Extra credit instructions
After reading the two articles posted on Learn, write a summary (2-3 pages ideally but can go certainly over that) of what you have read / learned about left-right patterning.
Try to be clear, concise and precise: 2 pages of good writing will be better than 4 of gibberish. I am looking for ideas / concepts / mechanisms linked in a coherent and logical order (you do not have to follow the order of the paragraphs of the paper). Do not patch statements one after the other with no transitions: this applies particularly to the “meeting review”. This one is a little trickier to address but I do not want to see “Mr. X said this” and “then Mrs. Y found that”. Try to say something like: “new research found …… “ or “this is corroborated by recent findings showing ….”.
HYPOTHESIS
The evolution and conservation of left-right patterning
mechanisms
Martin Blum‡, Kerstin Feistel, Thomas Thumberger* and Axel Schweickert
ABSTRACT
Morphological asymmetry is a common feature of animal body plans,
from shell coiling in snails to organ placement in humans. The
signaling protein Nodal is key for determining this laterality. Many
vertebrates, including humans, use cilia for breaking symmetry during
embryonic development: rotating cilia produce a leftward flow of
extracellular fluids that induces the asymmetric expression of Nodal.
By contrast, Nodal asymmetry can be induced flow-independently in
invertebrates. Here, we ask when and why flow evolved. We propose
that flow was present at the base of the deuterostomes and that it is
required to maintain organ asymmetry in otherwise perfectly
bilaterally symmetrical vertebrates.
KEY WORDS: Cilia, Evolution, Left-right asymmetry, Left-right
organizer, Leftward flow
Introduction
Symmetry is a guiding principle for the construction of animal body
plans. Apart from sponges, which are considered the most basal
branch of the animal phylogenetic tree (see Box 1), all other phyla
are characterized by one or several planes of symmetry along their
longitudinal axis. In radially symmetrical cnidarians, such as the
freshwater polyp Hydra, multiple planes of symmetry can be drawn.
All other major animal phyla belong to the bilateria, which are
marked by one plane of symmetry along the head to tail axis,
perpendicular to the dorsal-ventral axis. It has been suggested that
symmetry is used as a measurement of genetic fitness of a potential
mate in sexual selection (Brown et al., 2005). Asymmetry, in that
respect, is widely considered a defect. However, asymmetry is also
ubiquitously encountered in nature. This ranges from the chirality of
biomolecules, to functional asymmetries in symmetrical structures,
to the overt morphological asymmetries of organs.
In vertebrates, visceral and abdominal organs are asymmetrically
positioned with respect to the two main body axes (Fig. 1). This
arrangement, termed situs solitus (see Glossary, Box 2), is rarely
altered. Only ∼1/10,000 humans shows a mirror image o ...
HYPOTHESISThe evolution and conservation of left-right pat.docxadampcarr67227
HYPOTHESIS
The evolution and conservation of left-right patterning
mechanisms
Martin Blum‡, Kerstin Feistel, Thomas Thumberger* and Axel Schweickert
ABSTRACT
Morphological asymmetry is a common feature of animal body plans,
from shell coiling in snails to organ placement in humans. The
signaling protein Nodal is key for determining this laterality. Many
vertebrates, including humans, use cilia for breaking symmetry during
embryonic development: rotating cilia produce a leftward flow of
extracellular fluids that induces the asymmetric expression of Nodal.
By contrast, Nodal asymmetry can be induced flow-independently in
invertebrates. Here, we ask when and why flow evolved. We propose
that flow was present at the base of the deuterostomes and that it is
required to maintain organ asymmetry in otherwise perfectly
bilaterally symmetrical vertebrates.
KEY WORDS: Cilia, Evolution, Left-right asymmetry, Left-right
organizer, Leftward flow
Introduction
Symmetry is a guiding principle for the construction of animal body
plans. Apart from sponges, which are considered the most basal
branch of the animal phylogenetic tree (see Box 1), all other phyla
are characterized by one or several planes of symmetry along their
longitudinal axis. In radially symmetrical cnidarians, such as the
freshwater polyp Hydra, multiple planes of symmetry can be drawn.
All other major animal phyla belong to the bilateria, which are
marked by one plane of symmetry along the head to tail axis,
perpendicular to the dorsal-ventral axis. It has been suggested that
symmetry is used as a measurement of genetic fitness of a potential
mate in sexual selection (Brown et al., 2005). Asymmetry, in that
respect, is widely considered a defect. However, asymmetry is also
ubiquitously encountered in nature. This ranges from the chirality of
biomolecules, to functional asymmetries in symmetrical structures,
to the overt morphological asymmetries of organs.
In vertebrates, visceral and abdominal organs are asymmetrically
positioned with respect to the two main body axes (Fig. 1). This
arrangement, termed situs solitus (see Glossary, Box 2), is rarely
altered. Only ∼1/10,000 humans shows a mirror image of the
normal organ display (situs inversus; see Glossary, Box 2). Other
vertebrate asymmetries, such as left and right handedness, vary with
much higher frequencies in human populations and are not covered
here. Asymmetric organ morphogenesis and placement is initiated
during embryogenesis. In the early vertebrate neurula embryo, three
genes – those encoding Nodal, its feedback inhibitor Lefty and the
homeobox transcription factor Pitx2 – become asymmetrically
expressed in the left lateral plate mesoderm (LPM). This so-called
Nodal cascade (see Box 3) is a conserved feature of vertebrate left-
right (LR) axis formation. The functional importance of this
asymmetric expression has been demonstrated in all classes of
vertebrates (Yoshiba and Hamada, 2014). However, the mechanism
of symmetry .
This document discusses the evolution of body plans in animals and protists. It describes the major types of symmetry seen in nature including radial, bilateral, and asymmetry. It then discusses increasing complexity in body organization from unicellular to multicellular organisms with tissues and organ systems. The major body cavities seen in triploblastic animals are also summarized.
This document provides an overview of key concepts in human anatomy and physiology, including definitions of anatomy, physiology, and basic concepts like structure dictates function and homeostasis. It discusses anatomy at different levels from microscopic to macroscopic. Anatomy is the study of the structure and organization of the human body, while physiology is the study of how the body functions. The document emphasizes that understanding the relationship between structure and function is important in anatomy and physiology. It also notes that maintaining homeostasis, or internal stability, is essential for the normal functioning of the body.
The document provides an introduction to zoology, discussing several key topics:
- Theories of evolution from scientists like Lamarck and Cuvier are summarized, with Darwin's theory of natural selection identified as the most accurate.
- The complex life cycle of the monarch butterfly is used as an example to illustrate different life cycle stages like egg, larva, pupa, and adult.
- Adaptation strategies animals use to survive harsh environments like the desert and polar regions are outlined.
- The process of mitosis and key differences in replication between prokaryotes and eukaryotes are summarized.
- Homeostatic mechanisms that allow animals to maintain stable body conditions are briefly
1) The document discusses the decussatio pyramid and optical chiasm in vertebrates as examples of evolutionary processes that can provide insight into certain spinal cord phenomena.
2) It notes that gastropods exhibit a 180 degree anatomical torsion of organs and nerves due to their shell formation, similar to the nerve crossing seen in humans.
3) The authors hypothesize that examining evolutionary patterns in invertebrates like gastropods may help understand certain neurodegenerative diseases by providing new perspectives on spinal cord and brain circuits.
Orthogenesis is the theory that organisms evolve in a definite direction due to some internal mechanism, rejecting natural selection. Allometry describes the relationship between an organism's size and its body parts, such as brain size increasing with body size. Adaptive radiations occur when environmental changes open new niches, causing rapid speciation and phenotypic adaptation in a relatively short time, as seen with Hawaiian honeycreepers adapting to different island environments.
The document provides evidence that supports the theory of evolution from four main points: 1) The fossil record shows evolutionary changes and intermediate forms over time. 2) Comparative anatomy finds that closely related species share homologous structures, such as mammals sharing the same basic bone structure in their forelimbs. 3) Vestigial structures are body parts that have lost their primary function, providing evidence that structures once had a use. 4) Comparative embryology notes that in early stages, embryos of different animal species look similar, suggesting common ancestry.
1) There are two main hypotheses about the evolutionary origin of the gastropod body plan - the "rotation hypothesis" which proposes that all components of the visceropallium rotated 180 degrees relative to the head and foot, and the "asymmetry hypothesis" which proposes that the mantle cavity originated from one side only of a bilateral set of mantle cavities without requiring rotation.
2) Debate has focused on interpreting fossil evidence regarding whether ancient molluscs carried coiled shells in an exogastric or endogastric orientation.
3) While the rotation hypothesis was previously widely accepted, recent studies question whether synchronous rotation of all components actually occurred during development.
HYPOTHESISThe evolution and conservation of left-right pat.docxadampcarr67227
HYPOTHESIS
The evolution and conservation of left-right patterning
mechanisms
Martin Blum‡, Kerstin Feistel, Thomas Thumberger* and Axel Schweickert
ABSTRACT
Morphological asymmetry is a common feature of animal body plans,
from shell coiling in snails to organ placement in humans. The
signaling protein Nodal is key for determining this laterality. Many
vertebrates, including humans, use cilia for breaking symmetry during
embryonic development: rotating cilia produce a leftward flow of
extracellular fluids that induces the asymmetric expression of Nodal.
By contrast, Nodal asymmetry can be induced flow-independently in
invertebrates. Here, we ask when and why flow evolved. We propose
that flow was present at the base of the deuterostomes and that it is
required to maintain organ asymmetry in otherwise perfectly
bilaterally symmetrical vertebrates.
KEY WORDS: Cilia, Evolution, Left-right asymmetry, Left-right
organizer, Leftward flow
Introduction
Symmetry is a guiding principle for the construction of animal body
plans. Apart from sponges, which are considered the most basal
branch of the animal phylogenetic tree (see Box 1), all other phyla
are characterized by one or several planes of symmetry along their
longitudinal axis. In radially symmetrical cnidarians, such as the
freshwater polyp Hydra, multiple planes of symmetry can be drawn.
All other major animal phyla belong to the bilateria, which are
marked by one plane of symmetry along the head to tail axis,
perpendicular to the dorsal-ventral axis. It has been suggested that
symmetry is used as a measurement of genetic fitness of a potential
mate in sexual selection (Brown et al., 2005). Asymmetry, in that
respect, is widely considered a defect. However, asymmetry is also
ubiquitously encountered in nature. This ranges from the chirality of
biomolecules, to functional asymmetries in symmetrical structures,
to the overt morphological asymmetries of organs.
In vertebrates, visceral and abdominal organs are asymmetrically
positioned with respect to the two main body axes (Fig. 1). This
arrangement, termed situs solitus (see Glossary, Box 2), is rarely
altered. Only ∼1/10,000 humans shows a mirror image of the
normal organ display (situs inversus; see Glossary, Box 2). Other
vertebrate asymmetries, such as left and right handedness, vary with
much higher frequencies in human populations and are not covered
here. Asymmetric organ morphogenesis and placement is initiated
during embryogenesis. In the early vertebrate neurula embryo, three
genes – those encoding Nodal, its feedback inhibitor Lefty and the
homeobox transcription factor Pitx2 – become asymmetrically
expressed in the left lateral plate mesoderm (LPM). This so-called
Nodal cascade (see Box 3) is a conserved feature of vertebrate left-
right (LR) axis formation. The functional importance of this
asymmetric expression has been demonstrated in all classes of
vertebrates (Yoshiba and Hamada, 2014). However, the mechanism
of symmetry .
This document discusses the evolution of body plans in animals and protists. It describes the major types of symmetry seen in nature including radial, bilateral, and asymmetry. It then discusses increasing complexity in body organization from unicellular to multicellular organisms with tissues and organ systems. The major body cavities seen in triploblastic animals are also summarized.
This document provides an overview of key concepts in human anatomy and physiology, including definitions of anatomy, physiology, and basic concepts like structure dictates function and homeostasis. It discusses anatomy at different levels from microscopic to macroscopic. Anatomy is the study of the structure and organization of the human body, while physiology is the study of how the body functions. The document emphasizes that understanding the relationship between structure and function is important in anatomy and physiology. It also notes that maintaining homeostasis, or internal stability, is essential for the normal functioning of the body.
The document provides an introduction to zoology, discussing several key topics:
- Theories of evolution from scientists like Lamarck and Cuvier are summarized, with Darwin's theory of natural selection identified as the most accurate.
- The complex life cycle of the monarch butterfly is used as an example to illustrate different life cycle stages like egg, larva, pupa, and adult.
- Adaptation strategies animals use to survive harsh environments like the desert and polar regions are outlined.
- The process of mitosis and key differences in replication between prokaryotes and eukaryotes are summarized.
- Homeostatic mechanisms that allow animals to maintain stable body conditions are briefly
1) The document discusses the decussatio pyramid and optical chiasm in vertebrates as examples of evolutionary processes that can provide insight into certain spinal cord phenomena.
2) It notes that gastropods exhibit a 180 degree anatomical torsion of organs and nerves due to their shell formation, similar to the nerve crossing seen in humans.
3) The authors hypothesize that examining evolutionary patterns in invertebrates like gastropods may help understand certain neurodegenerative diseases by providing new perspectives on spinal cord and brain circuits.
Orthogenesis is the theory that organisms evolve in a definite direction due to some internal mechanism, rejecting natural selection. Allometry describes the relationship between an organism's size and its body parts, such as brain size increasing with body size. Adaptive radiations occur when environmental changes open new niches, causing rapid speciation and phenotypic adaptation in a relatively short time, as seen with Hawaiian honeycreepers adapting to different island environments.
The document provides evidence that supports the theory of evolution from four main points: 1) The fossil record shows evolutionary changes and intermediate forms over time. 2) Comparative anatomy finds that closely related species share homologous structures, such as mammals sharing the same basic bone structure in their forelimbs. 3) Vestigial structures are body parts that have lost their primary function, providing evidence that structures once had a use. 4) Comparative embryology notes that in early stages, embryos of different animal species look similar, suggesting common ancestry.
1) There are two main hypotheses about the evolutionary origin of the gastropod body plan - the "rotation hypothesis" which proposes that all components of the visceropallium rotated 180 degrees relative to the head and foot, and the "asymmetry hypothesis" which proposes that the mantle cavity originated from one side only of a bilateral set of mantle cavities without requiring rotation.
2) Debate has focused on interpreting fossil evidence regarding whether ancient molluscs carried coiled shells in an exogastric or endogastric orientation.
3) While the rotation hypothesis was previously widely accepted, recent studies question whether synchronous rotation of all components actually occurred during development.
This document summarizes key concepts in macroevolution, including how macroevolutionary changes occur through both gradualism and punctuated equilibrium. It discusses evidence from fossils and comparisons between living organisms. It also covers plate tectonics, morphological divergence and convergence, developmental patterns, comparative biochemistry, molecular clocks, and taxonomy.
This lab introduces students to the hierarchical organization of animal complexity from the cellular level to organ systems. Key concepts covered include the differences between acoelomate, pseudocoelomate, and coelomate organisms. Students learn the three main types of body symmetry - radial, bilateral, and spherical/asymmetrical - and examine examples from the animal kingdom. They also compare the developmental patterns of protostomes and deuterostomes, including differences in cleavage and fate of the blastopore. The lab aims to provide students with terminology to describe positions on bilaterally symmetrical organisms using terms like dorsal, ventral, anterior, posterior, and planes of section.
The document discusses the basis of animal classification, including:
1) Animals are classified based on their level of organization, symmetry, presence or absence of germinal layers and body cavities, segmentation, and whether they possess a notochord.
2) The key characteristics used to classify the major animal phyla include their tissue/organ structure, body plan, digestive system structure, and reproductive features.
3) The five animal kingdoms presented are sponges, cnidarians, ctenophores, flatworms, and several others with increasing complexity in their body plans and features.
Animals are classified based on fundamental features like their organization of cells, body symmetry, presence or absence of coelom, and patterns of organ systems. The classification recognizes seven animal phyla - Porifera, Cnidaria, Ctenophora, Platyhelminthes, Aschelminthes, Annelida, Arthropoda, Mollusca, and Chordata. Characteristics used for classification include their level of organization (cellular to organ systems), symmetry (radial or bilateral), presence of germ layers (diploblastic or triploblastic), and body cavity (acoelomate, pseudocoelomate, or coelomate). This classification system helps assign systematic
The document discusses the basis of animal classification, including:
1) Animals are classified based on their level of organization, symmetry, presence or absence of germinal layers and body cavities, segmentation, and whether they possess a notochord.
2) The five kingdoms of animals are sponges, cnidarians, ctenophores, flatworms, and higher animals with more complex levels of organization.
3) Key characteristics of sponges, cnidarians, ctenophores and flatworms are described.
PHYLUM ANNELIDA WITH SPECIAL REFERENCE TO METAMERISMLimitlessSourav
The document provides information about the phylum Annelida and segmentation. It discusses:
1) Annelids exhibit complete internal and external metamerism, with their bodies divided into similar segments by grooves and septa.
2) The three classes of annelids - Polychaeta, Oligochaeta, and Hirudinea - vary in their locomotory appendages and habitats.
3) Metamerism originated through various proposed theories but its exact origin remains unclear. Metamerism provides advantages for locomotion and structural evolution.
1. 1st lec. introd; classification, phylogeny, tree diagrams and pattrenswaqasAhmadshams
This document provides an introduction to animal diversity and classification. It discusses that zoology is the study of animals, which display immense diversity in forms and complexity. It then covers key concepts in animal classification including the six kingdom system, binomial nomenclature, biological species, taxa, phylogeny, and patterns of animal organization like symmetry, unicellular vs multicellular, and diploblastic vs triploblastic organization. The document provides foundational information on classifying and understanding the relationships between diverse animal forms.
1. The fossil record shows several patterns of evolution over geological time, including stasis, gradual morphological changes, and speciation.
2. Speciation can occur through either phyletic gradualism of small incremental changes over long periods, or through punctuated equilibrium of stasis with sudden changes following geographic isolation.
3. Complex structures evolved through incremental modifications of existing structures driven by genetic changes over generations in response to environmental pressures, rather than appearing abruptly, as seen in the evolution of limbs, jaws, wings, and other anatomical features.
This document discusses the classification of metazoan animals based on their anatomy and embryonic development. It describes how animals can be divided into three main groups: acoelomates without a body cavity, pseudocoelomates with only remnants of a blastocoel cavity, and coelomates with a true body cavity called a coelom. Within coelomates, animals are further divided into protostomes and deuterostomes based on differences in their early embryonic development. The classification systems discussed provide insights into evolutionary relationships among metazoan phyla.
1) Cephalopods such as octopuses, squid, and cuttlefish have adapted for life in the water through mechanisms like buoyancy control, shell reduction, and specialized cells and organs.
2) They possess acute sensory abilities, speed that rivals fish, and intelligence with large brains relative to body size.
3) Defenses include camouflage through chromatophores and iridophores that can change skin color and patterns rapidly, as well as ink secretions.
This document outlines a lesson plan on evidence for the theory of evolution. It includes discussions of various topics that provide support, such as fossil evidence, comparative anatomy and embryology, biogeography, and molecular biology. Students explore these topics through vocabulary exercises, lab stations, and analysis questions. The lesson aims to explain how this scientific evidence from diverse areas of biology all points to common descent and evolution of modern organisms over time.
Comparison Of Paramecium, Amoeba, And EuglenaJulie Kwhl
This document compares the structures and characteristics of three protists: Paramecium, Amoeba, and Euglena. Paramecium and Amoeba are both heterotrophs that feed on other organisms, while Euglena can be both a heterotroph and autotroph. Under a microscope, Paramecium has two distinct nuclei while Amoeba appears as a gray blob with one nucleus. Euglena contains chlorophyll and appears green under a microscope. The document examines differences in their trophic levels, locomotion, and reproduction to understand why they are classified into different protist supergroups.
Protozoans exhibit a variety of locomotory methods including amoeboid movement using pseudopodia, swimming movement using flagella or cilia, gliding movement using contractile myonemes, and metabolic movement through changes in body shape. Locomotion allows protozoans to search for food, mates, shelter and escape from predators. The document discusses the structures and mechanisms involved in each type of locomotion.
The document summarizes key concepts related to evolution:
1. Heredity allows traits to be passed from parents to offspring over generations, and changes in heritable traits through time result in evolution as it allows organisms to better survive and reproduce.
2. The central dogma explains how genetic information flows from DNA to RNA to proteins - DNA is transcribed into mRNA which is then translated by ribosomes into proteins.
3. Gradual changes over 300 million years led to the diversity of life today, supported by evidence like morphological similarities, connecting links between groups, and embryonic similarities showing common ancestry.
4. Anatomical and fossil evidence also support evolution by showing adaptations to environments and demonstrating changing life forms over ge
Anatomy refers to the internal and external structures of the body and their physical relationships, whereas physiology refers to the study of the functions of those structures.
From evolutionary patterns in invertebrates and vertebrates, some interesting peculiarities can be observed. For example, the decussatio pyramid in the motor system. This type of evolutionary process may be responsible for an intrinsic weakness in some spinal cord systems that warrants further investigation to develop new hypotheses about certain conditions. Specifically, the article discusses how gastropods evolved an anatomical torsion and crossed nerves, which some argue may relate to the optical chiasm and decussatio pyramid found in humans. The author aims to analyze these structures from an evolutionary perspective to further our understanding of some physiological and pathological neural processes.
This document discusses the evolutionary processes that led to the decussation of the pyramid and optical chiasm in humans. It notes that some gastropod mollusks exhibit a 180-degree torsion of internal organs due to their coiled shells. Some genes involved in regeneration and patterning are conserved between invertebrates like gastropods and vertebrates. The decussation of fibers in the human pyramid and optic chiasm may relate to an ancient genetic process that first occurred in gastropods or was an adaptation to the environment. Debate continues over whether gastropod torsion resulted from a single large mutation or a more gradual process, but it was crucial to their colonization of land.
The document discusses the cell theory, which states that all living things are made up of cells, cells carry out functions needed to support life, and cells only come from pre-existing cells. It describes how the cell theory was developed over 200 years through the work of scientists like Hooke, Pasteur, and Virchow. The cell theory gives us a foundation for understanding living things and cells. It has endured and remained largely unchanged for over 150 years despite new details being discovered. The cell theory helped develop a better understanding of how cells work.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to Extra credit instructionsAfter reading the two articles posted.docx
This document summarizes key concepts in macroevolution, including how macroevolutionary changes occur through both gradualism and punctuated equilibrium. It discusses evidence from fossils and comparisons between living organisms. It also covers plate tectonics, morphological divergence and convergence, developmental patterns, comparative biochemistry, molecular clocks, and taxonomy.
This lab introduces students to the hierarchical organization of animal complexity from the cellular level to organ systems. Key concepts covered include the differences between acoelomate, pseudocoelomate, and coelomate organisms. Students learn the three main types of body symmetry - radial, bilateral, and spherical/asymmetrical - and examine examples from the animal kingdom. They also compare the developmental patterns of protostomes and deuterostomes, including differences in cleavage and fate of the blastopore. The lab aims to provide students with terminology to describe positions on bilaterally symmetrical organisms using terms like dorsal, ventral, anterior, posterior, and planes of section.
The document discusses the basis of animal classification, including:
1) Animals are classified based on their level of organization, symmetry, presence or absence of germinal layers and body cavities, segmentation, and whether they possess a notochord.
2) The key characteristics used to classify the major animal phyla include their tissue/organ structure, body plan, digestive system structure, and reproductive features.
3) The five animal kingdoms presented are sponges, cnidarians, ctenophores, flatworms, and several others with increasing complexity in their body plans and features.
Animals are classified based on fundamental features like their organization of cells, body symmetry, presence or absence of coelom, and patterns of organ systems. The classification recognizes seven animal phyla - Porifera, Cnidaria, Ctenophora, Platyhelminthes, Aschelminthes, Annelida, Arthropoda, Mollusca, and Chordata. Characteristics used for classification include their level of organization (cellular to organ systems), symmetry (radial or bilateral), presence of germ layers (diploblastic or triploblastic), and body cavity (acoelomate, pseudocoelomate, or coelomate). This classification system helps assign systematic
The document discusses the basis of animal classification, including:
1) Animals are classified based on their level of organization, symmetry, presence or absence of germinal layers and body cavities, segmentation, and whether they possess a notochord.
2) The five kingdoms of animals are sponges, cnidarians, ctenophores, flatworms, and higher animals with more complex levels of organization.
3) Key characteristics of sponges, cnidarians, ctenophores and flatworms are described.
PHYLUM ANNELIDA WITH SPECIAL REFERENCE TO METAMERISMLimitlessSourav
The document provides information about the phylum Annelida and segmentation. It discusses:
1) Annelids exhibit complete internal and external metamerism, with their bodies divided into similar segments by grooves and septa.
2) The three classes of annelids - Polychaeta, Oligochaeta, and Hirudinea - vary in their locomotory appendages and habitats.
3) Metamerism originated through various proposed theories but its exact origin remains unclear. Metamerism provides advantages for locomotion and structural evolution.
1. 1st lec. introd; classification, phylogeny, tree diagrams and pattrenswaqasAhmadshams
This document provides an introduction to animal diversity and classification. It discusses that zoology is the study of animals, which display immense diversity in forms and complexity. It then covers key concepts in animal classification including the six kingdom system, binomial nomenclature, biological species, taxa, phylogeny, and patterns of animal organization like symmetry, unicellular vs multicellular, and diploblastic vs triploblastic organization. The document provides foundational information on classifying and understanding the relationships between diverse animal forms.
1. The fossil record shows several patterns of evolution over geological time, including stasis, gradual morphological changes, and speciation.
2. Speciation can occur through either phyletic gradualism of small incremental changes over long periods, or through punctuated equilibrium of stasis with sudden changes following geographic isolation.
3. Complex structures evolved through incremental modifications of existing structures driven by genetic changes over generations in response to environmental pressures, rather than appearing abruptly, as seen in the evolution of limbs, jaws, wings, and other anatomical features.
This document discusses the classification of metazoan animals based on their anatomy and embryonic development. It describes how animals can be divided into three main groups: acoelomates without a body cavity, pseudocoelomates with only remnants of a blastocoel cavity, and coelomates with a true body cavity called a coelom. Within coelomates, animals are further divided into protostomes and deuterostomes based on differences in their early embryonic development. The classification systems discussed provide insights into evolutionary relationships among metazoan phyla.
1) Cephalopods such as octopuses, squid, and cuttlefish have adapted for life in the water through mechanisms like buoyancy control, shell reduction, and specialized cells and organs.
2) They possess acute sensory abilities, speed that rivals fish, and intelligence with large brains relative to body size.
3) Defenses include camouflage through chromatophores and iridophores that can change skin color and patterns rapidly, as well as ink secretions.
This document outlines a lesson plan on evidence for the theory of evolution. It includes discussions of various topics that provide support, such as fossil evidence, comparative anatomy and embryology, biogeography, and molecular biology. Students explore these topics through vocabulary exercises, lab stations, and analysis questions. The lesson aims to explain how this scientific evidence from diverse areas of biology all points to common descent and evolution of modern organisms over time.
Comparison Of Paramecium, Amoeba, And EuglenaJulie Kwhl
This document compares the structures and characteristics of three protists: Paramecium, Amoeba, and Euglena. Paramecium and Amoeba are both heterotrophs that feed on other organisms, while Euglena can be both a heterotroph and autotroph. Under a microscope, Paramecium has two distinct nuclei while Amoeba appears as a gray blob with one nucleus. Euglena contains chlorophyll and appears green under a microscope. The document examines differences in their trophic levels, locomotion, and reproduction to understand why they are classified into different protist supergroups.
Protozoans exhibit a variety of locomotory methods including amoeboid movement using pseudopodia, swimming movement using flagella or cilia, gliding movement using contractile myonemes, and metabolic movement through changes in body shape. Locomotion allows protozoans to search for food, mates, shelter and escape from predators. The document discusses the structures and mechanisms involved in each type of locomotion.
The document summarizes key concepts related to evolution:
1. Heredity allows traits to be passed from parents to offspring over generations, and changes in heritable traits through time result in evolution as it allows organisms to better survive and reproduce.
2. The central dogma explains how genetic information flows from DNA to RNA to proteins - DNA is transcribed into mRNA which is then translated by ribosomes into proteins.
3. Gradual changes over 300 million years led to the diversity of life today, supported by evidence like morphological similarities, connecting links between groups, and embryonic similarities showing common ancestry.
4. Anatomical and fossil evidence also support evolution by showing adaptations to environments and demonstrating changing life forms over ge
Anatomy refers to the internal and external structures of the body and their physical relationships, whereas physiology refers to the study of the functions of those structures.
From evolutionary patterns in invertebrates and vertebrates, some interesting peculiarities can be observed. For example, the decussatio pyramid in the motor system. This type of evolutionary process may be responsible for an intrinsic weakness in some spinal cord systems that warrants further investigation to develop new hypotheses about certain conditions. Specifically, the article discusses how gastropods evolved an anatomical torsion and crossed nerves, which some argue may relate to the optical chiasm and decussatio pyramid found in humans. The author aims to analyze these structures from an evolutionary perspective to further our understanding of some physiological and pathological neural processes.
This document discusses the evolutionary processes that led to the decussation of the pyramid and optical chiasm in humans. It notes that some gastropod mollusks exhibit a 180-degree torsion of internal organs due to their coiled shells. Some genes involved in regeneration and patterning are conserved between invertebrates like gastropods and vertebrates. The decussation of fibers in the human pyramid and optic chiasm may relate to an ancient genetic process that first occurred in gastropods or was an adaptation to the environment. Debate continues over whether gastropod torsion resulted from a single large mutation or a more gradual process, but it was crucial to their colonization of land.
The document discusses the cell theory, which states that all living things are made up of cells, cells carry out functions needed to support life, and cells only come from pre-existing cells. It describes how the cell theory was developed over 200 years through the work of scientists like Hooke, Pasteur, and Virchow. The cell theory gives us a foundation for understanding living things and cells. It has endured and remained largely unchanged for over 150 years despite new details being discovered. The cell theory helped develop a better understanding of how cells work.
Similar to Extra credit instructionsAfter reading the two articles posted.docx (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
How to Make a Field Mandatory in Odoo 17Celine George
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
How to Manage Your Lost Opportunities in Odoo 17 CRMCeline George
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UPRAHUL
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
How to Add Chatter in the odoo 17 ERP ModuleCeline George
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
How to Setup Warehouse & Location in Odoo 17 InventoryCeline George
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
How to Create a More Engaging and Human Online Learning Experience
Extra credit instructionsAfter reading the two articles posted.docx
1. Extra credit instructions
After reading the two articles posted on Learn, write a summary
(2-3 pages ideally but can go certainly over that) of what you
have read / learned about left-right patterning.
Try to be clear, concise and precise: 2 pages of good writing
will be better than 4 of gibberish. I am looking for ideas /
concepts / mechanisms linked in a coherent and logical order
(you do not have to follow the order of the paragraphs of the
paper). Do not patch statements one after the other with no
transitions: this applies particularly to the “meeting review”.
This one is a little trickier to address but I do not want to see
“Mr. X said this” and “then Mrs. Y found that”. Try to say
something like: “new research found …… “ or “this is
corroborated by recent findings showing ….”.
HYPOTHESIS
The evolution and conservation of left-right patterning
mechanisms
Martin Blum‡, Kerstin Feistel, Thomas Thumberger* and Axel
Schweickert
ABSTRACT
Morphological asymmetry is a common feature of animal body
plans,
from shell coiling in snails to organ placement in humans. The
signaling protein Nodal is key for determining this laterality.
Many
vertebrates, including humans, use cilia for breaking symmetry
during
embryonic development: rotating cilia produce a leftward flow
2. of
extracellular fluids that induces the asymmetric expression of
Nodal.
By contrast, Nodal asymmetry can be induced flow-
independently in
invertebrates. Here, we ask when and why flow evolved. We
propose
that flow was present at the base of the deuterostomes and that
it is
required to maintain organ asymmetry in otherwise perfectly
bilaterally symmetrical vertebrates.
KEY WORDS: Cilia, Evolution, Left-right asymmetry, Left-
right
organizer, Leftward flow
Introduction
Symmetry is a guiding principle for the construction of animal
body
plans. Apart from sponges, which are considered the most basal
branch of the animal phylogenetic tree (see Box 1), all other
phyla
are characterized by one or several planes of symmetry along
their
longitudinal axis. In radially symmetrical cnidarians, such as
the
freshwater polyp Hydra, multiple planes of symmetry can be
drawn.
All other major animal phyla belong to the bilateria, which are
marked by one plane of symmetry along the head to tail axis,
perpendicular to the dorsal-ventral axis. It has been suggested
that
symmetry is used as a measurement of genetic fitness of a
potential
mate in sexual selection (Brown et al., 2005). Asymmetry, in
that
3. respect, is widely considered a defect. However, asymmetry is
also
ubiquitously encountered in nature. This ranges from the
chirality of
biomolecules, to functional asymmetries in symmetrical
structures,
to the overt morphological asymmetries of organs.
In vertebrates, visceral and abdominal organs are
asymmetrically
positioned with respect to the two main body axes (Fig. 1). This
arrangement, termed situs solitus (see Glossary, Box 2), is
rarely
altered. Only ∼1/10,000 humans shows a mirror image of the
normal organ display (situs inversus; see Glossary, Box 2).
Other
vertebrate asymmetries, such as left and right handedness, vary
with
much higher frequencies in human populations and are not
covered
here. Asymmetric organ morphogenesis and placement is
initiated
during embryogenesis. In the early vertebrate neurula embryo,
three
genes – those encoding Nodal, its feedback inhibitor Lefty and
the
homeobox transcription factor Pitx2 – become asymmetrically
expressed in the left lateral plate mesoderm (LPM). This so-
called
Nodal cascade (see Box 3) is a conserved feature of vertebrate
left-
right (LR) axis formation. The functional importance of this
asymmetric expression has been demonstrated in all classes of
vertebrates (Yoshiba and Hamada, 2014). However, the
mechanism
4. of symmetry breakage, i.e. how Nodal, the first asymmetric
gene, is
initially induced in the left LPM, remains a matter of much
debate.
In recent years, various models have been put forward to
explain
how symmetry is first broken in early embryos. The flow model
(Fig. 2) claims that cilia on the LR organizer (LRO; see
Glossary,
Box 2) of early developing embryos produce a leftward fluid
flow in
the extracellular space (Hamada, 2008; Hamada et al., 2002;
Hirokawa et al., 2012). This flow occurs a few hours before
induction of the Nodal cascade; LROs, which feature a
surprising
diversity of morphologies, are transient structures that
disappear
once the Nodal cascade is induced (Blum et al., 2007, 2009b).
By
contrast, the early determinants/ion-flux model acknowledges
that
cilia may play a role in symmetry breakage in some species,
such as
mouse, but proposes that symmetry breakage is initiated much
earlier – in the zygote and during early cleavage divisions
(reviewed
by Levin, 2005; Vandenberg and Levin, 2009, 2010, 2013). In
this
model, early determinants, in particular ion channels, set up
voltage
gradients that lead to the asymmetric distribution of small
molecules. In particular, the candidate molecule serotonin has
been suggested to govern asymmetric Nodal cascade activation
in
the LPM at a much later stage (Fukumoto et al., 2005;
5. Vandenberg
et al., 2013).
Genetic and experimental data clearly support the flow model in
fish, amphibians and some mammals (mouse, rabbit, human)
(Hirokawa et al., 2012). However, despite considerable efforts
in
many laboratories over a long period of time, LROs have not
been
found in the chick embryo and seem to be absent in the pig
(Gros
et al., 2009), a finding on which the early model capitalizes. In
addition, the Nodal cascade is already present in mollusks;
through an
unknown mechanism, the spiral cleavage pattern observed in
these
animals places Nodal and Pitx2 asymmetrically in the early
larva.
This asymmetry governs shell coiling in much the same way as
organ
placement in vertebrates is under the control of the Nodal
cascade
(Grande and Patel, 2009; Kuroda et al., 2009; Patel, 2009).
Here, we examine the evolution of asymmetryand of leftward
flow.
We infer that the Nodal cascade was already present in the last
common ancestor of bilateria, the urbilateria (see Glossary, Box
2).
We argue that the gastrointestinal (GI) tract was the first
functionally
asymmetrical organ system, and that the gut tube was
asymmetrical in
urbilateria.Wehypothesizethataflow-
basedmechanismofsymmetry
breakage exists in the entire deuterostome lineage (Box 1). We
7. M
E
N
T
coherent hypothesis on the evolution and conservation of LR
patterning mechanisms that is testable and, we hope, will
provoke
investigations in different model organisms throughout the
animal kingdom.
Why did organ asymmetry evolve?
If one considers the functional relevance of organ asymmetry in
humans, the heart is certainly the most striking case. It is not
only
placed asymmetrically in the chest, but also is built
asymmetrically
such that the left and right atria and ventricles differ with
respect to
pumping performance and wiring to arteries and veins
(Ramsdell,
2005). In evolutionary terms, however, a primitive heart was
nothing more than a linear contractile muscle that pumped
hemolymph, facilitating the distribution of nutrients throughout
the body (Carroll et al., 2004). Such a pump did not require
asymmetric morphogenesis or asymmetric placement in the
body.
There are many examples of such primitive hearts in extant
animals,
including the cardiac tube in Drosophila. The fly heart, which
constitutes the entire cardiovascular system, is a simple
muscular
8. pump, working in an open circulation. Flies are even viable
without
their heart, supporting a role for the heart as a facilitator of
nutrient
circulation (Medioni et al., 2009). Lung asymmetries, too, seem
not
to be functionally relevant but might reflect space constraints in
the
thorax resulting from asymmetric heart placement. We therefore
hypothesize that the digestive tube, or GI tract, was the first
organ
system to undergo asymmetric organ morphogenesis during
evolution. Invertebrates, such as snails, feature GI tracts that,
from
mouth to anus, exceed the length of the main body axis (Fig.
3A), a
situation encountered in all extant vertebrates. In carnivores,
such as
cats, this ratio is ∼3:1. It increases from 6:1 in omnivores
(humans)
to ∼10:1 in herbivores such as horses, and is particularly high
in
ruminants [>20:1 (Nickel et al., 1995)].
It is not just length, but also compartmentalization of the GI
tract
that is seen universally in animals. The mouth, esophagus,
stomach
and gut each represent modules with distinct functions and
physiological specializations. Both length and modularization
are
functionally relevant for the efficient recovery of nutrients from
ingested food. Interestingly, compartmentalization of the
digestive
system is already present in protozoans such as the ciliate
Paramecium. Here, the length of the passage of food vacuoles
9. exceeds the longitudinal dimension of the cell, the phagosome-
lysosome system is extremely plastic, and acidification occurs
only
in certain parts of the system (Allen and Fok, 2000; Fok and
Allen,
1990). A compartmentalized GI tract that exceeds body length
will inevitably need to be packaged asymmetrically.
Furthermore,
achieving this in a reliable manner, as opposed to stochastic
placement within the body cavity, would no doubt be
advantageous
both with respect to nutrient recovery and for the prevention of
Fig. 1. Asymmetric organs. In humans, asymmetric organs are
found in the
chest (heart, lung) and abdomen (stomach, spleen, liver, small
and large
intestine). The apex of the heart, which is placed at the midline,
points to the left
side. Lungs differ with respect to lobation: two lobes are found
on the left and
three lobes on the right side. The stomach and spleen are
positioned on the
left, whereas the liver and appendix are found on the right. In
addition, the small
intestine and colon coil asymmetrically.
Box 1. Phylogenetic tree of the major animal clades
The lineage relationships between phyla, based on the Tree of
Life project (tolweb.org), is outlined. The last common ancestor
of protostomes and
deuterostomes, a hypothetical bilaterally symmetrical animal
called urbilateria, is also included (outlined in red). Phyla in
which Nodal cascade genes have
been identified are marked in red text. The presence of Nodal
10. cascade genes in both protostomes and deuterostomes suggests
that urbilateria also
possessed the Nodal cascade (Carroll et al., 2004).
1604
HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
malfunctions. The many problems associated with intestinal
malrotation in humans, which has been estimated to occur in as
many as 1/500 births, support this reasoning (Burn and Hill,
2009;
Stewart et al., 1976; Sutherland and Ware, 2009).
When did organ asymmetry evolve?
The Nodal cascade, which is responsible for asymmetric organ
morphogenesis and placement in the vertebrates, is found in
deuterostomes and protostomes alike (Chea et al., 2005). This
suggests that the last common ancestor was also characterized
by
11. the presence of a Nodal cascade. This hypothetical animal at the
base of all bilaterally symmetrical species has been dubbed
urbilateria (De Robertis and Sasai, 1996) (see Glossary, Box 2).
Although no fossil record of such an animal is known to date,
nor
likely to exist, it has been described as a creature that possessed
a
heart-like pump, body appendages, a light-sensing primitive
eye,
and compartmentalization of the nervous system and digestive
tract (Carroll et al., 2004). Based on our consideration of the
Nodal
cascade, we hypothesize that the urbilaterian GI tract was
asymmetrically arranged (Fig. 3B).
Among the protostomes, Nodal has so far only been described in
mollusks, which belong to the lophotrochozoa (Box 1), which
includes snails and slugs. Gain- and loss-of-function
experiments in
snails have unequivocally shown that Nodal cascade asymmetry
is
responsible for shell coiling, i.e. asymmetric organ placement
(Grande and Patel, 2009). Many species from phyla of the other
major protostome group, the ecdysozoa (Box 1), also display
marked morphological and functional asymmetries. The
nematode
C. elegans, for example, undergoes LR asymmetric rotation
within
the eggshell, cleaves asymmetrically, loses sensory rays in an
asymmetric manner and shows lateralization of the nervous
system
(summarized in Burdine and Caspary, 2013). In Drosophila, the
genital disc and the gut rotate asymmetrically, a process driven
by an
actin-based mechanism (Petzoldt et al., 2012). However, the
12. genomes of C. elegans and Drosophila melanogaster have been
sequenced without discovery of a Nodal homolog, indicating
that
Nodal might have been lost in ecdysozoa. Given the low degree
of
nucleotide and protein homology between snail and
deuterostome
Nodal (Grande and Patel, 2009), however, one should not render
a
premature judgment. In addition, both C. elegans and
Drosophila
melanogaster represent highly derived species in their
respective
phyla. Finally, it remains to be seen whether cnidarians have a
Nodal gene. Certainly, there are no apparent organ asymmetries
in
Hydra (Technau and Steele, 2011). However, asexual
reproduction
through budding in Hydra occurs asymmetrically along the body
column and thus creates an asymmetry (Bode, 2011). The
molecular
mechanisms of asymmetric bud morphogenesis have not been
elucidated (Böttger and Hassel, 2012; Meinhardt, 2012), but if
Hydra has a Nodal gene, it would be likely to act in this
process.
Flow is error-prone and expensive: why should it evolve?
In snails, asymmetric induction of the Nodal cascade occurs via
chiral
blastomere arrangement at the 8-cell stage, providing a strong
argument in favor of symmetry breakage through early
determinants
(Kuroda et al., 2009). We envisage a scenario reminiscent of
asymmetric cell division in C. elegans, whereby cell polarity
governs
asymmetric cell division (Li, 2013; Munro and Bowerman,
13. 2009;
Sawa, 2012). Remnants of spiral cleavage are still present in the
Box 3. The Nodal cascade
The Nodal signaling cascade is active in the left LPM (Hamada
et al.,
2002). Nodal, a member of the TGFβ growth factor family,
induces
transcription of three target genes: Nodal itself, providing a
positive-
feedback loop; Lefty, which encodes a Nodal inhibitor and acts
in a
negative-feedback loop; and Pitx2, which encodes a homeobox
transcription factor. The Nodal cascade spreads rapidly
throughout the
LPM using a self-enhancement and lateral-inhibition mechanism
(Nakamura et al., 2006). Upstream, the cascade is regulated by
members of the DAN family of proteins, such as Coco and
Cerberus,
which act as Nodal antagonists. Coco is a secreted protein that
is co-
expressed with Nodal in somitic LRO cells and is
downregulated as an
immediate target of cilia-driven leftward flow. Coco repression
liberates
Nodal to signal and/or transfer to the left LPM. Although Nodal
and Pitx2
are conserved, variations on the theme have been described in
vertebrates, mostly in chick, in which a highly divergent set of
asymmetrically transcribed genes exists (reviewed by Raya and
Izpisúa-Belmonte, 2006): the snail-related transcription factor
cSnR is
active in the right LPM, whereas Lefty is missing in the left
LPM. Instead,
caronte, a cerberus/Dan-related growth factor, is active in the
left paraxial
14. mesoderm. Curiously, the homeobox transcription factor Nkx3.2
is
asymmetrically expressed in the mouse and chick LPM, but on
opposite
sides [right in mouse versus left in chick (Schneider et al.,
1999)]. It
remains to be seen whether and how these chick-specific
asymmetries
relate to the node rotation observed in chick. Targets of the
Nodal
cascade can also differ. For example, the neuropeptide galanin
was
shown to be asymmetrically expressed, in a flow-dependent
manner, on
the left side of the mouse heart anlage. As galanin asymmetry
was not
detected in Xenopus embryonic heart, this species-specific
difference
might relate to the much higher complexity of the mammalian
four-
chambered heart (Schweickert et al., 2008). Galanin might have
been
co-opted to the Nodal cascade through evolution of Pitx2
binding sites in
its promoter, an option that has yet to be tackled
experimentally.
Box 2. Glossary
Archenteron. The primitive gut tube that forms during
gastrulation.
Sometimes also termed the gastrocoel (cavity of the gastrula
embryo), it
transiently harbors the left-right organizer in amphibian and
mammalian
embryos. The mouse left-right organizer, before its renaming as
the
15. node/posterior notochord, was also referred to as the
archenteron (Blum
et al., 2009a,b; Theiler, 1972). Relationships are less clear in
bony fish
and birds, in which the archenteron is ill-defined.
Ciliopathies. A collective term that describes a diverse group of
human
syndromes caused by ciliary dysfunction. These include Bardet-
Biedl
syndrome, polycystic kidney disease, nephronophthisis, Meckel-
Gruber
syndrome, Joubert syndrome and Senior-Løken syndrome, all of
which
are associated with laterality defects (Fliegauf et al., 2007).
Left-right organizer (LRO). A ciliated epithelium that either
represents
the posterior part of, or is located at the posterior end of, the
notochord.
LROs come in different shapes and sizes, ranging from flat to
indented,
dome-shaped to spherical. Cilia on the LRO are polarized and
rotate in a
clockwise fashion to produce a leftward fluid flow in the
extracellular
space.
Situs solitus. The stable asymmetric arrangement of organs in
the chest
(heart, lung) and abdomen (stomach, spleen, liver, colon,
intestine).
Situs inversus. An inversion in the asymmetric arrangement of
organs.
Such inversion is very rare and occurs in ∼1/10,000 humans.
Synapomorphy. A synapomorphic trait is a character shared by
two or
more taxa and in their most recent common ancestor.
Urbilateria. The term urbilateria has been coined by Eddy De
16. Robertis to
describe the common ancestor of all bilateral symmetrical
animals
(De Robertis, 2008; De Robertis and Sasai, 1996). Although, in
all
likelihood, a fossil urbilaterian will never be found given the
complex
circumstances of successful fossilization, cladistic (deductive)
logics
were applied to characterize urbilateria as a light-sensing,
motile, worm-
like creature with a heart-like pump, a regionalized gut and
nervous
system (Carroll et al., 2004).
1605
HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
vertebrates. In the frog Xenopus, for example, it has been
17. shown that
the first cleavage division is inherently chiral (Danilchik et al.,
2006).
If mollusks use spiral cleavage to induce Nodal asymmetrically,
why,
then, should leftward flow evolve? What could be the advantage
of
having such a complex machinery for the sole reason of
inducing
Nodal mRNA transcription on the left side of the neurula
embryo?
It is possible that, if it was more reliable or ‘cheaper’ than a
cell
polarity-based mechanism, flow might yield increased fitness.
A detailed consideration of leftward flow, however, provides
proof
of the contrary, and the spontaneous rate of situs inversus in
snails is
fortunately known. When snails such as the Burgundy snail
Helix
pomatia are raised in France for consumption, corkscrew-like
pincers
are used to extract the meat from the shell. These tools do not
easily fit
into shells with inverted torsion, allowing ready identification
of these
so-called snail-kings. A snail-king is discovered in ∼1/20,000
specimens, closely matching the rate of situs inversus in
humans
(Brunner, 1999). Therefore, if one assumes that human embryos
employ leftward flow for symmetry breakage, which is well
justified
on the basis of cilia mutants resulting in laterality syndromes
(Goetz
18. andAnderson,2010;NorrisandGrimes,2012;ShiraishiandIchikawa
,
2012), both mechanisms appear equally reliable at first glance.
Vertebrate LR axis specification using flow is, however,
exceedingly error-prone. It has been estimated that congenital
heart defects occur in up to 1% of live human births (Liu et al.,
2013), of which some 3% are considered to arise from defects in
the
LR pathway (Sutherland and Ware, 2009). Individual
ciliopathies
(see Glossary, Box 2), a sizable number of which are associated
with
LR defects (Fliegauf et al., 2007; Gerdes et al., 2009; Norris
and
Grimes, 2012; Oh and Katsanis, 2012), tend to be relatively rare
(≤10−4). If these syndromes are considered in combination, it
has
been estimated that ∼1/300 humans is affected by some form of
ciliopathy. Other mutations, for example those occurring in
Nodal
cascade genes, also result in human LR defects (Bisgrove et al.,
2003; Sutherland and Ware, 2009). In zebrafish and Xenopus,
depending on the clutch of eggs, LR defects can be observed in
up to
10% of wild-type embryos (Danos and Yost, 1995; Lohr et al.,
1997; Long et al., 2003), further supporting our conclusion that
LR
axis determination via leftward flow is, in fact, error-prone.
To make things worse, flow is expensive. The embryo invests a
lot of energy to specify and pattern the gastrula embryo for the
transient emergence of an LRO, which has no other function
than to
break symmetry. Ciliogenesis and cilia polarization within the
LRO
19. require an elaborate cooperation of growth and transcription
factors
and their respective target genes and processes. In addition,
once
flow has been sensed at the left margin of the LRO, a
complicated
transfer system has to be set in motion to transport (an)
asymmetric
cue(s) from the LRO to the left LPM (Fig. 2). Ablation
experiments
Fig. 2. Left-right organizers and the flow model of symmetry
breakage.
(A) Left-right organizers (LROs) come in different forms (Blum
et al., 2007).
In zebrafish, the LRO is known as Kupffer’s vesicle and is a
closed sphere.
In Xenopus, the gastrocoel roof plate (GRP) acts as the LRO
and is a flat
triangular to diamond-shaped epithelium. In mouse, the LRO
(the posterior
notochord/‘node’) is an indentation at the distal tip of the egg
cylinder. In all
cases the LRO is positioned at the posterior pole of the
notochord (gray).
Axes are indicated: a, anterior; p, posterior; l, left; r, right. (B)
Depiction of
leftward flow at the ciliated epithelium of an LRO. Motile and
polarized cilia
(positioned at the posterior pole of cells) rotate in a clockwise
fashion to
produce a leftward fluid flow in the extracellular space. Flow is
sensed by
unpolarized cilia on cells bordering the LRO. In mouse and
Xenopus these
cilia have been described as being immotile (Boskovski et al.,
20. 2013;
McGrath et al., 2003). These cells express both Nodal and the
Nodal
inhibitor Coco. As a result of flow, Coco becomes
downregulated on the left
side (Hojo et al., 2007; Nakamura et al., 2012; Schweickert et
al., 2010),
thereby derepressing and liberating Nodal protein. Also shown
is the
transfer of an unidentified asymmetric signal (likely to be Nodal
protein; blue
octagon labeled with question mark) to the left lateral plate
mesoderm
(LPM), where the Nodal cascade is induced. Nodal transfers
across the
somites and intermediate mesoderm (not shown) to the LPM,
where it
induces its own transcription and that of its feedback inhibitor
Lefty as well as
expression of Pitx2.
Fig. 3. Organ asymmetry evolved to store a regionalized and
long gut
tube. (A) The regionalized (as represented by the color
gradient)
gastrointestinal (GI) tract of a snail. Note that its length
exceeds that of the main
body axis. A compartmentalized GI tract that exceeds body
length will
inevitably be packaged asymmetrically. (B) We hypothesize that
the
urbilaterian GI tract was also regionalized and asymmetrically
arranged.
D, dorsal; V, ventral; other axes as Fig. 2.
1606
21. HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
in the freshwater fish medaka and in Xenopus have shown that,
despite LR defects, development proceeded normally when
Kupffer’s vesicle, which is the fish LRO, was manually
destroyed, or upon removal of the superficial mesoderm, which
is
the LRO precursor in the frog (Bajoghli et al., 2007; Blum et
al.,
2009a). Following Nodal cascade induction, LROs rapidly
integrate
into the notochord and somites (Brennan et al., 2002; Shook et
al.,
2004; Yamanaka et al., 2007). Snails certainly use an easier and
cheaper way of rendering Nodal asymmetric.
In search of a solution: evolutionary considerations
Faced with two apparently very distinct modes of symmetry
breakage – one that is flow-based and one that requires early
22. determinants – we now consider more basal chordates, which
turns
out to be a rewarding exercise.
Insights from echinoderms
To begin this evolutionary reflection, we look at echinoderms,
the
other major deuterostome phylum aside from the chordata (Box
1).
In particular, we focus on LR asymmetry in sea urchins, which
has
been studied in great depth. Although apparently radially
symmetrical, echinoderms belong to the bilateria and develop
via
a larval stage that is bilaterally symmetrical; radial symmetry of
the
adult only develops during metamorphosis (McClay, 2011). Sea
urchin larvae show asymmetrical expression of Nodal cascade
genes, interestingly in the primitive gut (the archenteron; see
Glossary, Box 2), although in only a single patch of staining
(for a
recent review see Molina et al., 2013). From the archenteron,
coelomic pouches or sacs bud off in a symmetrical fashion. The
coelomic tissue may be considered as a structure homologous to
the
LPM, as it splits the LPM horizontally in vertebrates. It is
important
for the future development of the sea urchin; the rudiment of the
adult animal, an imaginal disc-like structure (Molina et al.,
2013),
only develops from the coelom on one side. In this case, it is
the side
on which Nodal is not expressed. Asymmetric Nodal expression
in
the archenteron, however, is responsible for the development of
the
23. adult rudiment; when Nodal signaling was inhibited after
gastrulation, an ectopic rudiment formed, whereas ectopic
Nodal
expression prevented rudiment formation (Duboc et al., 2005).
These experiments also confirmed that the LR axis becomes
fixed
only after gastrulation, a conclusion that was derived previously
from the culture of LR-bisected embryos (Aihara and Amemiya,
2001; McCain and McClay, 1994).
Nodal cascade asymmetry in sea urchins has been described as
right-sided, in contrast to the left-sided cascade in the LPM of
vertebrates (Molina et al., 2013). In the absence of a notochord
or
neural tube, the definition of left and right relies exclusively on
the
position of the mouth, which is considered to open on the
ventral
side. In fact, the oral ectoderm of the sea urchin embryo, from
which
the mouth develops, expresses all of the genes that are typically
expressed on the dorsal side of vertebrates, such as chordin,
nodal
and goosecoid (Li et al., 2013). In addition, gene regulatory
networks between sea urchins and vertebrates are apparently
inverted with respect to the dorsal-ventral axis (Molina et al.,
2013). If one considers the possibility that the mouth of the sea
urchin larva might open on the dorsal side (i.e. due to the
apparent
inversion of the dorsal-ventral axis) then the left and right sides
would also flip, and the sea urchin larva would display a left
asymmetric Nodal cascade like all other deuterostomes (Blum et
al.,
2009b). How, then, is this asymmetry set up in the larva?
We speculate that echinoderms possess archenteron cilia that
24. produce a directed fluid flow in much the same way as chordate
archenteron cilia, and that it is this fluid flow that induces the
asymmetric Nodal cascade (Fig. 4). Two published observations
support this notion. First, archenteron cilia have been described
in
gastrula embryos of the feather star Comanthus japonica
(Holland,
1976), which belongs to another, more basal, class of
echinoderms.
The second lead is more indirect and relates to the coelomic
pouches
before the development of the adult rudiment. In larvae of the
sea
urchin Temnopleurus hardwickii, it has been reported that the
coelomic sacs undergo a tube-like extension when they separate
from the archenteron tip (the future esophagus) and organize
into a
ciliated epithelium with motile 9+2 cilia (Hara et al., 2003).
Remarkably, these cilia produce a directed fluid flow (Ruppert
and
Balser, 1986). In addition, the tubulin staining pattern observed
in
these larvae strongly suggests that the archenteron tip cells are
also
ciliated, at least at the (late) stage when the coelom buds off
(Hara
et al., 2003). It would be worthwhile investigating whether
polarized and motile LR cilia are indeed present earlier, before
asymmetric Nodal expression, and whether flow, as we predict,
induces the asymmetric Nodal cascade.
Interestingly, monocilia are also found covering the epidermis
of
neurula embryos of ascidians, which are considered a sister
group to
25. the vertebrates (Box 1). These cilia show similarities to LR
cilia, as
they are polarized and ∼5 µm in length, and it is the motility of
these
cilia that is responsible for the chiral, anticlockwise rotation of
the
embryo (neurula rotation). Interfering with this process alters
LR
asymmetry, for example asymmetric Nodal expression, in the
ascidian Halocynthia roretzi (Nishide et al., 2012; Thompson et
al.,
2012). It has been proposed that such epidermal motile cilia,
which
are commonly used for locomotion and swimming by most non-
chordate embryos (such as the sea urchin pluteus larva), might
have
been re-adapted for symmetry breakage (Nishide et al., 2012). It
is
therefore tempting to speculate that the gastrocoel/archenteron
cilia of vertebrates evolved because superficial cells, from
which
the archenteron derives and which bear motile cilia, became
internalized during gastrulation. As the longitudinal extension
of the
archenteron corresponds to the anterior-posterior axis, it is not
difficult to imagine that cilia became polarized to the posterior
pole of cells, using global anterior-posterior cues, which await
identification even in the vertebrates. If this were the case, this
polarization would inevitably result in a leftward fluid flow.
Molecular data support our reasoning: manipulation of Notch
signaling or of the ion pump ATP4 affects asymmetric Nodal
expression in the sea urchin archenteron (Bessodes et al., 2012).
A role of Notch in vertebrate LR axis determination has long
been
Fig. 4. Cilia in the sea urchin gastrula embryo. Schematic of the
26. dorsal half
of a late gastrula sea urchin embryo. We speculate that
archenteron (ac) cells
are ciliated (A), and that cilia are polarized and produce a
leftward fluid flow
(B, green arrow). Nodal-expressing cells at the archenteron tip
are in blue.
1607
HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
known (Krebs et al., 2003; Przemeck et al., 2003). In addition,
it has
recently been shown that Notch signaling governs the ratio and
distribution of motile and non-motile sensory cilia on the frog
LRO
(Boskovski et al., 2013). ATP4 plays a dual role in the frog: it
is
required for the induction of the cilia transcription factor Foxj1
27. and
for cilia polarization, under the control of non-canonical and
canonical Wnt signaling, respectively (Walentek et al., 2012).
In
conclusion, we speculate that polarized archenteron cilia in sea
urchins produce a leftward fluid flow that is responsible for the
asymmetric induction of Nodal.
Lessons from amphioxus
We now consider amphioxus (also known as lancelets), which
belong to the chordate subphylum of the cephalochordates (Box
1).
This subphylum is evolutionarily ancient: fossils were reported
from
the Burgess shale, i.e. they date back ∼500-550 million years to
the
Cambrian (Putnam et al., 2008). Remarkably, the body plan of
all of
the ∼45 extant species, as well as that of fossil amphioxus, is
asymmetrical (Fig. 5): the mouth and anus open on the left side,
the
midgut cecum, where digestion and absorption take place,
extends
along the right side, and the cone-shaped muscle segments
(myomeres) are asymmetrically arranged on the left and right
side
of the body. Although mostly buried in the sand, where they
live as
filter-feeders, animals occasionally swim in an undulating
manner
owing to the asymmetric muscle alignment (Liem et al., 2001).
Because of its position at the base of the chordates, rooting the
vertebrates in the phylogenetic tree (Box 1), the embryology of
amphioxus has been studied in great detail (Bertrand and
28. Escriva,
2011; Holland et al., 2004). The first asymmetry that was
described
concerns the alignment of the somites on the left and right sides
of the
notochord (Schubert et al., 2001). Somites and the notochord
represent evolutionary novelties of the chordates, which makes
this
observation all the more interesting. Remarkably, somites form
asymmetrically on both sides of the amphioxus notochord, with
the
left side being slightly advanced compared with its counterpart
on the
right. It has been a long-standing debate as to when this
asymmetry
first appeared during development. Cerfontaine claimed
asymmetries
from the first pair of somites onward (Cerfontaine, 1906),
whereas
Hatschek and Conklin agreed that the first 7-8 somites develop
in a
symmetrical manner (Hatschek, 1893; Conklin, 1932) (Fig. 5F).
However, Conklin noted that the viewing perspective plays a
role in
judging these asymmetries, which is why he was “not inclined
to
place much weight upon this observation” (Conklin, 1932).
More
recently, molecular studies using the homeobox gene Mox to
mark
the forming somites clearly showed asymmetry from the fifth
somite
onwards, without resolving the dispute surrounding the first
pairs
(Minguillón and Garcia-Fernandez, 2002).
29. How do somites become asymmetrical during early
somitogenesis?
Perhaps not too surprisingly, the Nodal cascade in its entirety is
conserved in amphioxus. Nodal, Lefty and Pitx2 genes have
been
cloned and their expression patterns described during early
development (Boorman and Shimeld, 2002; Yu et al., 2002,
2007).
In thelategastrula/early neurula amphioxusembryo, Nodal is
found in
two patches in the roof of the archenteron (Fig. 6) (Yu et al.,
2002).
Fig. 5. Asymmetry in amphioxus. (A) Subadult animal (before
differentiation of the gonads). Histological transverse (B) and
longitudinal (C-E) sections of
adult animals. The longitudinal sections were taken at the level
of the dorsal muscle, dorsal to the neural tube (nt; C), at the
level of the notochord (no; D)
and at the level of the neural tube (E). Note the asymmetric
body plan as reflected in the placement of the pharynx (ph),
cecum (ce) and testes (te), and the
alignment of muscles [myomeres (my)], nerve (n) and nerve
fibers (nf). ar, fixation artifact; Rf, Reissner’s fiber. (F)
Reproduction of original drawings from
Conklin’s 1932 description of embryogenesis in amphioxus
[reproduced with permission (Conklin, 1932)]. At 18 h post-
fertilization (18 hpf, top), the somites
are symmetrically aligned. However, by 24 hpf (bottom),
somitogenesis has become out of register, as is obvious from the
seventh somite onwards. The
fourth (top) and seventh (bottom) somites are boxed in red. d,
dorsal; l, left; r, right; v, ventral.
1608
30. HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
Remarkably, this expression of Nodal marks the pre-somitic
mesoderm, as these cells in the archenteron roof bud off to give
rise
to the somites shortly thereafter (Bertrand and Escriva, 2011;
Holland
etal.,2004;Yuetal.,2002).Concomitantwiththebuddingoffofthese
cells, Nodal expression becomes asymmetrical, with much
stronger
signals on the left than right side (Yu et al., 2002).
Interestingly, the
cells in between these pre-somitic Nodal-positive cells also bud
off to
giverisetothenotochord(Fig.6)(Yuetal.,2002).Ifonecomparesthis
arrangement in the archenteron roof of amphioxus with that in
the
gastrocoel roof plate (GRP; i.e. the LRO) of Xenopus, striking
similarities become apparent (Fig. 6). The fate of the frog GRP
cells is
31. identical to that of the equivalent cells of amphioxus: Nodal-
positive
lateral cells integrate into the somites, while central cells fold
off to
become part of the notochord (Fig. 6C) (Shook et al., 2004). In
addition, it is these very cells of notochordal fate that in the
frog are
ciliated and produce a leftward fluid flow, which is sensed by
the
somitic lateral Nodal-positive cells (Boskovski et al., 2013;
Schweickert et al., 2007). In one of the extant cephalochordates,
Branchiostoma belcheri tsingtauense, ciliated archenteron cells
have
indeed been described (Hirakow and Kajita, 1991),
substantiating the
similarities between Xenopus and amphioxus.
We therefore propose that the axial cells in the archenteron roof
of
amphioxus possess polarized LR cilia that produce a fluid flow
from
right to left (Fig. 6A,B). This reasoning is further supported by
the
recent description of the expression of a cerberus gene in
amphioxus (Le Petillon et al., 2013). Amphioxus cerberus is
homologous to frog Coco, mouse cerberus-like 2 (Dand5) and
zebrafish charon (dand5), which all encode Nodal inhibitors that
become downregulated in a flow-dependent manner on the left
side
of the LRO (Box 3) (Hojo et al., 2007; Nakamura et al., 2012;
Schweickert et al., 2010). As in vertebrates, amphioxus cerberus
is
initially expressed in a bilaterally symmetrical fashion, co-
expressed
with Nodal. During early somitogenesis, it becomes
32. downregulated
on the left, i.e. appears asymmetrically expressed on the right
(Le Petillon et al., 2013). In vertebrates this asymmetry is the
result
of cilia-driven leftward flow (Schweickert et al., 2010), lending
strong support to the hypothesis that leftward flow was already
present in the cephalochordates at the base of the vertebrate
tree. It
will be rewarding to investigate cilia in amphioxus. The
prediction
based on vertebrate LR cilia would be to find motile cilia that
are
∼5 µm long, polarized to the posterior pole and perhaps exhibit
a
mix of different axoneme types, such as the 9+0, 9+2 and 9+4
configurations described in both rabbit and mouse (Caspary et
al.,
2007; Feistel and Blum, 2006).
One striking difference between asymmetric Nodal expression
in
sea urchin and amphioxus embryos is the split Nodal domain in
the
latter (Fig. 6A,B). As these domains contain descendants of the
organizer, which expresses Nodal in a single domain in the
early
gastrula (Yu et al., 2002), this split merely reflects the fate of
the
organizer: axial Nodal-negative notochordal cells and lateral
(paraxial) Nodal-positive somitic cells. In sea urchins, the
hypothesized leftward flow would displace the entire Nodal
domain
totheleft.Inamphioxus,flowacrosstheepitheliumofthenotochordal
plate would render the Nodal domain asymmetrical, using all of
the
players of vertebrate LROs, but without the need for further
33. transfer
into the LPM, as the entire mesoderm derives from the
archenteron
roof (notochordal plate and somites; Fig. 6B) (Yu et al., 2002).
LR patterning during vertebrate evolution
Our line of argument predicts leftward flow as a synapomorphy
of the
deuterostomes. Its presence throughout the vertebrates is thus
no
surprise, although its apparent loss in some species awaits
explanation. Remarkably, cilia and flow are not found in chick
embryos; here, asymmetric cell migration renders Hensen’s
node (the
organizer) and, in due course Nodal expression, asymmetrical
(Gros
etal.,2009).The emu,asarepresentative ofamore primitive
bird,also
has an asymmetric Hensen’s node (Nagai et al., 2011). It is
therefore
conceivable that all birds may lack LR cilia and leftward flow.
The
analysis of more basal reptiles will thus be a worthwhile
enterprise.
Node asymmetry and a lack of notochordal cilia are not
restricted to
birds: the pig embryo resembles the chick blastodisc in many
aspects,
including node and Nodal asymmetry (Gros et al., 2009).
Before we suggest a solution for the riddle that chick and pig
apparently lack cilia and flow, we wish first to discuss a more
fundamental problem for the evolution of vertebrates. It is
difficult to
imagine that the body plan of the cephalochordates, in
particular
34. somite asymmetry, is compatible with the development of a
perfectly bilateral axial skeleton. The morphogenesis of
vertebrae
requires somites to develop in register, and the same holds true
for
Fig. 6. Homology between amphioxus and Xenopus gastrocoel
roof
plates. Schematics of the gastrocoel roof plates (GRPs) of
amphioxus (A,B)
and Xenopus (C). Dorsal views of late gastrula (A) and 11.5 h
neurula (B)
embryos are shown (left) together with transverse sections
(right) at the levels
indicated. Nodal mRNA expression (blue) in amphioxus
becomes asymmetric
during early neurulation. Cells that are Nodal positive at late
gastrula bud off
from the archenteron roof to form the somites. At later stages,
the epithelium in
between the Nodal-positive cells likewise buds off to become
the notochord
(not indicated). Drawn according to Yu et al. (Yu et al., 2002).
Cilia and flow at
the notochordal part of the archenteron are a hypothetical
prediction of the
authors. (C) Schematic transverse section through a stage 17
Xenopus
neurula embryo. Drawn according to Schweickert et al.
(Schweickert et al.,
2007). Note the striking homology between amphioxus and
Xenopus GRPs: in
both cases, lateral cells expressing Nodal are fated to become
somites while
central cells fold off to form (amphioxus) or integrate into
(frog) the notochord.
35. no, notochord; np, neural plate; som, somite.
1609
HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
muscles that connect to the vertebral column and allow for
synchronous locomotion. As mentioned above, cephalochordates
swim in an oscillating manner (Liem et al., 2001) due to
asymmetric
myomeres that are connected to the notochord, i.e. the
functional
equivalent of the vertebral column in amphioxus. Vertebrates
thus
have two options: (1) to abandon flow and invent a new way to
induce Nodal asymmetrically in the left LPM; (2) to shield
somites
from the influence of flow and transfer the asymmetric signal
[Nodal
protein, in all likelihood (Yoshiba and Hamada, 2014)] across
36. the
somitic tissue without leaving an imprint.
We favor the second option, particularly because a shielding
mechanism that acts in both mouse (a flow species) and chick (a
no-
flow species) has been described. When embryos were depleted
of
retinoic acid, either genetically (mouse) or through drug
treatment
(chick), somite formation became out of register, with a delay
of
somitogenesis on the right side, precisely as is observed in
amphioxus (Vermot and Pourquié, 2005; Vermot et al., 2005).
Another observation fits with this reasoning: in mouse, it has
been
shown that retinoic acid-containing vesicles arise at the apical
surface of the LRO and that vesicles transfer to the left side of
the
LRO with flow (Tanaka et al., 2005). The evolution and the
mechanism of such shielding, which we predict was not present
in
cephalochordates, await elucidation.
Finally, it should be noted that vertebrates have minimized the
problem of shielding the somites from leftward flow, as most of
the
mesoderm does not bud off from the archenteron as it does in
amphioxus. The LRO cells, however, still stick out. They
produce and
sense the flow, create the asymmetric signal and send the signal
to the
LPM. In addition, where these cells have been studied it has
been
shown that they are of mesodermal fate and integrate into the
notochord [frog and mouse (Brennan et al., 2002; Shook et al.,
37. 2004;
Yamanaka et al., 2007)] as well as into somites [frog and fish
(Long
et al., 2003; Shook et al., 2004)]. Histology and scanning
electron
microscopy of frog neurula embryos clearly showed that the
sensory
lateral GRPcells of somitic fateare alreadya part ofthesomiteand
that
justtheirapicalsurfacesticksout,andonlyuntilflowhasbeenreceived
(Schweickert et al., 2007, 2010). In the zebrafish LRO, the
Nodal gene
southpaw is co-expressed with the presomitic marker spadetail
(Long
et al., 2003), suggesting that a somitic fate of flow-sensing cells
is
conserved from amphioxusto at least fish and amphibians. We
believe
that it is these cells that require shielding from flow.
A role for early determinants in vertebrate symmetry
breaking?
The scenario outlined above is of course hypothetical, as cilia-
driven leftward flow has not yet been described in echinoderms
or
amphioxus. If flow only evolved in the vertebrates, a shielding
mechanism would have had to evolve at the same time.
Furthermore, flow should have been present at the base of the
vertebrates. In line with this, primitive fish (sturgeon), which
gastrulate like amphibians, have a ciliated GRP as in the frog
(Blum
et al., 2009b; Bolker, 1993). The LRO/Kupffer’s vesicle in bony
fish is also ciliated. We thus suggest that leftward flow
represents the
ancestral mode of symmetry breakage in vertebrates.
Species that display flow at an LRO are characterized by the
38. expression of the cilia transcription factor Foxj1 in the
precursor tissue
of the LRO, i.e. the primary embryonic organizer or node.
Expression
of Foxj1 correlates with motile cilia in all cases investigated so
far. In
zebrafish and Xenopus, loss of Foxj1 function deletes motile
cilia,
whereas ectopic Foxj1 expression gives rise to ectopic motile
cilia
(Stubbs et al., 2008; Yu et al., 2008). We have previously
shown that
Foxj1 mRNA is expressed in the Hensen’s node of pig (Gros et
al.,
2009). The pig, like chick, lacks cilia at the posterior
notochord, which
otherwise resembles the ciliated LRO of the rabbit (Feistel and
Blum,
2006). Foxj1 expression in the chick embryo has not yet been
published; however, the chick Hensen’s node does express the
dynein
heavy chain gene Dnah11 (previously known as left-right
dynein, lrd)
(Essner et al., 2002), which is induced by Foxj1 (Stubbs et al.,
2008)
and is required for the motility of LRO cilia (Supp et al., 1997).
Based
onthesedata,wesuggestthatchickandpigbothinheritedthemolecula
r
Foxj1/Dnah11 module,which in other vertebrates sets up
leftward flow
at the LRO. It has been suggested that, in mouse, as few as two
cilia are
sufficient to produce and sense LRO flow (Shinohara et al.,
39. 2012), so it
is possible that chick and pig might have a tiny LRO with just a
few
motile and sensory cilia, which thus far have gone unnoticed.
We
consider this possibility unlikely, however, because many
laboratories
(including our own) have looked in vain for chick cilia in the
past.
Instead, we suggest that chick and pig have lost the
functionality of the
Foxj1/Dnah11module,perhapsthroughlossofapromoterelementin
a
Foxj1 target gene or through an epigenetic mechanism.
A precedent for such a loss is set by the limbless snakes, an
adaptation of the tetrapod body plan to a new form of
locomotion.
The python lineage represents a transitional stage that retains a
pelvic girdle and rudimentary hindlimbs. During development, a
hindlimb bud still forms but it lacks a functional apical
ectodermal
ridge (AER) and therefore does not elongate. Recombination
with a
chick AER or simply providing the AER signaling molecule
FGF
induces leg bud outgrowth, demonstrating that the molecular
machinery for limb outgrowth, with the sole exception of the
inducing AER signal, is present in the python (Cohn and Tickle,
1999; Graham and McGonnell, 1999). Thus, loss of a structure
or
process is not necessarily accompanied by the loss of the
genetic
modules required to set it into motion and, vice versa, the
presence
of a genetic module without the respective structure or process
40. represents a tell-tale sign of a function now lost during
evolution.
If chick and pig lack a functional Foxj1 module and hence do
not
use cilia, how do they break symmetry and induce the Nodal
cascade
on the left side? The fact that the ion pump ATP4 acts
hierarchically
upstream of asymmetric cell migration in the chick has been
taken as
support for the early determinants/ion-flux model of symmetry
breakage, acting before the onset of gastrulation in a cilia/LRO-
independentmanner(Grosetal.,2009;Vandenbergand Levin,2013).
ATP4 is an important player in the ion-flux model, and
asymmetric
expression of ATP4 in the 4-cell Xenopus embryo has been
described.
This asymmetry has been proposed to set up a voltage gradient
that
drives serotonin through gap junctions to the right side of the
embryo,
where it repressesthe Nodal cascade to break symmetryearlyon
(fora
recent review see Vandenberg and Levin, 2013). However,
recent
work, mostly in Xenopus but also in mouse, has examined the
role of
the centralcomponents oftheion-fluxmodelinLRO-
basedsymmetry
breakage. For example, ATP4 was shown to be symmetrically
expressed in frog embryos and to control ciliogenesis and cilia
polarization (Walentek et al., 2012). Serotonin was also found
in a
symmetrical fashion and was shown to be required for
specification of
41. the LRO precursor in the frog, the so-called superficial
mesoderm
(Beyer et al., 2012a). Finally, gap junction communication has
been
implicatedinthetransferofasymmetriccue(s)fromtheLROtotheleft
LPM in frog and mouse (Beyeret al., 2012b; Saund et al., 2012;
Viotti
et al., 2012). Together, these recent findings render the ion-flux
model
of symmetry breakage unlikely.
Symmetry breaking in chick and pig
How then do chick and pig, which have no functional LRO and
do not
use early determinants, break symmetry? Our last hypothesis,
which
1610
HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
42. suggests a solution to this riddle, rests on descriptive
embryology and
on a continuation of the evolutionary considerations outlined
above.
Let us recall the specifics of Nodal asymmetry in echinoderms
and
cephalochordates: there is a single asymmetric domain in the
sea
urchin archenteron but a split domain in the amphioxus
gastrocoel,
which only becomes asymmetric during late gastrulation (Figs 4
and 6). We hypothesize that, at least in the chordates, these
domains
are direct descendants of the previous Nodal domain in the
organizer
tissue at the onset of gastrulation. In many cases, Nodal
expression is
transiently off during involution of the organizer tissue. A
continuity
can occasionally be seen in mouse, i.e. expression in the node,
which
splits in its anteriormost aspect (Blum et al., 2007). The main
difference in the chordates compared with echinoderms is the
fate of
Nodal-positive organizer cells, which develop into notochord
and
somites in chordates (Spemann and Mangold, 1924). Following
involution (and specification of the notochord as the axial
mesodermal component) the Nodal domain splits down the
middle,
with central cells being Nodal negative and lateral cells
retaining
Nodal expression (Fig. 4). In the case of LRO flow, the central,
Nodal-
negative cells bear motile, polarized cilia, whereas the lateral,
43. Nodal-positive cells sense flow.
Remarkably, chick and pig embryos do not exhibit a split Nodal
domain. Rather, the organizer/node Nodal domain is displaced
to
the left side in its entirety, in chick through leftward migration
of
cells at Hensen’s node (Cui et al., 2009; Gros et al., 2009).
Recently, Viebahn and colleagues performed histological
analyses
of chicken nodes at different stages of development, showing
that
the right shoulder of the node differs from the left shoulder
following node rotation (Tsikolia et al., 2012). In particular,
they
describe that notochordal cells emerge via the thickened right
shoulder of the node (Tsikolia et al., 2012). A continuity
between
the right part of the node and the notochord was already
described
by Wetzel (Wetzel, 1929), the discoverer of node asymmetry in
chick. Based on these observations, we hypothesize that
leftward
node rotation leaves the organizer Nodal domain undivided,
because the notochord emerges on the right side of Hensen’s
node
(Fig. 7). Such a mechanism of leftward Nodal displacement
should be very robust and perhaps less error-prone than LRO
flow.
In agreement with this notion, no spontaneously occurring
alterations of Nodal cascade gene expression in chick and pig
embryos have been reported in the literature, in contrast to frog
and fish. How could leftward node rotation have evolved? We
can
suggest no solution for this fascinating question at this time.
44. Unraveling the precise role of ATP4 in the context of node
rotation
might be particularly rewarding as, to date, this ion pump
represents the only shared component between LRO flow and
node rotation.
Conclusions
Our examination of LR asymmetry in an evolutionary context
has
led us to three conclusions covering the base of bilateria, the
deuterostome tree and species-specific differences between
vertebrates. (1) Based on cladistic logics, we hypothesize that
urbilateria used the Nodal cascade for asymmetric
morphogenesis
of the gut tube. The Nodal cascade itself might have been lost in
ecdysozoa, and the elucidation of molecular mechanisms
underlying LR asymmetries in these species might lead to the
identification of novel homologies between protostomes and
deuterostomes, with the potential to sharpen the evolutionary
view
on the origin of animal LR asymmetry. (2) We speculate that a
cilia-driven mechanism of symmetry breakage exists throughout
the deuterostomes. We predict in which tissue and at what
embryonic stage LR cilia and leftward flow should be present in
sea urchin and amphioxus embryos, but descriptive and
functional
experiments will be required to prove or refute this hypothesis.
Not
working on these species ourselves, we hope to have provided
some leads for future investigations. (3) Finally, we highlight
that
traits, characters and processes can get lost during evolution if
other mechanisms are able to compensate. The absence of
leftward
flow in chick and pig, and perhaps in all birds and also in other
mammals, might represent such a case. Under the control of at
45. least
one common determinant, i.e. the ion pump ATP4, a new
process
has evolved to guide an as yet poorly understood mechanism for
breaking symmetry based on asymmetric cell movements. In
addition, the leftward displacement of an undivided organizer
Nodal domain can activate the asymmetric LPM signaling
cascade
in much the same way as if induced by flow, but this mechanism
should be cheaper, more robust and less error-prone. In the
future,
descriptive and functional work in both established and novel
model organisms, combined with evolutionary thinking and
reasoning, should hopefully provide a promising path through
which we can expand our understanding of the origin and
diversification of animal LR asymmetry.
Acknowledgements
We thank our colleagues in the left-right and EvoDevo
communities for numerous
discussions over the years, in particular Sebastian Shimeld,
Reinhard Schröder,
Julien Vermot, Philipp Vick and Christoph Viebahn. Bernd
Schmid produced some
of the artwork reproduced here. The amphioxus histology was
performed by the late
Otto Pflugfelder when Professor of Zoology at Hohenheim
University in the 1950s
and 1960s. We particularly thank Reinhard Hilbig for locating
and photographing
these slides.
Competing interests
The authors declare no competing financial interests.
Fig. 7. Divergent modes of symmetry breakage in vertebrates.
46. (A) Ancestral flow-based mode of chordates. The early gastrula
organizer
(node), which expresses Nodal (blue), differentiates into the
notochord and
somites during early neurulation. The notochord does not
express Nodal and
thus splits the Nodal-positive domain down the middle. Nodal-
positive cells
later integrate into the somites. (B) Divergent mechanism in
chick and pig. The
organizer (node) rotates during early gastrulation, which
renders the node left-
asymmetric. The notochord emerges over the right shoulder of
the node and
does not split the Nodal domain. Nodal thus becomes displaced
to the left
without the need for flow.
1611
HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
47. Funding
K.F. was supported by a Margarete-von-Wrangell Fellowship,
funded by the
European Social Fund and by the Ministry Of Science, Research
and the Arts in
Baden-Württemberg. Work in the M.B. laboratory was funded
by grants from the
Deutsche Forschungsgemeinschaft.
References
Aihara, M. and Amemiya, S. (2001). Left-right positioning of
the adult rudiment in
sea urchin larvae is directed by the right side. Development
128, 4935-4948.
Allen, R. D. and Fok, A. K. (2000). Membrane trafficking and
processing in
Paramecium. Int. Rev. Cytol. 198, 277-318.
Bajoghli, B., Aghaallaei, N., Soroldoni, D. and Czerny, T.
(2007). The roles of
Groucho/Tle in left-right asymmetry and Kupffer’s vesicle
organogenesis. Dev.
Biol. 303, 347-361.
Bertrand, S. and Escriva, H. (2011). Evolutionary crossroads in
developmental
biology: amphioxus. Development 138, 4819-4830.
Bessodes, N., Haillot, E., Duboc, V., Röttinger, E., Lahaye, F.
and Lepage, T.
(2012). Reciprocal signaling between the ectoderm and a
mesendodermal left-
right organizer directs left-right determination in the sea urchin
48. embryo. PLoS
Genet. 8, e1003121.
Beyer, T., Danilchik, M., Thumberger, T., Vick, P., Tisler, M.,
Schneider, I.,
Bogusch, S., Andre, P., Ulmer, B., Walentek, P. et al. (2012a).
Serotonin
signaling is required for Wnt-dependent GRP specification and
leftward flow in
Xenopus. Curr. Biol. 22, 33-39.
Beyer, T., Thumberger, T., Schweickert, A. and Blum, M.
(2012b). Connexin26-
mediated transfer of laterality cues in Xenopus. Biol. Open 1,
473-481.
Bisgrove, B. W., Morelli, S. H. and Yost, H. J. (2003). Genetics
of human laterality
disorders: insights from vertebrate model systems. Annu. Rev.
Genomics Hum.
Genet. 4, 1-32.
Blum, M., Andre, P., Muders, K., Schweickert, A., Fischer, A.,
Bitzer, E.,
Bogusch, S., Beyer, T., van Straaten, H. W. M. and Viebahn, C.
(2007). Ciliation
and gene expression distinguish between node and posterior
notochord in the
mammalian embryo. Differentiation 75, 133-146.
Blum, M., Beyer, T., Weber, T., Vick, P., Andre, P., Bitzer, E.
and Schweickert, A.
(2009a). Xenopus, an ideal model system to study vertebrate
left-right asymmetry.
Dev. Dyn. 238, 1215-1225.
49. Blum, M., Weber, T., Beyer, T. and Vick, P. (2009b). Evolution
of leftward flow.
Semin. Cell Dev. Biol. 20, 464-471.
Bode, H. (2011). Axis formation in hydra. Annu. Rev. Genet.
45, 105-117.
Bolker, J. A. (1993). The mechanism of gastrulation in the
white sturgeon. J. Exp.
Zool. 266, 132-145.
Boorman, C. J. and Shimeld, S. M. (2002). Pitx homeobox
genes in Ciona and
amphioxus show left-right asymmetry is a conserved chordate
character and
define the ascidian adenohypophysis. Evol. Dev. 4, 354-365.
Boskovski, M. T., Yuan, S., Pedersen, N. B., Goth, C. K.,
Makova, S., Clausen, H.,
Brueckner, M. and Khokha, M. K. (2013). The heterotaxy gene
GALNT11
glycosylates Notch to orchestrate cilia type and laterality.
Nature 504, 456-459.
Böttger, A. and Hassel, M. (2012). Hydra, a model system to
trace the emergence
of boundaries in developing eumetazoans. Int. J. Dev. Biol. 56,
583-591.
Brennan, J., Norris, D. P. and Robertson, E. J. (2002). Nodal
activity in the node
governs left-right asymmetry. Genes Dev. 16, 2339-2344.
Brown, W. M., Cronk, L., Grochow, K., Jacobson, A., Liu, C.
K., Popović, Z. and
Trivers, R. (2005). Dance reveals symmetry especially in young
men. Nature
50. 438, 1148-1150.
Brunner, H. (1999). Rechts oder links in der Natur und
anderswo. Weinheim:
Wiley-VCH.
Burdine, R. D. and Caspary, T. (2013). Left-right asymmetry:
lessons from Cancun.
Development 140, 4465-4470.
Burn, S. F. and Hill, R. E. (2009). Left-right asymmetry in gut
development: what
happens next? Bioessays 31, 1026-1037.
Carroll, S. B., Grenier, J. and Weatherbee, S. (2004). From
DNA to Diversity.
Hoboken, NJ: John Wiley & Sons.
Caspary, T., Larkins, C. E. and Anderson, K. V. (2007). The
graded response to
Sonic Hedgehog depends on cilia architecture. Dev. Cell 12,
767-778.
Cerfontaine, P. (1906). Recherche sur le développement de
l’Amphioxus. Arch. de
Biol. T22, 229-418.
Chea, H. K., Wright, C. V. and Swalla, B. J. (2005). Nodal
signaling and the
evolution of deuterostome gastrulation. Dev. Dyn. 234, 269-
278.
Cohn, M. J. and Tickle, C. (1999). Developmental basis of
limblessness and axial
patterning in snakes. Nature 399, 474-479.
51. Conklin, E. G. (1932). The embryology of amphioxus. J.
Morphol. 54, 69-151.
Cui, C., Little, C. D. and Rongish, B. J. (2009). Rotation of
organizer tissue
contributes to left-right asymmetry. Anat. Rec. (Hoboken) 292,
557-561.
Danilchik, M. V., Brown, E. E. and Riegert, K. (2006). Intrinsic
chiral properties of
the Xenopus egg cortex: an early indicator of left-right
asymmetry? Development
133, 4517-4526.
Danos, M. C. and Yost, H. J. (1995). Linkage of cardiac left-
right asymmetry and
dorsal-anterior development in Xenopus. Development 121,
1467-1474.
De Robertis, E. M. (2008). Evo-devo: variations on ancestral
themes. Cell 132,
185-195.
De Robertis, E. M. and Sasai, Y. (1996). A common plan for
dorsoventral patterning
in Bilateria. Nature 380, 37-40.
Duboc, V., Röttinger, E., Lapraz, F., Besnardeau, L. and
Lepage, T. (2005). Left-
right asymmetry in the sea urchin embryo is regulated by nodal
signaling on the
right side. Dev. Cell 9, 147-158.
Essner, J. J., Vogan, K. J., Wagner, M. K., Tabin, C. J., Yost,
H. J. and
Brueckner, M. (2002). Left–right development: conserved
function for embryonic
52. nodal cilia. Nature 418, 37-38.
Feistel, K. and Blum, M. (2006). Three types of cilia including
a novel 9+4 axoneme
on the notochordal plate of the rabbit embryo. Dev. Dyn. 235,
3348-3358.
Fliegauf, M., Benzing, T. and Omran, H. (2007). When cilia go
bad: cilia defects
and ciliopathies. Nat. Rev. Mol. Cell Biol. 8, 880-893.
Fok, A. K. and Allen, R. D. (1990). The phagosome-lysosome
membrane system
and its regulation in Paramecium. Int. Rev. Cytol. 123, 61-74.
Fukumoto, T., Kema, I. P. and Levin, M. (2005). Serotonin
signaling is a very early
step in patterning of the left-right axis in chick and frog
embryos. Curr. Biol. 15,
794-803.
Gerdes, J. M., Davis, E. E. and Katsanis, N. (2009). The
vertebrate primary cilium
in development, homeostasis, and disease. Cell 137, 32-45.
Goetz, S. C. and Anderson, K. V. (2010). The primary cilium: a
signalling centre
during vertebrate development. Nat. Rev. Genet. 11, 331-344.
Graham, A. and McGonnell, I. (1999). Developmental
evolution: this side of
paradise. Curr. Biol. 9, R630-R632.
Grande, C. and Patel, N. H. (2009). Nodal signalling is involved
in left-right
asymmetry in snails. Nature 457, 1007-1011.
53. Gros, J., Feistel, K., Viebahn, C., Blum, M. and Tabin, C. J.
(2009). Cell
movements at Hensen’s node establish left/right asymmetric
gene expression in
the chick. Science 324, 941-944.
Hamada, H. (2008). Breakthroughs and future challenges in left-
right patterning.
Dev. Growth Differ. 50 Suppl. 1, S71-S78.
Hamada, H., Meno, C., Watanabe, D. and Saijoh, Y. (2002).
Establishment of
vertebrate left-right asymmetry. Nat. Rev. Genet. 3, 103-113.
Hara, Y., Kuraishi, R., Uemura, I. and Katow, H. (2003).
Asymmetric formation and
possible function of the primary pore canal in plutei of
Temnopleurus hardwicki.
Dev. Growth Differ. 45, 295-308.
Hatschek, B. (1893). The Amphioxus and its Development.
London: Swan
Sonnenschein.
Hirakow, R. and Kajita, N. (1991). Electron microscopic study
of the development of
amphioxus, Branchiostoma belcheri tsingtauense: the gastrula.
J. Morphol. 207,
37-52.
Hirokawa, N., Tanaka, Y. and Okada, Y. (2012). Cilia, KIF3
molecular motor and
nodal flow. Curr. Opin. Cell Biol. 24, 31-39.
Hojo, M., Takashima, S., Kobayashi, D., Sumeragi, A.,
54. Shimada, A.,
Tsukahara, T., Yokoi, H., Narita, T., Jindo, T., Kage, T. et al.
(2007). Right-
elevated expression of charon is regulated by fluid flow in
medaka Kupffer’s
vesicle. Dev. Growth Differ. 49, 395-405.
Holland, N. D. (1976). The fine structure of the embryo during
the gastrula stage of
Comanthus japonica (Echinodermata: Crinoidea). Tissue Cell 8,
491-510.
Holland, L. Z., Laudet, V. and Schubert, M. (2004). The
chordate amphioxus: an
emerging model organism for developmental biology. Cell. Mol.
Life Sci. 61,
2290-2308.
Krebs, L. T., Iwai, N., Nonaka, S., Welsh, I. C., Lan, Y., Jiang,
R., Saijoh, Y.,
O’Brien, T. P., Hamada, H. and Gridley, T. (2003). Notch
signaling regulates left-
right asymmetry determination by inducing Nodal expression.
Genes Dev. 17,
1207-1212.
Kuroda,R.,Endo,B.,Abe,M.andShimizu,M.(2009).Chiralblastome
rearrangement
dictates zygotic left-right asymmetry pathway in snails. Nature
462, 790-794.
Le Petillon, Y., Oulion, S., Escande, M.-L., Escriva, H. and
Bertrand, S. (2013).
Gene expression patterns. Gene Expr. Patterns 13, 377-383.
Levin, M. (2005). Left-right asymmetry in embryonic
55. development: a comprehensive
review. Mech. Dev. 122, 3-25.
Li, R. (2013). The art of choreographing asymmetric cell
division. Dev. Cell 25,
439-450.
Li, E., Materna, S. C. and Davidson, E. H. (2013). New
regulatory circuit controlling
spatial and temporal gene expression in the sea urchin embryo
oral ectoderm
GRN. Dev. Biol. 382, 268-279.
Liem, K. F., Bemis, W. E., Walker,W. F. and Grande, L. (2001).
Functional Anatomy
of the Vertebrates: An Evolutionary Perspective. San Diego,
CA: Hartcourt College
Publishers.
Liu, X., Tobita, K., Francis, R. J. B. and Lo, C. W. (2013).
Imaging techniques for
visualizing and phenotyping congenital heart defects in murine
models. Birth
Defects Res. C Embryo Today 99, 93-105.
Lohr, J. L., Danos, M. C. and Yost, H. J. (1997). Left-right
asymmetry of a nodal-
related gene is regulated by dorsoanterior midline structures
during Xenopus
development. Development 124, 1465-1472.
Long, S., Ahmad, N. and Rebagliati, M. (2003). The zebrafish
nodal-related gene
southpaw is required for visceral and diencephalic left-right
asymmetry.
Development 130, 2303-2316.
56. 1612
HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
http://dx.doi.org/10.1016/S0074-7696(00)98007-0
http://dx.doi.org/10.1016/S0074-7696(00)98007-0
http://dx.doi.org/10.1016/j.ydbio.2006.11.020
http://dx.doi.org/10.1016/j.ydbio.2006.11.020
http://dx.doi.org/10.1016/j.ydbio.2006.11.020
http://dx.doi.org/10.1242/dev.066720
http://dx.doi.org/10.1242/dev.066720
http://dx.doi.org/10.1371/journal.pgen.1003121
http://dx.doi.org/10.1371/journal.pgen.1003121
http://dx.doi.org/10.1371/journal.pgen.1003121
http://dx.doi.org/10.1371/journal.pgen.1003121
http://dx.doi.org/10.1016/j.cub.2011.11.027
http://dx.doi.org/10.1016/j.cub.2011.11.027
http://dx.doi.org/10.1016/j.cub.2011.11.027
http://dx.doi.org/10.1016/j.cub.2011.11.027
http://dx.doi.org/10.1242/bio.2012760
http://dx.doi.org/10.1242/bio.2012760
61. insights into the functional evolution of Mox genes, somites,
and the asymmetry of
amphioxus somitogenesis. Dev. Biol. 246, 455-465.
Molina, M. D., de Crozé, N., Haillot, E. and Lepage, T. (2013).
Nodal: master and
commander of the dorsal. Curr. Opin. Genet. Dev. 23, 445-453.
Munro, E. and Bowerman, B. (2009). Cellular symmetry
breaking during
Caenorhabditis elegansdevelopment.Cold Spring Harb. Perspect.
Biol. 1, a003400.
Nagai, H., Mak, S.-S., Weng, W., Nakaya, Y., Ladher, R. and
Sheng, G. (2011).
Embryonic development of the emu, Dromaius novaehollandiae.
Dev. Dyn. 240,
162-175.
Nakamura, T., Mine, N., Nakaguchi, E., Mochizuki, A.,
Yamamoto, M.,
Yashiro, K., Meno, C. and Hamada, H. (2006). Generation of
robust left-right
asymmetry in the mouse embryo requires a self-enhancement
and lateral-
inhibition system. Dev. Cell 11, 495-504.
Nakamura, T., Saito, D., Kawasumi, A., Shinohara, K., Asai, Y.,
Takaoka, K.,
Dong, F., Takamatsu, A., Belo, J. A., Mochizuki, A. et al.
(2012). Fluid flow and
interlinked feedback loops establish left-right asymmetric decay
of Cerl2 mRNA.
Nat. Commun. 3, 1322.
Nickel, R., Schummer, A. and Seiferle, E. (1995). Lehrbuch der
62. Anatomie der
Haustiere, 9th edn (ed. J. Frewein, H. Gasse, R. Leiser, H.
Roos, H. Thomé,
B. Vollmerhaus and H. Waibl). Stuttgart: Parey Publishers.
Nishide, K., Mugitani, M., Kumano, G. and Nishida, H. (2012).
Neurula rotation
determines left-right asymmetry in ascidian tadpole larvae.
Development 139,
1467-1475.
Norris, D. P. and Grimes, D. T. (2012). Mouse models of
ciliopathies: the state of
the art. Dis. Model. Mech. 5, 299-312.
Oh, E. C. and Katsanis, N. (2012). Cilia in vertebrate
development and disease.
Development 139, 443-448.
Patel, N. H. (2009). Developmental biology: asymmetry with a
twist. Nature 462,
727-728.
Petzoldt, A. G., Coutelis, J.-B., Géminard, C., Spéder, P.,
Suzanne, M.,
Cerezo, D. and Noselli, S. (2012). DE-Cadherin regulates
unconventional
Myosin ID and Myosin IC in Drosophila left-right asymmetry
establishment.
Development 139, 1874-1884.
Przemeck, G. K. H., Heinzmann, U., Beckers, J. and Hrabé de
Angelis, M.
(2003). Node and midline defects are associated with left-right
development in
Delta1 mutant embryos. Development 130, 3-13.
63. Putnam, N. H., Butts, T., Ferrier, D. E. K., Furlong, R. F.,
Hellsten, U.,
Kawashima, T., Robinson-Rechavi, M., Shoguchi, E., Terry, A.,
Yu, J.-K. et al.
(2008). The amphioxus genome and the evolution of the
chordate karyotype.
Nature 453, 1064-1071.
Ramsdell, A. F. (2005). Left-right asymmetry and congenital
cardiac defects: getting
to the heart of the matter in vertebrate left-right axis
determination. Dev. Biol.
288, 1-20.
Raya, A. and Izpisúa-Belmonte, J. C. (2006). Left-right
asymmetry in the
vertebrate embryo: from early information to higher-level
integration. Nat. Rev.
Genet. 7, 283-293.
Ruppert, E. E. and Balser, E. J. (1986). Nephridia in the larvae
of hemichordates
and echinoderms. Biol. Bull. 171, 188-196.
Saund, R. S., Kanai-Azuma, M., Kanai, Y., Kim, I., Lucero, M.
T. and Saijoh, Y.
(2012). Gut endoderm is involved in the transfer of left-right
asymmetry from the
node to the lateral plate mesoderm in the mouse embryo.
Development 139,
2426-2435.
Sawa, H. (2012). Control of cell polarity and asymmetric
division in C. elegans. Curr.
Top. Dev. Biol. 101, 55-76.
64. Schneider, A., Mijalski, T., Schlange, T., Dai, W., Overbeek,
P., Arnold, H.-H. and
Brand, T. (1999). The homeobox gene it NKX3.2 is a target of
left-right signalling
and is expressed on opposite sides in chick and mouse embryos.
Curr. Biol. 9,
911-914.
Schubert, M., Holland, L. Z., Stokes, M. D. and Holland, N. D.
(2001). Three
amphioxus Wnt genes (AmphiWnt3, AmphiWnt5, and
AmphiWnt6) associated
with the tail bud: the evolution of somitogenesis in chordates.
Dev. Biol. 240,
262-273.
Schweickert, A., Weber, T., Beyer, T., Vick, P., Bogusch, S.,
Feistel, K. and
Blum, M. (2007). Cilia-driven leftward flow determines
laterality in Xenopus. Curr.
Biol. 17, 60-66.
Schweickert, A., Deissler, K., Britsch, S., Albrecht, M.,
Ehmann, H., Mauch, V.,
Gaio, U. and Blum, M. (2008). Left-asymmetric expression of
Galanin in the linear
heart tube of the mouse embryo is independent of the nodal co-
receptor gene
cryptic. Dev. Dyn. 237, 3557-3564.
Schweickert, A., Vick, P., Getwan, M., Weber, T., Schneider, I.,
Eberhardt, M.,
Beyer, T., Pachur, A. and Blum, M. (2010). The nodal inhibitor
Coco is a critical
target of leftward flow in Xenopus. Curr. Biol. 20, 738-743.
65. Shinohara, K., Kawasumi, A., Takamatsu, A., Yoshiba, S.,
Botilde, Y.,
Motoyama, N., Reith, W., Durand, B., Shiratori, H. and
Hamada, H. (2012).
Two rotating cilia in the node cavity are sufficient to break left-
right symmetry in the
mouse embryo. Nat. Commun. 3, 622.
Shiraishi, I. and Ichikawa, H. (2012). Human heterotaxy
syndrome – from molecular
genetics to clinical features, management, and prognosis. Circ.
J. 76, 2066-2075.
Shook, D. R., Majer, C. and Keller, R. (2004). Pattern and
morphogenesis of
presumptive superficial mesoderm in two closely related
species, Xenopus laevis
and Xenopus tropicalis. Dev. Biol. 270, 163-185.
Spemann, H. and Mangold, H. (1924). Über induktion von
Embryonalanlagen
durch Implantation artfremder Organisatoren. Roux’ Arch.
Entw. Mech. 100,
599-638.
Stewart, D. R., Colodny, A. L. and Daggett, W. C. (1976).
Malrotation of the bowel
in infants and children: a 15 year review. Surgery 79, 716-720.
Stubbs, J. L., Oishi, I., Izpisúa-Belmonte, J. C. and Kintner, C.
(2008). The
forkhead protein Foxj1 specifies node-like cilia in Xenopus and
zebrafish
embryos. Nat. Genet. 40, 1454-1460.
66. Supp, D. M., Witte, D. P., Potter, S. S. and Brueckner, M.
(1997). Mutation of an
axonemal dynein affects left-right asymmetry in inversus
viscerum mice. Nature
389, 963-966.
Sutherland, M. J. and Ware, S. M. (2009). Disorders of left-
right asymmetry:
heterotaxy and situs inversus. Am. J. Med. Genet. C Semin.
Med. Genet. 151C,
307-317.
Tanaka, Y., Okada, Y. and Hirokawa, N. (2005). FGF-induced
vesicular release of
Sonic hedgehog and retinoic acid in leftward nodal flow is
critical for left-right
determination. Nature 435, 172-177.
Technau, U. and Steele, R. E. (2011). Evolutionary crossroads
in developmental
biology: Cnidaria. Development 138, 1447-1458.
Theiler, K. (1972). The House Mouse. Berlin, Heidelberg, New
York: Springer-
Verlag.
Thompson, H., Shaw, M. K., Dawe, H. R. and Shimeld, S. M.
(2012). The formation
and positioning of cilia in Ciona intestinalis embryos in relation
to the generation
and evolution of chordate left-right asymmetry. Dev. Biol. 364,
214-223.
Tsikolia, N., Schröder, S., Schwartz, P. and Viebahn, C. (2012).
Paraxial left-
sided nodal expression and the start of left-right patterning in
67. the early chick
embryo. Differentiation 84, 380-391.
Vandenberg, L. N. and Levin, M. (2009). Perspectives and open
problems in the
early phases of left-right patterning. Semin. Cell Dev. Biol. 20,
456-463.
Vandenberg, L. N. and Levin, M. (2010). Far from solved: a
perspective on what we
know about early mechanisms of left-right asymmetry. Dev.
Dyn. 239, 3131-3146.
Vandenberg, L. N. and Levin, M. (2013). A unified model for
left-right asymmetry?
Comparison and synthesis of molecular models of embryonic
laterality. Dev. Biol.
379, 1-15.
Vandenberg, L. N., Lemire, J. M. and Levin, M. (2013).
Serotonin has early, cilia-
independent roles in Xenopus left-right patterning. Dis. Model.
Mech. 6, 261-268.
Vermot, J. and Pourquié, O. (2005). Retinoic acid coordinates
somitogenesis and
left-right patterning in vertebrate embryos. Nature 435, 215-
220.
Vermot, J., Gallego Llamas, J., Fraulob, V., Niederreither, K.,
Chambon, P. and
Dollé, P. (2005). Retinoic acid controls the bilateral symmetry
of somite formation
in the mouse embryo. Science 308, 563-566.
Viotti, M., Niu, L., Shi, S.-H. and Hadjantonakis, A.-K. (2012).
68. Role of the gut
endoderm in relaying left-right patterning in mice. PLoS Biol.
10, e1001276.
Walentek, P., Beyer, T., Thumberger, T., Schweickert, A. and
Blum, M. (2012).
ATP4a is required for Wnt-dependent Foxj1 expression and
leftward flow in
Xenopus left-right development. Cell Rep. 1, 516-527.
Wetzel, R. (1929). Untersuchungen am Hühnchen. Die
Entwicklung des Keims
während der ersten beiden Bruttage. Roux’ Arch. Entw. Mech.
119, 188-321.
Yamanaka, Y., Tamplin, O. J., Beckers, A., Gossler, A. and
Rossant, J. (2007).
Live imaging and genetic analysis of mouse notochord
formation reveals regional
morphogenetic mechanisms. Dev. Cell 13, 884-896.
Yoshiba, S. and Hamada, H. (2014). Roles of cilia, fluid flow,
and Ca(2+) signaling
in breaking of left-right symmetry. Trends Genet. 30, 10-17.
Yu, J.-K., Holland, L. Z. and Holland, N. D. (2002). An
amphioxus nodal gene
(AmphiNodal) with early symmetrical expression in the
organizer and mesoderm
and later asymmetrical expression associated with left-right axis
formation. Evol.
Dev. 4, 418-425.
Yu, J.-K., Satou, Y., Holland, N. D., Shin-I, T., Kohara, Y.,
Satoh, N., Bronner-
Fraser, M. and Holland, L. Z. (2007). Axial patterning in
69. cephalochordates and
the evolution of the organizer. Nature 445, 613-617.
Yu, X., Ng, C. P., Habacher, H. and Roy, S. (2008). Foxj1
transcription factors are
master regulators of the motile ciliogenic program. Nat. Genet.
40, 1445-1453.
1613
HYPOTHESIS Development (2014) 141, 1603-1613
doi:10.1242/dev.100560
D
E
V
E
L
O
P
M
E
N
T
http://dx.doi.org/10.1242/dev.048967
http://dx.doi.org/10.1242/dev.048967
http://dx.doi.org/10.1016/S0092-8674(03)00511-7
http://dx.doi.org/10.1016/S0092-8674(03)00511-7
http://dx.doi.org/10.1016/S0092-8674(03)00511-7
http://dx.doi.org/10.1016/j.gde.2009.07.004
http://dx.doi.org/10.1016/j.gde.2009.07.004
http://dx.doi.org/10.1016/j.gde.2009.07.004
http://dx.doi.org/10.1387/ijdb.113483hm
http://dx.doi.org/10.1387/ijdb.113483hm