Dr Nicholas Shackel - Bioinformatics and Personalised Medicine
•Download as PPT, PDF•
1 like•898 views
Bioinformatics aims to understand disease processes by analyzing high-throughput experimental data like genomics and transcriptomics using computational methods. Systems biology views biological systems holistically rather than through reductionism. Personalized medicine is informed by understanding an individual's genome, transcriptome, epigenetics and miRNA expression. Deep sequencing is generating vast amounts of data but presents challenges for analysis that could amplify problems for personalized medicine.
Report
Share
Report
Share
![Overview ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)
Recommended
複製 Mitalipov
This document summarizes research on replacing the mitochondrial DNA (mtDNA) in human eggs to prevent inherited mtDNA diseases. Key points include:
- Over 700 mtDNA mutations can cause inherited diseases affecting thousands born each year in the US. Current treatments don't exist.
- Researchers developed a technique called spindle transfer to replace the entire mtDNA in an egg by transferring its nuclear DNA to a donor egg, eliminating future risk of transmission.
- Studies in monkey eggs and embryos showed very low levels of mutated mtDNA carryover and normal development. Similar success was found in human eggs and stem cell lines derived from resulting embryos.
- Ongoing clinical trials aim to use this technique to help families affected
Genomic oncology and personalized medicine
This document discusses genomic oncology and personalized medicine, using lung cancers as a model. It summarizes several key technologies that enable genomic oncology like cDNA microarrays, array CGH, and next generation sequencing. It provides examples of how these technologies have been used to classify cancers like diffuse large B-cell lymphoma and myelodysplastic syndrome, and identify genetic mutations that can guide targeted therapies for cancers like EGFR-mutated lung cancer.
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challeng...
I reviewed recent advances, challenges, and opportunities to implement clinical cancer genomics. Case studies of advanced systems, such as Foundation Medicine, MI-ONCOSEQ are introduced for benchmark. A few fundamental limitations to establish personalized oncology are also discussed.
Modelling gender-specific regulation of tau in Alzheimer’s disease
Public transcriptomic studies have shown that several genes display pronounced gender differences in their expression in the human brain, which may influence the manifestations and risk for neuronal disorders. Here, we apply a transcriptome-wide analysis to discover genes with gender-specific expression and significant alterations in public postmortem brain tissue from Alzheimer’s disease (AD) patients compared to controls. We identify the sex-linked ubiquitin-specific peptidase 9 (USP9) as an outstanding candidate gene with highly significant expression differences between the genders and male-specific underexpression in AD. Since previous studies have shown that USP9 can modulate the phosphorylation of the AD-associated protein MAPT, we investigate functional associations between USP9 and MAPT in further detail. After observing a high positive correlation between the expression of USP9 and MAPT in the public transcriptomics data, we show that USP9 knockdown results in significantly decreased MAPT expression in a DU145 cell culture model and a concentration-dependent decrease for the MAPT orthologs mapta and maptb in a zebrafish model. From the analysis of microarray and qRT-PCR experiments for the knockdown in DU145 cells and prior knowledge from the literature, we derive a data-congruent model for a USP9-dependent regulatory mechanism modulating MAPT expression via BACH1 and SMAD4. Overall, the analyses suggest USP9 may contribute to molecular gender differences observed in tauopathies and provide a new target for intervention strategies to modulate MAPT expression.
See associated publication: http://link.springer.com/article/10.1007%2Fs12035-016-0299-z
GENE THERAPY
Gene therapy involves introducing genes into cells to treat or prevent disease. This document discusses using gene therapy to treat cancer by delivering the p53 tumor suppressor gene via an adenovirus vector. The adenovirus binds to receptors on cancer cells and injects the p53 gene into the nucleus. This gene then causes cancer cells to self-destruct without harming normal cells, potentially providing a treatment for cancers like liver cancer, lung cancer, and cancer of the lower lip.
Epigenetic regulation of cardiogenesis
Présentation de Michel Pucéat réalisée durant le cours du réseau international des instituts Pasteur de "Médecine Génomique: du diagnostic à la thérapie " (17-21 octobre 2016)
MCO 2011 - Slide 20 - R.A. Stahel - Spotlight session - New drugs in oncogeni...
MCO 2011 - Slide 20 - R.A. Stahel - Spotlight session - New drugs in oncogeni...European School of Oncology
Rolf Stahel presented a document on various oncogenic pathways and targeted therapies. The document discussed:
1) The ALK pathway and its role in cancers like NSCLC and neuroblastoma. Drugs like Crizotinib have shown responses in ALK-positive NSCLC.
2) The RET pathway's role in medullary thyroid cancer. Drugs like Vandetanib have shown responses in RET-mutated MTC.
3) The Hedgehog pathway's role in basal cell carcinoma and medulloblastoma. Inhibitors like GDC-0449 have induced responses in Hedgehog pathway-driven tumors.Proteus Syndrome Seminar
This study identified a mosaic activating mutation in the AKT1 gene associated with Proteus syndrome. Researchers sequenced DNA from tissue samples of 29 patients with Proteus syndrome and identified a recurrent somatic mutation, c.49G>A, in the AKT1 gene in 26 patients. This mutation leads to increased phosphorylation and activation of the AKT1 protein. Western blot analysis showed increased phosphorylation of AKT1 in tissues affected by Proteus syndrome. The findings link activation of the AKT1 signaling pathway through somatic mutations to overgrowth observed in Proteus syndrome patients.
Recommended
複製 Mitalipov
This document summarizes research on replacing the mitochondrial DNA (mtDNA) in human eggs to prevent inherited mtDNA diseases. Key points include:
- Over 700 mtDNA mutations can cause inherited diseases affecting thousands born each year in the US. Current treatments don't exist.
- Researchers developed a technique called spindle transfer to replace the entire mtDNA in an egg by transferring its nuclear DNA to a donor egg, eliminating future risk of transmission.
- Studies in monkey eggs and embryos showed very low levels of mutated mtDNA carryover and normal development. Similar success was found in human eggs and stem cell lines derived from resulting embryos.
- Ongoing clinical trials aim to use this technique to help families affected
Genomic oncology and personalized medicine
This document discusses genomic oncology and personalized medicine, using lung cancers as a model. It summarizes several key technologies that enable genomic oncology like cDNA microarrays, array CGH, and next generation sequencing. It provides examples of how these technologies have been used to classify cancers like diffuse large B-cell lymphoma and myelodysplastic syndrome, and identify genetic mutations that can guide targeted therapies for cancers like EGFR-mutated lung cancer.
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challeng...
I reviewed recent advances, challenges, and opportunities to implement clinical cancer genomics. Case studies of advanced systems, such as Foundation Medicine, MI-ONCOSEQ are introduced for benchmark. A few fundamental limitations to establish personalized oncology are also discussed.
Modelling gender-specific regulation of tau in Alzheimer’s disease
Public transcriptomic studies have shown that several genes display pronounced gender differences in their expression in the human brain, which may influence the manifestations and risk for neuronal disorders. Here, we apply a transcriptome-wide analysis to discover genes with gender-specific expression and significant alterations in public postmortem brain tissue from Alzheimer’s disease (AD) patients compared to controls. We identify the sex-linked ubiquitin-specific peptidase 9 (USP9) as an outstanding candidate gene with highly significant expression differences between the genders and male-specific underexpression in AD. Since previous studies have shown that USP9 can modulate the phosphorylation of the AD-associated protein MAPT, we investigate functional associations between USP9 and MAPT in further detail. After observing a high positive correlation between the expression of USP9 and MAPT in the public transcriptomics data, we show that USP9 knockdown results in significantly decreased MAPT expression in a DU145 cell culture model and a concentration-dependent decrease for the MAPT orthologs mapta and maptb in a zebrafish model. From the analysis of microarray and qRT-PCR experiments for the knockdown in DU145 cells and prior knowledge from the literature, we derive a data-congruent model for a USP9-dependent regulatory mechanism modulating MAPT expression via BACH1 and SMAD4. Overall, the analyses suggest USP9 may contribute to molecular gender differences observed in tauopathies and provide a new target for intervention strategies to modulate MAPT expression.
See associated publication: http://link.springer.com/article/10.1007%2Fs12035-016-0299-z
GENE THERAPY
Gene therapy involves introducing genes into cells to treat or prevent disease. This document discusses using gene therapy to treat cancer by delivering the p53 tumor suppressor gene via an adenovirus vector. The adenovirus binds to receptors on cancer cells and injects the p53 gene into the nucleus. This gene then causes cancer cells to self-destruct without harming normal cells, potentially providing a treatment for cancers like liver cancer, lung cancer, and cancer of the lower lip.
Epigenetic regulation of cardiogenesis
Présentation de Michel Pucéat réalisée durant le cours du réseau international des instituts Pasteur de "Médecine Génomique: du diagnostic à la thérapie " (17-21 octobre 2016)
MCO 2011 - Slide 20 - R.A. Stahel - Spotlight session - New drugs in oncogeni...
MCO 2011 - Slide 20 - R.A. Stahel - Spotlight session - New drugs in oncogeni...European School of Oncology
Rolf Stahel presented a document on various oncogenic pathways and targeted therapies. The document discussed:
1) The ALK pathway and its role in cancers like NSCLC and neuroblastoma. Drugs like Crizotinib have shown responses in ALK-positive NSCLC.
2) The RET pathway's role in medullary thyroid cancer. Drugs like Vandetanib have shown responses in RET-mutated MTC.
3) The Hedgehog pathway's role in basal cell carcinoma and medulloblastoma. Inhibitors like GDC-0449 have induced responses in Hedgehog pathway-driven tumors.Proteus Syndrome Seminar
This study identified a mosaic activating mutation in the AKT1 gene associated with Proteus syndrome. Researchers sequenced DNA from tissue samples of 29 patients with Proteus syndrome and identified a recurrent somatic mutation, c.49G>A, in the AKT1 gene in 26 patients. This mutation leads to increased phosphorylation and activation of the AKT1 protein. Western blot analysis showed increased phosphorylation of AKT1 in tissues affected by Proteus syndrome. The findings link activation of the AKT1 signaling pathway through somatic mutations to overgrowth observed in Proteus syndrome patients.
Solitary cerebral metastasis from undiagnosed prostate cancer. potential role...
Solitary cerebral metastasis from undiagnosed prostate cancer. potential role...Clinical Surgery Research Communications
This document describes a case of a 73-year-old man who presented with neurological symptoms and was found to have a brain lesion that was determined to be a solitary cerebral metastasis. Further investigation did not reveal the primary site. The patient underwent resection of the brain lesion, which was determined to be metastatic prostate cancer based on histopathology. Subsequent multiparametric MRI of the prostate revealed a lesion highly suggestive of prostate cancer. The document argues that multiparametric MRI of the prostate should be included in the diagnostic workup for patients presenting with cerebral metastases of unknown primary, as it may help identify occult prostate primary cancers earlier and guide more targeted treatment.Assessing the clinical utility of cancer genomic and proteomic data across tu...
This document summarizes a study that used machine learning to predict cancer patient survival based on integrating multiple types of molecular and clinical data from The Cancer Genome Atlas. The study found that combining molecular data like gene expression, methylation, and mutations with clinical data significantly improved survival prediction for kidney, ovarian, and lung cancers compared to using single data types alone. Analyzing the models provided biological insights into molecular subtypes and markers correlated with survival outcomes. The results suggest that more comprehensive molecular profiling of tumors could help stratify patients and identify targets for personalized cancer treatment.
Journal of Surgical Oncology - Barnabas
This study analyzed mutations in the von Hippel-Lindau (VHL) gene in 67 cases of renal cell carcinoma (RCC) to determine if VHL mutations could help distinguish between RCC subtypes. Single strand conformational polymorphism analysis and sequencing identified VHL mutations in RCC samples. Exon 3 mutations were found primarily in conventional (clear cell) RCC and correlated with more aggressive tumor phenotypes. Mutations were absent in papillary RCC and oncocytoma samples. VHL mutations were found to help distinguish conventional RCC from chromophobe RCC showing clear cells, serving as an adjunct to histological diagnosis of RCC subtypes.
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neutrophils. Lung tumors disrupt bone homeostasis and increase osteoblast activity and bone formation. Osteoblasts amplify tumor-associated SiglecFhigh neutrophils that promote tumor growth through angiogenesis, immunosuppression and other mechanisms. Serum from tumor-bearing mice increases osteoblast activity through elevated sRAGE, which stimulates neutrophil maturation. SiglecFhigh neutrophils correlate with poor survival in lung cancer patients. Therefore, lung tumors communicate with bone through factors like sRAGE to modulate osteoblasts and promote neutrophil-driven tumor progression.
Alternative lengthening of telomeres is enriched in, and impacts survival of ...
This study investigated the prevalence and significance of alternative lengthening of telomeres (ALT) in pediatric brain tumors. The researchers screened 517 pediatric brain tumor samples for ALT using the C-circle assay and validated the results with other assays. They found that ALT was detected in a subset of malignant pediatric brain tumors, especially primitive neuroectodermal tumors, choroid plexus carcinomas, and high-grade gliomas. Somatic mutations in TP53 were strongly associated with ALT. ALT attenuated the poor prognosis associated with TP53 mutations in some tumor types. ALT positive tumors had higher survival rates than ALT negative tumors for children with TP53 mutant malignant gliomas and choroid plexus carcinomas. This suggests ALT may impact survival
Roles of circular rn as and their interactions with micro rnas in human disor...
Roles of circular rn as and their interactions with micro rnas in human disor...Clinical Surgery Research Communications
Circular RNAs (circRNAs) are a class of non-coding RNAs that can regulate gene expression by interacting with microRNAs (miRNAs). This document reviews the roles of circRNAs in human disorders through circRNA-miRNA interactions. It discusses how specific circRNAs like CDR1as have been found to be dysregulated in neurological disorders, cancers, and cardiovascular diseases and can contribute to disease by sponging up certain miRNAs. The prospect of using circRNAs as biomarkers for disease diagnosis and prognosis is also mentioned.Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...
We performed the first proteogenomic study on a prospectively collected colon cancer cohort. Comparative proteomic and phosphoproteomic analysis of paired tumor and normal adjacent tissues produced a catalog of colon cancer-associated proteins and phosphosites, including known and putative new biomarkers, drug targets, and cancer/testis antigens. Proteogenomic integration not only prioritized genomically inferred targets, such as copy-number drivers and mutation-derived neoantigens, but also yielded novel findings. Phosphoproteomics data associated Rb phosphorylation with increased proliferation and decreased apoptosis in colon cancer, which explains why this classical tumor suppressor is amplified in colon tumors and suggests a rationale for targeting Rb phosphorylation in colon cancer. Proteomics identified an association between decreased CD8 T cell infiltration and increased glycolysis in microsatellite instability-high (MSI-H) tumors, suggesting glycolysis as a potential target to overcome the resistance of MSI-H tumors to immune checkpoint blockade. Proteogenomics presents new avenues for biological discoveries and therapeutic development.
The Laboratory Diagnosis Of Tuberous Sclerosis
The document summarizes the laboratory diagnosis of tuberous sclerosis through genetic testing. It discusses two genes, TSC1 and TSC2, that are associated with the disease. Mutation detection methods including multiplex ligation-dependent probe amplification and DNA sequencing are able to identify mutations in approximately 75% of cases. The summary also notes that comprehensive genetic testing still fails to find mutations in all patients.
Gene therapy
Gene therapy is an experimental technique that involves inserting a normal gene to replace a defective gene responsible for disease. It can replace a mutated disease-causing gene with a healthy copy or inactivate a mutated gene functioning improperly. Common diseases targeted include severe combined immunodeficiency, hemophilia, cystic fibrosis, hemoglobinopathies like thalassemia and sickle cell anemia, Parkinson's disease, and cancer. The first approved gene therapy case occurred in 1990 treating a girl with immune deficiency. Since then, gene therapy has been used to treat metastatic melanoma. Gene therapy can affect the germline permanently or somatic cells temporarily.
Mi r 139 inhibits proliferation, migration and invasion of osteosarcoma cell ...
Osteosarcoma is the most common type of bone cancer that occurs most often in children and adolescents. This study aims to reveal the mechanism of how miR-139 regulates osteosarcoma progression by targeting ITGAV. The expression of miR-139 and ITGAV were detected in osteosarcoma tissue samples using qRT-PCR and western blot. The effects of miR-139 and ITGAV on cell cycle were measured using flow cytometry. The results demonstrate that miR-139 inhibits osteosarcoma progression by targeting ITGAV.
Tuberous Sclerosis - Orrin Devinsky, MD
This document summarizes research on Tuberous Sclerosis Complex (TSC), including key facts about the disease, progress that has been made in understanding the genetics and molecular mechanisms, development of treatments like Everolimus, and ongoing areas of research focus like clinical trials of new drugs and studying disease mechanisms using cellular and animal models.
Monogenic Diseases
The document discusses two studies, one on cracking the genetic code of Huntington's disease which found that modifying protein structures could help reduce disease symptoms, and another finding that adding fat-soluble vitamins to antibiotics may help combat antibiotic resistance in cystic fibrosis patients by allowing the antibiotics to attack bacteria more effectively. A student comments that these strategies could provide alternatives to changing antibiotics and help develop treatments before severe symptoms appear.
A review of micro rn as related to the occurrence, diagnosis, and prognosis o...
A review of micro rn as related to the occurrence, diagnosis, and prognosis o...Clinical Surgery Research Communications
This document reviews microRNAs (miRNAs) related to the occurrence, diagnosis, and prognosis of non-small cell lung cancer (NSCLC). It discusses how some miRNAs act as oncogenes in NSCLC by promoting proliferation, migration, and invasion through targeting tumor suppressor genes. Other miRNAs act as tumor suppressors by inhibiting oncogenes. The expression levels of certain miRNAs have diagnostic and prognostic value for NSCLC. Some miRNAs show potential as biomarkers for early detection of NSCLC or for distinguishing NSCLC subtypes. Circulating miRNAs may also serve as biomarkers for cancer detection and prognosis. Single nucleotide polymorphisms in miRNA genes have been associated with survival in NSCLC patients.Seminario Biologia Molecular
The document discusses bone mesenchymal stem cell-derived extracellular vesicles (exosomes) encapsulated in thermosensitive hydrogels for accelerating osteogenesis and angiogenesis. Mesenchymal stem cells and exosomes released from them play an important role in bone formation. Laboratory techniques like western blot, immunofluorescence, and RT-qPCR were used to analyze protein expression and exosome uptake related to bone formation and angiogenesis. The investigation represents a breakthrough that could allow bone regeneration through exosome therapy and avoid more invasive procedures.
Gene therapy lecture_spring_2007
Gene therapy aims to manage and correct human diseases like cancer, AIDS, and inherited disorders. While promising advances have been made in DNA technology, the efficacy of gene therapy protocols has yet to be definitively proven due to insufficient understanding of vector-host interactions. Gene therapy works by delivering exogenous DNA using a viral vector to enable protein expression in target cells. However, barriers like the immune system and lysosomes can prevent successful gene transfer. While many clinical applications exist, such as for inherited monogenic disorders and infectious diseases, safety issues remain a challenge as evidenced by the death of the first patient to die from a gene therapy treatment.
MONOGENIC AND POLYGENIC DISEASES
This document discusses monogenic and polygenic diseases like cystic fibrosis and autism. It summarizes recent research that found fat-soluble vitamins may help antibiotics treat cystic fibrosis by preventing antibiotics from binding to proteins. A separate study identified 18 new autism-linked genes by analyzing the entire genomes of individuals, providing insight into autism's genetic causes and variability between patients. The research aims to improve treatment and quality of life for patients suffering from these hereditary conditions.
Analytical performance of a novel next generation sequencing assay for Myeloi...
Analytical performance of a novel next generation sequencing assay for Myeloi...Thermo Fisher Scientific
To support clinical and translational research into precision oncology strategies for myeloid cancers, a next-generation sequencing (NGS) assay was developed to detect common and relevant somatic alterations. To define gene targets that were recurrently altered in myeloid cancers and relevant for clinical and translational research, an extensive survey of investigators at hematology oncology research labs was performed.Subcutaneous Epstein-Barr Virus–Positive Diffuse Large B Cell Lymphoma Follow...
Subcutaneous Epstein-Barr Virus–Positive Diffuse Large B Cell Lymphoma Follow...ANALYTICAL AND QUANTITATIVE CYTOPATHOLOGY AND HISTOPATHOLOGY
BACKGROUND: Sequential Epstein-Barr virus (EBV)–positive B cell lymphoma to the initial diagnosis of angioimmunoblastic T cell lymphoma (AITL) is very rare, the exact mechanism and standard therapy of which is still being explored. CASE: A 50-year-old man was admitted to our hospital in January 2014 with a three-week history of enlargement of multiple lymph nodes. His initial pathological evaluation indicated AILT. The reactivation of EBV was observed during the immunosuppression therapy for AITL, accompanied by onset of subcutaneous nodules proven to be EBV-positive diffuse large B cell lymphoma (DLBCL) based on the pathological findings of rebiopsy. The patient was successfully treated with chidamide, a histone deacetylase (HDAC) inhibitor, and rituximab.
Conclusion: The sufficient surveillance for serum EBV and repeat biopsy is necessary for patients with AITL, and this treatment modality may become an active option.
Keywords: angioimmunoblastic T cell lymphoma, Epstein-Barr virus, HDAC inhibitor, non-Hodgkin lymphoma, peripheral T cell lymphomaApplications of gene therapy
Applications of gene therapy and potential disease targeted by gene therapy ( Basic Information about them)
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...Clinical Surgery Research Communications
1) The study investigated the role of the long non-coding RNA NNT-AS1 in progesterone resistance in endometrial cancer.
2) The researchers found that NNT-AS1 and survivin expression were increased, while miR-542-3p expression was decreased, in progesterone-resistant endometrial cancer cells.
3) Experiments showed that NNT-AS1 regulates progesterone resistance in endometrial cancer by functioning as a competing endogenous RNA for miR-542-3p, thereby regulating survivin expression.Next Generation Sequencing and its Applications in Medical Research - Frances...
The so-called “next-generation” sequencing (NGS) technologies allows us, in a short time and in parallel, to sequence massive amounts of DNA, overcoming the limitations of the original Sanger sequencing methods used to sequence the first human genome. NGS technologies have had an enormous impact on biomedical research within a short time frame. This talk will give an overview of these applications with specific examples from Mendelian genomics and cancer research. #h2ony
Open Source Pharma /Genomics and clinical practice / Prof Hosur
Genomics is increasingly being used in clinical practice to inform diagnosis and treatment. The document discusses several examples where genomics has identified disease-causing genes and mutations, leading to new treatments. It also describes methods for genome sequencing and variant calling. The author's studies on epilepsy found variants in genes related to brain function in drug-resistant epilepsy patients. A large number of variants were in the 3' UTR, suggesting expression level variations in these genes may cause epilepsy.
More Related Content
What's hot
Solitary cerebral metastasis from undiagnosed prostate cancer. potential role...
Solitary cerebral metastasis from undiagnosed prostate cancer. potential role...Clinical Surgery Research Communications
This document describes a case of a 73-year-old man who presented with neurological symptoms and was found to have a brain lesion that was determined to be a solitary cerebral metastasis. Further investigation did not reveal the primary site. The patient underwent resection of the brain lesion, which was determined to be metastatic prostate cancer based on histopathology. Subsequent multiparametric MRI of the prostate revealed a lesion highly suggestive of prostate cancer. The document argues that multiparametric MRI of the prostate should be included in the diagnostic workup for patients presenting with cerebral metastases of unknown primary, as it may help identify occult prostate primary cancers earlier and guide more targeted treatment.Assessing the clinical utility of cancer genomic and proteomic data across tu...
This document summarizes a study that used machine learning to predict cancer patient survival based on integrating multiple types of molecular and clinical data from The Cancer Genome Atlas. The study found that combining molecular data like gene expression, methylation, and mutations with clinical data significantly improved survival prediction for kidney, ovarian, and lung cancers compared to using single data types alone. Analyzing the models provided biological insights into molecular subtypes and markers correlated with survival outcomes. The results suggest that more comprehensive molecular profiling of tumors could help stratify patients and identify targets for personalized cancer treatment.
Journal of Surgical Oncology - Barnabas
This study analyzed mutations in the von Hippel-Lindau (VHL) gene in 67 cases of renal cell carcinoma (RCC) to determine if VHL mutations could help distinguish between RCC subtypes. Single strand conformational polymorphism analysis and sequencing identified VHL mutations in RCC samples. Exon 3 mutations were found primarily in conventional (clear cell) RCC and correlated with more aggressive tumor phenotypes. Mutations were absent in papillary RCC and oncocytoma samples. VHL mutations were found to help distinguish conventional RCC from chromophobe RCC showing clear cells, serving as an adjunct to histological diagnosis of RCC subtypes.
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neutrophils. Lung tumors disrupt bone homeostasis and increase osteoblast activity and bone formation. Osteoblasts amplify tumor-associated SiglecFhigh neutrophils that promote tumor growth through angiogenesis, immunosuppression and other mechanisms. Serum from tumor-bearing mice increases osteoblast activity through elevated sRAGE, which stimulates neutrophil maturation. SiglecFhigh neutrophils correlate with poor survival in lung cancer patients. Therefore, lung tumors communicate with bone through factors like sRAGE to modulate osteoblasts and promote neutrophil-driven tumor progression.
Alternative lengthening of telomeres is enriched in, and impacts survival of ...
This study investigated the prevalence and significance of alternative lengthening of telomeres (ALT) in pediatric brain tumors. The researchers screened 517 pediatric brain tumor samples for ALT using the C-circle assay and validated the results with other assays. They found that ALT was detected in a subset of malignant pediatric brain tumors, especially primitive neuroectodermal tumors, choroid plexus carcinomas, and high-grade gliomas. Somatic mutations in TP53 were strongly associated with ALT. ALT attenuated the poor prognosis associated with TP53 mutations in some tumor types. ALT positive tumors had higher survival rates than ALT negative tumors for children with TP53 mutant malignant gliomas and choroid plexus carcinomas. This suggests ALT may impact survival
Roles of circular rn as and their interactions with micro rnas in human disor...
Roles of circular rn as and their interactions with micro rnas in human disor...Clinical Surgery Research Communications
Circular RNAs (circRNAs) are a class of non-coding RNAs that can regulate gene expression by interacting with microRNAs (miRNAs). This document reviews the roles of circRNAs in human disorders through circRNA-miRNA interactions. It discusses how specific circRNAs like CDR1as have been found to be dysregulated in neurological disorders, cancers, and cardiovascular diseases and can contribute to disease by sponging up certain miRNAs. The prospect of using circRNAs as biomarkers for disease diagnosis and prognosis is also mentioned.Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...
We performed the first proteogenomic study on a prospectively collected colon cancer cohort. Comparative proteomic and phosphoproteomic analysis of paired tumor and normal adjacent tissues produced a catalog of colon cancer-associated proteins and phosphosites, including known and putative new biomarkers, drug targets, and cancer/testis antigens. Proteogenomic integration not only prioritized genomically inferred targets, such as copy-number drivers and mutation-derived neoantigens, but also yielded novel findings. Phosphoproteomics data associated Rb phosphorylation with increased proliferation and decreased apoptosis in colon cancer, which explains why this classical tumor suppressor is amplified in colon tumors and suggests a rationale for targeting Rb phosphorylation in colon cancer. Proteomics identified an association between decreased CD8 T cell infiltration and increased glycolysis in microsatellite instability-high (MSI-H) tumors, suggesting glycolysis as a potential target to overcome the resistance of MSI-H tumors to immune checkpoint blockade. Proteogenomics presents new avenues for biological discoveries and therapeutic development.
The Laboratory Diagnosis Of Tuberous Sclerosis
The document summarizes the laboratory diagnosis of tuberous sclerosis through genetic testing. It discusses two genes, TSC1 and TSC2, that are associated with the disease. Mutation detection methods including multiplex ligation-dependent probe amplification and DNA sequencing are able to identify mutations in approximately 75% of cases. The summary also notes that comprehensive genetic testing still fails to find mutations in all patients.
Gene therapy
Gene therapy is an experimental technique that involves inserting a normal gene to replace a defective gene responsible for disease. It can replace a mutated disease-causing gene with a healthy copy or inactivate a mutated gene functioning improperly. Common diseases targeted include severe combined immunodeficiency, hemophilia, cystic fibrosis, hemoglobinopathies like thalassemia and sickle cell anemia, Parkinson's disease, and cancer. The first approved gene therapy case occurred in 1990 treating a girl with immune deficiency. Since then, gene therapy has been used to treat metastatic melanoma. Gene therapy can affect the germline permanently or somatic cells temporarily.
Mi r 139 inhibits proliferation, migration and invasion of osteosarcoma cell ...
Osteosarcoma is the most common type of bone cancer that occurs most often in children and adolescents. This study aims to reveal the mechanism of how miR-139 regulates osteosarcoma progression by targeting ITGAV. The expression of miR-139 and ITGAV were detected in osteosarcoma tissue samples using qRT-PCR and western blot. The effects of miR-139 and ITGAV on cell cycle were measured using flow cytometry. The results demonstrate that miR-139 inhibits osteosarcoma progression by targeting ITGAV.
Tuberous Sclerosis - Orrin Devinsky, MD
This document summarizes research on Tuberous Sclerosis Complex (TSC), including key facts about the disease, progress that has been made in understanding the genetics and molecular mechanisms, development of treatments like Everolimus, and ongoing areas of research focus like clinical trials of new drugs and studying disease mechanisms using cellular and animal models.
Monogenic Diseases
The document discusses two studies, one on cracking the genetic code of Huntington's disease which found that modifying protein structures could help reduce disease symptoms, and another finding that adding fat-soluble vitamins to antibiotics may help combat antibiotic resistance in cystic fibrosis patients by allowing the antibiotics to attack bacteria more effectively. A student comments that these strategies could provide alternatives to changing antibiotics and help develop treatments before severe symptoms appear.
A review of micro rn as related to the occurrence, diagnosis, and prognosis o...
A review of micro rn as related to the occurrence, diagnosis, and prognosis o...Clinical Surgery Research Communications
This document reviews microRNAs (miRNAs) related to the occurrence, diagnosis, and prognosis of non-small cell lung cancer (NSCLC). It discusses how some miRNAs act as oncogenes in NSCLC by promoting proliferation, migration, and invasion through targeting tumor suppressor genes. Other miRNAs act as tumor suppressors by inhibiting oncogenes. The expression levels of certain miRNAs have diagnostic and prognostic value for NSCLC. Some miRNAs show potential as biomarkers for early detection of NSCLC or for distinguishing NSCLC subtypes. Circulating miRNAs may also serve as biomarkers for cancer detection and prognosis. Single nucleotide polymorphisms in miRNA genes have been associated with survival in NSCLC patients.Seminario Biologia Molecular
The document discusses bone mesenchymal stem cell-derived extracellular vesicles (exosomes) encapsulated in thermosensitive hydrogels for accelerating osteogenesis and angiogenesis. Mesenchymal stem cells and exosomes released from them play an important role in bone formation. Laboratory techniques like western blot, immunofluorescence, and RT-qPCR were used to analyze protein expression and exosome uptake related to bone formation and angiogenesis. The investigation represents a breakthrough that could allow bone regeneration through exosome therapy and avoid more invasive procedures.
Gene therapy lecture_spring_2007
Gene therapy aims to manage and correct human diseases like cancer, AIDS, and inherited disorders. While promising advances have been made in DNA technology, the efficacy of gene therapy protocols has yet to be definitively proven due to insufficient understanding of vector-host interactions. Gene therapy works by delivering exogenous DNA using a viral vector to enable protein expression in target cells. However, barriers like the immune system and lysosomes can prevent successful gene transfer. While many clinical applications exist, such as for inherited monogenic disorders and infectious diseases, safety issues remain a challenge as evidenced by the death of the first patient to die from a gene therapy treatment.
MONOGENIC AND POLYGENIC DISEASES
This document discusses monogenic and polygenic diseases like cystic fibrosis and autism. It summarizes recent research that found fat-soluble vitamins may help antibiotics treat cystic fibrosis by preventing antibiotics from binding to proteins. A separate study identified 18 new autism-linked genes by analyzing the entire genomes of individuals, providing insight into autism's genetic causes and variability between patients. The research aims to improve treatment and quality of life for patients suffering from these hereditary conditions.
Analytical performance of a novel next generation sequencing assay for Myeloi...
Analytical performance of a novel next generation sequencing assay for Myeloi...Thermo Fisher Scientific
To support clinical and translational research into precision oncology strategies for myeloid cancers, a next-generation sequencing (NGS) assay was developed to detect common and relevant somatic alterations. To define gene targets that were recurrently altered in myeloid cancers and relevant for clinical and translational research, an extensive survey of investigators at hematology oncology research labs was performed.Subcutaneous Epstein-Barr Virus–Positive Diffuse Large B Cell Lymphoma Follow...
Subcutaneous Epstein-Barr Virus–Positive Diffuse Large B Cell Lymphoma Follow...ANALYTICAL AND QUANTITATIVE CYTOPATHOLOGY AND HISTOPATHOLOGY
BACKGROUND: Sequential Epstein-Barr virus (EBV)–positive B cell lymphoma to the initial diagnosis of angioimmunoblastic T cell lymphoma (AITL) is very rare, the exact mechanism and standard therapy of which is still being explored. CASE: A 50-year-old man was admitted to our hospital in January 2014 with a three-week history of enlargement of multiple lymph nodes. His initial pathological evaluation indicated AILT. The reactivation of EBV was observed during the immunosuppression therapy for AITL, accompanied by onset of subcutaneous nodules proven to be EBV-positive diffuse large B cell lymphoma (DLBCL) based on the pathological findings of rebiopsy. The patient was successfully treated with chidamide, a histone deacetylase (HDAC) inhibitor, and rituximab.
Conclusion: The sufficient surveillance for serum EBV and repeat biopsy is necessary for patients with AITL, and this treatment modality may become an active option.
Keywords: angioimmunoblastic T cell lymphoma, Epstein-Barr virus, HDAC inhibitor, non-Hodgkin lymphoma, peripheral T cell lymphomaApplications of gene therapy
Applications of gene therapy and potential disease targeted by gene therapy ( Basic Information about them)
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...Clinical Surgery Research Communications
1) The study investigated the role of the long non-coding RNA NNT-AS1 in progesterone resistance in endometrial cancer.
2) The researchers found that NNT-AS1 and survivin expression were increased, while miR-542-3p expression was decreased, in progesterone-resistant endometrial cancer cells.
3) Experiments showed that NNT-AS1 regulates progesterone resistance in endometrial cancer by functioning as a competing endogenous RNA for miR-542-3p, thereby regulating survivin expression.What's hot (20)
Solitary cerebral metastasis from undiagnosed prostate cancer. potential role...
Solitary cerebral metastasis from undiagnosed prostate cancer. potential role...
Assessing the clinical utility of cancer genomic and proteomic data across tu...
Assessing the clinical utility of cancer genomic and proteomic data across tu...
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...
Alternative lengthening of telomeres is enriched in, and impacts survival of ...
Alternative lengthening of telomeres is enriched in, and impacts survival of ...
Roles of circular rn as and their interactions with micro rnas in human disor...
Roles of circular rn as and their interactions with micro rnas in human disor...
Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...
Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...
Mi r 139 inhibits proliferation, migration and invasion of osteosarcoma cell ...
Mi r 139 inhibits proliferation, migration and invasion of osteosarcoma cell ...
A review of micro rn as related to the occurrence, diagnosis, and prognosis o...
A review of micro rn as related to the occurrence, diagnosis, and prognosis o...
Analytical performance of a novel next generation sequencing assay for Myeloi...
Analytical performance of a novel next generation sequencing assay for Myeloi...
Subcutaneous Epstein-Barr Virus–Positive Diffuse Large B Cell Lymphoma Follow...
Subcutaneous Epstein-Barr Virus–Positive Diffuse Large B Cell Lymphoma Follow...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Similar to Dr Nicholas Shackel - Bioinformatics and Personalised Medicine
Next Generation Sequencing and its Applications in Medical Research - Frances...
The so-called “next-generation” sequencing (NGS) technologies allows us, in a short time and in parallel, to sequence massive amounts of DNA, overcoming the limitations of the original Sanger sequencing methods used to sequence the first human genome. NGS technologies have had an enormous impact on biomedical research within a short time frame. This talk will give an overview of these applications with specific examples from Mendelian genomics and cancer research. #h2ony
Open Source Pharma /Genomics and clinical practice / Prof Hosur
Genomics is increasingly being used in clinical practice to inform diagnosis and treatment. The document discusses several examples where genomics has identified disease-causing genes and mutations, leading to new treatments. It also describes methods for genome sequencing and variant calling. The author's studies on epilepsy found variants in genes related to brain function in drug-resistant epilepsy patients. A large number of variants were in the 3' UTR, suggesting expression level variations in these genes may cause epilepsy.
Cancer Res-2015-Bonastre-1287-97
This document discusses the role of the cell polarity regulator PARD3 in lung squamous cell carcinomas (LSCC). The key points are:
1. PARD3 was found to be somatically and biallelically inactivated through mutations, deletions, and promoter hypermethylation in 8% of examined LSCC tumors and cell lines. Most alterations resulted in truncated or non-functional PARD3 proteins.
2. Reconstitution of normal PAR3 activity in vivo reduced the invasive and metastatic properties of tumors, suggesting PARD3 acts as a tumor suppressor in LSCC.
3. PARD3 alterations prevented the formation of tight junctions between cells and the downstream signaling of STAT
04 rencontres biomédicale LIR Philippe Froguel
1. Advances in human genomics research have identified over 800 genetic loci associated with common diseases like type 2 diabetes through genome-wide association studies and candidate gene studies.
2. Further research has found that most type 2 diabetes genes identified play a role in pancreatic beta-cell function, and that both frequent and rare genetic variants contribute to disease risk.
3. Integrating human genomics with metabolic medicine offers advantages for personalized healthcare, including identifying new drug targets, predicting drug responses and side effects, improving clinical trial design, and enabling more optimized long-term patient care.
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...European School of Oncology
The document summarizes a presentation on using gene profiling and biomarkers to better classify and treat non-small cell lung cancer (NSCLC). It discusses current and emerging markers like EGFR mutations, ALK translocations, and FGFR1 amplifications that define NSCLC subtypes and can guide targeted therapies. Integrating multiple genomic analyses may help characterize unknown abnormalities in a third of NSCLC tumors and identify new treatment opportunities.全人關懷獎的簡報
This document provides personal and professional information about Dr. Teh-Ying Chou. It summarizes her educational background, current positions, work experience, research interests and topics. Her research focuses on the pathobiology of lung diseases, including studies on EGFR mutations in lung cancer patients treated with gefitinib, genetic profiling of in situ and invasive lung adenocarcinomas, and the role of Clusterin in epithelial-mesenchymal transitions and metastasis of lung cancer cells. She has published papers on biomarkers for acute respiratory distress syndrome outcomes and the predictive value of EGFR mutations for gefitinib treatment responses in lung cancer.
Molecular techniques for pathology research - MDX .pdf
This document discusses molecular techniques used in pathology research such as PCR, microarrays, next generation sequencing, immunohistochemistry, ELISA, and Western blotting. It provides details on each technique including the basic principles, applications in research, and examples of uses in studies of gene expression, cancer, bone disease, and growth retardation. The learning outcomes are to understand these techniques and their uses in basic and clinical research.
Circ ldlrad3 regulates cell proliferation, migration and invasion of pancreat...
Circ ldlrad3 regulates cell proliferation, migration and invasion of pancreat...Clinical Surgery Research Communications
1) The study found that circ-LDLRAD3, STAT3 expression were upregulated while miR-876-3p expression was downregulated in pancreatic cancer tissues and cell lines compared to normal tissues/cells.
2) Knockdown of circ-LDLRAD3 suppressed pancreatic cancer cell proliferation, migration, and invasion.
3) Mechanistically, circ-LDLRAD3 was found to directly regulate miR-876-3p expression, and miR-876-3p targets STAT3. Downregulation of circ-LDLRAD3 inhibited cell proliferation, invasion and migration by regulating the miR-876-3p/STAT3 axis.TRIM 47 accelerates aerobic glycolysis and tumor progression through regulati...
TRIM 47 accelerates aerobic glycolysis and tumor progression through regulati...MariaFernandaMazoPar
This document summarizes key aspects of pancreatic cancer. It begins by defining the pancreas and describing the two main types of pancreatic cancer - adenocarcinoma and neuroendocrine tumors. Adenocarcinoma accounts for about 95% of pancreatic cancers. Current treatment options for pancreatic cancer are then outlined, including surgery, radiation therapy, chemotherapy, targeted therapy, and immunotherapy. The document also provides brief descriptions of two genes - FBP1 and TRIM47 - that are relevant to pancreatic cancer. It concludes by stating that ubiquitination plays a vital role in pancreatic cancer pathogenesis and targeting ubiquitination regulation could be a potential treatment approach.Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...European School of Oncology
The document summarizes key information from a conference on gene profiling in clinical oncology, including:
1) New markers such as EGFR, KRAS, ALK, HER2, and PI3K mutations are defining subsets of non-small cell lung cancer and informing targeted therapy approaches.
2) Drugs like erlotinib, gefitinib, and crizotinib, which target EGFR, ALK, and c-MET mutations respectively, have shown efficacy in molecularly selected patient populations.
3) Comprehensive genomic profiling of lung tumors is needed to discover new targets, as around a third of cases still have unknown driver mutations.Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Giovanni Martinelli, PhD
Associate Professor of Haematology, Institute of Haematology and Medical Oncology, University of Bologna, Italy
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...BioMedSciDirect Publications
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articlesAdenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...BioMedSciDirect Publications
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717 "Rare diseases as platform to develop novel therapeutic strategies: the examp...
"Rare diseases as platform to develop novel therapeutic strategies: the examp...Vall d'Hebron Institute of Research (VHIR)
La recerca bàsica i traslacional en malalties rares és fonamental per entendre la fisiologia humana i per desenvolupar teràpies innovadores sovint útils també per malalties molt més prevalents. L’anèmia de Fanconi, caracteritzada per disfunció de la medul·la òssia i predisposició tumoral, n’és un exemple edificant. El primer transplantament de cordó umbilical de la història de la medicina fou en un pacient Fanconi. El primer nen medicament va néixer per curar un pacient Fanconi. El primer cop que s’han generat teixits sans per auto-transplantament curant, desprogramant i re-diferenciant cèl·lules de la pell d’un malalt ha estat en anèmia de Fanconi. I els primers assajos clínics de teràpia gènica s’estan desenvolupat també en malalties de la sang com l’anèmia de Fanconi. Aquests són alguns exemples de com l’estudi de malalties rares por transcendir més enllà del pacient afecte en benefici de tota la societat.508 search for genomic and proteomic risk factors and protective factors asso...
508 search for genomic and proteomic risk factors and protective factors asso...Society for Heart Attack Prevention and Eradication
1. The study aims to identify genomic and proteomic risk and protective factors for coronary heart disease by analyzing gene and protein expression profiles in blood cells from patients with and without heart disease and associated risk factors.
2. Blood samples will be collected from five patient groups and mRNA will be isolated from monocytes and neutrophils for analysis using DNA microarrays and suppression subtractive hybridization.
3. Differentially expressed genes will be confirmed with real-time PCR and protein expression analyzed using in situ hybridization and immunochemistry to help identify new diagnostic and therapeutic targets for coronary heart disease.508 search for genomic and proteomic risk factors and protective factors asso...
1. This study aims to identify genomic and proteomic risk factors and protective factors associated with coronary heart disease by analyzing gene and protein expression profiles in blood cells from patients with and without heart disease.
2. The study will recruit patients aged 18-80 categorized into five groups based on having heart disease and traditional risk factors. Gene expression in monocytes and neutrophils will be analyzed using microarray technology and real-time PCR.
3. Differentially expressed genes will be identified by comparing expression profiles between patient groups to uncover new diagnostic markers and therapeutic targets for coronary heart disease.
The Cancer Genome Atlas Update
Presentation by Scott Woodman, MD, PhD. Presented at the 2018 Eyes on a Cure: Patient & Caregiver Symposium, hosted by the Melanoma Research Foundation's CURE OM initiative.
Journal Club- Urinary cell mRNA profile and acute cellular rejection
A three-gene urinary cell mRNA signature including CD3ε, IP-10, and 18S rRNA can diagnose and predict acute cellular rejection in kidney transplants. In a study of 485 kidney transplant recipients, urinary mRNA levels distinguished acute cellular rejection from other conditions with 71-79% sensitivity and 72-78% specificity. Elevated signature levels weeks before a biopsy showing rejection indicate potential for preemptive therapy. The signature was also associated with future graft dysfunction. However, the study had limitations including missing biopsy-matched urine samples and small numbers of antibody-mediated rejections.
NY Prostate Cancer Conference - S. Stone - Session 1: Cell cycle progression ...
NY Prostate Cancer Conference - S. Stone - Session 1: Cell cycle progression ...European School of Oncology
The study found that a cell cycle progression (CCP) gene expression signature can differentiate indolent from aggressive prostate cancer and provide prognostic information beyond standard clinical parameters. Specifically:
1) Higher CCP scores, indicating more actively dividing cells, were associated with increased risk of biochemical recurrence after prostatectomy and death from prostate cancer in a conservatively managed cohort.
2) The CCP score was a strong univariate predictor of outcome and added significant prognostic information when combined with clinical factors like PSA and Gleason score in multivariate analyses.
3) The CCP score was robust across different patient populations and clinical settings and may help physicians select optimal treatment strategies at diagnosis.Medicine of the Future—The Transformation from Reactive to Proactive (P4) Med...
Medicine of the Future—The Transformation from Reactive to Proactive (P4) Medicine as presented at the Ohio State University Medical Center Personalized Health Care National Conference.
Leroy Hood, MD, PhD, is the president and founder of the Institute of Systems Biology. Dr. Hood is a member of the National Academy of Sciences, the American Philosophical Society, the American Academy of Arts and Sciences, the Institute of Medicine and the National Academy of Engineering. His professional career began at Caltech where he and his colleagues pioneered four instruments — the DNA gene sequencer and synthesizer and the protein synthesizer and sequencer — which comprise the technological foundation for contemporary molecular biology. In particular, the DNA sequencer played a crucial role in contributing to the successful mapping of the human genome during the 1990s.
http://www.systemsbiology.org/Scientists_and_Research
Similar to Dr Nicholas Shackel - Bioinformatics and Personalised Medicine (20)
Next Generation Sequencing and its Applications in Medical Research - Frances...
Next Generation Sequencing and its Applications in Medical Research - Frances...
Open Source Pharma /Genomics and clinical practice / Prof Hosur
Open Source Pharma /Genomics and clinical practice / Prof Hosur
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Molecular techniques for pathology research - MDX .pdf
Molecular techniques for pathology research - MDX .pdf
Circ ldlrad3 regulates cell proliferation, migration and invasion of pancreat...
Circ ldlrad3 regulates cell proliferation, migration and invasion of pancreat...
TRIM 47 accelerates aerobic glycolysis and tumor progression through regulati...
TRIM 47 accelerates aerobic glycolysis and tumor progression through regulati...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
"Rare diseases as platform to develop novel therapeutic strategies: the examp...
"Rare diseases as platform to develop novel therapeutic strategies: the examp...
508 search for genomic and proteomic risk factors and protective factors asso...
508 search for genomic and proteomic risk factors and protective factors asso...
508 search for genomic and proteomic risk factors and protective factors asso...
508 search for genomic and proteomic risk factors and protective factors asso...
Journal Club- Urinary cell mRNA profile and acute cellular rejection
Journal Club- Urinary cell mRNA profile and acute cellular rejection
NY Prostate Cancer Conference - S. Stone - Session 1: Cell cycle progression ...
NY Prostate Cancer Conference - S. Stone - Session 1: Cell cycle progression ...
Medicine of the Future—The Transformation from Reactive to Proactive (P4) Med...
Medicine of the Future—The Transformation from Reactive to Proactive (P4) Med...
Recently uploaded
National Security Agency - NSA mobile device best practices
Threats to mobile devices are more prevalent and increasing in scope and complexity. Users of mobile devices desire to take full advantage of the features
available on those devices, but many of the features provide convenience and capability but sacrifice security. This best practices guide outlines steps the users can take to better protect personal devices and information.
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
Dr. Sean Tan, Head of Data Science, Changi Airport Group
Discover how Changi Airport Group (CAG) leverages graph technologies and generative AI to revolutionize their search capabilities. This session delves into the unique search needs of CAG’s diverse passengers and customers, showcasing how graph data structures enhance the accuracy and relevance of AI-generated search results, mitigating the risk of “hallucinations” and improving the overall customer journey.
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
Sudheer Mechineni, Head of Application Frameworks, Standard Chartered Bank
Discover how Standard Chartered Bank harnessed the power of Neo4j to transform complex data access challenges into a dynamic, scalable graph database solution. This keynote will cover their journey from initial adoption to deploying a fully automated, enterprise-grade causal cluster, highlighting key strategies for modelling organisational changes and ensuring robust disaster recovery. Learn how these innovations have not only enhanced Standard Chartered Bank’s data infrastructure but also positioned them as pioneers in the banking sector’s adoption of graph technology.
Pushing the limits of ePRTC: 100ns holdover for 100 days
At WSTS 2024, Alon Stern explored the topic of parametric holdover and explained how recent research findings can be implemented in real-world PNT networks to achieve 100 nanoseconds of accuracy for up to 100 days.
Microsoft - Power Platform_G.Aspiotis.pdf
Revolutionizing Application Development
with AI-powered low-code, presentation by George Aspiotis, Sr. Partner Development Manager, Microsoft
Mind map of terminologies used in context of Generative AI
Mind map of common terms used in context of Generative AI.
Removing Uninteresting Bytes in Software Fuzzing
Imagine a world where software fuzzing, the process of mutating bytes in test seeds to uncover hidden and erroneous program behaviors, becomes faster and more effective. A lot depends on the initial seeds, which can significantly dictate the trajectory of a fuzzing campaign, particularly in terms of how long it takes to uncover interesting behaviour in your code. We introduce DIAR, a technique designed to speedup fuzzing campaigns by pinpointing and eliminating those uninteresting bytes in the seeds. Picture this: instead of wasting valuable resources on meaningless mutations in large, bloated seeds, DIAR removes the unnecessary bytes, streamlining the entire process.
In this work, we equipped AFL, a popular fuzzer, with DIAR and examined two critical Linux libraries -- Libxml's xmllint, a tool for parsing xml documents, and Binutil's readelf, an essential debugging and security analysis command-line tool used to display detailed information about ELF (Executable and Linkable Format). Our preliminary results show that AFL+DIAR does not only discover new paths more quickly but also achieves higher coverage overall. This work thus showcases how starting with lean and optimized seeds can lead to faster, more comprehensive fuzzing campaigns -- and DIAR helps you find such seeds.
- These are slides of the talk given at IEEE International Conference on Software Testing Verification and Validation Workshop, ICSTW 2022.
Best 20 SEO Techniques To Improve Website Visibility In SERP
Boost your website's visibility with proven SEO techniques! Our latest blog dives into essential strategies to enhance your online presence, increase traffic, and rank higher on search engines. From keyword optimization to quality content creation, learn how to make your site stand out in the crowded digital landscape. Discover actionable tips and expert insights to elevate your SEO game.
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
Maruthi Prithivirajan, Head of ASEAN & IN Solution Architecture, Neo4j
Get an inside look at the latest Neo4j innovations that enable relationship-driven intelligence at scale. Learn more about the newest cloud integrations and product enhancements that make Neo4j an essential choice for developers building apps with interconnected data and generative AI.
Driving Business Innovation: Latest Generative AI Advancements & Success Story
Are you ready to revolutionize how you handle data? Join us for a webinar where we’ll bring you up to speed with the latest advancements in Generative AI technology and discover how leveraging FME with tools from giants like Google Gemini, Amazon, and Microsoft OpenAI can supercharge your workflow efficiency.
During the hour, we’ll take you through:
Guest Speaker Segment with Hannah Barrington: Dive into the world of dynamic real estate marketing with Hannah, the Marketing Manager at Workspace Group. Hear firsthand how their team generates engaging descriptions for thousands of office units by integrating diverse data sources—from PDF floorplans to web pages—using FME transformers, like OpenAIVisionConnector and AnthropicVisionConnector. This use case will show you how GenAI can streamline content creation for marketing across the board.
Ollama Use Case: Learn how Scenario Specialist Dmitri Bagh has utilized Ollama within FME to input data, create custom models, and enhance security protocols. This segment will include demos to illustrate the full capabilities of FME in AI-driven processes.
Custom AI Models: Discover how to leverage FME to build personalized AI models using your data. Whether it’s populating a model with local data for added security or integrating public AI tools, find out how FME facilitates a versatile and secure approach to AI.
We’ll wrap up with a live Q&A session where you can engage with our experts on your specific use cases, and learn more about optimizing your data workflows with AI.
This webinar is ideal for professionals seeking to harness the power of AI within their data management systems while ensuring high levels of customization and security. Whether you're a novice or an expert, gain actionable insights and strategies to elevate your data processes. Join us to see how FME and AI can revolutionize how you work with data!
Infrastructure Challenges in Scaling RAG with Custom AI models
Building Retrieval-Augmented Generation (RAG) systems with open-source and custom AI models is a complex task. This talk explores the challenges in productionizing RAG systems, including retrieval performance, response synthesis, and evaluation. We’ll discuss how to leverage open-source models like text embeddings, language models, and custom fine-tuned models to enhance RAG performance. Additionally, we’ll cover how BentoML can help orchestrate and scale these AI components efficiently, ensuring seamless deployment and management of RAG systems in the cloud.
Climate Impact of Software Testing at Nordic Testing Days
My slides at Nordic Testing Days 6.6.2024
Climate impact / sustainability of software testing discussed on the talk. ICT and testing must carry their part of global responsibility to help with the climat warming. We can minimize the carbon footprint but we can also have a carbon handprint, a positive impact on the climate. Quality characteristics can be added with sustainability, and then measured continuously. Test environments can be used less, and in smaller scale and on demand. Test techniques can be used in optimizing or minimizing number of tests. Test automation can be used to speed up testing.
Building Production Ready Search Pipelines with Spark and Milvus
Spark is the widely used ETL tool for processing, indexing and ingesting data to serving stack for search. Milvus is the production-ready open-source vector database. In this talk we will show how to use Spark to process unstructured data to extract vector representations, and push the vectors to Milvus vector database for search serving.
“I’m still / I’m still / Chaining from the Block”
“An Outlook of the Ongoing and Future Relationship between Blockchain Technologies and Process-aware Information Systems.” Invited talk at the joint workshop on Blockchain for Information Systems (BC4IS) and Blockchain for Trusted Data Sharing (B4TDS), co-located with with the 36th International Conference on Advanced Information Systems Engineering (CAiSE), 3 June 2024, Limassol, Cyprus.
HCL Notes and Domino License Cost Reduction in the World of DLAU
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-and-domino-license-cost-reduction-in-the-world-of-dlau/
The introduction of DLAU and the CCB & CCX licensing model caused quite a stir in the HCL community. As a Notes and Domino customer, you may have faced challenges with unexpected user counts and license costs. You probably have questions on how this new licensing approach works and how to benefit from it. Most importantly, you likely have budget constraints and want to save money where possible. Don’t worry, we can help with all of this!
We’ll show you how to fix common misconfigurations that cause higher-than-expected user counts, and how to identify accounts which you can deactivate to save money. There are also frequent patterns that can cause unnecessary cost, like using a person document instead of a mail-in for shared mailboxes. We’ll provide examples and solutions for those as well. And naturally we’ll explain the new licensing model.
Join HCL Ambassador Marc Thomas in this webinar with a special guest appearance from Franz Walder. It will give you the tools and know-how to stay on top of what is going on with Domino licensing. You will be able lower your cost through an optimized configuration and keep it low going forward.
These topics will be covered
- Reducing license cost by finding and fixing misconfigurations and superfluous accounts
- How do CCB and CCX licenses really work?
- Understanding the DLAU tool and how to best utilize it
- Tips for common problem areas, like team mailboxes, functional/test users, etc
- Practical examples and best practices to implement right away
UiPath Test Automation using UiPath Test Suite series, part 6
Welcome to UiPath Test Automation using UiPath Test Suite series part 6. In this session, we will cover Test Automation with generative AI and Open AI.
UiPath Test Automation with generative AI and Open AI webinar offers an in-depth exploration of leveraging cutting-edge technologies for test automation within the UiPath platform. Attendees will delve into the integration of generative AI, a test automation solution, with Open AI advanced natural language processing capabilities.
Throughout the session, participants will discover how this synergy empowers testers to automate repetitive tasks, enhance testing accuracy, and expedite the software testing life cycle. Topics covered include the seamless integration process, practical use cases, and the benefits of harnessing AI-driven automation for UiPath testing initiatives. By attending this webinar, testers, and automation professionals can gain valuable insights into harnessing the power of AI to optimize their test automation workflows within the UiPath ecosystem, ultimately driving efficiency and quality in software development processes.
What will you get from this session?
1. Insights into integrating generative AI.
2. Understanding how this integration enhances test automation within the UiPath platform
3. Practical demonstrations
4. Exploration of real-world use cases illustrating the benefits of AI-driven test automation for UiPath
Topics covered:
What is generative AI
Test Automation with generative AI and Open AI.
UiPath integration with generative AI
Speaker:
Deepak Rai, Automation Practice Lead, Boundaryless Group and UiPath MVP
Essentials of Automations: The Art of Triggers and Actions in FME
In this second installment of our Essentials of Automations webinar series, we’ll explore the landscape of triggers and actions, guiding you through the nuances of authoring and adapting workspaces for seamless automations. Gain an understanding of the full spectrum of triggers and actions available in FME, empowering you to enhance your workspaces for efficient automation.
We’ll kick things off by showcasing the most commonly used event-based triggers, introducing you to various automation workflows like manual triggers, schedules, directory watchers, and more. Plus, see how these elements play out in real scenarios.
Whether you’re tweaking your current setup or building from the ground up, this session will arm you with the tools and insights needed to transform your FME usage into a powerhouse of productivity. Join us to discover effective strategies that simplify complex processes, enhancing your productivity and transforming your data management practices with FME. Let’s turn complexity into clarity and make your workspaces work wonders!
GraphSummit Singapore | The Future of Agility: Supercharging Digital Transfor...
Leonard Jayamohan, Partner & Generative AI Lead, Deloitte
This keynote will reveal how Deloitte leverages Neo4j’s graph power for groundbreaking digital twin solutions, achieving a staggering 100x performance boost. Discover the essential role knowledge graphs play in successful generative AI implementations. Plus, get an exclusive look at an innovative Neo4j + Generative AI solution Deloitte is developing in-house.
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Monitoring and observability aren’t traditionally found in software curriculums and many of us cobble this knowledge together from whatever vendor or ecosystem we were first introduced to and whatever is a part of your current company’s observability stack.
While the dev and ops silo continues to crumble….many organizations still relegate monitoring & observability as the purview of ops, infra and SRE teams. This is a mistake - achieving a highly observable system requires collaboration up and down the stack.
I, a former op, would like to extend an invitation to all application developers to join the observability party will share these foundational concepts to build on:
Recently uploaded (20)
National Security Agency - NSA mobile device best practices
National Security Agency - NSA mobile device best practices
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
GraphSummit Singapore | Enhancing Changi Airport Group's Passenger Experience...
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
GraphSummit Singapore | Graphing Success: Revolutionising Organisational Stru...
Pushing the limits of ePRTC: 100ns holdover for 100 days
Pushing the limits of ePRTC: 100ns holdover for 100 days
Mind map of terminologies used in context of Generative AI
Mind map of terminologies used in context of Generative AI
Best 20 SEO Techniques To Improve Website Visibility In SERP
Best 20 SEO Techniques To Improve Website Visibility In SERP
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
GraphSummit Singapore | Neo4j Product Vision & Roadmap - Q2 2024
Driving Business Innovation: Latest Generative AI Advancements & Success Story
Driving Business Innovation: Latest Generative AI Advancements & Success Story
Infrastructure Challenges in Scaling RAG with Custom AI models
Infrastructure Challenges in Scaling RAG with Custom AI models
Climate Impact of Software Testing at Nordic Testing Days
Climate Impact of Software Testing at Nordic Testing Days
Building Production Ready Search Pipelines with Spark and Milvus
Building Production Ready Search Pipelines with Spark and Milvus
HCL Notes and Domino License Cost Reduction in the World of DLAU
HCL Notes and Domino License Cost Reduction in the World of DLAU
UiPath Test Automation using UiPath Test Suite series, part 6
UiPath Test Automation using UiPath Test Suite series, part 6
Essentials of Automations: The Art of Triggers and Actions in FME
Essentials of Automations: The Art of Triggers and Actions in FME
GraphSummit Singapore | The Future of Agility: Supercharging Digital Transfor...
GraphSummit Singapore | The Future of Agility: Supercharging Digital Transfor...
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Observability Concepts EVERY Developer Should Know -- DeveloperWeek Europe.pdf
Dr Nicholas Shackel - Bioinformatics and Personalised Medicine
- 1. Bioinformatics and Personalized Medicine Nicholas A. Shackel 1 A.W. Morrow Gastroenterology and Liver Centre Royal Prince Alfred Hospital 2 Liver Laboratory, Centenary Institute Sydney, NSW, Australia 3 Medicine University of Sydney Sydney, NSW, Australia.
- 4. Functional Genomics Cell Nucleus Chromosome Protein Graphics courtesy of the National Human Genome Research Institute Gene (DNA) Gene (mRNA), single strand
- 8. Gene Regulation and Expression Post Translational Mechanisms Alternate Splicing / ncRNA Epigenetic regulation
- 13. HCC Pathogenesis Saffroy (2007) Clin Chem Lab Med 45(9) : 1169
- 15. Gene Expression and Outcome in HCC Hoshida (2008) NEJM : 1
- 16. Chromosomal Aberrations Pie (2009) Acta Biochim Biophys Sin : 1
- 17. mRNA profiling of HCV-induced cirrhosis and HCC - Hierarchal Clustering HCC Cirrhotic (F4) Donor Cirrhotic G1 HCC G1 HCC G3 HCC G1 Cirrhotic G3 Cirrhotic G3 HCC G_ HCC G_+HBV HCC G3 HCC ALD HCC G3 HCC ALD HCC ALD HCC G3 Cirrhotic G1 Cirrhotic G1 HCC G1 Cirrhotic G3 Cirrhotic G3 HCC G4+HBV Cirrhotic G1 HCC G1 Cirrhotic G3 Cirrhotic G1 Cirrhotic G3 HCC G1 HCC G3 Cirrhotic ALD Cirrhotic ALD Cirrhotic ALD Cirrhotic ALD Cirrhotic ALD Donor D o nor Donor Donor Pearson ’ s Correlation
- 18. HCC Pathogenesis Aravalli (2008) Hepatology : 2049
- 19. MicroRNA Targets Chen WJG 2009 p1665 LIVER
- 20. miRNA Clinical Outcomes Junfang et al NEJM 2009 p1437
- 27. IL-28B Ge et al Nature 2009 461, p1
- 28. IL-28B Ge et al Nature 2009 461, p1
- 29. New Technologies
- 30. Sequencing costs