individuals
Materials: Pen, & Poem sheet, paper
START: EXPLAINING WHAT MENTAL HEALTH IS AND WHAT THE GOAL OF THE GROUP. 2 sentences of guidelines.
GOALS:
Introduce the concept of healthy relationships
· INTRODUCTION OF MYSELF
· INTRO OF MEMBERS
· INTRO ACTIVITY: READ POEM “THIS WAS ONCE A LOVE POEM” BY JANE HIRSHFIELD
This was once a love poem,
before its haunches thickened, its breath grew short,
before it found itself sitting,
perplexed and a little embarrassed,
on the fender of a parked car,
while many people passed by without turning their heads.
It remembers itself dressing as if for a great engagement.
It remembers choosing these shoes,
this scarf or tie.
Steps:
1. Hand everyone the poem. Have them read it. After, hand them a piece of paper, and ask them to write one word of the poem or in general that describes how they’re feeling.
2. Explain what the purpose of the poem is. Have everyone show and talk about what they wrote on the piece of paper. Validate their feelings. Re-Explain the purpose of the group.
Questions to consider:
1. What is love?
2. Define healthy, unhealthy, and abusive. Define a healthy/unhealthy relationship
3. What are your expectations in future relationships?
SECCION 2
Population: Divorce or Separated adults
Timing: 45-60 Minutes
Group size: 6-8 individuals
Materials: Activity paper, pen
START:
· EXPLAIN THE GOALS OF THE SECCION.
· ACTIVITY: START OFF WITH MOOD METER ACTIVITY.
Steps:
1. Define family. What does family mean to you?
2. Members will complete form (shorter version of course) of https://www.thebalancedlifellc.com/images/forms/Couples-Counseling-Initial-Intake-Form.pdf
3. Discuss with the members their answers. Get to know each other deeper.
Questions:
1.
Running head: GOALS AND OUTCOMES IN CONTEXT 1
GOALS AND OUTCOMES IN CONTEXT 4
WEEK3 PART 1
Goals and Outcomes in Context
Student Name
Institutional Affiliation
Course
Date
Goals and Outcomes in Context
The health need identified is the lack of access to healthcare in a systematic and preventive way by Riverbend City citizens. Access to healthcare is a glaring concern in the neighborhood. One qualitative theme from the interview is the problematic access to preventative healthcare. It shows that lack of access to healthcare is a problem since very few people feel like they have access to healthcare, especially preventive healthcare. The problem affects the people who work and those who do not. Some of the top concerns regarding preventive healthcare are the lack of sufficient programs and resources for obesity prevention and chronic disease. The other qualitative theme from the interview is structural barriers that impede individuals' access to long-term medical care. It indicates the need for the city to empower organizations ...
Task Force Project—Applying TheoryIn Module 1, you began.docxbriankimberly26463
Task Force Project—Applying Theory
In
Module 1
, you began your work as the head of the Maternal, Infant, and Reproductive Health Task Force in Centervale. You did this by learning more about adolescent pregnancy and the behavioral, cultural, and environmental risk factors associated with this health issue. In this assignment, your attention turns to community issues. Your task force has representatives from several community organizations. You know that in addition to your focus on an individual-level change, you will need to provide the group with information about community-level change to impact the adolescent pregnancy issue in Centervale.
Directions:
Read the editorial entitled “Community-based Intervention” in which the authors recommend four typologies or approaches to community-based projects (McLeroy, Norton, Kegler, Burdine, & Sumaya, 2003). Consider how each of these typologies might be applicable to adolescent pregnancy prevention in Centervale.
Download and review the “Demographic Background on Centervale.”
Prepare a memo for the task force on the following:
Compare and contrast the four categories of community-based interventions.
Select two typologies to present as options to the task force and explain in detail how these can be applied.
Identify one typology for recommendation, giving reasons in support.
Your final product will be in a MS Word document of approximately 3–4 pages. You should utilize at least 3 scholarly sources beyond the course readings in your research. Your paper should be written in a clear, concise, and organized manner; demonstrate ethical scholarship in accurate representation and attribution of sources; and display accurate spelling, grammar, and punctuation.
THIS THE REFERENCE THAT YOU NEED
Community-based interventions
McLeroy, Kenneth R
Author Information
;
Norton, Barbara L
Author Information
;
Kegler, Michelle C
Author Information
;
Burdine, James N
Author Information
;
Sumaya, Ciro V
Author Information
.
American Journal of Public Health
; Washington
93.4
(Apr 2003): 529-33.
Full text
Full text - PDF
Abstract/Details
References 25
Abstract
TranslateAbstract
McLeroy et al examine the four categories of community-based projects: community as setting, community as target, community as agent, and community as resource. The goal of community-based programs is to carefully work with naturally occurring units of solution as our units of practice. This necessitates a careful assessment of community structures and processes of any intervention.
Full Text
·
TranslateFull text
·
The article Reconsidering Community-Based Health Promotion: Promise, Performance, and Potential by Merzel and D'Afflitti1 in this issue of the Journal makes a valuable contribution to the literature on community approaches to health promotion. The breadth of studies covered in this review article, combined with the prominence the Journal is giving to the subject in this issue, sug.
Literary Analysis and Composition II (Sem1) Writing to a Promp.docxSHIVA101531
Literary Analysis and Composition II (Sem1) | Writing to a Prompt | Lesson 3
HW 425: Health and Wellness Programming: Design and Administration
Unit 1 Needs Assessment: The Big Picture
Lesson 3: Conducting Needs Assessments
Conducting a needs assessment entails the completion of a series of activities that are repeated to identify and prioritize the health needs of a target population. (Hodges & Videto, 2005, page 5, ¶3)
“Health educators gather, analyze, and prioritize information across and within groups of similar data to my systematic, well-informed decisions regarding the highest and most feasible health-related needs to be addressed” (Hodges & Videto, 2005, page 5, ¶3)
within a clearly defined, specific, target population.
Conducting needs assessments is the first step in “…the process of creating health education and health promotion programs” (Hodges and Videto, 2005, page 7, ¶3).
Hodges and Videto point out that while “Planning and conducting a needs assessment can seem like a daunting task…there are models and frameworks to help organize your planning” (2005, page 7, ¶3).
Models and Frameworks
Planned Approach to Community Health (PATCH)
The U.S. Department of Health and Human Services, Centers for Disease Control and Prevention (CDC) developed this approach for use in health education and health promotion situations. (Hodges & Videto, 2005, page 7, ¶3)
According to the Centers for Disease Control and Prevention (CDC)
PATCH, the acronym for Planned Approach to Community Health, is a cooperative program of technical assistance managed and supported by the Centers for Disease Control (CDC). PATCH is designed to strengthen state and local health departments' capacities to plan, implement, and evaluate community- based health promotion activities targeted toward priority health problems. (CDC, 2007)
The PATCH concept emerged in 1983 primarily as a CDC response to the shift in federal policy regarding categorical grants to states. One of those categorical grant programs was the Health Education-Risk Reduction (HERR) Grants Program. (CDC, 2007)
Basic Concept: Diffuse Effective Strategies
From its inception, the primary goal of PATCH was to create a practical mechanism through which effective community health education action could be targeted to address local-level health priorities. A secondary goal was to offer a practical, skills-based program of technical assistance wherein health education leaders in state health agencies would work with their local level counterparts to establish community health education programs. (Kreuter, 1984; Nelson, Kreuter, Watkins, & Stoddard, 1987). (CDC, 2007)
During the formative stages of PATCH, knowledge of what constituted effective community-based health education interventions was by no means complete and, of course, remains in a continuous state of development. However, as investigators directing community-based cardiovascular disease intervention programs began to describe resu ...
CHSJ focuses on health and gender justice, with the objective of enabling good governance and accountability from the
perspective of social justice. It seeks to strengthen accountability of public health systems and health governance through
community empowerment, resource support, capacity building for local Civil Society Organizations (CSOs), research and
advocacy. CHSJ also seeks to develop ways to engage men for gender justice
GUEST EDITORIALSocial Work and Implementation of theAffordable Care Ac.docxharrym15
GUEST EDITORIAL
Social Work and Implementation of the Affordable Care Act
Christina M. Andrews, Julie S. Darnell, Timothy D. McBride, and Sarah Gehlert
The Affordable Care Act (ACA) (full title: The Patient Protection and Affordable Care Act) (P.L. 111-148) will generate
sweeping changes in the financing, organization, and accessibility of health and social services in the United States. The expansion of Medicaid and the establishment of state health insurance exchanges (HIEs) will vastly expand insurance access in the United States, with an estimated 30 million Ameri- cans gaining coverage (Banthin et al., 2012). The emphasis on integrated models of care, including patient-centered medical homes and accountable care organizations, introduces new opportunities to improve care coordination, reduce unnecessary service use, and make health care more cost- effective. Realizing these changes relies on the work of many health care professions. In this edi- torial, we make a case for how the social work pro- fession can forge a leadership role in implementing this historic legislation.
SOCIALWORK EXPERTISE AND THE ACA Because the ACA is so bold and ambitious, it is important to consider how the unique skills and knowledge bases of social work and other health care professions align with its objectives and goals. An integrated approach is needed to maximize the ACA’s potential to improve the health of the pop- ulation.
Four central qualities of the social work profes- sion make it uniquely suited to advance a number of the objectives and goals of the ACA. First, social work situates individuals in the social contexts in which they live. Social workers understand that individuals are part of social networks, neighbor- hoods, and communities that influence their health choices and participation in health care. Under- standing these social relationships provides us with
insight into health behaviors and health outcomes that is necessary to achieve population health goals.
Social workers likewise understand the relation- ship between health, education, employment, and other systems that form the nexus from which resources can be drawn to protect, maintain, and restore health. Social workers are familiar with the complex and overlapping systems that must be negotiated to ensure that the social, psychological, and economic needs of individuals and groups are addressed in a way that underscores optimal health. For instance, social workers know how to ensure that patients have what they need from multiple systems upon discharge, that discharge instructions are understood, and that resources are in place to ensure that those instructions can be followed. This knowledge is essential for avoiding unneces- sary readmissions—events subject to financial penalties under the ACA.
In a related sense, social work is guided by an evidence base that is informed by rigorous research within communities and collective wisdom gleaned from over a century of social work p.
July 2002, Vol 92, No. 7 American Journal of Public Health E.docxcroysierkathey
July 2002, Vol 92, No. 7 | American Journal of Public Health Editorial | 1057
⏐ EDITORIAL
A Code of
Ethics for
Public Health
The mandate to ensure and pro-
tect the health of the public is an
inherently moral one. It carries
with it an obligation to care for
the well-being of communities,
and it implies the possession of an
element of power to carry out
that mandate. The need to exer-
cise power to ensure the health of
populations and, at the same time,
to avoid abuses of such power are
at the crux of public health ethics.
Until recently, the ethical na-
ture of public health has been im-
plicitly assumed rather than ex-
plicitly stated. Increasingly,
however, society is demanding ex-
plicit attention to ethics. This de-
mand arises from technological
advances that create new possibil-
ities and, with them, new ethical
dilemmas; new challenges to
health, such as the advent of HIV;
and abuses of power, such as the
Tuskegee study of syphilis.
Medical institutions have been
more explicit about the ethical
elements of their practice than
have public health institutions.
However, the concerns of public
health are not fully consonant
with those of medicine. Thus, we
cannot simply translate the princi-
ples of medical ethics to public
health. In contrast to medicine,
public health is concerned more
with populations than with indi-
viduals, and more with prevention
than with cure. The need to artic-
ulate a distinct ethic for public
health has been noted by a num-
ber of public health professionals
and ethicists.1–5
A code of ethics for public
health can clarify the distinctive
elements of public health and the
ethical principles that follow from
or respond to those elements. It
can make clear to populations and
communities the ideals of the pub-
lic health institutions that serve
them, ideals for which the institu-
tions can be held accountable.
THE PROCESS OF
WRITING THE CODE
The backgrounds and perspec-
tives of people who identify
themselves as public health pro-
fessionals are as diverse as the
multitude of factors affecting the
health of populations. Articulating
a common ethic for this diverse
group is a formidable challenge.
In the spring of 2000, the gradu-
ating class of the Public Health
Leadership Institute chose writing
a code of ethics for public health
as a group project. The institute
provides advanced leadership
training to people who are al-
ready in leadership roles in pub-
lic health. Because the fellows
bring a wealth of experience from
a wide variety of public health in-
stitutions, they are uniquely able
to represent diverse perspectives
and identify ethical issues com-
mon in public health.
At the 2000 meeting of the Na-
tional Association of City and
County Health Officers, the group
added a non-institute member
( J. C. Thomas) and charted a plan
for working toward a code. The
plan included receiving a formal
charge as the code of ethics work-
ing group at the annual meeting of
the American Public Health Asso-
c ...
July 2002, Vol 92, No. 7 American Journal of Public Health E.docxdonnajames55
July 2002, Vol 92, No. 7 | American Journal of Public Health Editorial | 1057
⏐ EDITORIAL
A Code of
Ethics for
Public Health
The mandate to ensure and pro-
tect the health of the public is an
inherently moral one. It carries
with it an obligation to care for
the well-being of communities,
and it implies the possession of an
element of power to carry out
that mandate. The need to exer-
cise power to ensure the health of
populations and, at the same time,
to avoid abuses of such power are
at the crux of public health ethics.
Until recently, the ethical na-
ture of public health has been im-
plicitly assumed rather than ex-
plicitly stated. Increasingly,
however, society is demanding ex-
plicit attention to ethics. This de-
mand arises from technological
advances that create new possibil-
ities and, with them, new ethical
dilemmas; new challenges to
health, such as the advent of HIV;
and abuses of power, such as the
Tuskegee study of syphilis.
Medical institutions have been
more explicit about the ethical
elements of their practice than
have public health institutions.
However, the concerns of public
health are not fully consonant
with those of medicine. Thus, we
cannot simply translate the princi-
ples of medical ethics to public
health. In contrast to medicine,
public health is concerned more
with populations than with indi-
viduals, and more with prevention
than with cure. The need to artic-
ulate a distinct ethic for public
health has been noted by a num-
ber of public health professionals
and ethicists.1–5
A code of ethics for public
health can clarify the distinctive
elements of public health and the
ethical principles that follow from
or respond to those elements. It
can make clear to populations and
communities the ideals of the pub-
lic health institutions that serve
them, ideals for which the institu-
tions can be held accountable.
THE PROCESS OF
WRITING THE CODE
The backgrounds and perspec-
tives of people who identify
themselves as public health pro-
fessionals are as diverse as the
multitude of factors affecting the
health of populations. Articulating
a common ethic for this diverse
group is a formidable challenge.
In the spring of 2000, the gradu-
ating class of the Public Health
Leadership Institute chose writing
a code of ethics for public health
as a group project. The institute
provides advanced leadership
training to people who are al-
ready in leadership roles in pub-
lic health. Because the fellows
bring a wealth of experience from
a wide variety of public health in-
stitutions, they are uniquely able
to represent diverse perspectives
and identify ethical issues com-
mon in public health.
At the 2000 meeting of the Na-
tional Association of City and
County Health Officers, the group
added a non-institute member
( J. C. Thomas) and charted a plan
for working toward a code. The
plan included receiving a formal
charge as the code of ethics work-
ing group at the annual meeting of
the American Public Health Asso-
c.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
*
CSCI 714: Software Project Planning and Estimation
Lecture 4B: Work Breakdown Structure
Gursimran Singh Walia
North Dakota State University
[email protected]
*
The Work Breakdown StructureA work breakdown structure (WBS) is an outcome-oriented analysis of the work involved in a project that defines the total scope of the projectIt is a foundation document in project management because it provides the basis for planning and managing project schedules, costs, and changes
Approaches to Developing WBSsUsing guidelines: Some organizations, like the DOD, provide guidelines for preparing WBSsThe analogy approach: It often helps to review WBSs of similar projectsThe top-down approach: Start with the largest items of the project and keep breaking them downThe bottoms-up approach: Start with the detailed tasks and roll them up
Basic Principles for Creating WBSs*
1. A unit of work should appear at only one place in the WBS.
3. A WBS item is the responsibility of only one individual, even though many people may be working on it.
4. The WBS must be consistent with the way in which work is actually going to be performed; it should serve the project team first and other purposes only if practical.
5. Project team members should be involved in developing the WBS to ensure consistency and buy-in.
6. Each WBS item must be documented to ensure accurate understanding of the scope of work included and not included in that item.
7. The WBS must be a flexible tool to accommodate inevitable changes while properly maintaining control of the work content in the project according to the scope statement. *Cleland, David I. Project Management: Strategic Design and Implementation, 1994
Good WBS Design PrinciplesThe 100% RuleThe WBS defines 100% of the work of the projectAnything that isn’t defined in the WBS is outside the scope of the project.The work content on any item is the sum of what is included under that work itemUpper Levels are Planned outcomes (deliverables), not planned actionsEnds of WBS include the activities needed to create the project deliverablesMutually-exclusive elementsWork should only appear in one place in the WBSWBS must be consistent with the way the project will be performed and controlledMust be easy to update
WBS RolePartition the major project deliverables into smaller components to improve the accuracy of cost estimatesProvide a mechanism for collecting actual costsProvide a mechanism for performance measurement and control
Why create a WBS?Cost EstimatingCost BudgetingResource PlanningRisk Management PlanningActivity Definition
SchedulingScheduling forces:Quantification of discrete effortPlacement of tasks in proper relationshipTwo most common scheduling methodologiesBar Charts (aka Gantt Charts)Critical Path Method (CPM) using Precedence Diagramming Method (PDM)
Bar / Gantt Charts Defined:Analyze and specify the basic approach in executionSegment into reasonable number of activitiesEstimate the time required.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
CSCI 561 DB Standardized Rubric
50 Points
Criteria
Levels of Achievement
Content
Advanced
Proficient
Developing
Not present
Thread (19 pts.)
Student effectively answers the questions with supporting material from the week’s reading with thoughtful analysis. Christian worldview integration found, supported by scripture.
19 to 17 points*
Student’s post effectively answers both questions in the discussion board by thoroughly analyzing material presented by the course readings (internal sources) as well as other academically approved sources (external). Post shows a thorough interaction with material in a thought-provoking manner to encourage class interaction.
16 points*
Student’s post effectively answers the key points of both questions in the discussion board. Post reveals interaction with course readings (internal) sources or other academically approved (external) sources. Post shows proficient interaction with material in logical manner so as to encourage class interaction.
15 to 1 points*
Student’s post answers all or most of the key points of both questions in the discussion board. Post reveals interaction with some course (internal) sources or other (external) sources. Post shows moderate interaction with material in logical manner which may or may not promote class interaction.
0 points
No post was made for this thread.
Reply 1 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with both course readings (internal sources) and other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the ongoing conversation and encourages collaborative discussion among peers in a proficient way. Student supports their thoughts with either course readings (internal sources) or other academically approved sources (external). Biblical integration found.
6 to 1 points*
Student’s reply adds minimal depth to the ongoing conversation among peers in a thought-provoking way. Student supports their thoughts with either course readings (internal sources) or other sources (external). Biblical integration may or may not be found.
0 points
No initial reply was made for this thread.
Reply 2 (8 pts)
Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture.
8 points*
Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with course readings (internal sources) or other academically approved sources (external). Biblical integration found.
7 points*
Student’s reply adds some depth to the .
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
How to Make a Field invisible in Odoo 17Celine George
It is possible to hide or invisible some fields in odoo. Commonly using “invisible” attribute in the field definition to invisible the fields. This slide will show how to make a field invisible in odoo 17.
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdfTechSoup
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
2024.06.01 Introducing a competency framework for languag learning materials ...Sandy Millin
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Introduction to AI for Nonprofits with Tapp Network
F e a t u r eGetting on Target with CommunityHealth Advi.docx
1. F e a t u r e
Getting on Target with Community
Health Advisors (GOTCHA): an
innovative stroke prevention project
Lachel Story, Susan Mayfield-Johnson, Laura H Downey,
Charkarra Anderson-Lewis, Rebekah Young
and Pearlean Day
The University of Southern Mississippi, Hattiesburg, MS, USA
Accepted for publication 18 September 2010
STORY L, MAYFIELD-JOHNSON S, DOWNEY LH,
ANDERSON-LEWIS C, YOUNG R and DAY P. Nursing Inquiry
2010; 17:
373–384
Getting on Target with Community Health Advisors
(GOTCHA): an innovative stroke prevention project
Health disparities along with insufficient numbers of healthcare
providers and resources have created a need for effective and
efficient grassroots approaches to improve community health.
Community-based participatory research (CBPR), more specifi-
cally the utilization of community health advisors (CHAs), is
2. one such strategy. The Getting on Target with Community
Health
Advisors (GOTCHA) project convened an interdisciplinary team
to answer the call from 10 counties in the rural Mississippi
Delta area of ‘The Stroke Belt’ to meet the region’s identified
health needs, and to impact the health of a disparaged state.
This
article explores this CBPR project including the community
involvement strategies, innovative CHA training curriculum,
evalua-
tion plan, and implications to healthcare professionals,
particularly nurses.
Key words: cardiovascular health, community, education, health
promotion, lay health workers, minority.
Health disparities along with insufficient numbers of health-
care providers and resources have created a need for grass-
roots approaches that effectively and efficiently address
community health needs. Community-based participatory
research (CBPR) is one such strategy and is defined as a ‘col-
laborative approach to research that equitably involves all
partners in the research process and recognizes the unique
strengths that each bring’ (Minkler and Wallerstein 2003, 4).
3. CBPR is a long-term cyclical process that requires commit-
ment to meet three goals: research, action, and education.
In this participatory process, information is exchanged freely
and all partners share problem-solving to accomplish knowl-
edge attainment. The community is a unit of identity with
existing strengths and resources upon which to build this
process. Additionally, the resources and expertise of research
partners are employed to benefit all stakeholders. CBPR
focuses on local public health problems and ecology while
recognizing that there are multiple determinants of health
(Minkler and Wallerstein 2003). This approach creates a
project that is truly community-based and community-driven
not merely community-placed. This approach also provides a
unique opportunity for nurses to engage the community to
generate substantial societal change.
Community transformation works through a social ecol-
ogy model (Stokols 2000; Institute of Medicine 2002). Social
ecology implies that certain behaviors, social roles, and envir-
4. onmental conditions can influence an individual’s well-
being, thus connecting well-being with the sociophysical
environment. The social ecology model appreciates that the
individual is intertwined with the environment in a dynamic
relationship. Individual health behaviors are developed and
reinforced by the personal, physical, and social context of
multiple life domains (Stokols 2000). Health is a result of the
quality of the individual’s fit with his or her environment.
A core assumption of the social ecology model is that
environment is whole and interconnected. All parts of the
whole are equal and mutually influence each other. Individ-
Correspondence: Assistant Professor Lachel Story, The
University of Southern
Mississippi, School of Nursing, 118 College Dr., Box 5095,
Hattiesburg, MS
39406, USA.
E-mail: <[email protected]>
� 2010 Blackwell Publishing Ltd
Nursing Inquiry 2010; 17(4): 373–384
5. ual- and community-level variables influence health as well
as health outcomes. Altering both levels of variables can initi-
ate ecological transformation as well as impact specific
health outcomes. Another key principle of the socioeco-
logical model is that a comprehensive understanding of
health requires a multidisciplinary approach (Freudenberg
et al. 1995). Healthcare providers’ participation in the pro-
cess requires reciprocity and co-operation by all disciplines
involved to bring about transformation (Grzywacz and Fugua
2000).
Considering an individual’s community is a powerful
force in his or her lives, standard individually based interven-
tions may not be suitable for long-lasting change. Innovation
in developing or refining interventions to include broader
community-based dimensions can improve outcomes. Devel-
oping interventions to solve community problems can occur
through social engineering, new knowledge production, and
6. transformational leadership inspired to create a self-reflec-
tive community of inquiry (Minkler and Wallerstein 2003).
Getting on Target with Community Health Advisors
(GOTCHAs) is a cost-effective, community-based participa-
tory research (CBPR) approach that can address a variety of
constructs identified by the social ecological model. Commu-
nity health advisors (CHAs) are lay persons with special train-
ing to provide designated health services and information to
fellow community members. Serving primarily underserved
populations, these health workers provide valuable liaison
services between community members and the formal health-
care delivery system. An accepted characteristic of a CHA is
that the individual is indigenous to the community and famil-
iar with its physical and social characteristics. CHAs also have
local knowledge of community problems and possible solu-
tions (Nemcek and Sabatier 2003; Andrews et al. 2004).
Located in ‘The Stroke Belt’, Mississippi (MS), is a prime
location to initiate grassroots efforts where recognized
7. health disparities, especially in cardiovascular disease (CVD)
and obesity, exceed those in other states and are exacerbated
by a shortage of healthcare providers. Over three-fourths of
the state’s counties, including all of those in the MS Delta,
are designated health professional shortage areas (MS
Department of Health 2004). The MS Delta is an obvious
choice for a CBPR project because of its deep sense of com-
munity along with its rich history of coming together to over-
come obstacles. The depth of community involvement has
varied across CBPR projects with a wide range of success in
their outcomes (i.e. Baker et al. 1997; Earp et al. 2002;
Kegler and Malcoe 2004; Kim et al. 2004; Krieger et al. 2005;
Mukherjee and Eustache 2007). The purpose of this article
is to explore an innovative stroke prevention project in the
MS Delta, GOTCHA, which incorporated CBPR principles
in all phases of the project to engage and work with the com-
munity to address this overwhelming health disparity. At the
conclusion of the article, implications of CHAs to nursing
8. and community health practice are presented.
GOTCHA PROJECT OVERVIEW
In response to a request for proposals by the Delta Health
Alliance (DHA), the Center for Sustainable Health Outreach
staff members convened two informal discussion groups as a
means of initiating the CBPR process prior to writing the
proposal and guide the resulting project. The information
provided in these discussion groups was used in proposal
development. Two discussion groups were held in the MS
Delta area – one with 13 healthcare professionals (social
workers, dietitians, nurses, administrators, and clinic manag-
ers) and one with 10 community members. Participants in
both groups identified CVD – particularly stroke and heart
disease – as well as diabetes, hypertension, and obesity, as pri-
ority health concerns. Participants specifically discussed the
lack of basic knowledge concerning risk factors, prevention
methods, lifestyle, and behavior modification as well as the
lack of access to health-care in the community. Participants
9. were concerned that there was inadequate attention to the
prevention of these chronic conditions.
When asked what type of programs and activities partici-
pants would like to see in their communities, both groups
advocated for programs that incorporated methods that
were participatory, accessible, and free. In addition, both
groups discussed the need for easily understood educational
activities and materials delivered in common language.
Health professionals participating in the discussion group
stressed the need for community residents to have access to
free hypertension and glucose testing in their communities.
Community residents expressed their desire for peer-to-peer
education that was easily understood and without medical
jargon as well as support, especially for caregivers of persons
with chronic diseases and the elderly. Residents wanted prac-
tical information applicable to their daily routines.
Discussion questions were strength-based, explorative,
and focused on the types of programs and services commu-
10. nity members desired. Thus, the GOTCHA project was devel-
oped from the feedback provided in those discussion
groups, input from other community leaders in the targeted
service areas, and MS morbidity and mortality data.
The purpose of GOTCHA was to develop and implement
a CHA project grounded in CBPR that focuses on stroke pre-
vention and early detection methods. Although emphasis has
been placed on the prevention and early detection of strokes
in African American men and women, considerable attention
374 � 2010 Blackwell Publishing Ltd
L Story et al.
has not been focused on the several contributing chronic dis-
eases (diabetes, hypertension, and CVD) to stroke in combi-
nation with lifestyle modification, improved nutrition, stress
management, and increased physical activity. The GOTCHA
service area included 10 of the 18 counties serviced by DHA
in the MS Delta: (i) Coahoma, Quitman, and Tallahatchie
11. counties; (ii) Leflore, Carroll, and Holmes counties; (iii) Sun-
flower and Bolivar counties; (iv) Washington county; and (v)
Humphreys county. Staff and community leaders who live
and work in the Delta area recommended the aforemen-
tioned groups of counties. Location of health services and
resources was an additional consideration for clustering.
Utilization of CHAs as connectors between healthcare
consumers and providers has become increasingly attractive
as a means of promoting health among groups that have
traditionally lacked access to health care. GOTCHA incorp-
orated a training design that was comprehensive and holistic
in nature. Recommendations from previous research guided
GOTCHA program staff in adapting and designing the pro-
ject curriculum. Following recommendations of other lead-
ers in the field, project staff developed a curriculum that
would first train participants with core skills and competen-
cies in outreach, followed by disease-specific training
(Catalani et al. 2009). Project staff did not assume that
12. participants already possessed all necessary outreach skills.
Rather, the training curriculum and educational methods
are more comprehensive in an effort to address the com-
plexities of health outreach.
The GOTCHA project comprised two segments of
training: comprehensive core skills and chronic disease
modules. The Comprehensive Core Skills in Outreach for
CHAs training was adapted from The Community Health
Workers Comprehensive Skills Training (Community Health
Worker Network of NYC n.d.) curriculum and included the
development of core skills and competencies identified by
the National CHA Study (Rosenthal et al. 1998). Upon com-
pletion of a 35-hour core skills training, CHAs would acquire
comprehensive outreach skills and be equipped to under-
stand and translate chronic disease information. After com-
pletion of the Comprehensive Core Skills in Outreach for
CHA training, CHAs selected areas of focus (nutrition,
hypertension, diabetes, CVD, and lifestyle management) that
13. they wished to pursue.
Comprehensive core skills in outreach for CHAs
curriculum
CHAs do not merely educate community members about
their health, and consequently, this CHA training included
more than just health education. CHAs serve in a variety of
roles including community facilitators, lay health educators,
resource referrals, advocates, community organizers, home
visitors, medical interpreters, and patient navigators to name
a few. When working with members of the community, their
efforts are neither pedantic in nature nor didactic in meth-
odology (Community Health Worker Network of NYC n.d.).
Yet historically, CHAs are trained in narrowly defined con-
tent information utilizing methods that are instructive and
didactic with the expectation that they will enable citizens to
assume the responsibility for their own and their commu-
nity’s health. This counterintuitive thought process speaks to
the existing health disparity gaps, and a paradigm shift must
14. occur. Employing participatory and emancipatory educa-
tional methods provide training in more appropriate behav-
iors to meet the goal of community and social
transformation and reinforce CPBR theoretical constructs
(Matos and Mayfield-Johnson 2006).
Contrary to formal pedagogy, an androgogical philoso-
phy or adult education and adult-learning theories should
guide CHA training (Mayfield-Johnson 2007). An emphasis
on experiential learning is crucial because adult-learning
teaching principles and methodology should be grounded
in the learners’ experiences as true learning takes place
when applied to experience (Knowles 1980, 1984; Mayfield-
Johnson 2007). The purpose of adult education is to give
meaning to experience (Lindeman 1989). Lindeman (1989)
has stated, ‘experience is the adult learners living textbook’
(7), and adult education is ‘a continuing process of evaluat-
ing experience’ (85). Through this continual process of eval-
uating experiences, a method of awareness where one learns
15. to become alert in the discovery of meanings is developed.
The goal of adult education is twofold: personal self-
improvement in the short term with changing the social
order in the long term (Lindeman 1989).
Fundamental to adult-learning theory is the realization
that an individual must experience a need to change or to
learn before a change can occur. Lewin (1997) postulated
that people must experience an ‘unfreezing’ of old attitudes
and beliefs before they can consider new ones. Likewise, Nys-
wander (1956) built upon this perspective when she articu-
lated the principle of relevance, or starting where the people
are, as perhaps the most fundamental tenet of health educa-
tion practice. Parallel to this notion of relevance is the
importance of participation and experience (Matos and
Mayfield-Johnson 2006; Mayfield-Johnson 2007). With health
viewed as a resource originating from people within their
social context rather than from the healthcare system, par-
ticipation is critical to ensure the cultural sensitivity of
16. � 2010 Blackwell Publishing Ltd 375
GOTCHA
programs, facilitate sustainability of change efforts, and
enhance health in its own right (Jewkes and Murcott 1998).
CBPR principles support this theoretical framework.
Such emphasis on appropriate pedagogy is fundamental
to the development of a successful CHA training program
including popular education techniques as the primary teach-
ing methodologies. Popular education is an educational
approach designed to raise participant consciousness of the
connection between individual personal experiences and lar-
ger societal problems. Popular education has origins in the
writings of exiled Brazilian philosopher Paulo Freire through
the publication of Pedagogy of the oppressed (Freire 1970) and
other banned writings during the Latin American military dic-
tatorship in the 1970s. Freire expressed that reality was not
objective truth or facts to be discovered but ‘includes the ways
17. in which people involved with facts perceive them … The con-
crete reality is the connection between subjectivity and objec-
tivity, never objectivity isolated from subjectivity’ (Freire
1973,
29). Freire (1970) provided the psychosocial understanding
of how emancipatory knowledge can lead to the power to
make change. As people engage in dialog with each other
about their communities and the larger social context, how
they think and ascribe meaning about their social world
changes, their relationships to each other become strength-
ened and their ability to reflect on their own values and
choices increases (Matos and Mayfield-Johnson 2006; May-
field-Johnson 2007). Social change then begins with persons
reflecting on their values, their concern for a more equitable
society, and their willingness to support others in the commu-
nity. As people learn about root causes to issues and under-
stand their strengths, they are better able to recognize and
understand the political, economic, and social conditions
that surround them. After which, people are able to move
18. from passivity to active participation, to be critical of the status
quo, reject oppression, and affect change (Mayfield-Johnson
2007).
As a result, the GOTCHA training design and curriculum
differs significantly from other CHA interventions and pro-
grams. In most CHA models, an integrative disease-specific
curriculum is developed and implemented with identified
recruits. Because most training participants in CHA pro-
grams are identified as informal leaders in the community,
assumptions are made about their abilities to be a CHA.
CHA models work well in communities because CHAs are
members of their communities with knowledge of the com-
munity’s culture, language, and history. Community resi-
dents often look to these persons for advice and assistance,
and they are informal gatekeepers to the community. How-
ever, funding is rarely non-prescriptive. The collective
assumptions made about an individual’s ability to conduct
outreach by restrictive proposals when submitted to funders
19. are often misguided. Often, these proposals direct little
attention to the core skills necessary to be effective in out-
reach because outreach skills are assumed. Instead, attention
is largely focused on the specific disease or topic. These core
skills are foundational building blocks to personal develop-
ment, program implementation, program evaluation, and
community capacity building.
The National CHA Study (Rosenthal et al. 1998) recom-
mended that CHA programs adopt and refine the following
identified CHA roles and competencies: (i) cultural mediat-
ing between communities and healthcare providers; (ii)
informal counseling and social support; (iii) providing cul-
turally appropriate health education; (iv) advocating for an
individual’s and the community’s needs; (v) assuring individ-
uals receive necessary services; (vi) building individual and
community capacity; and (vii) providing limited direct ser-
vices (e.g. blood pressure readings, glucose testing). CHA
skill competencies identified included: communication
20. skills, knowledge expertise, capacity-building skills, interper-
sonal skills, service coordination skills, teaching skills, advo-
cacy skills, and organizational skills.
Table 1 (Rosenthal et al. 1998) summarizes the imple-
mentation of these roles and competencies into the
GOTCHA training, and these core roles and competencies
encapsulate the functions CHAs can serve in their communi-
ties. For example, many CHAs play an important role as
bridges and mediators between communities and the health-
care delivery system. This cultural mediation may include col-
lecting pertinent and private information from community
members that is often not shared with health and social service
providers. CHAs can ‘translate’ medical and other health ter-
minology into lay language a community member can under-
stand. They may educate community members on changes in
how services are offered, hours and pay rates at community
health clinics, and ways to engage provider interaction. CHAs
provide informal counseling and support through leading
21. support groups, time spent working with community mem-
bers on goal setting, and community resources CHAs have
developed through extensive resource networks. CHAs pro-
vide culturally appropriate health education by often making
it physically available to community members through hand-
ing out pamphlets on street corners, performing door-to-door
outreach, and home visits. CHAs often advocate for individual
and community needs as intermediaries between community
members and bureaucracies, explaining systems in lay lan-
guage and assisting to resolve problems like the lack of insur-
ance or prescription assistance programs.
CHAs do not just put community members in contact
with health services; they go much further to ensure that ser-
376 � 2010 Blackwell Publishing Ltd
L Story et al.
vices are actually obtained. As Table 1 (Rosenthal et al.
1998) specifies, CHAs attempt to ensure that people receive
22. necessary services. Ensuring people receive these services
may include physically locating an individual who lacks a
telephone about test results or providing referrals to food
banks and other support programs. CHAs assist in building
individual and community capacity. CHAs increase the indi-
vidual’s capacity to protect and improve health through edu-
cation and skill development, such as how to prepare
traditional foods with less fat. CHAs also help communities
identify their priority needs and work to resolve identified
problem areas. Finally, some CHAs provide various limited
services such as BMI assessment, cardiopulmonary resuscita-
tion and first aid, and home glucose and blood pressure
monitoring.
Incorporation of a core skills curriculum that included
the identified CHA roles and competences in an emancipa-
tory and participatory curriculum design was vital to the
philosophical foundational for this project. The Community
Health Workers Comprehensive Skills Training (Community
23. Health Worker Network of NYC n.d.) curriculum was
adapted for use with the GOTCHA program. The Commu-
Table 1 Methods for incorporating suggested roles and
competencies into GOTCHA
CHA roles and competencies
Methods for incorporating suggested roles and competencies
into
GOTCHA
Cultural mediating between communities and
healthcare providers
Educating community members on understanding and navigating
the healthcare and social service systems
Translation, interpretation, and facilitation of community-
provider
communication
Gathering information for medical providers
Educating medical and social service providers about
community
needs
Linking health professionals to community needs
24. Informal counseling and social support Helping families
develop social capital
Leading support groups
Providing individual support through active listening techniques
Providing culturally appropriate health education Teaching
concepts of disease prevention and health promotion
Helping manage chronic illness
Integrating concepts of adult learning and popular education
Advocating for an individual’s and the community’s
needs
Knowledge of resources in community
Representatives for community needs
Presentations to community and larger stakeholders
Assuring an individual receive necessary services Linking to
services
Making referrals
Providing follow-up
Building individual and community capacity Individual –
change health-related behaviors
Community – help communities assess their needs and develop
25. action plans
Providing limited direct services Personal height, weight, waist
circumference, body fat percentage,
and BMI awareness; CPR and first aid; home glucose
monitoring;
home blood pressure readings; leading physical activity exercise
sessions and walking groups; and demonstrating how to read
food
labels, control portion sizes, reducing salt, fat, and sugar in
foods,
and translating consumer marketing techniques and food buying
relationships into healthier habits
Assisting with food, employment, and ⁄ or housing resources
Source: Rosenthal et al. (1998).
� 2010 Blackwell Publishing Ltd 377
GOTCHA
nity Health Workers Comprehensive Skills Training is a
35-hour training designed by community health workers to
include the core skills and competencies identified by the
26. National CHA Study (Rosenthal et al. 1998). Additional
examples of cultural humility (Tervalon and Murray-Garcia
1998), popular education methods, reflections of MS Delta
history, and participants’ life stories were included in train-
ing to enhance the application and utility of the curriculum
by MS Delta residents. The resulting Comprehensive Core
Skills in Outreach for CHAs curriculum is consistent with
popular education and adult-learning principles in design,
length, and philosophy.
Table 2 Summary of chronic disease modules
Chronic Disease
Modules Objectives
Nutrition Reinforce key stroke messages
Increase knowledge of basic nutrition knowledge
Identify the functions of nutrients in the body
Demonstrate accurate measurement of height, weight, waist
circumference, and body mass index
Compare and contrast serving sizes and portion sizes
Demonstrate accurate readings of food labels
27. Understand grocery store marketing techniques and consumer
food buying relationships
Translate Delta culture eating habits
Model a supermarket tour and food label reading exercise
Cook heart healthy meals
Explore options for CHA to use knowledge and skills in the
community
Diabetes Reinforce key stroke messages
Increase knowledge of diabetes including risk factors,
prevention, treatment, and complications
Increase knowledge of how to engage healthcare professionals
to improve personal diabetes
outcomes
Demonstrate accurate measurement of blood glucose
Explore options for CHA to use knowledge and skills in the
community
Hypertension Reinforce key stroke messages
Increase knowledge of hypertension including risk factors,
prevention, treatment, and complications
Increase knowledge of how to engage healthcare professionals
to improve personal hypertension
28. outcomes
Demonstrate accurate blood pressure measurement
Explore options for CHA to use knowledge and skills in the
community
Cardiovascular disease Reinforce key stroke messages
Increase knowledge of hypertension including risk factors,
prevention, treatment, and
complications
Demonstrate proficiency in community cardiopulmonary
resuscitation
Explore options for CHA to use knowledge and skills in the
community
Lifestyle management Reinforce key stroke messages
Define stress and understand the body’s physiological responses
Increase knowledge of stress risk factors, prevention,
modification techniques, and potential
complications of unmanaged stress
Demonstrate stress management techniques
Increase knowledge of physical activity basics and potential for
life enhancement and
disease reduction
29. Identify potential home exercise equipment activities
Demonstrate strength training, low impact and stretching
exercises
378 � 2010 Blackwell Publishing Ltd
L Story et al.
Chronic disease modules for CHAs curriculum
Public health professionals, nutritionists, and a nurse affili-
ated with the project developed the chronic disease modules
in collaboration with community members. Specifically,
training modules related to nutrition, hypertension, dia-
betes, CVD, and lifestyle management were developed fol-
lowing input from community consultants (see Table 2).
Table 2 also identifies the content areas and the objectives
for each of the training modules. To obtain this input, pro-
fessionals trained in the content areas met with CHA repre-
sentatives to determine the community’s expectations,
needs, and previous content experiences. The information
gained from these meetings then guided the development
30. of each module. Once the modules were developed,
GOTCHA staff substantiated these chronic disease modules
with the CHAs to determine whether the module accurately
and culturally reflected the information they had shared.
These CHA representatives also received acknowledgement
in authorship of the modules for the critical part they played
in its development. This interdisciplinary partnership,
among both program staff and CHAs, reflects the CBPR
focus and commitment guiding the GOTCHA project.
Key stroke messages including the American Heart Asso-
ciation’s Know Your Numbers (KYN; blood pressure, body
mass index, glucose, cholesterol) underlined each disease
module, and the connection of stroke to each individual
chronic disease area was demonstrated. The premise for all
the chronic disease modules was not only to increase knowl-
edge in these areas but also to equip CHAs with skills that
could be used in the community and at their jobs when
applicable. These skills included the measurement of blood
31. pressure, pulse, weight, height, body mass index, and blood
glucose as well as cardiopulmonary resuscitation. The ultim-
ate goal of the chronic disease modules was to create lay
‘content experts’ that could then go out and train future
CHAs in these areas as well as conduct community-level activ-
ities. CHAs can utilize their familial and peer networks to
share correct stroke prevention and early detection educa-
tion, offer some direct services, and provide social support.
Upon the completion of the core skills and chronic dis-
ease training, participants received continuing education
units (CEUs) from the Office of Professional Development
and Educational Outreach at The University of Southern
Mississippi (USM) in addition to certificates of completion.
By including CEUs as a part of the training design, the sig-
nificance of the training is emphasized with goals, objectives,
content outline, and teaching methodologies submitted and
approved by a governing academic institution. CEU tran-
scripts are from the university, not from the program. Train-
32. ing participants also received a small monetary stipend for
their participation at the completion of the comprehensive
core skills and three of the chronic disease training modules.
At the conclusion of the core and chronic disease training
modules, a graduation ceremony was held at each training
site to celebrate the accomplishment of completing the
extensive CHA trainings. Each CHA group had completed
approximately 95 hours of training over a period of
6 months, and graduation often reflects the deep physical,
emotional, and time commitment each CHA voluntarily
makes. A graduation ceremony also forges a strong CHA
group identity in that it facilitates a strong sense of accom-
plishment and gives value to the training they have received
(Mayfield-Johnson 2007). The ceremony also presented the
CHAs to the community and introduced their new roles.
During this ceremony, the CHAs received a tool kit includ-
ing the necessary equipment (i.e. glucose monitors, strips,
blood pressure cuffs, scales, tape measures, biohazard con-
33. tainers, sanitizing wipes, antibacterial hand sanitizer) needed
to conduct skills acquired in the chronic disease training.
The CHAs can use the toolkits to implement their newly
acquired skills in their community.
RECRUITMENT
Recruitment of GOTCHA training participants involved a
two-step process that began with the identification of com-
munity consultants, who were recognized, informal leaders,
in a community area. These persons represented invaluable
resources and often were gatekeepers in their communities.
An informal method of snowball interviewing, specifically
reputational and decisional analysis, through community for-
ums held in each training area identified community consul-
tants. Identification involved the formal or informal
nomination of residents who play a powerful role in commu-
nity affairs by knowledgeable community members. Addi-
tionally, community informants were asked to describe
recent community decisions and key players in those deci-
34. sions. The following questions were used to help identify
community consultants: (i) Who do people in this commu-
nity go to for help or advice? (ii) What person in this com-
munity do people trust will do what is right for the
community? (iii) When the community has had a problem
in the past, who has been involved in working to solve it?
and (iv) Who would have to be involved to get things done
in the community? Persons designated as meeting the above
criteria were asked to serve as community consultants.
Roles of the community consultants included assisting
GOTCHA staff in publicizing the GOTCHA project, identify-
ing and recruiting potential community members to partici-
� 2010 Blackwell Publishing Ltd 379
GOTCHA
pate in CHA training, and assisting staff with training set up.
The following criteria guided CHA training recruitment:
(i) participants must be at least 18 years old; (ii) participants
35. must hold a high school diploma or equivalent; and (iii) par-
ticipants should display an active interest in improving the
health of their communities. Some community consultants
utilized a convenience sampling method to recruit partici-
pants, often targeting people who attended the same church
or worked in the same business thus limiting representation
of the entire target areas. GOTCHA staff guided community
consultants to broaden their recruiting base to represent the
target service area comprehensively. Changes in marketing
strategies (i.e. local television, radio, and newspapers) were
employed to increase community awareness of the project
and improve recruitment.
Additionally, the consultants worked closely with GOT-
CHA staff in identifying training locations, arranging for
audiovisual equipment needs, and coordinating food for
each training group. The consultants assisted in greeting
participants and providing assistance at each training ses-
sion. Each community consultant received monetary com-
36. pensation for the assistance provided.
COMMUNITY PRESENCE
In addition to reducing the incidence of stroke in the MS
Delta, GOTCHA staff worked to develop and maintain posi-
tive relationships with community members. Prior to begin-
ning training, all GOTCHA staff from the principal
investigator ⁄ director down to the community consultants
attended and facilitated community informational meetings
in the target service areas. To establish positive relationships
with the community, GOTCHA staff recognized the import-
ance of removing distance and unfamiliarity as barriers to
their accessibility and acceptance within the communities.
These meetings provided an opportunity for staff to intro-
duce themselves to the community as well as to share infor-
mation regarding the purpose and design of the project with
the community. During the informational meetings,
GOTCHA staff asked community members to prioritize their
major health issues and identify local community resources
37. and barriers to improving health in the area. Further, com-
munity members were encouraged to ask questions, offer
suggestions, and hold the staff accountable to maintaining
open community dialog so that the project would truly
reflect an equitable community relationship. These meetings
were foundational to the project’s paradigm and would aid
in successful implementation of the project. Staff mailed a
summary of all information obtained during the community
informational meeting to all community members who
attended the meeting. Too often, data shared with academic
intuitions and health programs are not reported back to the
community members from which the information originated
(Minkler and Wallerstein 2003); GOTCHA staff desired to
facilitate an emancipatory model in philosophy and practice.
All communication shared with the program is disseminated
to the community. This approach is one method of ensuring
the ongoing communication and supporting a true CPBR
relationship.
38. Although an employee of USM, the GOTCHA project
program coordinator lives and works in the MS Delta. The
involvement of an MS Delta resident as a project staff mem-
ber allowed community consultants and training participants
to relate to a well-known and recognized person in the com-
munity with the GOTCHA project. The program coordina-
tor successfully developed rapport with community members
because of their similar ethnic and cultural backgrounds.
The program coordinator’s accessibility in the community
enhanced the GOTCHA project’s entry and acceptance in
the community, and the program coordinator’s presence in
the community increased the participants’ trust in the
GOTCHA project and its staff. According to Catalani et al.
(2009), trust represents the most consequential aspect of
community health work that allows access to personal infor-
mation – essential in helping community members make
healthful lifestyle and behavioral changes. Observation of
the trusting and respectful relationships between the pro-
39. gram coordinator and other GOTCHA staff accelerated
entry into the community and increased the probability of
successful project implementation.
EVALUATION
Because of the time limitations of funding for this project,
evaluation of community- and policy-level changes is not pos-
sible. An extensive amount of time is needed to observe and
measure macro-level changes resulting from CBPR projects.
However, from the beginning of the project, GOTCHA staff
sought to evaluate rigorously the impact of the CHA training
on participants. Because implementation of the GOTCHA
project is ongoing, impact or outcome evaluation cannot be
conducted at this time. With these limitations stated, it is
important to review and disseminate information on what
evaluation strategies are being implemented to evaluate the
impact of GOTCHA’s training. A mixed method approach is
being used to evaluate comprehensive core skills training and
training in the chronic disease modules. Quantitative and
40. qualitative approaches are employed to assess how the com-
prehensive core skills training enhanced CHAs competency,
stroke prevention skills, as well as other factors, such as CHAs’
380 � 2010 Blackwell Publishing Ltd
L Story et al.
sense of empowerment. Table 3 defines the data collection
instruments used, identifies whether it is qualitative or quanti-
tative in nature, and specifies when each data collection
method occurs.
To evaluate CHA’s competency in core skills, the CHA
core competency instrument is administered as a traditional
pretest at the first core training session, and again as a retro-
spective pretest at the end of the CHAs’ chosen chronic dis-
ease training. Core competencies evaluated include
leadership, translation, guidance, advocacy, and caring as
related to stroke prevention. Based on previous work, Story
(2008) identified these as skills critical to an individual’s abil-
41. ity to perform as a CHA.
To assess CHA’s competency in a specific chronic disease
module, several instruments are used. These include the
KYN knowledge assessment that is administered at the begin-
ning and ending session of each chronic disease training ses-
sion to evaluate the key stroke prevention knowledge
attainment. Similarly, a brief assessment pertaining to CVD,
lifestyle, diabetes, nutrition, and hypertension is adminis-
tered to participants before they begin a particular chronic
disease module and after they conclude the module. Addi-
tionally, a checklist is used to assess whether CHAs are able
to successfully complete certain skills. These skills include
the accurate measurement of blood pressure, pulse, weight,
height, body mass index, and blood glucose. Periodically,
the project’s registered nurse assesses whether participants
are competent in these skills. If a participant is unable to
meet these basic skills, they receive additional training on
the unmet practices. Participants should be able to perform
42. tasks related to the chronic disease modules they completed.
At the initiation of training and at the end of the chronic
disease training, the CHA lifestyle behaviors instrument is
administered to assess how participating in CHA training
affects personal health behaviors. This instrument assesses
participant’s health-related behaviors, including diet, phys-
ical activity, and smoking. Finally, an assessment of a CHA’s
perceived locus of control instrument is administered at the
first training and repeated at the end of the chronic disease
training. To collect demographic information, training par-
ticipants complete a profile sheet at the initiation of training
– the first core training session.
Talking circles, very similar to the focus group method-
ology, are used to evaluate the CHA training program,
including core skills and chronic disease-specific training ses-
sions. Each CHA group in their respective clustering is
invited to join in this reflective process at the end of the
chronic disease modules. The facilitator, an internal evalua-
43. tor who has not trained any of the CHA groups, moderates
each focus group using the same question guide. Concepts
Table 3 GOTCHA project data collection timeline
Data
Data point
Baseline
End of
core
Beginning of
chronic disease
End of chronic
disease Each session
Quantitative
CHA profile sheet X
CHA core competency X X
KYN knowledge X X
CVD knowledge X X
Lifestyle knowledge (physical
44. activity and smoking)
X X
Diabetes knowledge X X
Nutrition knowledge X X
Hypertension knowledge X X
CHA lifestyle behaviors X X
CHA self-assessment of perceived control X X
Skills checklist X
Qualitative
Session evaluation X
Overall training evaluation X X
Empowerment X
Locus of control X
� 2010 Blackwell Publishing Ltd 381
GOTCHA
explored in the talking circles include the quality of the over-
all training, their perception of being prepared to perform
45. CHA duties, personal empowerment from completing the
program, and additional support needed to perform their
role as a CHA.
Data are also collected to evaluate the process of program
implementation. At the conclusion of each training session,
participants complete a brief, open-ended survey. The survey
asks participants to identify material covered in each session
that is valuable to them and their role as a CHA. Similarly,
participants are asked to identify what segments of the ses-
sion need improvement. The overall delivery of the material
is also assessed. GOTCHA staff members review the com-
ments provided after each training session and seek to
enhance the quality of future sessions based of participant’s
feedback. Findings from each assessment are reported to
training participants at the beginning of the following train-
ing session. Again, this is a method for staff to understand
the importance of participants’ experience, comments, and
reflections. Although the content of each training session
46. remains the same, feedback from the participants directs pro-
ject staff’s delivery of the material. Participants’ honest
responses on these surveys help staff tailor the trainings to
the specific needs and desires of each group, respectively. At
the conclusion of the core and chronic disease training, each
CHA completes an open-ended questionnaire to evaluate all
training sessions as a whole.
IMPLICATIONS?? FOR NURSING AND
COMMUNITY HEALTH PRACTICE
Although there are statewide efforts to recruit and retain
health professionals in the MS Delta, health disparities, and
specifically access to medical providers, remain a barrier.
A major barrier to optimal care is the lack of access to qual-
ity, culturally appropriate preventative health care, which is
exacerbated by the fact that many people who are trying to
manage chronic diseases do not have health insurance cover-
age. Even with medical care, there may be multiple individ-
ual- and community-level barriers to adequate self-care.
47. Healthcare providers, interested community members, and
even policy-makers are continually exploring innovative strat-
egies for filling the healthcare gap.
Many noteworthy CHA programs are currently meeting
the health professional gap among groups that experience
health disparities (Perez and Martinez 2008). As knowledge
about the effectiveness of CHAs increases, greater attention
is being directed toward identifying the specific training
needs of persons preparing to become CHAs. Until recently,
very little attention has been given to standardizing CHA
training as related to critical competencies. CHAs increas-
ingly report that they see themselves as a frontline public
health worker. This perception, and the increasing demand
for CHAs to bridge the gap between health institutions and
communities, suggests that practitioners and researchers
should explore training needs and effectively meet those
needs through competency-based curriculum. Identifying
competencies, documenting training procedures that
48. address those competencies, and measuring the attainment
of competencies will provide a framework for evaluating
training effectiveness.
During the development and implementation of
GOTCHA, program staff considered how to address training
needs related to core competencies and chronic diseases.
Evaluation of this more comprehensive training curriculum,
as well as implementation of adult-learning methods, con-
tributes to the evidence base of CHA training. Specifically,
findings from this project will provide additional insight into
the process, content, and structure of a two-pronged
approach to CHA training.
The GOTCHA project is an initial step toward rigorously
evaluating the process and impact of CHA trainings. Find-
ings from this project have the potential to inform and
enhance the usefulness and relevance of CHA training pro-
grams in the MS Delta and beyond. Documentation and
evaluation of training methods and content will help estab-
49. lish best training practices, and further develop the educa-
tional evidence base of CHA trainings.
The training and practice of CHAs in communities could
be of particular interest to front-line medical providers, such
as nurses. Increasingly, nurses and nurse educators are rec-
ognizing the need for community-based approaches to care
as a means of addressing health disparities. The need for
health practitioners, including nurses, to understand and
incorporate the perspectives of diverse communities is
becoming more relevant as health professionals realize that
many health problems are influenced by factors other than
biological causes (Anderson, Calvillo, and Fongwa 2007).
The relationship between nurses and CHAs is important as
health professionals seek to connect disadvantaged popula-
tions with a fractured healthcare system.
CHAs are a logical partner for nurses who deliver
chronic disease prevention and maintenance education. Par-
ticipatory methods, specifically CBPR, will continue to be
50. invaluable as nurses and community members, including
CHAs, collaborate to meet local needs and harness assets.
For improving the delivery of health care, nursing education
and practice could include the interdisciplinary implementa-
tion and evaluation of CHA-based CBPR programs, such as
the one presented in this study.
382 � 2010 Blackwell Publishing Ltd
L Story et al.
ACKNOWLEDGEMENTS
The Getting on Target with Community Health Advisors
Project is a program of the Center for Sustainable Health
Outreach at The University of Southern Mississippi. Funding
for the Getting On Target with Community Health Advisors
Project is provided by the Delta Health Alliance (DHA), a
501(c)3 non-profit organization, and by the Office of Rural
Health Policy, Health Resources and Services Administra-
tion, Grant No. U1FRH07411, 07 ⁄ 01 ⁄ 08 to 06 ⁄ 30 ⁄ 09.
51. REFERENCES
Anderson, Nancy LR, Evelyn R Calvillo and Maria N
Fongwa. 2007. Community-based approaches to
strengthen cultural competency in nursing education
and practice. Journal of Transcultural Nursing 18: 49S–
59S.
Andrews, Jeannette O, Gwen Felton, Mary E Wewers and
Janie Heath. 2004. Use of community health workers in
research with ethnic minority women. Journal of Nursing
Scholarship 36: 358–65.
Baker, Elizabeth A, Niva Bouldin, Maria Durham, Monica E
Lowell, Maria Gonzalez, Nancy Jodaitis, Leo N Cruz, Tor-
res Idali, Miriam Torres and Sara T Adams. 1997. The
Latino health advocacy program: A collaborative lay
health advisor approach. Health Education and Behavior
24: 495–509.
Catalani, Caricia EC, Sally E Findley, Sergio Matos and
Romelia Rodriguez. 2009. Community health worker
52. insights on their training and certification. Progress in
Community Health Partnerships: Research, Education, and
Action 3: 227–35.
Community Health Worker Network of New York City. n.d.
Comprehensive skills training for community health
workers. http://www.chwnetwork.org/id15.html.
Earp, Jo Anne, Eugenia Eng, Michael S O’Malley, Mary
Altpeter, Garth Rauscher, Linda Mayne, Holly F
Matthews, Kathy S Lynch and Bahjat Qaqish. 2002.
Increasing use of mammography among older rural Afri-
can American women: Results from a community trial.
American Journal of Public Health 92: 646–54.
Freire, Paulo. 1970. Pedagogy of the oppressed. New York: Sea-
bury Press.
Freire, Paulo. 1973. Education for critical consciousness. New
York: Continuum Press.
Freudenberg, Nicholas, Eugenia Eng, Brian Flay, Guy
Parcel, Todd Rogers and Nina Wallerstein. 1995.
53. Strengthening individual and community capacity to
prevent disease and promote health: In search of rel-
evant theories and principles. Health Education Quar-
terly 22: 290–306.
Grzywacz, Joseph G and Juliana Fugua. 2000. The social ecol-
ogy of health: Leverage points and linkages. Behavioral
Medicine 26: 101–15.
Institute of Medicine. 2002. Unequal treatment: Confronting
racial and ethnic disparities in health care. Washington, DC:
The National Academies Press.
Jewkes, Rachel and Ann Murcott. 1998. Community repre-
sentatives: Representing the community? Social Science
Medicine 46: 843–58.
Kegler, Michelle C and Lorraine H Malcoe. 2004. Results
from a lay health advisor intervention to prevent lead
poisoning among rural Native American children. Ameri-
can Journal of Public Health 94: 1730–5.
Kim, Sue, Deborah Koniak-Griffin, Jacqueline H Flaskerud
54. and Peter A Guarnero. 2004. The impact of lay health
advisors cardiovascular health promotion: Using a com-
munity-based participatory approach. Journal of Cardiovas-
cular Nursing 19: 192–9.
Knowles, Malcolm S. 1980. The modern practice of adult educa-
tion: From pedagogy to andragogy, rev. edn. Chicago: Follett
Publishing Company.
Knowles, Malcolm S. 1984. The adult learner: A neglected
species,
3rd edn. Houston, TX: Gulf Publishing Company.
Krieger, James, Tim K Takaro, Lin Song and Marcia Wea-
ver. 2005. The Seattle-King County health homes pro-
ject: A randomized, controlled trial of a community
health worker intervention to decrease exposure to
indoor asthma triggers. American Journal of Public Health
94: 652–9.
Lewin, Kurt. 1997. Resolving social conflicts and field theory
in
social science. Washington, DC: American Psychological
55. Association.
Lindeman, Edward. 1989. The meaning of adult education. Nor-
man, OK: Oklahoma Research Center for Continuing
Professional and Higher Education.
Matos, Sergio and Susan Mayfield-Johnson. 2006. Compre-
hensive skills training for community health workers: A train-
ing program for frontline health and social service workers.
Hattiesburg, MS: Center for Sustainable Health
Outreach.
Mayfield-Johnson S. 2007. Her story through photovoice and
reflective interviews: Describing changes in empower-
ment among community health advisors as research part-
ners in Mississippi and Alabama. PhD diss., The
University of Southern Mississippi.
Minkler, Meredith and Nina Wallerstein, eds. 2003. Commu-
nity-based participatory research for health. San Francisco, CA:
Jossey-Bass.
� 2010 Blackwell Publishing Ltd 383
56. GOTCHA
Mississippi Department of Health. 2004. Mississippi state plan
for heart disease and stroke prevention and control. Jackson,
MS: Mississippi Department of Health.
Mukherjee, Joia S and FE Eustache. 2007. Community
health workers as a cornerstone for integrating HIV and
primary healthcare. AIDS Care 19(Suppl. 1): 73–82.
Nemcek, Mary Ann and Rosemary Sabatier. 2003. State of
evaluation: Community health workers. Public Health
Nursing 20: 260–70.
Nyswander, Dorothy. 1956. Education for health: Some prin-
cipals and their application. California Health 14: 65–70.
Perez, Leda M and Jacqueline Martinez. 2008. Community
health workers: Social justice and policy advocates for
community health and well-being. American Journal of
Public Health 98: 11–14.
Rosenthal, E Lee, Noel Wiggins, Nell J Brownstein, Sarah
57. Johnson, Angelina Borbon and Roberta Rael. 1998. Final
report of the national community health advisor study. Tucson,
AZ: University of Arizona Press.
Stokols, Daniel. 2000. Social ecology and behavioral medi-
cine: Implications for training, practice, and policy.
Behavioral Medicine 26: 129–38.
Story L. 2008. Training community health advisors in the
Mercy Delta Express Project: A case study. PhD diss., The
University of Mississippi Medical Center.
Tervalon, Melanie and Jann Murray-Garcia. 1998. Cultural
humility vs. cultural competence: A critical distinction in
defining physician training outcomes in medical educa-
tion. Journal of Health Care for the Poor and Underserved 9:
117–25.
384 � 2010 Blackwell Publishing Ltd
L Story et al.
Copyright of Nursing Inquiry is the property of Wiley-
Blackwell and its content may not be copied or emailed
58. to multiple sites or posted to a listserv without the copyright
holder's express written permission. However,
users may print, download, or email articles for individual use.
CASE: CAN THE TSA SECURE TOP-FLIGHT
PERFORMANCE?
If you’ve flown in the United States recently, you’ve passed
through security checkpoints staffed by the Transportation
Security Administration, a federal agency created in November
2001 to protect all modes of transportation. TSA agents are best
known for scanning baggage and screening persons headed for
gates in the nation’s airports. Most travelers appreciate the
concern for safety following the 2001 terrorist attacks, but
many also grumble about times they have encountered a TSA
employee who was unpleasant or seemed capricious in enforcing
rules.
For its part, TSA management has been challenged to maintain a
workforce that is knowledgeable, well qualified, ethical, and
vigilant about identifying risky persons and behavior.
Occasional news reports have identified lapses such as items
stolen from luggage (perhaps when TSA agents are inspecting
checked bags) and claims that security screeners have cheated
on tests of their ability to spot smuggled weapons.
In a recent year, TSA received an average of 1,443 claims for
lost, stolen, or damaged items, affecting a small share of the 65
million passengers who travel each month. Geoff Rabinowitz, a
business traveler whose laptop computer disappeared from one
of his bags, worries that theft by TSA or airline employees
could signal a huge security risk: “If they can get away with
taking something out of bags, what can they put in bags without
getting caught?” Lauren Suhre lost jewelry and sees theft as a
sign of poor management: “I can’t imagine working for them.”
TSA responds to such complaints by noting that it has a zero-
59. tolerance policy for employees caught stealing and investigates
charges aggressively.
Cheating on security tests is another problem that raises ethics
questions. One report said agents at airports in San Francisco
and Jackson, Mississippi, allegedly were tipped off about
undercover tests to be conducted. According to the allegations,
TSA employees described to screeners the undercover agents,
the type of weapons they would attempt to smuggle through
checkpoints, and the way the weapons would be hidden.
What is the TSA doing to improve the professionalism of its
employees? Many of the efforts involve human resource
management. One practice involves the design of jobs. TSA
wants employees to see themselves not just as “screeners” who
sit in airports but as part of a larger law enforcement effort. So
that job title was eliminated and replaced with the term security
officers, and career paths were developed. The agency also
improved its training in job tasks such as interpreting X rays
and searching property. It added performance-based pay to its
compensation plan, so high-performing employees are rewarded
in a practical way. Such changes have helped reduce employee
turnover substantially. A survey also found greater job
satisfaction among TSA workers.
These improvements are no small achievement, considering that
government agencies have tended to lag behind many businesses
in creating a focus on high performance. In a government
agency, which is not ruled by sales and profits, it can be
difficult to develop measurable performance outcomes—
measuring what individuals and groups actually achieve, rather
than merely tracking their day-to-day activities. As a result,
employees may not always see how their individual efforts can
help the agency achieve broader goals. Without this vision, they
have less incentive to excel.
TSA, part of the Department of Homeland Security (DHS), has
tried to become an exception, a performance-oriented
government agency. Marta Perez, chief human capital officer of
DHS, says TSA defined its overall objective as “to deploy
60. layers of security to protect the traveling public and the nation’s
transportation system.” To achieve that objective, the agency
set specific goals for individual airports, including goals to
improve the efficiency and effectiveness of airport screening, as
well as safety targets. For example, one goal is that the wait
time for 80 percent of the passengers going through airport
security should be 10 minutes or less. Individuals at each
airport have specific goals aimed at achieving the airport’s
overall goals. According to Perez, the goals help employees and
managers talk about what is expected and how they will be
evaluated.