Intellectual Property Management Training Cum Writeshop on Technology Disclosure and Claim Drafting, Philippine Council for Agriculture, Aquatic, and Natural Resources Research and Development (PCAARRD), Bulwagang Panday Karunungan, PCAARRD, Los Baños, Laguna (Philippines), 30 August 2012
Workshop for the Intellectual Property Department of the Sapalo Velez Bundang & Bulilan Law Offices, Marikina East Lake View Farm (MELF) Morong, Rizal (Philippines), 13 January 2012
This document discusses several patent cases in India between foreign pharmaceutical companies and Indian generic drug manufacturers. It summarizes key patent cases such as Novartis vs. India regarding Glivec, Bayer vs. Natco regarding Nexavar, Roche vs. Cipla regarding Tarceva. It also discusses India's patent laws including sections 3(d) and compulsory licensing. Many foreign drug patents were revoked by Indian courts based on lack of innovation or in the interest of public health and making medicines more affordable in India. The document supports India's stance on promoting generic competition and ensuring access to healthcare.
Training cum Write-Shop on Technology Disclosures and Claim Drafting, Organized by the Philippine Council for Agriculture and Forestry Research and Development Council (PCARRD) for selected NARRDN Researchers, BPK, PCARRD, Los Baños, Laguna, 30-31 August 2007
The document discusses patentable subject matter under Indian and international law. It provides definitions of invention and outlines what can and cannot be patented according to the Indian Patents Act of 1970 and TRIPS agreement. It discusses exclusions from patentability including those that are frivolous, contrary to public order or morality, or mere discoveries with examples of each.
The document discusses various formats and types of patent claims. It describes the typical format of a patent claim as a single sentence with an identifier like "Claim 1". Claims have a preamble that identifies the category of invention, a transitional phrase like "comprising", and a body that describes interrelated elements. The document provides examples of different types of claims like independent claims, dependent claims, improvement claims, two-part form claims, means-plus-function claims, and apparatus and method claims. It also discusses proper punctuation, antecedent basis, reference numerals, and multiple claim elements.
Presentation on the Patent Process in US
Contact Us for Intellectual Property Services
BananaIP Counsels
Regd Office
No.40,3rd Main Road,JC Industrial Estate,
Kanakapura Road,Bangalore – 560 062.
Email: contact@bananaip.com
Telephone: +91-80-26860414 /24/34
The document discusses the patent document, its form and substance. It begins with a review of patenting concepts such as the definition of a patent, reasons for patenting, and patentability requirements. It then discusses the typical parts of a patent document, including the title, abstract, claims, specifications, and drawings [SECTION 2]. The document explains how to construct a patent document and stresses the importance of a clear disclosure of the invention. Finally, it discusses how to exploit patent document information to learn about the inventor's goals for protection, competitors, markets, and more [SECTION 3].
Workshop for the Intellectual Property Department of the Sapalo Velez Bundang & Bulilan Law Offices, Marikina East Lake View Farm (MELF) Morong, Rizal (Philippines), 13 January 2012
This document discusses several patent cases in India between foreign pharmaceutical companies and Indian generic drug manufacturers. It summarizes key patent cases such as Novartis vs. India regarding Glivec, Bayer vs. Natco regarding Nexavar, Roche vs. Cipla regarding Tarceva. It also discusses India's patent laws including sections 3(d) and compulsory licensing. Many foreign drug patents were revoked by Indian courts based on lack of innovation or in the interest of public health and making medicines more affordable in India. The document supports India's stance on promoting generic competition and ensuring access to healthcare.
Training cum Write-Shop on Technology Disclosures and Claim Drafting, Organized by the Philippine Council for Agriculture and Forestry Research and Development Council (PCARRD) for selected NARRDN Researchers, BPK, PCARRD, Los Baños, Laguna, 30-31 August 2007
The document discusses patentable subject matter under Indian and international law. It provides definitions of invention and outlines what can and cannot be patented according to the Indian Patents Act of 1970 and TRIPS agreement. It discusses exclusions from patentability including those that are frivolous, contrary to public order or morality, or mere discoveries with examples of each.
The document discusses various formats and types of patent claims. It describes the typical format of a patent claim as a single sentence with an identifier like "Claim 1". Claims have a preamble that identifies the category of invention, a transitional phrase like "comprising", and a body that describes interrelated elements. The document provides examples of different types of claims like independent claims, dependent claims, improvement claims, two-part form claims, means-plus-function claims, and apparatus and method claims. It also discusses proper punctuation, antecedent basis, reference numerals, and multiple claim elements.
Presentation on the Patent Process in US
Contact Us for Intellectual Property Services
BananaIP Counsels
Regd Office
No.40,3rd Main Road,JC Industrial Estate,
Kanakapura Road,Bangalore – 560 062.
Email: contact@bananaip.com
Telephone: +91-80-26860414 /24/34
The document discusses the patent document, its form and substance. It begins with a review of patenting concepts such as the definition of a patent, reasons for patenting, and patentability requirements. It then discusses the typical parts of a patent document, including the title, abstract, claims, specifications, and drawings [SECTION 2]. The document explains how to construct a patent document and stresses the importance of a clear disclosure of the invention. Finally, it discusses how to exploit patent document information to learn about the inventor's goals for protection, competitors, markets, and more [SECTION 3].
Dr. amit gangwal ka pharmaceutical patent presentation
highly exhaustive and updated ppt on pharmaceutical patents, a must watch by all those concerned with the same.
The document discusses various topics related to patent searching and drafting patent claims including:
1) The purposes of conducting patent searches such as avoiding infringement and monitoring competitors.
2) Resources for conducting patent searches such as online databases and tools from patent offices which provide time-efficient and cost-effective access to comprehensive international patent information.
3) Key considerations for drafting patent claims including writing broad and narrow claims to fully cover the invention while avoiding prior art and unnecessary limitations.
International Patenting: Paris Convention, Patent Cooperation Treaty, and Pat...Patterson Thuente IP
India's place in the patent world.
International patenting basics.
Patent Cooperation Treaty (PCT) overview.
Patent Prosecution Highway (PPH) benefits.
Detailed information on different types of intellectual property rights and how to protect them through patent filing, copy rights, geographical identification and other procedures
The document provides an introduction to patent law, including:
1) A patent is a legal document issued by a government that grants the right to prohibit others from making, using, or selling a claimed invention for a limited time in exchange for publicly disclosing the invention details.
2) The purpose of patent law is to promote science and useful arts by securing exclusive rights to authors and inventors for limited times.
3) Inventors seek patent protection for both offensive and defensive strategies related to investment, revenue, market protection, and preventing competitor patents.
The document discusses patents, copyrights, and trademarks. It covers what patents, copyrights, and trademarks are, how to obtain them, requirements for protection, infringement issues, and international considerations. Key points include patents providing temporary monopoly for inventions, copyright protecting original creative works, and trademarks identifying business sources and brands. The document also notes limitations and exceptions for protection.
Knobbe Martens’ patent attorneys Russell Jeide and Scott Cromar hosted a seminar series on intellectual property basics for Temecula’s business community. Entrepreneurs, investors, startups, inventors and anyone interested in learning how intellectual property and patents can help their business will benefit from this presentation.
The document discusses the different types of patent claims that can be used to define the scope of legal protection for an invention. It describes independent claims, dependent claims, product claims, process claims, product-by-process claims, two part/Jepson claims, means plus function claims, Markush claims, Swiss claims, multiple dependent claims, and omnibus claims. The types of claims serve to precisely define the boundaries of what is covered by the patent.
This document discusses patents, patent law, and two important case studies related to biotechnological patents. It provides an overview of what patents protect, the history and conventions around patents, and key details of India's National Biodiversity Act of 2002. It then summarizes the Diamond v. Chakrabarty and Dimminaco AG v. Controller of Patents and Designs cases, which established that genetically modified organisms and processes producing living products can be patented.
Patent Law in India_What,How to get it regisgtered and protectedKrishan Singla
It describes the patent law in India and describes what comes and what does come under patent . In other words it defines what kind of inventions can be patented . In brief it contains the following topics:
-What is intellectual property
-Meaning of Patent
-Legislative Framework Patents
-Patent Law - Salient Features
-Safeguards in the Patent Law
-Definition of patentable invention
-Inventions not patentable
-Documenting invention
-Steps for obtaining a patent in India
-Rights of product patentee
-Rights of process patentee
-Renewal of patent
-Infringement of patent
-Patent Due Diligence
The document is a sample patent landscape report that shows what information can be gleaned from such reports. In 3 sentences: Patent landscape reports can show trends in technology sectors over time, the main players and applicants in a technology area as well as potential collaboration partners, and maps of innovation in an area through patent citation analysis to understand development of patent protection over time. The sample report provides examples of charts and data that may be included to illustrate technology trends, key players, collaborations and innovation tracks in a given field of technology.
This presentation helps you to thoroughly understand the concept of patents, copyrights, trademarks, trade secrets etc. Also it includes the steps for registering the above mentioned subjects. Do have a look.
The document discusses non-obviousness, which is a requirement for patentability. To satisfy non-obviousness, an invention must not be obvious to someone with skill in the related field. While it does not need to be a brilliant act of new genius, the combination of elements cannot be obvious and must provide a utility greater than the sum of the parts. The patent application process involves initially filing a provisional application, then a formal application which undergoes review and potential appeals before a patent is issued. The process is lengthy and obtaining a US patent can cost over $1 million due to extensive legal costs.
This document provides an overview of the patent filing process in India. It begins by defining what a patent is and noting that it provides exclusive rights for 20 years. It then outlines the key steps and requirements for filing a patent application in India, including which documents are needed, who can file, where to file, and how to file. The document explains the timeline for publication, request for examination, and potential hearing. It also describes what is not patentable under Indian law and the criteria the examiner evaluates like novelty, non-obviousness, and industrial applicability. The review and response process is summarized, concluding with the potential outcomes of acceptance, rejection, or partial acceptance of claims.
The document discusses the process for obtaining a patent right in India. It begins by defining what a patent is - a set of exclusive rights granted by a government for a new invention for a limited period of time. It then outlines the 5 main steps to obtain a patent right in India: 1) determine the marketability of the invention, 2) conduct a worldwide patent search, 3) file a provisional patent application, 4) file a complete patent application, and 5) follow all patent deadline dates. The document emphasizes that patents only provide protection within the country they are filed in, so separate patents are needed in each country where protection is desired.
The document discusses different types of patent searches including patentability searches, freedom to operate searches, validity searches, landscape searches, state-of-the-art searches, bibliographic searches, continuing searches, assignment searches, number searches, name searches, subject searches, classification searches, family searches, and legal status searches. It provides details on the purpose, timing, and scope of each type of search.
The document summarizes the process of registration and grant of patents in India. It discusses key aspects like application for a patent, provisional and complete specifications, publication of applications, examination of applications, opposition to patents, and grant of a patent. It also provides statistics on patents filed, examined, granted and disposed in India from 2014-15 to 2019-20. Finally, it discusses an important case law on determining the timeline for pre-grant opposition.
The patent licensing occurs when the licensor (patent holder) grants exploitation rights over a patent to a licensee for royalty or a lump sum payment. A licensee can challenge the validity of a licensed patent to avoid paying royalties, though there are some limitations, such as not being able to challenge after failing to pay royalties. The Supreme Court's MedImmune v. Genentech decision found that licensees can challenge licensed patents even while continuing to pay royalties, increasing licensees' freedom to challenge validity. Licensors may respond by negotiating higher royalties, up-front payments, or termination clauses.
Patent Drafting and Writing Strong Patent Applications for Creating & Protect...TechLaw.Attorney
Patent drafting is a process to convert inventor’s ideas into a legal document describing the technology covering inventor’s innovation in broadest possible format comprising patent claims, abstract, drawings and detailed description of the invention. Our team of technical patent attorneys are skilled and experienced to provide various services across diverse industry sectors.
1. The document discusses new chemical entities (NCEs) and aspects of drafting and prosecuting patents for NCEs in India.
2. It provides an overview of patentable subject matter for NCEs, challenges with Markush claims, and case studies comparing prosecution of related patents in India, the US and Europe.
3. The case studies analyze allowed claims and references cited during prosecution, finding that scopes of protection and references cited tended to be more similar between Indian and European patents compared to corresponding US patents.
Dr. amit gangwal ka pharmaceutical patent presentation
highly exhaustive and updated ppt on pharmaceutical patents, a must watch by all those concerned with the same.
The document discusses various topics related to patent searching and drafting patent claims including:
1) The purposes of conducting patent searches such as avoiding infringement and monitoring competitors.
2) Resources for conducting patent searches such as online databases and tools from patent offices which provide time-efficient and cost-effective access to comprehensive international patent information.
3) Key considerations for drafting patent claims including writing broad and narrow claims to fully cover the invention while avoiding prior art and unnecessary limitations.
International Patenting: Paris Convention, Patent Cooperation Treaty, and Pat...Patterson Thuente IP
India's place in the patent world.
International patenting basics.
Patent Cooperation Treaty (PCT) overview.
Patent Prosecution Highway (PPH) benefits.
Detailed information on different types of intellectual property rights and how to protect them through patent filing, copy rights, geographical identification and other procedures
The document provides an introduction to patent law, including:
1) A patent is a legal document issued by a government that grants the right to prohibit others from making, using, or selling a claimed invention for a limited time in exchange for publicly disclosing the invention details.
2) The purpose of patent law is to promote science and useful arts by securing exclusive rights to authors and inventors for limited times.
3) Inventors seek patent protection for both offensive and defensive strategies related to investment, revenue, market protection, and preventing competitor patents.
The document discusses patents, copyrights, and trademarks. It covers what patents, copyrights, and trademarks are, how to obtain them, requirements for protection, infringement issues, and international considerations. Key points include patents providing temporary monopoly for inventions, copyright protecting original creative works, and trademarks identifying business sources and brands. The document also notes limitations and exceptions for protection.
Knobbe Martens’ patent attorneys Russell Jeide and Scott Cromar hosted a seminar series on intellectual property basics for Temecula’s business community. Entrepreneurs, investors, startups, inventors and anyone interested in learning how intellectual property and patents can help their business will benefit from this presentation.
The document discusses the different types of patent claims that can be used to define the scope of legal protection for an invention. It describes independent claims, dependent claims, product claims, process claims, product-by-process claims, two part/Jepson claims, means plus function claims, Markush claims, Swiss claims, multiple dependent claims, and omnibus claims. The types of claims serve to precisely define the boundaries of what is covered by the patent.
This document discusses patents, patent law, and two important case studies related to biotechnological patents. It provides an overview of what patents protect, the history and conventions around patents, and key details of India's National Biodiversity Act of 2002. It then summarizes the Diamond v. Chakrabarty and Dimminaco AG v. Controller of Patents and Designs cases, which established that genetically modified organisms and processes producing living products can be patented.
Patent Law in India_What,How to get it regisgtered and protectedKrishan Singla
It describes the patent law in India and describes what comes and what does come under patent . In other words it defines what kind of inventions can be patented . In brief it contains the following topics:
-What is intellectual property
-Meaning of Patent
-Legislative Framework Patents
-Patent Law - Salient Features
-Safeguards in the Patent Law
-Definition of patentable invention
-Inventions not patentable
-Documenting invention
-Steps for obtaining a patent in India
-Rights of product patentee
-Rights of process patentee
-Renewal of patent
-Infringement of patent
-Patent Due Diligence
The document is a sample patent landscape report that shows what information can be gleaned from such reports. In 3 sentences: Patent landscape reports can show trends in technology sectors over time, the main players and applicants in a technology area as well as potential collaboration partners, and maps of innovation in an area through patent citation analysis to understand development of patent protection over time. The sample report provides examples of charts and data that may be included to illustrate technology trends, key players, collaborations and innovation tracks in a given field of technology.
This presentation helps you to thoroughly understand the concept of patents, copyrights, trademarks, trade secrets etc. Also it includes the steps for registering the above mentioned subjects. Do have a look.
The document discusses non-obviousness, which is a requirement for patentability. To satisfy non-obviousness, an invention must not be obvious to someone with skill in the related field. While it does not need to be a brilliant act of new genius, the combination of elements cannot be obvious and must provide a utility greater than the sum of the parts. The patent application process involves initially filing a provisional application, then a formal application which undergoes review and potential appeals before a patent is issued. The process is lengthy and obtaining a US patent can cost over $1 million due to extensive legal costs.
This document provides an overview of the patent filing process in India. It begins by defining what a patent is and noting that it provides exclusive rights for 20 years. It then outlines the key steps and requirements for filing a patent application in India, including which documents are needed, who can file, where to file, and how to file. The document explains the timeline for publication, request for examination, and potential hearing. It also describes what is not patentable under Indian law and the criteria the examiner evaluates like novelty, non-obviousness, and industrial applicability. The review and response process is summarized, concluding with the potential outcomes of acceptance, rejection, or partial acceptance of claims.
The document discusses the process for obtaining a patent right in India. It begins by defining what a patent is - a set of exclusive rights granted by a government for a new invention for a limited period of time. It then outlines the 5 main steps to obtain a patent right in India: 1) determine the marketability of the invention, 2) conduct a worldwide patent search, 3) file a provisional patent application, 4) file a complete patent application, and 5) follow all patent deadline dates. The document emphasizes that patents only provide protection within the country they are filed in, so separate patents are needed in each country where protection is desired.
The document discusses different types of patent searches including patentability searches, freedom to operate searches, validity searches, landscape searches, state-of-the-art searches, bibliographic searches, continuing searches, assignment searches, number searches, name searches, subject searches, classification searches, family searches, and legal status searches. It provides details on the purpose, timing, and scope of each type of search.
The document summarizes the process of registration and grant of patents in India. It discusses key aspects like application for a patent, provisional and complete specifications, publication of applications, examination of applications, opposition to patents, and grant of a patent. It also provides statistics on patents filed, examined, granted and disposed in India from 2014-15 to 2019-20. Finally, it discusses an important case law on determining the timeline for pre-grant opposition.
The patent licensing occurs when the licensor (patent holder) grants exploitation rights over a patent to a licensee for royalty or a lump sum payment. A licensee can challenge the validity of a licensed patent to avoid paying royalties, though there are some limitations, such as not being able to challenge after failing to pay royalties. The Supreme Court's MedImmune v. Genentech decision found that licensees can challenge licensed patents even while continuing to pay royalties, increasing licensees' freedom to challenge validity. Licensors may respond by negotiating higher royalties, up-front payments, or termination clauses.
Patent Drafting and Writing Strong Patent Applications for Creating & Protect...TechLaw.Attorney
Patent drafting is a process to convert inventor’s ideas into a legal document describing the technology covering inventor’s innovation in broadest possible format comprising patent claims, abstract, drawings and detailed description of the invention. Our team of technical patent attorneys are skilled and experienced to provide various services across diverse industry sectors.
1. The document discusses new chemical entities (NCEs) and aspects of drafting and prosecuting patents for NCEs in India.
2. It provides an overview of patentable subject matter for NCEs, challenges with Markush claims, and case studies comparing prosecution of related patents in India, the US and Europe.
3. The case studies analyze allowed claims and references cited during prosecution, finding that scopes of protection and references cited tended to be more similar between Indian and European patents compared to corresponding US patents.
This is a presentation during the First International Workshop on Bioethics and Ethical Aspects of Biosafety sponsored by the National Centre of Genetic Engineering and Biotechnology, Tehran, Iran, 22 November 2011. This is an attempt of the author to specialize further on intellectual property rights, specifically on the intertwine of patents and bioethics. Since the author is an agricultural researcher in the past and currently a practicing patent agent, this piece is considered as one of his most interesting works so far.
The course covers the following topics:
* General Intro to IP Rights
* Patenting Timeline and Costs
* The Patent Description
* Approaches to Claim Drafting
Part of the MaRS Best Practices Event Series. For more information, please visit: http://www.marsdd.com/Events/Event-Calendar/Best-Practices-Series/patents-05072009.html
The document discusses the drafting of a patent specification. It explains that an applicant must file a specification describing the invention to receive patent rights. The specification can be a provisional or complete specification. A provisional specification broadly discloses the invention to secure priority date, while a complete specification discloses all details clearly to enable practice of the invention and must include claims. The complete specification format includes the title, technical field, background, objectives, description, drawings, claims, and abstract.
Protecting Open Innovation with the Defensive Patent LicenseOSCON Byrum
The Defensive Patent License (DPL) is a new legal mechanism to protect innovators by creating a patent network that is committed to defense and "de-weaponizing" patents. It draws from the theories and values of F/OSS licensing to create obligations that "travel with the patent"--preventing troll from taking over open technologies and pulling them out of the public domain.
The document discusses ex-parte interim injunction orders passed by Indian courts and whether they follow guidelines from the Supreme Court of India on such orders. It notes that obtaining ex-parte orders can create havoc for defendants and be difficult to vacate. While the Supreme Court laid down principles to curb misuse, some courts still tend to pass ex-parte orders without properly applying the law or considering principles of natural justice. The document analyzes some cases where ex-parte orders were passed without following guidelines. It questions whether courts sufficiently consider merits before granting such drastic relief.
Start from Patentability – 4 legal requirements
req.1: a statutory class – lawsuits & 5 classes cover processes, Machines, Manufactures, Compositions, New use
req.2: Utility including software, non-patentable case by drug issue & how to turn back a whimsical case
Req.3: Novelty - prior art (Reduction to Practice)
This document provides an overview of copyright law and its application to libraries from a presentation given to interlibrary loan librarians. It discusses the complexity of copyright law and guidelines, highlighting sections like 108 that provide exceptions for library activities. It also summarizes CONTU guidelines for interlibrary lending and addresses how digital technologies have impacted practices like document delivery and preservation. Overall, the document aims to help librarians navigate copyright considerations in their work.
This document outlines an intellectual property rights program for kids ages 10-18. The program uses PowerPoint slides and WIPO comics to teach about copyrights, patents, trademarks and other intellectual property topics. It covers inventions, creativity techniques, the invention process, intellectual property protections, and commercializing inventions. The program is available in English or Arabic and lasts between 10-40 hours. Further details on pricing and registration can be obtained by contacting the program creator.
This document discusses innovation and provides information on how to encourage innovation. It defines innovation, explains why innovation is important, what types of innovations companies may want, and lists some of the most innovative companies. It then discusses Apple's history of innovation in detail, from its early successes to challenges and return to profitability under Jobs' leadership. The document emphasizes that Apple has continued to innovate through new products and patents to stay on top. It also discusses how to identify opportunities for innovation and evaluate technologies to prioritize innovation efforts.
The document discusses various types of patent licensing including exclusive, non-exclusive, and royalty-free licenses. It describes key components of a patent license agreement such as background, definitions, license grants, royalties, technical assistance, warranties, terms, termination, recording, and obligations of parties. The document also discusses licensing strategies, antitrust considerations, compulsory licensing, and tips for negotiating patent license agreements.
Presentation on Software patenting in IndiaIP Dome
The document discusses legal aspects of patenting software. It states that software is protected by copyright and not patents. Algorithms and computer programs are considered abstract ideas and mental acts, so are not patentable. The document provides examples of software content that is not patentable, such as methods, algorithms, user interfaces, and databases. However, the technical implementation or functionality of an algorithm can be patented if claimed as a series of method steps involving technical aspects rather than just claiming source code. Some examples of allowable method claims are provided involving technical processes like wireless communication scheduling and mobile device location services. System, module, and device claims related solely to software are not patentable.
This document discusses QR codes and how universities can use them for technology marketing. It provides examples of how some universities have used QR codes on items like t-shirts, posters and newspapers to direct viewers to promotional websites. The document advises that QR codes work best when they lead viewers to engaging content on mobile devices and that marketers should know their audience and provide a compelling story. It also lists some reasons why QR codes may not be effective in some situations.
The document summarizes notable patents from Northwest Ohio over time. It discusses early patents from the late 1800s and early 1900s related to chewing gum, paper milk bottles, vehicle designs, scales, and spark plugs. It then provides a sampling of more recent patents from Northwest Ohio companies and institutions related to glass fiber production, measuring tapes, tires, windows, welding methods, rain sensors, caskets, plasma displays, elevators, solar cells, electrical boxes, cancer treatment devices, material coatings detection, and temperature controlled magnetic rollers. The document was presented by a patent attorney from the region to provide an overview of innovation in Northwest Ohio.
The document provides an overview of past and current USPTO programs for expediting patent prosecution. It discusses several expired past programs and several current programs, including Track 1 Prioritized Examination, Accelerated Examination, Petition to Make Special, First Action Interview, and the Patent Prosecution Highway. It compares factors of the different current programs such as costs, expected timelines, limits on claims, and timing for requesting the programs. The document aims to help applicants determine which program may be best suited to expedite examination of their patent applications.
This document provides an overview of intellectual property rights (IPR) and patents. It discusses the history and purpose of patents, the conditions required for patentability, and the rights conferred by a patent. Specifically, it outlines that a patentable invention must be novel, non-obvious, and industrially applicable. It also reviews India's patent system and trends in patent filings and grants over time.
Patentable and Non Patentable Inventionsegoistic_ek
The document provides information on patentable and non-patentable inventions under Indian patent law. It discusses what constitutes a patent, requirements for an invention to be considered patentable such as novelty, non-obviousness, and industrial applicability. Biotechnological inventions are discussed, including examples of patentable subject matter such as genetically modified organisms, DNA/protein sequences. The document also outlines acts and sections of Indian patent law that define non-patentable subject matter such as discoveries, plants/animals, and traditional knowledge.
This document discusses various types of intellectual property, including patents, copyrights, trademarks, trade secrets, and geographical indications. It provides details on:
- What constitutes each type of intellectual property and the basic requirements or criteria for protection. For example, patents require novelty, inventive step, and industrial applicability.
- The rights granted by each type of intellectual property. For example, copyright provides exclusive rights over reproduction, preparation of derivatives, and distribution.
- Examples of intellectual property disputes in various jurisdictions.
- The procedures for obtaining intellectual property protections like patents and registering trademarks.
So in summary, the document outlines the key types of intellectual property, their defining characteristics and rights, as well
Intellectual property law refers to creations of the mind such as inventions, literary works, and symbols. The US Constitution gives Congress the power to grant limited monopolies to authors and inventors via copyright and patent laws. There are several types of intellectual property including patents, copyrights, trademarks, and trade secrets. Patents protect new and useful processes, machines, manufactures, compositions of matter, and plant designs for a limited term. Obtaining a patent requires an application process to show the invention is novel, non-obvious, and adequately disclosed. The America Invents Act of 2011 modernized US patent law and changed it from a first-to-invent system to a first-inventor-to-file
nnano 2007 55 From the lab to the marketMike Helmus
Patent protection and freedom to operate are essential for successfully commercializing nanotechnology innovations. The document provides a step-by-step process for navigating intellectual property issues from the lab to the market. It begins with defining functional requirements, prioritizing them, and using brainstorming to generate new ideas and inventions. Key intellectual property is then captured through patent applications. Further refinement and testing leads to additional intellectual property reviews and potential new inventions or licensing needs. Following this process helps establish value, allows for investment, and enables commercialization strategies while mitigating intellectual property risks.
This document discusses different forms of intellectual property protection for innovations, with a focus on patents. It explains that patents protect product and process innovations by providing a limited monopoly in exchange for public disclosure. To obtain a patent, an innovation must be novel, useful, and non-obvious. Processes, as well as products, can be patented. However, basic scientific ideas and principles cannot be patented.
SKGF_Presentation_IP Issues in Nanotechnology - A View from Around the World_...SterneKessler
This document discusses several intellectual property issues related to nanotechnology, including:
1) Different types of intellectual property like patents, trade secrets, copyrights and how they apply to nanotechnology.
2) Issues around patentability at the nanoscale, where traditional mechanical and chemical properties are blurred.
3) Challenges around identifying infringing products that incorporate patented nanotechnologies.
4) Best practices for strategic alliances and technology transfers to appropriately allocate intellectual property rights.
This document provides an overview of patent law and the patent filing procedure in India. It discusses what a patent is, the types of intellectual property, and the various legislations in India for protecting intellectual property rights. It then describes the different parts of a patent document, the criteria for patentability, and how to identify a potential patent. Finally, it outlines the patent filing process in India, including filing an application, publication, examination, and granting of a patent.
A patent is an exclusive right granted for an invention, which is a product or a process that provides, in general, a new way of doing something, or offers a new technical solution to a problem.
To get a patent, technical information about the invention must be disclosed to the public in a patent application.
The patent is usually referred to as the right granted to an inventor for his Invention of any new, useful, non-obvious process, machine, article of manufacture, or composition of matter
Patent thickets occur when a technology is covered by many overlapping patents from different owners. This makes it difficult and costly for companies to develop new products without licensing many patents. Industries like pharmaceuticals, software, and nanotechnology are prone to thickets because they involve incremental innovations built on existing technologies. Thickets can arise unintentionally due to lack of prior art searches or abstract patent claims. They also are sometimes deliberately created as a business strategy to block competitors. This increases transaction costs and hampers innovation. Cross-licensing and patent pools help reduce thickets by bundling related patents from multiple owners.
COVID Crisis unleashed creativity of Indian Researchers and Innovators like never before. Is India becoming an Innovation nation? Here, we look at basics of IPR and some of the COVID 19 innovations.
This document discusses intellectual property rights and access and benefit-sharing regarding genetic resources. It provides the legal context of the Convention on Biological Diversity and Nagoya Protocol. There is a need for a new international instrument on biodiversity beyond national jurisdiction. The optimal system would promote research, provide legal certainty, and ensure fair sharing of benefits. The EMBRIC community could play a role by advocating for an open notification system, promoting open access, avoiding embargos, benefit sharing from commercialization, and facilitating global south collaborations.
Intellectual Property Rights in Nanotechnologyipspat
This document discusses intellectual property rights in the field of nanotechnology. It begins by explaining the importance of protecting intellectual property from both offensive and defensive standpoints, citing examples of costly patent disputes. It then provides an overview of nanotechnology and different types of intellectual property protection applicable to nanotechnology, including patents, copyrights, trademarks, and trade secrets. The document outlines areas of nanotechnology research and applications that could be protected, such as manufacturing methods, computational techniques, molecular electronics, sensors, and more. It concludes by noting the challenges of obtaining intellectual property rights in nanotechnology.
The document provides an overview of intellectual property rights (IPR) and patents. It defines IPR as exclusive rights granted to authors for their creations. There are different types of IPR including patents, trademarks, copyrights, industrial designs, geographical indications, and trade secrets. The document then discusses patents in more detail, noting that a patent is a contract with the government that provides a limited monopoly in exchange for sufficient disclosure of an invention. It provides examples of patentable subject matter and exclusions, the patent filing process, and benefits of obtaining a patent.
This document provides an introduction to intellectual property rights and different types of intellectual property. It discusses patents, copyrights, trademarks, trade secrets and other forms of IP. For patents specifically, it describes what can be patented, the claims process, prior art, and types of patents including utility patents and industrial designs. It also includes sections on documenting inventions, conducting patent searches, case studies of companies leveraging IP, and dos and don'ts of IP.
The document provides information about intellectual property rights (IPR) and patents. It defines IPR as exclusive rights granted to authors for their creations. It lists different types of IPR including patents, trademarks, copyrights, industrial designs, geographical indications, and trade secrets. The document then discusses patents in more detail, defining a patent as a contract with the government that provides a limited monopoly in exchange for sufficient disclosure of an invention. It provides examples of patentable subject matter and exclusions. It also outlines the patent filing process and requirements for an invention to be considered new, useful, and non-obvious.
The document discusses intellectual property rights (IPR) and patents. It defines IPR as exclusive rights granted to authors for utilizing and benefiting from their creations. The types of IPR are then outlined, including patents, trademarks, copyrights, and industrial designs. The document goes on to provide definitions and examples of patents, the patent process, patentable subject matter, and sections of Indian patent law that outline exclusions from patentability.
The document is a report on the management of intellectual property rights in India. It provides an overview of intellectual property rights in India, including:
1) An introduction to different types of intellectual property rights like patents, copyrights, trademarks etc. and how they are regulated.
2) A discussion of patent laws in India, eligibility criteria for patents, and exceptions.
3) Details on management of intellectual property in publicly funded institutions in India, and statistics on patent filings from these institutions.
This document provides an overview of patents, including types of patents, what can and cannot be patented, and the patent process. It discusses plant patents, limitations on patent rights, and provides examples of patent infringement and expiration. The document contains information on the Indian patent system, the various patent offices and their jurisdictions, and the stages and procedures for obtaining a patent in India, from initial filing through examination and potential grant. It aims to introduce readers to the basic concepts of the patent system.
Similar to Drafting chemical patent specs and claims (20)
Fundamentals of Intellectual Property Rights (IPRs): Perspectives for an Acad...Caezar Angelito E Arceo
Lecture during the 9th Martin M. Posadas Memorial Research Forum held at the Virgen Milagrosa University Foundation, San Carlos City, Pangasinan, Philippines, on 23 February 2012. The audience was composed of professors, university researchers, and students. Some university models were also presented.
Some Current Philippine Rice Production Technology and Constraints: Opportuni...Caezar Angelito E Arceo
A Country Report for the Rice Production Technology for ASEAN Countries, International Technical Cooperation Center, Rural Development Administration, Suwon City, South Korea, 29 July 2003. This presentation highlighted my previous works while still teaching at a state university, and featured an award-winning research on the use of hybrid rice in the mountains.
Training slides for a PCAARRD-organized training on Invention Spotting, Patent Search, Documentation and Interpretation, 18 December 2012. Special thanks to fellow Patent Agent Mr. Noel A. Catibog, Dr. Melvin B. Carlos, and Exec. Director Patricio S. Faylon, for the invitation.
Training slides for a PCAARRD-organized training on Invention Spotting, Patent Search, Documentation and Interpretation, 18 December 2012. Special thanks to fellow Patent Agent Mr. Noel A. Catibog, Dr. Melvin B. Carlos, and Exec. Director Patricio S. Faylon, for the invitation.
Training on Intellectual Property Rights, Biotech-IPR Training Center,
Philippine Rice Research Institute, Science City of Muñoz, Nueva Ecija, Philippines, 24-25 November 2005
This very short document appears to be a test that contains a single word "This" followed by the sentence "is a test." and includes a date "2011.12.08" but no other context or information.
Threats to mobile devices are more prevalent and increasing in scope and complexity. Users of mobile devices desire to take full advantage of the features
available on those devices, but many of the features provide convenience and capability but sacrifice security. This best practices guide outlines steps the users can take to better protect personal devices and information.
For the full video of this presentation, please visit: https://www.edge-ai-vision.com/2024/06/building-and-scaling-ai-applications-with-the-nx-ai-manager-a-presentation-from-network-optix/
Robin van Emden, Senior Director of Data Science at Network Optix, presents the “Building and Scaling AI Applications with the Nx AI Manager,” tutorial at the May 2024 Embedded Vision Summit.
In this presentation, van Emden covers the basics of scaling edge AI solutions using the Nx tool kit. He emphasizes the process of developing AI models and deploying them globally. He also showcases the conversion of AI models and the creation of effective edge AI pipelines, with a focus on pre-processing, model conversion, selecting the appropriate inference engine for the target hardware and post-processing.
van Emden shows how Nx can simplify the developer’s life and facilitate a rapid transition from concept to production-ready applications.He provides valuable insights into developing scalable and efficient edge AI solutions, with a strong focus on practical implementation.
Removing Uninteresting Bytes in Software FuzzingAftab Hussain
Imagine a world where software fuzzing, the process of mutating bytes in test seeds to uncover hidden and erroneous program behaviors, becomes faster and more effective. A lot depends on the initial seeds, which can significantly dictate the trajectory of a fuzzing campaign, particularly in terms of how long it takes to uncover interesting behaviour in your code. We introduce DIAR, a technique designed to speedup fuzzing campaigns by pinpointing and eliminating those uninteresting bytes in the seeds. Picture this: instead of wasting valuable resources on meaningless mutations in large, bloated seeds, DIAR removes the unnecessary bytes, streamlining the entire process.
In this work, we equipped AFL, a popular fuzzer, with DIAR and examined two critical Linux libraries -- Libxml's xmllint, a tool for parsing xml documents, and Binutil's readelf, an essential debugging and security analysis command-line tool used to display detailed information about ELF (Executable and Linkable Format). Our preliminary results show that AFL+DIAR does not only discover new paths more quickly but also achieves higher coverage overall. This work thus showcases how starting with lean and optimized seeds can lead to faster, more comprehensive fuzzing campaigns -- and DIAR helps you find such seeds.
- These are slides of the talk given at IEEE International Conference on Software Testing Verification and Validation Workshop, ICSTW 2022.
CAKE: Sharing Slices of Confidential Data on BlockchainClaudio Di Ciccio
Presented at the CAiSE 2024 Forum, Intelligent Information Systems, June 6th, Limassol, Cyprus.
Synopsis: Cooperative information systems typically involve various entities in a collaborative process within a distributed environment. Blockchain technology offers a mechanism for automating such processes, even when only partial trust exists among participants. The data stored on the blockchain is replicated across all nodes in the network, ensuring accessibility to all participants. While this aspect facilitates traceability, integrity, and persistence, it poses challenges for adopting public blockchains in enterprise settings due to confidentiality issues. In this paper, we present a software tool named Control Access via Key Encryption (CAKE), designed to ensure data confidentiality in scenarios involving public blockchains. After outlining its core components and functionalities, we showcase the application of CAKE in the context of a real-world cyber-security project within the logistics domain.
Paper: https://doi.org/10.1007/978-3-031-61000-4_16
Full-RAG: A modern architecture for hyper-personalizationZilliz
Mike Del Balso, CEO & Co-Founder at Tecton, presents "Full RAG," a novel approach to AI recommendation systems, aiming to push beyond the limitations of traditional models through a deep integration of contextual insights and real-time data, leveraging the Retrieval-Augmented Generation architecture. This talk will outline Full RAG's potential to significantly enhance personalization, address engineering challenges such as data management and model training, and introduce data enrichment with reranking as a key solution. Attendees will gain crucial insights into the importance of hyperpersonalization in AI, the capabilities of Full RAG for advanced personalization, and strategies for managing complex data integrations for deploying cutting-edge AI solutions.
Have you ever been confused by the myriad of choices offered by AWS for hosting a website or an API?
Lambda, Elastic Beanstalk, Lightsail, Amplify, S3 (and more!) can each host websites + APIs. But which one should we choose?
Which one is cheapest? Which one is fastest? Which one will scale to meet our needs?
Join me in this session as we dive into each AWS hosting service to determine which one is best for your scenario and explain why!
Ivanti’s Patch Tuesday breakdown goes beyond patching your applications and brings you the intelligence and guidance needed to prioritize where to focus your attention first. Catch early analysis on our Ivanti blog, then join industry expert Chris Goettl for the Patch Tuesday Webinar Event. There we’ll do a deep dive into each of the bulletins and give guidance on the risks associated with the newly-identified vulnerabilities.
AI-Powered Food Delivery Transforming App Development in Saudi Arabia.pdfTechgropse Pvt.Ltd.
In this blog post, we'll delve into the intersection of AI and app development in Saudi Arabia, focusing on the food delivery sector. We'll explore how AI is revolutionizing the way Saudi consumers order food, how restaurants manage their operations, and how delivery partners navigate the bustling streets of cities like Riyadh, Jeddah, and Dammam. Through real-world case studies, we'll showcase how leading Saudi food delivery apps are leveraging AI to redefine convenience, personalization, and efficiency.
Infrastructure Challenges in Scaling RAG with Custom AI modelsZilliz
Building Retrieval-Augmented Generation (RAG) systems with open-source and custom AI models is a complex task. This talk explores the challenges in productionizing RAG systems, including retrieval performance, response synthesis, and evaluation. We’ll discuss how to leverage open-source models like text embeddings, language models, and custom fine-tuned models to enhance RAG performance. Additionally, we’ll cover how BentoML can help orchestrate and scale these AI components efficiently, ensuring seamless deployment and management of RAG systems in the cloud.
In the rapidly evolving landscape of technologies, XML continues to play a vital role in structuring, storing, and transporting data across diverse systems. The recent advancements in artificial intelligence (AI) present new methodologies for enhancing XML development workflows, introducing efficiency, automation, and intelligent capabilities. This presentation will outline the scope and perspective of utilizing AI in XML development. The potential benefits and the possible pitfalls will be highlighted, providing a balanced view of the subject.
We will explore the capabilities of AI in understanding XML markup languages and autonomously creating structured XML content. Additionally, we will examine the capacity of AI to enrich plain text with appropriate XML markup. Practical examples and methodological guidelines will be provided to elucidate how AI can be effectively prompted to interpret and generate accurate XML markup.
Further emphasis will be placed on the role of AI in developing XSLT, or schemas such as XSD and Schematron. We will address the techniques and strategies adopted to create prompts for generating code, explaining code, or refactoring the code, and the results achieved.
The discussion will extend to how AI can be used to transform XML content. In particular, the focus will be on the use of AI XPath extension functions in XSLT, Schematron, Schematron Quick Fixes, or for XML content refactoring.
The presentation aims to deliver a comprehensive overview of AI usage in XML development, providing attendees with the necessary knowledge to make informed decisions. Whether you’re at the early stages of adopting AI or considering integrating it in advanced XML development, this presentation will cover all levels of expertise.
By highlighting the potential advantages and challenges of integrating AI with XML development tools and languages, the presentation seeks to inspire thoughtful conversation around the future of XML development. We’ll not only delve into the technical aspects of AI-powered XML development but also discuss practical implications and possible future directions.
Driving Business Innovation: Latest Generative AI Advancements & Success StorySafe Software
Are you ready to revolutionize how you handle data? Join us for a webinar where we’ll bring you up to speed with the latest advancements in Generative AI technology and discover how leveraging FME with tools from giants like Google Gemini, Amazon, and Microsoft OpenAI can supercharge your workflow efficiency.
During the hour, we’ll take you through:
Guest Speaker Segment with Hannah Barrington: Dive into the world of dynamic real estate marketing with Hannah, the Marketing Manager at Workspace Group. Hear firsthand how their team generates engaging descriptions for thousands of office units by integrating diverse data sources—from PDF floorplans to web pages—using FME transformers, like OpenAIVisionConnector and AnthropicVisionConnector. This use case will show you how GenAI can streamline content creation for marketing across the board.
Ollama Use Case: Learn how Scenario Specialist Dmitri Bagh has utilized Ollama within FME to input data, create custom models, and enhance security protocols. This segment will include demos to illustrate the full capabilities of FME in AI-driven processes.
Custom AI Models: Discover how to leverage FME to build personalized AI models using your data. Whether it’s populating a model with local data for added security or integrating public AI tools, find out how FME facilitates a versatile and secure approach to AI.
We’ll wrap up with a live Q&A session where you can engage with our experts on your specific use cases, and learn more about optimizing your data workflows with AI.
This webinar is ideal for professionals seeking to harness the power of AI within their data management systems while ensuring high levels of customization and security. Whether you're a novice or an expert, gain actionable insights and strategies to elevate your data processes. Join us to see how FME and AI can revolutionize how you work with data!
HCL Notes and Domino License Cost Reduction in the World of DLAUpanagenda
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-and-domino-license-cost-reduction-in-the-world-of-dlau/
The introduction of DLAU and the CCB & CCX licensing model caused quite a stir in the HCL community. As a Notes and Domino customer, you may have faced challenges with unexpected user counts and license costs. You probably have questions on how this new licensing approach works and how to benefit from it. Most importantly, you likely have budget constraints and want to save money where possible. Don’t worry, we can help with all of this!
We’ll show you how to fix common misconfigurations that cause higher-than-expected user counts, and how to identify accounts which you can deactivate to save money. There are also frequent patterns that can cause unnecessary cost, like using a person document instead of a mail-in for shared mailboxes. We’ll provide examples and solutions for those as well. And naturally we’ll explain the new licensing model.
Join HCL Ambassador Marc Thomas in this webinar with a special guest appearance from Franz Walder. It will give you the tools and know-how to stay on top of what is going on with Domino licensing. You will be able lower your cost through an optimized configuration and keep it low going forward.
These topics will be covered
- Reducing license cost by finding and fixing misconfigurations and superfluous accounts
- How do CCB and CCX licenses really work?
- Understanding the DLAU tool and how to best utilize it
- Tips for common problem areas, like team mailboxes, functional/test users, etc
- Practical examples and best practices to implement right away
“An Outlook of the Ongoing and Future Relationship between Blockchain Technologies and Process-aware Information Systems.” Invited talk at the joint workshop on Blockchain for Information Systems (BC4IS) and Blockchain for Trusted Data Sharing (B4TDS), co-located with with the 36th International Conference on Advanced Information Systems Engineering (CAiSE), 3 June 2024, Limassol, Cyprus.
Fueling AI with Great Data with Airbyte WebinarZilliz
This talk will focus on how to collect data from a variety of sources, leveraging this data for RAG and other GenAI use cases, and finally charting your course to productionalization.
1. Patenting “chemical” inventions
An appreciation topic to draft specifications
and claims in the Chemical Field
Caezar Angelito E. Arceo
Registered Patent Agent in the Philippines
(Non-chemical field, 2006; Chemical field, 2007)
Mentor, Patent Agent Qualifying Examinations 2011
Intellectual Property Management Training Cum Writeshop on Technology Disclosure and Claim Drafting
Philippine Council for Agriculture, Aquatic, and Natural Resources Research and Development (PCAARRD)
Bulwagang Panday Karunungan, PCAARRD, Los Baños, Laguna (Philippines)
30 August 2012
2. Special notes
(1) Grateful acknowledgment:
Mr. Noel A. Catibog, PCAARRD Dr. Karl Rackette, EPO
Dr. Patricio S. Faylon, PCAARRD Dr. Ray Coleiro, EPO
Dr. Cecilia P. Reyes, NRCP The World Intellectual Property Office
Ms. Renia C. Corocoto, NRCP The men and women of the Sapalo Velez Bundang &
Mr. Jerry C. Serapion, PhilRice Bulilan Law Offices
Engr. Rey Negre, IPOPHIL Atty. Anna Mariae Celeste V. Jumadla, former boss
Ms. Rosa M. Fernandez, IPOPHIL Atty. Ronilo A. Beronio, former boss
Ms. Virginia M. Aumentado, IPOPHIL
Ms. Rudina Pescante, Patrick Miranda (Singapore)
(2) This presentation was designed not to teach claim drafting, which requires
at least one week training course, but to help interested participants to
appreciate the art, which is necessary for effective chemical claim drafting.
(3) Citing the source of slides in your public presentation/publication is humbly
requested.
(4) May this serve as an invitation to take the Patent Agent Qualifying
Examinations (PAQE).
(5) Enjoy!
3. Outline
1.0 Patenting quick review 3 min
2.0 Claims 10 min
3.0 Scenario: My awesome eureka! 30 min
4.0 The “chemical” claims 15 min
5.0 End 1 min
4. 1.0 Patenting quick review
Our questions:
1.1 What is a patent?
1.2 Why patent?
1.3 What can be patented?
1.4 What cannot be patented?
1.5 What are the requirements of a patent?
1.6 What are the parts of a patent document?
6. 1.2 Why patent?
“There is no reason
anyone would want a computer
in their home.”
- Ken Olsen (1977)
Founding Chair, Digital
Equipment Corporation
1.3 What can be patented?
Any technical solution of a problem
in any field of human activity which
is new, involves an inventive step
and is industrially applicable shall be - Sec. 21, RA 8293
Patentable. It may be, or may relate to, a
product, or process, or an improvement
of any of the foregoing.
7. 1.4 What cannot be patented?
EXCLUSIONS: An invention shall not be
considered new if it forms part of a
(1) Discoveries, scientific prior art.
theories and mathematical
methods; - Sec. 23, RA 8293
(2) Schemes, rules and methods - Rule 203, Patents IRR
of performing mental acts,
playing games or doing Made available to the public
business, and programs for anywhere in the world.
computers; Earlier applications.
(3) Methods for treatment of the - Rule 204, Patents IRR
human or animal body;
(4) Plant varieties or animal
breeds or essentially
biological process for the
Prohibited statements in the application:
production of plants or (1) Contrary to “public order” or morality.
animals. (2) Disparaging other products or
(5) Aesthetic creations; and processes of any person other than the
(6) Anything which is contrary to applicant.
public order or morality. (3) Obviously irrelevant or unnecessary
under the circumstances.
- Sec. 22, RA 8293 - Rule 412, Patents IRR
10. 1.6 What are the parts of a patent document?
Title Abstract
Authors and Affiliations Contact a Claims
patent agent
Abstract
Specifications
Introduction
Review of Literature
Methodology Request for Grant of
Patent (Application
Results and Discussion form)
Summary, Conclusions, Recommendations
Drawings
Literature cited
11. 2.0 Patent claims
Our questions:
2.1 What is a claim?
2.2 Why claim?
2.3 How to draft claims?
17. 2.2 Why claim?
(4) It is a MUST.
“[T]he name of the game
is the claim.”
In re Hiniker Co.,
150 F.3d 1362, 1369 (Fed.Cir.1998)
18. 2.3 How to draft claims?
(1) Use the “Problem and solution approach”
Step 1
Determine the closest prior art.
Step 2
Evaluate the difference between the
closest prior art and the claimed invention.
Step 3
Formulate the technical problem.
Step 4
Determine obviousness.
19. 2.3 How to draft claims?
(2) Follow basic steps in claim drafting.
Step 1
Evaluate the subject matter. Step 2
Identify basic elements of invention.
Step 3
Prepare outline of subject Step 4
matter. Draft set of claims.
Step 5
Prepare drawings/figures (whenever applicable).
Step 6
Draft abstract of disclosure. Based on “Claim Drafting in the Field of Biotechnology”
by Ms. Rosa M. Fernandez and Engr. Herminia T.
Maniquiz, PCARRD presentation, 30-31 August 2007.
21. 3.0 Scenario: My awesome eureka!!!
Our simple question:
3.1 Can you help me file a patent application?
General instructions:
(1) Group yourselves and grab your writing materials.
(2) You may switch on your “specialist knowledge” for this exercise,
provided, that you will accept my disclosures as true.
(3) Listen to my disclosures and ask questions.
(4) Prepare a matrix like this for presentation. Defend your position.
Disclosure Patentable? Reason(s) If yes, list what to claim
23. 3.1 Can you help me file a patent application?
(1) Amazing morphology Leg!
Leg!
Leg! Leg!
Two nuclei!
Leg!
Leg!
Leg!
Leg!
0.01 mm
24. 3.1 Can you help me file a patent application?
(2) Amazing locomotion
Unidirectional speed:
Steering speed: 0.01 mm min-1
0.005 mm min-1
Note: I used a novel
method of determining
speed of this
microorganism!
0.01 mm
25. 3.1 Can you help me file a patent application?
(3) Amazing cell wall
Pinch-proof!!!
Novel compound:
DNA
CTGGTGAAGCCTTCACAGACCCTGTCCCTC
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGA
Protein
LVKPSQTLSLQVQLQESGPG
26. 3.1 Can you help me file a patent application?
(4) Amazing chemical compounds produced
TiO2
Negrein, with unknown use
Catibein, with anti-
dengue properties
??? Unknown structure
27. 3.1 Can you help me file a patent application?
(5) Amazing magical features
If temperature drops
to below 10 degrees
Celsius, it turns to
pink or red!!!
28. 3.1 Can you help me file a patent application?
Sample answer
Disclosure Patentable? Reason(s) If yes, list what to claim
1. Morphology No Naturally occurring
2. Locomotion Speed, Naturally occurring
ability: No
Tool: Yes Perhaps novel method Method of determining speed
3. Cell Wall Features: No “Pinch proof” is a
natural characteristic
of a naturally occurring
organism
Compound: Perhaps novel Allegedly novel compound,
Perhaps compound depending on the patent agent;
Better: with industrial application
4. Chemical Negrein: No No industrial
compound application yet
Catibein: Yes Medical use Catebein’s use; better if structure
is already available
5. “Magic” No No industrial
application yet
29. 4.0 The “chemical” claims
Our questions:
4.1 What are “chemical” inventions?
4.2 How are “chemical” inventions protected?
4.3 What can be claimed in “chemical” inventions?
4.4 What cannot be claimed in “chemical” inventions?
4.5 How to draft “chemical” claims?
30. 4.1 What are “chemical” inventions?
(1) They are not mechanical inventions. ^_^
Relatively tough to claim.
Differences between chemical and non-chemical (mechanical) claims:
Type/format Brief description Chemical Non-chemical
Jepson claims Basic two-part claim type √ √
Beauregard Generally used to circumvent √
claims unpatentability of software
Markush claims Claims species/groups √
Means-plus- Apparatus and its functional √
function features
Product-by- Chemical product as a product of a √
process process
Swiss type Equivalent of “second medical use” √
format in the Philippines
31. 4.1 What are “chemical” inventions?
(2) They encompass a broad range of inventions.
Based on “Claim Drafting in the Field of Biotechnology”
by Ms. Rosa M. Fernandez and Engr. Herminia T.
Maniquiz, PCARRD presentation, 30-31 August 2007.
32. 4.2 How to protect “chemical” inventions?
(1) File a patent application before publication.
Necessary if you intend to file through PCT, or in countries that require
absolute novelty.
Applicable if you intend to upload your sequences or compound
structures in public databases.
Practical re: “First to file rule”.
(2) Test and claim within the group, class, or category.
Applicable for chemical compounds (re: Markush claim).
May be applicable for microoganisms with potential antimicrobial use
(i.e., within the genus instead of species)
(3) Deposit microorganisms.
Budapest Treaty.
Find a suitable (read: cost-effective) depositary institution.
33. 4.3 What can be claimed in “chemical” inventions?
Three types of claims based on the subject matter
1. Claims to a physical entity
Entity Classes/sub-classes Examples
Products Chemical compounds, Insecticide compositions, Has broader
compositions proteins commercial
Microorganisms Vectors for plant application
transformation (conventional
patent agent
Apparatus Machine used to Gene gun view).
manufacture the products
2. Claims to an activity
Entity Classes/sub-classes Examples
Process Chemical production Biopesticide production
Method of application of a “Ballistic” biopesticide
chemical product
Use First use Biopesticide
Second use Biopesticide as foliar spray
3. Combination of both.
“Product-by-process”
34. 4.4 What cannot be claimed in “chemical”
inventions?
(1) Method of treating human or animal bodies.
Methods of surgery or therapy and diagnostic methods.
Any treatment or diagnostic method that will be carried out on the living
human or animal body.
(2) Lacking “industrial applicability”.
Method of contraception vs. “purely cosmetic treatment of a human by
administration of a chemical product”
- p. 55, Ch IV, 4.3, Manual of Substantive Examination Practice
35. 4.4 What cannot be claimed in “chemical”
inventions?
(3) Anything that is contrary to morality or public order.
Example 1: Abortion pill vs. medical drug.
Example 2: Dynamite to kill people vs. blast mountains for mining
purposes.
Example 3: Stem cell to create human parts vs. treat diseases.
Example 4: Sex enhancement drugs vs. medicine for sexual dysfunction.
36. 4.5 How to draft “chemical” claims?
(1) Spot the invention!
Shortcut: Identify the closest prior art.
For a process invention, the closest prior art is usually a similar process.
For a method of use invention, the closest prior art is usually a
disclosure of a similar use of the same product, or the same use of a
structurally similar product.
For a product invention, the closest prior art is usually another product
having the same intended use or purpose. This product will normally also
have the greatest number of technical features in common with the
invention.
- p. 78, Annex 2 to Ch IV, 9, Manual of Substantive Examination Practice
37. 4.5 How to draft “chemical” claims?
(2) Follow appropriate claim set format.
Preamble
Independent claim
Also known as (1)
main claim; (2)
mother claim.
The most important
claim in the set.
Characterizing portion
Dependent claims
Include all the features of
any other claim(s).
Contain a reference to the
other claim. (i.e., “according
to claim 1”, etc)
38. 4.5 How to draft “chemical” claims?
(3) Follow appropriate claim style.
Type/format Brief description Chemical Non-chemical
Jepson claims Basic two-part claim type √ √
Beauregard Generally used to circumvent √
claims unpatentability of software
Markush claims Claims species/groups √
Means-plus- Apparatus and its functional √
function features
Product-by- Chemical product as a product of a √
process process
Swiss type Equivalent of “second medical use” √
format in the Philippines
39. 4.5 How to draft “chemical” claims?
(3) Follow appropriate claim style.
Type/format Brief description Chemical Non-chemical
Jepson claims Basic two-part claim type √ √
Beauregard Generally used to circumvent √
claims About Jepson of software
unpatentability claims:
Markush claims Claims species/groups √
(1) Basic claim construction acceptable in the Philippines.
Means-plus- (2) Rule 416(a) its functional
Apparatus and and (b) on Patents define the two-part form √
function features a claim should adopt “wherever appropriate.”
which
Product-by- Chemical product as a product of a √
process Example:
process
Swiss type Equivalent of “second medical use” √
“1. A continuous on-line steam purity monitoring system for
format in the Philippines
geothermal power generation plants comprising the steps of
xxx, whereby the sodium concentration in the steam is used
as an indication of purity.”
(Philippine Pat. No. 1-2007-000448)
40. 4.5 How to draft Markush claims: claims?
About
“chemical”
(1) Usually used in chemical patents although also
(3) Follow appropriate claim style.
applicable in other fields.
(2) A "Markush claim" can be considered as a shortened
formulation of a claim. (Rule 605, Rules on Patents)
Type/format (3) Markush grouping is allowable only if all alternatives
Brief description Chemical Non-chemical
have a common property or activity AND a common
Jepson claims Basic two-part claim type √ √
structure is present. (Rule 605, Rules on Patents)
Beauregard Generally used to circumvent √
claims unpatentability of software
Markush claims Claims species/groups √
Means-plus- Apparatus and its functional √
function features Examples:
Product-by- Chemical product as a product of a √
process process “1. A composition comprising a copper compound
and a dimerised thiourea derivative of Formula
Swiss type Equivalent of “second medical use” √
format in the Philippines
wherein the two substituents R, which may...
(Manual of Substantive Examination and Practice)
41. 4.5 How to draft “chemical” claims?
About Product-by-Process claims:
(3) Follow appropriate claiminstyle. inventions, as a chemical
(1) Usually used medical
product can be characterized as the product of a
process. Acceptable if compound is new.
Type/format Brief description #1: Only when a process used is
(2) Application Chemical Non-chemical
Jepson claims Basic two-part claim typethe case of microorganisms.
repeatable, as in √ √
(3) Application #2: A recombinant vector, being a chemical
Beauregard Generally used to circumvent √
product, may be characterized by (i) its formula, (ii) as
claims unpatentability of software
the product of a process, (iii) a combination of
Markush claims √
Claims parameters, or (iv) composition of sub-parts. (p. 161,
species/groups
Means-plus- Ch. 7, Manual of Substantive Examination Practice)
Apparatus and its functional √
function features
Product-by- Chemical product as a product of a √
process process
Swiss type Equivalent of “second medical use” √
Example: format in the Philippines
“1. Product prepared by reacting the reaction product of A and B with substances
X and Y.” (p. 137, Ch. 7, Manual of Substantive Examination Practice)
42. 4.5 How to draft Swiss-type claims:claims?
About
“chemical”
(1) Equivalent of “second medical use” claim format in the
(3) Follow appropriate claim style.
Philippines.
(2) Allowed even if the compound is already known and the
medical use is also known, but a second medical use was
Type/format Brief description before.
not disclosed Chemical Non-chemical
(3) Some acceptable formats:
Jepson claims Basic two-part claim type √ √
(a) compound X for use as a medicament
Beauregard Generally (b) compound X for use as an analgesic
used to circumvent √
claims unpatentability of software for use in curing disease Y
(c) compound X
√
(d) medicament containing the compound X
Markush claims Claims species/groups
(e) use of X for preparing a medicament
Means-plus- Apparatus and its functional √
function features
Example:
Product-by- Chemical product as a product of a √
process process of an oculosurface selective glucocorticoid for the
“1. Use
Swiss type Equivalent ofof a topical ophthalmic composition for treating
preparation “second medical use” √
format in dry eye conditions, xxx wherein the oculosurface
chronic the Philippines
selective glucocorticoid comprises rimexolone and wherein the
composition contains rimexolone at a concentration of 0.001 to
less than 0.1 w/v%.” (Phil. Pat. 1-2005-501206)