This document describes a study that used real-time PCR to detect and quantify mitochondrial DNA from various animal species in domestic wastewater influent from two municipal wastewater treatment facilities over a 24-week period. Human and dog mtDNA were detected in all samples, while bovine, swine, cat, goose, and deer mtDNA were detected sporadically at lower levels. Correlations were observed between some mtDNA concentrations and other measured wastewater parameters. The results indicate that real-time PCR analysis of mtDNA can provide a profile of animal sources contributing to municipal wastewaters and could help identify sources of fecal contamination in environmental waters.
This document describes a study that developed and validated a multiplex real-time PCR assay to distinguish between human, bovine, and swine fecal contamination in water samples. Species-specific primers and probes were created to target the NADH dehydrogenase subunit 5 (ND5) gene in the mitochondrial DNA of each species. The assay was able to correctly identify the species in spiked effluent samples 83% of the time with no false positives. Some carry-over mitochondrial DNA signal was detected in human feces after consuming beef but not pork products. The multiplex real-time PCR provides a promising new tool for identifying the source of fecal contamination in environmental samples.
Effect of secondary treatment on pathogensTst Thong
This study evaluated the reduction of Cryptosporidium and Giardia (oo)cysts in two sewage treatment plants (STPs) in Malaysia over one year. The study found that an STP using an extended aeration process significantly reduced both Cryptosporidium and Giardia, while an STP using an aerated lagoon process only significantly reduced Giardia but not Cryptosporidium. This indicates that different sewage treatment processes have varying effectiveness in reducing these pathogenic parasites. The presence of Cryptosporidium and Giardia in treated sewage effluent that is discharged into water sources is a public health concern.
Effect Of Exposure To Lead And Cadmium In Drinking Water Sources From Nigeria...iosrjce
As Nigeria strives towards attaining the Millennium Development Goal for water, this study was
carried out to investigate the effect of exposure to lead (Pd) and cadmium (Cd) in drinking water source in the
Niger Delta region on fecundity and reproductive organ weights. Prior to the study, levels of heavy metals in
samples were assessed and compared to WHO permissible limit. The levels of Pb and Cd were higher than that
of WHO limit in some samples selected and used for the study. WHO permissible limit of lead and cadmium in
the drinking water are 0.01 and 0 003mg/L respectively. Forty eight albino Wistar rats (210-240g) of both
sexes were assigned into three groups: control (16), Pb-treated (16) and Cd-treated (16). The control group was
given distilled water, while the Pd-treated and Cd-treated group were administered drinking water randomly
collected from natural source with Pd (0.00-0.142mg/L) and Cd (0.00-0.024mg/L/) .All water was administered
in drinking water bottles filled with nozzles for a 28-day period. Male and female rats of each group were then
mated as follows: control males versus control females, control males versus Pb-treated females, Pb-treated
males versus control females and Pb-treated males versus Pb-treated females. The same procedure was
followed for Cd, Gestation day zero was regarded as day spermatozoa were identified in vaginal smear of
female rats. Pregnant animals were separated and the pregnancy allowed to come to term. Litter size and
morphological appearance of litters from each group and reproductive organ weight were noted. The litter size
of group 1 (control) for Pb and Cd was 12; group 11 was 8 and 6 respectively; group 111 was 5 and 2
respectively; while group IV showed no reproductive outcome. The results suggest adverse effect of Pb and Cd
in drinking water on fecundity of albino Wistar rats
The researchers collected blue crabs from a polluted wetland (experimental group) and unpolluted dock (control group) to compare bacteria levels in their blood. They found higher bacteria counts in the male crab from the polluted site, including a salt-tolerant Bacillus species and Micrococcus species. However, further samples did not produce reliable bacteria counts, possibly due to differences in crab size and sex between trials. The study aimed to correlate environmental pollution to bacteria levels in crab blood but yielded inconclusive results requiring more sampling.
This document discusses the development of transgenic zebrafish as biosensors to detect acid pollution in Minnesota waters. Researchers injected zebrafish with a vector containing GPI-GFP and a blue heart gene, resulting in fluorescent expression localized to tissues. They are currently sequencing the GPI-SEP vector to create a potential pH-sensitive biosensor fish. Two additional biosensor fish lines were added to the library. The ongoing work involves further developing the pH-sensitive fish and testing it and other biosensors against Minnesota pollutants to expand the library of tools for assessing environmental quality in classrooms.
This study examines genetic variation in the Alabama hog sucker (Hypentelium etowanum) across river drainages in the southeastern United States using DNA sequencing of the mitochondrial cytochrome b gene. Tissue samples were collected from seven locations and DNA was extracted and amplified via PCR. Approximately 1150 base pairs of the cyt b gene were sequenced. Preliminary results found genetic variations between populations that are consistent with a previous study. The sequences from a new location in the Little Tallapoosa drainage were most closely related to those from the Chattahoochee drainage. This ongoing study aims to increase sampling to further resolve the genetic structure of H. etowanum across its range.
Pharmaceuticals and Personal Care Products. Source: (Nettesheim et al., 2007)...SerPIE Repository
Pharmaceuticals and Personal Care Products (PPCPs), Hormones, and Alkylphenol Ethoxylates (APEs) in the North Shore Channel of the Chicago River. Source: (Nettesheim et al., 2007) USEPA, USGS & USDA/SETAC Annual Meeting
Grimmett et al., growth rate hypothesisIvan Grimmett
The study tested whether the growth rate hypothesis applies to five species of aquatic hyphomycetes grown in broth cultures. Samples were taken from the cultures over 56 days and analyzed for biomass accumulation, ergosterol concentration (indicator of fungal biomass), and concentrations of carbon, nitrogen, phosphorus, RNA, and DNA. Growth curves followed a rectangular hyperbola pattern. There were no consistent trends in carbon, nitrogen, phosphorus, or ergosterol concentrations related to culture age or growth rate. RNA and DNA concentrations and their ratio decreased with culture age. Only RNA concentrations were positively correlated with growth rate, supporting the growth rate hypothesis for aquatic hyphomycetes.
This document describes a study that developed and validated a multiplex real-time PCR assay to distinguish between human, bovine, and swine fecal contamination in water samples. Species-specific primers and probes were created to target the NADH dehydrogenase subunit 5 (ND5) gene in the mitochondrial DNA of each species. The assay was able to correctly identify the species in spiked effluent samples 83% of the time with no false positives. Some carry-over mitochondrial DNA signal was detected in human feces after consuming beef but not pork products. The multiplex real-time PCR provides a promising new tool for identifying the source of fecal contamination in environmental samples.
Effect of secondary treatment on pathogensTst Thong
This study evaluated the reduction of Cryptosporidium and Giardia (oo)cysts in two sewage treatment plants (STPs) in Malaysia over one year. The study found that an STP using an extended aeration process significantly reduced both Cryptosporidium and Giardia, while an STP using an aerated lagoon process only significantly reduced Giardia but not Cryptosporidium. This indicates that different sewage treatment processes have varying effectiveness in reducing these pathogenic parasites. The presence of Cryptosporidium and Giardia in treated sewage effluent that is discharged into water sources is a public health concern.
Effect Of Exposure To Lead And Cadmium In Drinking Water Sources From Nigeria...iosrjce
As Nigeria strives towards attaining the Millennium Development Goal for water, this study was
carried out to investigate the effect of exposure to lead (Pd) and cadmium (Cd) in drinking water source in the
Niger Delta region on fecundity and reproductive organ weights. Prior to the study, levels of heavy metals in
samples were assessed and compared to WHO permissible limit. The levels of Pb and Cd were higher than that
of WHO limit in some samples selected and used for the study. WHO permissible limit of lead and cadmium in
the drinking water are 0.01 and 0 003mg/L respectively. Forty eight albino Wistar rats (210-240g) of both
sexes were assigned into three groups: control (16), Pb-treated (16) and Cd-treated (16). The control group was
given distilled water, while the Pd-treated and Cd-treated group were administered drinking water randomly
collected from natural source with Pd (0.00-0.142mg/L) and Cd (0.00-0.024mg/L/) .All water was administered
in drinking water bottles filled with nozzles for a 28-day period. Male and female rats of each group were then
mated as follows: control males versus control females, control males versus Pb-treated females, Pb-treated
males versus control females and Pb-treated males versus Pb-treated females. The same procedure was
followed for Cd, Gestation day zero was regarded as day spermatozoa were identified in vaginal smear of
female rats. Pregnant animals were separated and the pregnancy allowed to come to term. Litter size and
morphological appearance of litters from each group and reproductive organ weight were noted. The litter size
of group 1 (control) for Pb and Cd was 12; group 11 was 8 and 6 respectively; group 111 was 5 and 2
respectively; while group IV showed no reproductive outcome. The results suggest adverse effect of Pb and Cd
in drinking water on fecundity of albino Wistar rats
The researchers collected blue crabs from a polluted wetland (experimental group) and unpolluted dock (control group) to compare bacteria levels in their blood. They found higher bacteria counts in the male crab from the polluted site, including a salt-tolerant Bacillus species and Micrococcus species. However, further samples did not produce reliable bacteria counts, possibly due to differences in crab size and sex between trials. The study aimed to correlate environmental pollution to bacteria levels in crab blood but yielded inconclusive results requiring more sampling.
This document discusses the development of transgenic zebrafish as biosensors to detect acid pollution in Minnesota waters. Researchers injected zebrafish with a vector containing GPI-GFP and a blue heart gene, resulting in fluorescent expression localized to tissues. They are currently sequencing the GPI-SEP vector to create a potential pH-sensitive biosensor fish. Two additional biosensor fish lines were added to the library. The ongoing work involves further developing the pH-sensitive fish and testing it and other biosensors against Minnesota pollutants to expand the library of tools for assessing environmental quality in classrooms.
This study examines genetic variation in the Alabama hog sucker (Hypentelium etowanum) across river drainages in the southeastern United States using DNA sequencing of the mitochondrial cytochrome b gene. Tissue samples were collected from seven locations and DNA was extracted and amplified via PCR. Approximately 1150 base pairs of the cyt b gene were sequenced. Preliminary results found genetic variations between populations that are consistent with a previous study. The sequences from a new location in the Little Tallapoosa drainage were most closely related to those from the Chattahoochee drainage. This ongoing study aims to increase sampling to further resolve the genetic structure of H. etowanum across its range.
Pharmaceuticals and Personal Care Products. Source: (Nettesheim et al., 2007)...SerPIE Repository
Pharmaceuticals and Personal Care Products (PPCPs), Hormones, and Alkylphenol Ethoxylates (APEs) in the North Shore Channel of the Chicago River. Source: (Nettesheim et al., 2007) USEPA, USGS & USDA/SETAC Annual Meeting
Grimmett et al., growth rate hypothesisIvan Grimmett
The study tested whether the growth rate hypothesis applies to five species of aquatic hyphomycetes grown in broth cultures. Samples were taken from the cultures over 56 days and analyzed for biomass accumulation, ergosterol concentration (indicator of fungal biomass), and concentrations of carbon, nitrogen, phosphorus, RNA, and DNA. Growth curves followed a rectangular hyperbola pattern. There were no consistent trends in carbon, nitrogen, phosphorus, or ergosterol concentrations related to culture age or growth rate. RNA and DNA concentrations and their ratio decreased with culture age. Only RNA concentrations were positively correlated with growth rate, supporting the growth rate hypothesis for aquatic hyphomycetes.
This document describes research into using surface-enhanced Raman spectroscopy (SERS) and peptide-functionalized SERS substrates to detect Bacillus anthracis spores. The researchers developed a peptide that selectively binds B. anthracis-Sterne spores. They found that exposing 109 B. anthracis-Sterne spores/mL to the functionalized SERS substrate and acetic acid produced a strong dipicolinic acid spectrum, whereas the same treatment of B. cereus and B. subtilis at the same concentration did not produce a signal. This peptide-functionalized SERS approach provides a method for differentiating B. anthracis at the species level, overcoming limitations of other detection
This document summarizes a study that analyzed genetic diversity and gene flow between wild and hatchery-raised populations of Catla Catla fish in Madhya Pradesh, India using DNA fingerprinting. Samples were collected from river, reservoir, and hatchery populations. DNA was extracted and amplified using RAPD-PCR with random primers. Results showed hatchery populations had lower genetic diversity and polymorphism compared to wild populations, indicating genetic changes have occurred in hatchery stocks. The study provides a baseline for developing conservation strategies for this important freshwater fish species.
Barbaro et al, 2007. comparative study on extracts from the tissue covering thepryloock
1. The study compared properties of tissue extracts from the stingers of freshwater Potamotrygon falkneri and marine Dasyatis guttata stingrays.
2. By SDS-PAGE, the tissue extracts had similar protein bands above 80 kDa, but differences below this mass.
3. P. falkneri tissue extract displayed lethal, dermonecrotic, and myotoxic activities, while D. guttata did not. Both induced similar edema in mice. P. falkneri induced stronger nociception.
This document discusses the complexity of the transcriptome and the many sources of technical noise in RNA-Seq experiments. It notes that the transcriptome includes different combinations of exons from genes and that RNA-Seq experiments can be affected by over a dozen technical factors related to sample preparation and sequencing. Accurately analyzing results requires controlling for these sources of variability.
The document summarizes work using an AudioLyse device to lyse bacterial cells at the point of care in low resource settings. The AudioLyse uses an audio file played through a portable audio device to spin a magnet and agitate glass beads, releasing DNA from bacterial cells like Staphylococcus aureus. Testing showed the AudioLyse was about 60% as effective as a bead beater at releasing amplifiable DNA. While the presence of simulated nasal matrix and glycerol decreased efficiency for both methods, the AudioLyse performed similarly to other point-of-care lysis devices but with less user time. Future work will test different bacteria, frequencies, and sample viscosities to further evaluate the AudioLyse's
1) Researchers developed transgenic medaka (fish) carrying multiple copies of a bacteriophage vector containing the cII gene, which serves as a target for detecting mutations.
2) They adapted an assay used in transgenic rodents to efficiently recover cII mutants from fish genomic DNA and detect them by infecting bacteria.
3) Spontaneous mutant frequencies in liver, whole fish, and testes of medaka were comparable to frequencies observed in transgenic rodents. Treatment with ethylnitrosourea induced cII mutations in the medaka in a tissue-specific and time-dependent manner consistent with known mutagen mechanisms.
Alkaline hydrolysis is an effective method for carcass disposal that involves using specific temperature and time parameters with potassium hydroxide (KOH) or sodium hydroxide. The USDA has used this process to decontaminate infected animal carcasses and materials by liquefying the organic material at high temperatures and retaining it for over an hour. This results in a nutrient-rich liquid effluent that can be disposed of through various methods like land application, dehydration, or sewers. The document discusses the applicability of this process and compares sodium and potassium hydroxide.
This document summarizes a study investigating the presence of pesticides in American lobsters from Long Island Sound. A steering committee with representatives from regulatory agencies, academia, and industry oversaw the study. Researchers validated testing methods by fortifying lobster tissue samples with known amounts of pesticides. In fall 2014, researchers collected 45 lobsters from Long Island Sound and tested claw/tail muscle and hepatopancreas (tomalley) for 5 pesticides using gas chromatography–tandem mass spectrometry. Neither laboratory detected any of the pesticides above their detection limits of 6-20 parts per billion.
This document describes the development of a rapid enzyme-linked immunosorbent assay (ELISA) for detecting the algal toxin domoic acid. The assay uses a monoclonal antibody that was produced against domoic acid. A domoic acid-horseradish peroxidase conjugate was also developed. The optimized ELISA has a linear range of 0.1-3 parts per billion and takes approximately 1.5 hours to complete. It was validated for use in measuring domoic acid levels in razor clams, mussels, scallops, and phytoplankton. The ELISA offers environmental managers and public health officials an accurate, rapid and cost-effective tool for monitoring domoic acid concentrations in shellfish
1. The study tested the toxicity of used coffee grounds on larvae of the mosquito Ochlerotatus notoscriptus at different concentrations. High concentrations induced high larval mortality within days, while low concentrations boosted survivorship.
2. The results suggest used coffee grounds could be a cost-free and environmentally friendly larval control method, but extensive field trials are needed before use is advocated.
3. Nutrient depletion in the laboratory conditions likely caused high mortality in the controls, compromising the results, whereas providing food sustained higher survival rates in previous studies.
George Harper is a chemical engineering student at North Carolina State University seeking a position in biomanufacturing. He has a 3.25 GPA and will graduate in May 2016 with a B.S. in Chemical Engineering and a minor in Biotechnology and Tissue Engineering. His experience includes undergraduate research utilizing molecular biotechnology techniques like DNA manipulation and protein purification. He has presented his research at several conferences and is published as a coauthor. Harper also has experience as a teaching assistant and engineering consultant.
Real time pcr assay for rapid detection and quantification of campylobacter j...Tiensae Teshome
The document describes the development of a real-time PCR (rtPCR) assay for rapid detection and quantification of Campylobacter jejuni on chicken rinses from poultry processing plants without an enrichment step. Eighty-four chicken rinse samples were collected from three processing plants and tested using both rtPCR and culture methods. Sixty-five samples were positive by rtPCR while 27 were positive by culture, with 27 samples positive by both methods. The rtPCR assay was able to detect C. jejuni with a limit of 1 CFU and provide results within 90 minutes, significantly faster than the 5-7 days required for culture.
This study sequenced the carbonic anhydrase gene in Wabash pigtoe mussels to determine how they may respond to a proposed carbon dioxide barrier meant to prevent the spread of invasive Asian carp. RNA was extracted from mussel tissues and used to synthesize cDNA. Primers were designed based on a related species' gene sequence and used to amplify and sequence a 954 base pair region of the carbonic anhydrase gene. While real-time PCR was not performed due to time constraints, the researchers hypothesize expression of this gene, which is important for acid-base regulation and shell formation, would increase under elevated carbon dioxide levels.
Effects of Collection, Preservation, and Sample Preparation Methods on the Qu...Nicole Petegorsky
Adult T. confusum beetles were collected using various methods and preserved under different conditions to test the quality of extracted DNA for barcoding. Beetles preserved in 100% ethanol at -20°C produced high quality DNA, while those in water at room temperature produced degraded DNA. Preservation in 70% ethanol or dry collection with dichlorvos strips had minimal negative effects on DNA compared to 100% ethanol or wet collection. Low temperature storage is important for maintaining DNA quality for barcoding.
Decellularized Plants as Tissue Engineering ScaffoldsZamrun Mehatri
Zamrun Kousar Mehatri presented their research on decellularizing plants to create tissue engineering scaffolds. Spinach leaves were decellularized using SDS and Triton-X-100 solutions, removing cells and nucleic acids while maintaining the vascular structure. Histological and SEM analysis showed the decellularized leaves lacked cells and nuclei but retained the native vascular pattern. The decellularized leaves were perfused with dye and microspheres, demonstrating the vasculature could support flow. Human cells were seeded, with HUVECs remaining viable, hMSCs adhering, and hPS-CMs attaching and exhibiting contractile behavior and calcium fluctuations for 21 days. The research aims to develop
Widespread Natural Occurrence of Hydroxyurea in AnimalsMichelle Pyle
This research article reports the discovery of naturally occurring hydroxyurea, an antibiotic compound, in many animal species across taxonomic groups. The highest levels were found in the little skate shark, with concentrations in some tissues high enough to have antiviral and anticancer effects based on in vitro studies. Embryos of the little skate also showed increasing hydroxyurea levels with development, indicating the ability to synthesize it. While levels in most other species examined were lower, certain tissues in some invertebrates and vertebrates also had concentrations expected to have antiviral effects. The widespread natural presence of hydroxyurea suggests it may play a role in disease resistance as part of the innate immune system in combating infections.
This document describes a study that analyzed the transcriptome of the gut epithelium in Helicoverpa zea (corn earworm) larvae 24 hours after being infected with Helicoverpa zea single nucleopolyhedrovirus (HzSNPV) or a mock treatment. The study found 1,139 genes were differentially expressed between the two groups, with 63% downregulated and 37% upregulated in infected larvae. Genes related to digestion, detoxification, and some immune responses like viral recognition were generally downregulated upon infection, while antimicrobial peptides and prophenoloxidase were upregulated. This provided insight into how baculovirus infection alters gene expression in the gut, likely the most heavily
Sarah's INBRE poster updated Aug 11 LL FINAL-2Sarah Sanders
1) Vibrio vulnificus (Vv) is an opportunistic human pathogen found in the Great Bay Estuary (GBE) of New Hampshire. While cases of Vv infection have increased in the Gulf of Maine, there have been no reported cases from GBE strains.
2) The study analyzed 37 Vv isolates from GBE using short read genome sequencing and multilocus sequence typing (MLST). Most isolates contained novel sequence types not in databases, suggesting genetic diversity.
3) Analysis of virulence genes and a phylogenetic marker showed GBE isolates were more similar to environmental strains and different from known pathogenic strains, supporting the hypothesis that GBE strains are non-pathogenic.
Developmental Biology Special Problem: Benzalkonium Chloride and Drosophila m...Joanna Rose Navarro
This document appears to be a student research paper that investigates the mutagenic effects of benzalkonium chloride on Drosophila melanogaster (fruit flies). The paper includes an introduction discussing background on mutations and why fruit flies are used for this type of study. It also includes the research questions and hypothesis. The methodology section describes how the experiment will be conducted, including preparing the mutagen, collecting fruit fly samples, and observing for visible mutations between generations exposed to the chemical.
This production drawing shows a multi-service module with duct sensors, control boxes mounted on a frame, and pre-fitted twin valvesets with building management system actuators. It also details a commissioning valveset and pre-fabricated heatstation skid with a control panel, temperature sensor, isolator, and Forta M40 actuator.
Sir Raymond Carr will receive the first award from the Fundación Banco Santander for Anglo-Spanish Relations on his 93rd birthday at the Spanish Embassy in London. The award recognizes British or Spanish personalities who have contributed to strengthening ties between the two countries. Carr is being honored for his work understanding Spanish history from the 19th century to the Spanish Civil War and helping liberate it from prejudice through a modern, conciliatory approach. As director of St. Antony's College in Oxford for 20 years, he influenced generations of Spanish and Latin American historians.
This document describes research into using surface-enhanced Raman spectroscopy (SERS) and peptide-functionalized SERS substrates to detect Bacillus anthracis spores. The researchers developed a peptide that selectively binds B. anthracis-Sterne spores. They found that exposing 109 B. anthracis-Sterne spores/mL to the functionalized SERS substrate and acetic acid produced a strong dipicolinic acid spectrum, whereas the same treatment of B. cereus and B. subtilis at the same concentration did not produce a signal. This peptide-functionalized SERS approach provides a method for differentiating B. anthracis at the species level, overcoming limitations of other detection
This document summarizes a study that analyzed genetic diversity and gene flow between wild and hatchery-raised populations of Catla Catla fish in Madhya Pradesh, India using DNA fingerprinting. Samples were collected from river, reservoir, and hatchery populations. DNA was extracted and amplified using RAPD-PCR with random primers. Results showed hatchery populations had lower genetic diversity and polymorphism compared to wild populations, indicating genetic changes have occurred in hatchery stocks. The study provides a baseline for developing conservation strategies for this important freshwater fish species.
Barbaro et al, 2007. comparative study on extracts from the tissue covering thepryloock
1. The study compared properties of tissue extracts from the stingers of freshwater Potamotrygon falkneri and marine Dasyatis guttata stingrays.
2. By SDS-PAGE, the tissue extracts had similar protein bands above 80 kDa, but differences below this mass.
3. P. falkneri tissue extract displayed lethal, dermonecrotic, and myotoxic activities, while D. guttata did not. Both induced similar edema in mice. P. falkneri induced stronger nociception.
This document discusses the complexity of the transcriptome and the many sources of technical noise in RNA-Seq experiments. It notes that the transcriptome includes different combinations of exons from genes and that RNA-Seq experiments can be affected by over a dozen technical factors related to sample preparation and sequencing. Accurately analyzing results requires controlling for these sources of variability.
The document summarizes work using an AudioLyse device to lyse bacterial cells at the point of care in low resource settings. The AudioLyse uses an audio file played through a portable audio device to spin a magnet and agitate glass beads, releasing DNA from bacterial cells like Staphylococcus aureus. Testing showed the AudioLyse was about 60% as effective as a bead beater at releasing amplifiable DNA. While the presence of simulated nasal matrix and glycerol decreased efficiency for both methods, the AudioLyse performed similarly to other point-of-care lysis devices but with less user time. Future work will test different bacteria, frequencies, and sample viscosities to further evaluate the AudioLyse's
1) Researchers developed transgenic medaka (fish) carrying multiple copies of a bacteriophage vector containing the cII gene, which serves as a target for detecting mutations.
2) They adapted an assay used in transgenic rodents to efficiently recover cII mutants from fish genomic DNA and detect them by infecting bacteria.
3) Spontaneous mutant frequencies in liver, whole fish, and testes of medaka were comparable to frequencies observed in transgenic rodents. Treatment with ethylnitrosourea induced cII mutations in the medaka in a tissue-specific and time-dependent manner consistent with known mutagen mechanisms.
Alkaline hydrolysis is an effective method for carcass disposal that involves using specific temperature and time parameters with potassium hydroxide (KOH) or sodium hydroxide. The USDA has used this process to decontaminate infected animal carcasses and materials by liquefying the organic material at high temperatures and retaining it for over an hour. This results in a nutrient-rich liquid effluent that can be disposed of through various methods like land application, dehydration, or sewers. The document discusses the applicability of this process and compares sodium and potassium hydroxide.
This document summarizes a study investigating the presence of pesticides in American lobsters from Long Island Sound. A steering committee with representatives from regulatory agencies, academia, and industry oversaw the study. Researchers validated testing methods by fortifying lobster tissue samples with known amounts of pesticides. In fall 2014, researchers collected 45 lobsters from Long Island Sound and tested claw/tail muscle and hepatopancreas (tomalley) for 5 pesticides using gas chromatography–tandem mass spectrometry. Neither laboratory detected any of the pesticides above their detection limits of 6-20 parts per billion.
This document describes the development of a rapid enzyme-linked immunosorbent assay (ELISA) for detecting the algal toxin domoic acid. The assay uses a monoclonal antibody that was produced against domoic acid. A domoic acid-horseradish peroxidase conjugate was also developed. The optimized ELISA has a linear range of 0.1-3 parts per billion and takes approximately 1.5 hours to complete. It was validated for use in measuring domoic acid levels in razor clams, mussels, scallops, and phytoplankton. The ELISA offers environmental managers and public health officials an accurate, rapid and cost-effective tool for monitoring domoic acid concentrations in shellfish
1. The study tested the toxicity of used coffee grounds on larvae of the mosquito Ochlerotatus notoscriptus at different concentrations. High concentrations induced high larval mortality within days, while low concentrations boosted survivorship.
2. The results suggest used coffee grounds could be a cost-free and environmentally friendly larval control method, but extensive field trials are needed before use is advocated.
3. Nutrient depletion in the laboratory conditions likely caused high mortality in the controls, compromising the results, whereas providing food sustained higher survival rates in previous studies.
George Harper is a chemical engineering student at North Carolina State University seeking a position in biomanufacturing. He has a 3.25 GPA and will graduate in May 2016 with a B.S. in Chemical Engineering and a minor in Biotechnology and Tissue Engineering. His experience includes undergraduate research utilizing molecular biotechnology techniques like DNA manipulation and protein purification. He has presented his research at several conferences and is published as a coauthor. Harper also has experience as a teaching assistant and engineering consultant.
Real time pcr assay for rapid detection and quantification of campylobacter j...Tiensae Teshome
The document describes the development of a real-time PCR (rtPCR) assay for rapid detection and quantification of Campylobacter jejuni on chicken rinses from poultry processing plants without an enrichment step. Eighty-four chicken rinse samples were collected from three processing plants and tested using both rtPCR and culture methods. Sixty-five samples were positive by rtPCR while 27 were positive by culture, with 27 samples positive by both methods. The rtPCR assay was able to detect C. jejuni with a limit of 1 CFU and provide results within 90 minutes, significantly faster than the 5-7 days required for culture.
This study sequenced the carbonic anhydrase gene in Wabash pigtoe mussels to determine how they may respond to a proposed carbon dioxide barrier meant to prevent the spread of invasive Asian carp. RNA was extracted from mussel tissues and used to synthesize cDNA. Primers were designed based on a related species' gene sequence and used to amplify and sequence a 954 base pair region of the carbonic anhydrase gene. While real-time PCR was not performed due to time constraints, the researchers hypothesize expression of this gene, which is important for acid-base regulation and shell formation, would increase under elevated carbon dioxide levels.
Effects of Collection, Preservation, and Sample Preparation Methods on the Qu...Nicole Petegorsky
Adult T. confusum beetles were collected using various methods and preserved under different conditions to test the quality of extracted DNA for barcoding. Beetles preserved in 100% ethanol at -20°C produced high quality DNA, while those in water at room temperature produced degraded DNA. Preservation in 70% ethanol or dry collection with dichlorvos strips had minimal negative effects on DNA compared to 100% ethanol or wet collection. Low temperature storage is important for maintaining DNA quality for barcoding.
Decellularized Plants as Tissue Engineering ScaffoldsZamrun Mehatri
Zamrun Kousar Mehatri presented their research on decellularizing plants to create tissue engineering scaffolds. Spinach leaves were decellularized using SDS and Triton-X-100 solutions, removing cells and nucleic acids while maintaining the vascular structure. Histological and SEM analysis showed the decellularized leaves lacked cells and nuclei but retained the native vascular pattern. The decellularized leaves were perfused with dye and microspheres, demonstrating the vasculature could support flow. Human cells were seeded, with HUVECs remaining viable, hMSCs adhering, and hPS-CMs attaching and exhibiting contractile behavior and calcium fluctuations for 21 days. The research aims to develop
Widespread Natural Occurrence of Hydroxyurea in AnimalsMichelle Pyle
This research article reports the discovery of naturally occurring hydroxyurea, an antibiotic compound, in many animal species across taxonomic groups. The highest levels were found in the little skate shark, with concentrations in some tissues high enough to have antiviral and anticancer effects based on in vitro studies. Embryos of the little skate also showed increasing hydroxyurea levels with development, indicating the ability to synthesize it. While levels in most other species examined were lower, certain tissues in some invertebrates and vertebrates also had concentrations expected to have antiviral effects. The widespread natural presence of hydroxyurea suggests it may play a role in disease resistance as part of the innate immune system in combating infections.
This document describes a study that analyzed the transcriptome of the gut epithelium in Helicoverpa zea (corn earworm) larvae 24 hours after being infected with Helicoverpa zea single nucleopolyhedrovirus (HzSNPV) or a mock treatment. The study found 1,139 genes were differentially expressed between the two groups, with 63% downregulated and 37% upregulated in infected larvae. Genes related to digestion, detoxification, and some immune responses like viral recognition were generally downregulated upon infection, while antimicrobial peptides and prophenoloxidase were upregulated. This provided insight into how baculovirus infection alters gene expression in the gut, likely the most heavily
Sarah's INBRE poster updated Aug 11 LL FINAL-2Sarah Sanders
1) Vibrio vulnificus (Vv) is an opportunistic human pathogen found in the Great Bay Estuary (GBE) of New Hampshire. While cases of Vv infection have increased in the Gulf of Maine, there have been no reported cases from GBE strains.
2) The study analyzed 37 Vv isolates from GBE using short read genome sequencing and multilocus sequence typing (MLST). Most isolates contained novel sequence types not in databases, suggesting genetic diversity.
3) Analysis of virulence genes and a phylogenetic marker showed GBE isolates were more similar to environmental strains and different from known pathogenic strains, supporting the hypothesis that GBE strains are non-pathogenic.
Developmental Biology Special Problem: Benzalkonium Chloride and Drosophila m...Joanna Rose Navarro
This document appears to be a student research paper that investigates the mutagenic effects of benzalkonium chloride on Drosophila melanogaster (fruit flies). The paper includes an introduction discussing background on mutations and why fruit flies are used for this type of study. It also includes the research questions and hypothesis. The methodology section describes how the experiment will be conducted, including preparing the mutagen, collecting fruit fly samples, and observing for visible mutations between generations exposed to the chemical.
This production drawing shows a multi-service module with duct sensors, control boxes mounted on a frame, and pre-fitted twin valvesets with building management system actuators. It also details a commissioning valveset and pre-fabricated heatstation skid with a control panel, temperature sensor, isolator, and Forta M40 actuator.
Sir Raymond Carr will receive the first award from the Fundación Banco Santander for Anglo-Spanish Relations on his 93rd birthday at the Spanish Embassy in London. The award recognizes British or Spanish personalities who have contributed to strengthening ties between the two countries. Carr is being honored for his work understanding Spanish history from the 19th century to the Spanish Civil War and helping liberate it from prejudice through a modern, conciliatory approach. As director of St. Antony's College in Oxford for 20 years, he influenced generations of Spanish and Latin American historians.
Customer recollect and reconnect - a simple CRM storyRajagopalan V
This document discusses how small specialty businesses can grow by reconnecting with existing customers. It describes a business owner in Delhi, India who sold nuts and dried fruits. His business did $1000 in daily revenue but he wanted to grow. A consultant helped him collect customer data and use promotions to reconnect with customers. This increased repeat purchases and word-of-mouth referrals. The owner opened a second store and started online sales. By focusing on customer service and keeping in contact with customers, the business was able to grow substantially within a year without much additional marketing spend. The document advocates that small businesses focus on retaining and reconnecting with existing customers to drive the majority of their revenue growth.
Journey from a Startup to an enterpriseRajagopalan V
Running a startup is tough. Making it successful is much tougher and involves much more than the individual entrepreneur. As a first step, I have tried to put a process to the growth phases one would go through from a startup to becoming a company earning money and what one needs to watch for along the way to success.
Une brochure permet de donner le choix aux femmes: visitez http://cancer-rose.fr/
Le dépistage organisé du cancer du sein, généralisé en France depuis 2004 et proposé aux femmes de 50 à 74 ans, fait l’objet de controverses. Celles-ci, publiées dans des revues scientifiques de premier plan, ont été longtemps minimisées auprès du grand public.
Les doutes portent sur un faible bénéfice et des risques avérés. Ces derniers sont essentiellement les fausses alertes, c’est à dire l’annonce d’une lésion mammographique qui ne s’avère pas réelle, et le surdiagnostic. Le surdiagnostic est la découverte d’un cancer qui n’aurait pas affecté la santé de la femme de son vivant, s’il n’avait pas été détecté. Le bénéfice s’avère beaucoup plus faible que présenté officiellement, en raison notamment du faible risque en valeur absolue de mourir de ce cancer, et de la faible efficacité du dépistage.
De ce constat est née une brochure indépendante, délivrant une information claire, qui se veut loyale, aussi complète que possible et facilement accessible. Elle est téléchargeable gratuitement directement sur la page d’accueil de "cancer rose".
Seize auteurs l’ont élaborée. Destinée à la lectrice concernée par le dépistage, elle est aussi pensée comme aide au praticien démuni face aux interrogations d’une patiente.
L’objectif de cette brochure, (unique en langue française alors qu’il en existe p.ex. en Allemagne pour les femmes) est de donner aux femmes le pouvoir de décider de façon rationnelle et sans être culpabilisées. Chacune se fera ainsi son opinion au travers des meilleures sources scientifiques disponibles. Même si le dépistage du cancer du sein est un programme dit de santé publique, il n’en reste pas moins que la participation est une décision individuelle qui ne peut être prise qu’en connaissance de cause, ni imposée ni subie.
This document provides an introduction and overview of key features in Salesforce.com, including how to view leads and prospects, assign new tasks, and navigate the home page. It outlines the main sections in Salesforce like Home, Contact, Account, Lead, Opportunity, and Reports. It then provides step-by-step instructions on how to view leads by team, sort lists, and assign new tasks by setting details like subject, due date, priority, and reminders.
Similar to Domestic-wastewater-influent-profiling-using-mitochondrial-real-time-PCR-for-source-tracking-animal-contamination_2008_Journal-of-Microbiological-Methods
This document discusses a study that combines DNA barcoding and macroinvertebrate sampling to assess water quality in two sites along the White Clay Creek in Pennsylvania. Macroinvertebrates were collected from each site and identified to different taxonomic levels by an amateur, professional taxonomist, and through DNA barcoding. The study aims to see if water quality differences between the sites can be better distinguished at lower taxonomic levels, including species identification through DNA barcoding. The results may help integrate DNA barcoding into water quality assessment and create a reference species list for future studies in the area.
Slaughter waste effluents and river catchment watershed contamination in Caga...Angelo Mark Walag
Slaughterhouse waste products are commonly known globally to pollute nearby communities and receiving bodies of water. The main aim of this study was to analyze the effluents disposed by Cagayan de Oro City Slaughterhouse to river catchment watershed. Standard methods were utilized in sampling and analyzing water quality parameters to determine the levels of nitrates, BOD, COD, total coliform, and lead. It was found out that the majority of wastes produced are internal organs, blood and urine mixtures, and manures. The study also revealed that all parameters tested crossed the permissible limits set by the government for effluent and inland water except for BOD and nitrates, in the river watershed. It was also determined that during wet seasons, major contaminants like lead and nitrates were diluted resulting to lower levels when compared to national standards. The result of this study also revealed the need for further remediation of the river water quality and intervention strategies to sustainably manage and prevent disposal of untreated effluents.
Reduction of cryptosporidium and giardia by sewage treatment processesTst Thong
This study evaluated the reduction of Cryptosporidium and Giardia (oo)cysts in the effluent of two sewage treatment plants (STPs) in Malaysia over one year. The two STPs used different treatment processes: one used extended aeration and one used an aerated lagoon system. Statistical analysis showed that the extended aeration system significantly reduced concentrations of both Cryptosporidium and Giardia, while the aerated lagoon system only significantly reduced Giardia but not Cryptosporidium. This finding has public health implications, as effluent discharged from sewage plants upstream of drinking water sources could potentially contaminate the water if treatment is insufficient to remove
Determination of Bacteriological and Physiochemical Properties of Som-Breiro ...RSIS International
The study seeks to examine the Bacteriological and
physiochemical properties of Sambrero River in Ahoada East
Local Government Area of Rivers State. Three (3) points were
sampled from different locations designated as location (L1)
location (L2) and location (L3) respectively, samples were
collected in 0.1m of Sterile containers and were transported to
the laboratory for immediate analysis. Ten (10) physiochemical,
three (3) heavy metal sand three microbiological parameters
were observed. Data was analyzed using standard methods
(ALPHA, 1998) 20th edition and Ms-Excel version 2013 software.
The result showed little variation in physiochemical parameters
which are in line with World Health Organization (WHO)
standard of potable water but shows much variation in
microbiological parameters which are not in line with WHO
standard, thereby making the water not wholesome and not
potable for consumption except after proper treatment of the
water. The work therefore recommends that members of Ekpena
Community should ensure basic water treatment such as boiling
and chlorination before consumption.
Our research team sampled 33 holy wells in western Ireland to test for the presence of fecal indicator bacteria and waterborne pathogens. We found that 8 of the wells tested positive for Enterococcus faecalis based on qPCR analysis. The wells were located in rural areas near agricultural land grazed by livestock, which are potential sources of contamination. We used end-point PCR and gel electrophoresis to confirm the presence of bacterial DNA in the well water samples. Quantitative PCR was then performed to detect specific pathogen genes and quantify bacterial densities by comparing results to a standard curve developed from serial dilutions of Enterococcus faecalis DNA. This research helps evaluate the potential public health risks associated with the use of holy wells in Ireland.
This document summarizes a study on microcystin levels in raw and treated municipal drinking water sources in Alberta. Microcystin is a toxin produced by some cyanobacteria (blue-green algae) that can be harmful to human health. The study analyzed water samples from 18 municipalities over 10 weeks and found microcystin present in 67% of raw water samples, with concentrations up to 14.8 μg/L in some sources. Microcystin was detected less often and at lower levels in treated water, indicating conventional treatment removes some toxin. All samples complied with Health Canada guidelines. The study recommends further sampling of rural communities to fully evaluate microcystin occurrence in municipal surface drinking water supplies.
This document summarizes research on water quality and gastrointestinal illness from two case studies. The first case study examined water contamination between the source and point of use in Esmeraldas, Ecuador. It found higher levels of E. coli and enterococci at the source than in household water, along with recontamination occurring in about 50% of households. The second case study analyzed the relationship between water residence time in the distribution system and gastrointestinal illness in Atlanta, GA. It found that people in zip codes receiving water with the longest residence times had a moderately increased risk of GI illness. Both studies suggest considering initial water quality and potential for recontamination.
Journal of Laboratory Automation-2016-Cain-Hom-37-48J. Colin Cox
This document summarizes the use of acoustic droplet ejection (ADE) liquid handling systems for genotyping genetically engineered mouse models. Key points:
- Traditional liquid handling robots are limited by low throughput, reproducibility issues, and cross-contamination risks. ADE provides contact-free liquid transfer at much higher speeds and precision.
- The authors integrated an ADE system into their workflow for PCR and qPCR reactions, allowing analysis of complex genetic models. ADE increased throughput by 8-10x compared to traditional robots.
- Testing showed ADE greatly improved data reproducibility and consistency for qPCR, while virtually eliminating cross-contamination risks. It also reduced reagent volumes for significant cost savings.
This study analyzed bacterial communities in drinking water biofilms using next-generation sequencing of 16S rRNA genes. Biofilm samples were collected from water meters and pipes in a drinking water distribution system in southern Sweden. Over 600,000 DNA sequences were obtained and classified. The bacterial communities differed between water meters from households with and without complaints about water quality. Water meters from complaining households had fewer Proteobacteria and more Nitrospira and Pedomicrobium. Biofilm communities also differed between water meters and pipes, with pipes containing more Mycobacterium, Nocardia, Desulfovibrio, and Sulfuricurvum. Next-generation sequencing resolved bacterial diversity and differences in communities associated with water quality
THE EFFECT OF WATER TREATMENT ON CALCIUM AND BERYLLIUM LEVELS OF WATER IN KAR...EDITOR IJCRCPS
Introduction: Water quality is an important issue for human health management.The aim of this research was to compare calcium
and beryllium levels in the water of Karun river at the influent stream of the water treatment plant number two (WTP2) in Ahvaz city
and Byblus and Anahita companies and their outlet water after the water treatment process. Materials and Methods: Fourteen
samples of Karun river water at the inlet of AhvazWTP2and Byblus and Anahita companies and their outlet water after the water
treatment process were collected during five months (September2013, and January - April 2014). Samples were taken fourteen
times, each time; five, one liter samples were collected. The samples were then mix and one liter composite sample was isolated
and transported to laboratory. The collected samples were filtered through filter paper (0.45 μm). For their fixation and pro tection
by nitric acid the pH adjusted ≤2 and was analyzed by ICP-MS. Results: it was shown that average of Calcium in water at the inlet
of AhvazWTP2and Byblus and Anahita companies and their outlet water after the water treatment process were 164.714, 94.571,
111.714, 54.485, 124.571, and 17.528 μg/l ,respectively. Also, average of Beryllium in water at the inlet of AhvazWTP2and Byblus
and Anahita companies and their outlet water after the water treatment process were 15.142, 5.714, 8.714, 2.571, 9.428 and 2.285
μg/l, respectively. Conclusion: The results showed that the purification process causes reduction in content of metals in waters
Keywords: Karun River, beryllium, calcium, water treatment process, ICP-MS.
This document discusses the analysis of microbial communities through sequencing of the 16S rRNA gene. It presents WATERS, a workflow system that automates and bundles various software tools for analyzing 16S rRNA sequence data. The goals of WATERS are to simplify the analysis process for users without specialized bioinformatics expertise and to facilitate reproducibility through tracking of data provenance. WATERS guides users through the typical sequence analysis steps of alignment, chimera filtering, OTU clustering, taxonomy assignment, phylogeny tree building, and ecological analyses and visualization. By integrating existing tools into a single automated workflow, WATERS aims to reduce the effort required for 16S rRNA data analysis and allow researchers to focus on biological interpretation of results.
Environmental Monitoring Model of Health, Parasitological, And Colorimetric C...theijes
The sanitary quality of water was evaluated in two micro basins, Bacaxá and Capivari belonging to the Lakes Basin St. John in the state of Rio de Janeiro, Brazil, for colimetric and parasitological analysis. Analyses were performed seasonally over a year and the levels of Escherichia coli were within the recommended only in the summer of 2012 and fall, and inappropriate with levels above recommended in winter, spring and summer of 2013 in both the micro basins. Through our observations, we compare the average values of the levels of total coliforms and Escherichia coli between both rivers. Initially, the samples indicate a similarity between the distributions of coliforms and Escherichia coli. However, Mann-Whitney-Wilcoxon test samples indicate that the distributions are different. In parasitological analysis it was observed that in Capivari was detected a greater presence of filarial larvae. Anthropogenic influences mainly by the presence of sewage is being able to compromise the health quality of the micro basins studied carrying a significant pollutant load to the Juturnaíba reservoir. The monitoring of the sanitary quality of the watersheds that supply the population may indicate when it is necessary to adopt more effective measures in the treatment of water supply of cities.
Physico-Chemical and Microbial Analysis of Drinking Water of Four Springs of ...IJEAB
Drinking water of good quality is essential for human physiology whose continual existence depends on the availability of water and any sort of contamination in water which is above the standard limits set by international water regulating agencies can lead to water related diseases. So, the present investigation was conducted to determine the physico-chemical and bacteriological contents of four springs i.e.Heshi spring 1, Heshi spring 2, Kitaab Roong, and Kooti spring and its distribution system such as water reservoir inlet, outlet, mid and end point of distribution systems, junction where it merge with glacier water. The temperature was in a range of 13oC - 22oC. The turbidity of water samples fluctuate from 0.02NTU-1.99NTU. The pH value was in a range of 6.2-7.1. Electrical conductivity range of minimum 122µS/cm to a maximum of 600µS/cm. The TDS of all water samples ranging from minimum of 164-513mg/l. The amount of reactive ortho phosphate was in a range of 26mg/l to 59mg/L. The amount of total phosphorous was in a range of minimum 23m/L to maximum of 120mg/L. The total bacterial count was in a range of 11CFU/100ml to 83 CFU/100ml.The findings showed there should be comprehensive standardization of drinking water of Danyore village according to guidelines of WHO water quality standards and make it safe for human consumption.
This document outlines a proposed MSc research project that will evaluate the microbiological quality and potential health risks of tanker-supplied borehole water and roof-harvested rainwater in Nsukka, Nigeria. The study will involve collecting water samples from storage tanks, analyzing them for pH, temperature, and bacterial indicators. Isolates will be characterized, tested for antibiotic susceptibility, and pathogenic bacteria will be identified using PCR. Finally, a quantitative microbial risk assessment will estimate health risks associated with using the water sources. The expected outcomes are providing baseline water quality data, encouraging similar research, and publishing at least two journal articles.
This document discusses using environmental DNA (eDNA) to analyze zooplankton distribution in Monterey Bay, California from 2010-2015. Water samples were collected and eDNA was extracted and sequenced to identify species. Results found copepods but little krill DNA. This could be due to methodological errors or krill DNA being misidentified as flies. While eDNA has potential, improvements are needed as it is a new technique prone to errors. Climate change is reducing biodiversity, making monitoring important for conservation.
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
Investigation of the effect of initial biomass on nitrate and phosphate remov...Alexander Decker
This study investigated the effect of initial biomass concentration on the ability of four bacterial species
(Klebsiella sp., Pseudomonas sp., Lysinibacillus sp., and Staphylococcus sp.) to remove nitrate and phosphate from synthetic wastewater. The bacteria were inoculated at different concentrations and their ability to remove nutrients was measured over 96 hours. All isolates significantly removed nitrate except Lysinibacillus sp., removing between 68-91% nitrate. Phosphate removal was slight. The study revealed the nutrient removal abilities of the isolates at different initial biomass concentrations.
The document summarizes a quantitative microbial risk assessment (QMRA) model developed to estimate the risk of cryptosporidiosis from drinking water in Philadelphia. Key points:
- The model estimates the risk of cryptosporidiosis from the concentrations of Cryptosporidium oocysts in the source water and the log removal achieved by the water treatment process.
- Risk estimates are provided for the current treatment and for nanofiltration under average annual conditions and turbidity spikes. All risks are below EPA's 1 in 10,000 annual infection risk goal.
- Additional risk management options like improved turbidity removal, UV disinfection, and public education on vulnerable groups are discussed to further reduce risks
The document summarizes a quantitative microbial risk assessment (QMRA) model developed to estimate the risk of cryptosporidiosis from drinking water in Philadelphia. Key points:
- The model estimates the risk of cryptosporidiosis from the concentrations of Cryptosporidium detected in the source water and the log removal achieved by the water treatment process.
- Risk estimates are provided for the current treatment and for nanofiltration under average annual conditions and turbidity spikes. All risks are below EPA's 1 in 10,000 annual infection risk goal.
- Additional risk management options like improved turbidity removal, UV disinfection, and public education on vulnerable groups are discussed to further reduce risks.
Similar to Domestic-wastewater-influent-profiling-using-mitochondrial-real-time-PCR-for-source-tracking-animal-contamination_2008_Journal-of-Microbiological-Methods (20)
This study examined the presence of Borrelia burgdorferi, the bacterium that causes Lyme disease, in blacklegged ticks and rodents across five sites on the Outer Banks of North Carolina over an 18-year period from 1991 to 2009. B. burgdorferi was detected in questing blacklegged ticks and isolated from white-footed mice, rice rats, and marsh rabbits sampled at the sites. Sequence analysis confirmed the isolates were B. burgdorferi sensu stricto. The long-term detection of the bacterium across multiple years and locations indicates it is stably transmitted between ticks and rodent populations in this region.
1) The study examined the survival of E. coli O157:H7 in commercial cucumber fermentation brines and cucumber juice media under different conditions.
2) The results showed that the time needed for a 5-log reduction of E. coli ranged from 3 to 24 days depending on the pH of the commercial brines, which ranged from 3.2 to 4.6.
3) In laboratory cucumber juice media that had been previously fermented to a pH of 3.9, a 5-log reduction was achieved within 1 to 16 days depending on pH, acid concentration, and temperature.
This document discusses superoxide dismutases (SODs) in the bacteria Azotobacter chroococcum and Azotobacter vinelandii. It finds that:
1) A. chroococcum and A. vinelandii only contain iron-containing SOD and copper-zinc SOD, and do not contain manganese SOD.
2) Genomic DNA analysis using sodA- and sodB-specific primers only produced a product for sodB, and not sodA, disputing a previous report that A. chroococcum contains manganese SOD.
3) The results confirm previous findings of iron SOD and copper-z
This document describes a new species of bacteria, Pectinatus sottacetonis sp. nov., that was isolated from a commercial pickle spoilage tank. The bacterium, strain FSRU B0405T, was identified as a member of the genus Pectinatus based on 16S rRNA gene sequencing and phylogenetic analysis. P. sottacetonis is a strictly anaerobic, Gram-negative, non-spore-forming rod that is motile with distinctive X-shaped movement. Biochemical and physiological characterization differentiated P. sottacetonis from other Pectinatus species. The document proposes P. sottacetonis as a novel species based on its phenotypic and genetic
This document summarizes a study that evaluated mitochondrial DNA (mtDNA) fragmentation as a potential time-temperature integrator for monitoring safety and quality in dry roasted peanuts. MtDNA fragmentation was measured using quantitative PCR (qPCR) and compared to reduction of the Salmonella surrogate Enterococcus faecium and changes in peanut color (Hunter L value) during roasting. While E. faecium reduction curves were highly repeatable, mtDNA fragmentation did not correlate linearly with time at a given temperature. Dissection of individual peanuts also showed differential heating effects depending on peanut part. The researchers determined that mtDNA fragmentation as measured by qPCR was too variable for validation of dry roasted peanut processes but could help evaluate heat penetration through
JFS#2 final before print 10-9-15 jfds13139_Rev (1)Jane Caldwell
Mitochondrial DNA (mtDNA) fragmentation was assessed in acidified foods using quantitative PCR (qPCR). Ct values from cucumber mtDNA at different processing stages and storage times were significantly different, indicating mtDNA fragmentation from low temperature (75C for 15 min) processing in acidic conditions (pH 3.8). Pasteurization of tomato serum at 95C for varying times highly correlated Ct values to time-temperature treatment. Longer qPCR amplicons provided greater sensitivity to differentiate heat treatments. MtDNA fragmentation is a potential tool to characterize low temperature (<100C) high acid processes, fermentations, and storage of acidic plant products.
Mito low acid final JFS#1 10.1111-1750-3841.12937Jane Caldwell
This document describes a new method for monitoring thermal processing of plant-based foods using quantitative PCR (qPCR) to measure fragmentation of mitochondrial DNA (mtDNA). Universal primers were developed to amplify a conserved mtDNA gene (atp1) present in many plants. Using a sweet potato puree model, the increase in qPCR cycle threshold (Ct) values correlated highly with increased time and temperature of thermal processing, as well as reduction of bacterial spores. The kinetics of mtDNA fragmentation were similar to validated microbial indicators. This novel approach provides a rapid, molecular tool for validating and monitoring thermal food processing as an alternative or supplement to traditional microbiological methods.
Biopeptides article for Prog Dairyman 6-12-16Jane Caldwell
This document discusses biopeptides, which are small protein fragments produced during the fermentation of milk by probiotic bacteria. There are several key points:
1) Biopeptides have beneficial physiological effects when consumed, such as reducing stress and lowering blood pressure. They act like hormones or messengers in the body.
2) Fermented milk products like yogurt contain higher concentrations of biopeptides than plain milk due to the fermentation process. These biopeptides can improve mineral absorption and immune function.
3) As populations age, fermented milk products containing biopeptides may become more popular functional foods due to their potential health benefits compared to caffeinated energy drinks.
Abiotics are non-viable bacteria and their fermentation products that can provide health benefits to hosts when consumed. Abiotics offer advantages over probiotics and prebiotics such as longer shelf life without refrigeration, stimulating the immune system through components like peptidoglycan in cell walls, and feeding beneficial gut bacteria through metabolites. Abiotics are also safer options as they cannot mutate, become pathogenic, or transfer antibiotic resistance, and provide benefits through binding toxins and pathogens without host specificity issues of probiotics.
2. contamination (Siewicki et al., 2007; Somarelli et al., 2007; Ram et al.,
2007; Yan et al., 2007).
2. Materials and methods
2.1. Sample collection and concentration
Composite samples (500 ml pooled from 24 hourly samples) of
domestic wastewater influent were collected weekly at the same day
and time for twelve weeks from two local wastewater treatment
facilities. The Town of Holly Springs Wastewater Treatment Plant
processes 1.1 million gallons per day of mostly domestic wastewater
from a population of approximately 20,000 people. Holly Springs
WWTF discharges into Utley Creek in southwestern Wake County, NC.
Besides domestic sources, Holly Springs also processes wastewater
from two light industries: a corrugated container plant that produces
plastic and cardboard waste and a microbrewery, which produces beer
locally. The South Cary Water Reclamation Plant is a biological
nutrient removal system with filtration. The plant has a treatment
capacity of 12.8 million gallons per day and services 55,000 residents.
Located on Middle Creek in southern Wake County, it processes
wastewater from homes and small, non-industrial businesses such as
offices and restaurants.
Influent samples were collected in 500 ml sterile centrifuge bottles
and concentrated by centrifugation using a Sorvall RC-5B plus
superspeed centrifuge (Thermo Electron Corp., Asheville, NC) at
9000 g for 15 min. Pellets were resuspended in remaining liquid
(~5–25 ml) after supernatant aspiration. Concentrations obtained
were approximately 6-fold as determined by DNA measurements
(260 nm) taken with NanoDrop spectrophotometer (NanoDrop
Technologies, Wilmington, DE) before and after centrifugation.
2.2. Chemical parameters
Holly Springs WWTF assayed influent for fecal coliforms (CFU/
100 ml), BOD (biological oxygen demand, mg/l), TSS (total
suspended solids, mg/l), ammonia (mg/l), total P (phosphorus,
mg/l), and total N (nitrogen, mg/l) according to Standard Methods
18th edition (AWWA et al., 1992). South Cary WWTF assayed for
alkalinity (mg/l), TSS, TVSS (total volatile suspended solids, mg/l),
ammonia, BOD, TKN (total Kjeldahl nitrogen, mg/l), NOx (nitrate+
nitrite nitrogen, mg/l), total N, total P and pH (SU) according to
Standard Methods 20th edition (AWWA et al., 1999). Both facilities
test chemical parameters from composite influent samples on a
daily basis to monitor process controls for the National Pollutant
Discharge Elimination System (NPDES, 2008), (http://cfpub.epa.
gov/npdes/home.cfm?program_id=13).
2.3. Spectrophotometric parameters
A NanoDrop spectrophotometer (NanoDrop Technologies,
Wilmington, DE) was used to assess influent samples before and
after concentration by centrifugation (initial and final readings,
respectively) (Table 3). Wavelengths of 260, 600 and 340 nm were
recorded, corresponding to DNA concentration, bacterial culture
optical density (OD600) and humic acid concentration (Lakay et al.,
2007), respectively.
2.4. DNA extraction
Influent samples were frozen at −20 °C overnight then thawed at
55 °C. One ml aliquots were heated at 99 °C, 300 rpm for 5 min. This
formed a crude DNA preparation suitable for real-time PCR.
2.5. Primer and probe design
Three species-specific primer and dual-labeled probe sets (human,
bovine, and swine) specific for amplification of mitochondrial gene
NADH dehydrogenase subunit 5 (ND5) for a multiplex real-time PCR
assay were previously published (Caldwell et al., 2007): human
forward primer (5′-CAG CAG CCA TTC AAG CAA TGC-3′), human
reverse primer (5′-GGT GGA GAC CTA ATT GGG CTG ATT AG-3′),
human probe (5′-TAT CGG CGA TAT CGG TTT CAT CCT CG-3′), bovine
forward primer (5′-CAG CAG CCC TAC AAG CAA TGT-3′), bovine
reverse primer (5′-GAG GCC AAA TTG GGC GGA TTA T-3′), bovine
probe (5′-CAT CGG CGA CAT TGG TTT CAT TTT AG-3′), swine forward
primer (5′-ACA GCT GCA CTA CAA GCA ATG C-3′), swine reverse
primer (5′-GGA TGT AGT CCG AAT TGA GCT GAT TAT-3′), and swine
probe (5′-CAT CGG AGA CAT TGG ATT TGT CCT AT-3′). The dual-labeled
probes were conjugated with Quasar 570, Cal Red, and FAM at the 5′
ends for human, bovine, and swine probe, respectively. The probe 3′
ends utilized Black Hole quenchers (BioSearch Technologies; Novato,
CA).
New species-specific primers and probes for real-time PCR
(singleplex) were developed using Primer Quest software (http://
scitools.idtdna.com/Primerquest/) for amplification of mitochon-
drial genes NADH dehydrogenase subunit 5 (ND5) for dog and cat,
ND2 for Canada goose, and cytochrome b (cytb) for white-tailed
deer (Table 1). All primers, including those previously published,
were adjusted for mismatch amplification mutation assay (Cebula
et al., 1995) utilizing penultimate primer mismatch kinetics to
increase their specificity. Primers were purchased from IDT (http://
www.idtdna.com). Dual-labeled probes were purchased from
BioSearch (www.biosearch.com) with 3′ black hole quenchers,
(BHQ), and 5′fluorophores Quasar 570, Cal Red, and Quasar 670
corresponding to Cy3, Texas Red and Cy5, respectively (Table 1). All
oligonucleotides were reconstituted in TE buffer (pH 7.5) and stored
at −20 °C prior to use.
2.6. Standard curves and assay specificity
Standard curves were generated using 10-fold serial dilutions
(107
–100
) of mtDNA copies produced from double PCR amplifications
Table 1
Mitochondrial real-time PCR primers and probes
Primer or
probea
Nucleotide sequence (5 to 3′) Tm
(°C)
Location
within
targetb
Amplicon
size (bp)
Dog forward GGCATGCCTTTCCTTACAGGATTC 58.2 1144–1167 102
Dog reverse GGGATGTGGCAACGAGTGTAATTATG 57.9 1227–1245
Dog probe TCATCGAGTCCGCTAACACGTCGAAT 61.2 1184–1209
Cat forward AACTATTCATCGGCTGAGAGGCA 58.1 416–438 143
Cat reverse GCTATGATGAAGCCTACGTCTCCAAAG 58.9 537–560
Cat probe ATGCAAACACTGCCGCCCTACAAGCAAT 64.5 488–515
Canada goose
for
CTAACATCCAAATCCCTCGACCCA 58.5 430–453 77
Canada goose
rev
TCCTATTCAGCCTCCTAGTGCTCT 58.8 484–507
Canada goose
probe
TACTCACCGCCATAGCCCTAGCCT 63.1 458–482
Deer forward TAACCCGATTCTTCGCCTTCCTCT 59.7 524–547 122
Deer reverse GTCTGCGTCTGATGGAATTCCTGAT 58.8 624–648
Deer probe CCTCCCATTTATCATCGCAGCACTTGCT 62.3 592–579
a
Primers and probes were designed using IDT Primer Questsm
program (http://scitools.
idtdna.com/Primerquest/) and adjusted for mismatch amplification mutation assay
(MAMA) (Cebula et al., 1995) in primers and species-specificity in probes. The dual-
labeled probes were conjugated at the 5′ ends with Quasar 670 for cat and deer and FAM
for dog and C. goose. The probe 3′ ends utilized Black Hole quenchers (BioSearch
Technologies; Novato, CA).
b
Positions of the oligonucleotides are listed relative to the numbering of gene ND5
(dog and cat), ND2 (C. goose) and cytb (deer) in VectorNTI version 10.1 (2005, Invitrogen
Corp). Nucleotide sequences were retrieved from GenBank™
(http://www3.ncbi.nlm.nih.
gov) under accession numbers AY656739 (dog), NC_1700 (cat), NC_007011 (C. goose), and
DQ379370 (deer).
2 J.M. Caldwell, J.F. Levine / Journal of Microbiological Methods xxx (2009) xxx–xxx
ARTICLE IN PRESS
Please cite this article as: Caldwell, J.M., Levine, J.F., Domestic wastewater influent profiling using mitochondrial real-time PCR for source
tracking animal contamination, J. Microbiol. Methods (2009), doi:10.1016/j.mimet.2008.11.007
3. of dog (ND5), cat (ND5), Canada goose (ND2) and white-tailed deer
(cytb) mitochondrial clones. Using the real-time PCR assay (Section
2.7), a composite of two identical experiments (performed on separate
days) is shown (Fig. 1). Amplicons were cloned using the TOPO TA kit
(Invitrogen, Carlsbad, CA), sequenced (Section 2.8) and NCBI BLAST
searches were performed to verify sequence identity. Standard curves
and PCR amplification efficiencies for multiplex real-time PCR of
human, bovine and swine mtDNA were published previously
(Caldwell et al., 2007).
Pet and wildlife primers and probes were tested for real-time PCR
cross-reactions with other avian, mammalian and piscine feces and
found to be species-specific (data not shown). Annealing tempera-
tures, thermal cycler background and cycle threshold levels were
optimized for each primer/probe set.
2.7. Real-time PCR
Multiplex and singleplex real-time PCR was run in 25 µl volume
reaction tubes (Cepheid; Sunnyvale, CA) with OmniMix Bead (TaKaRa
Bio Inc.; Madison, WI), (1.5U TaKaRa hot start Taq polymerase, 200 µM
dNTP, 4 mM MgCl2, 25 mM HEPES pH 8.0), forward and reverse
primers (300 nM each) and probe (320 nM) (Table 1), additional
1.5 mM MgCl2 (5.5 mM final MgCl2), 5 µl of crude DNA from influent or
known mitochondrial copies for the standard curve, and RT-PCR water
(Ambion, Austin, TX) to final volume.
Amplifications were performed in a Cepheid Smart Cycler II
thermal cycler (Cepheid, Sunnyvale, CA) with the following condi-
tions: 95 °C for 120 s, 40 cycles of 94 °C for 10 s, 60 °C for 12 s, and 72 °C
for 10 s. Four fluorophore channel optics were in use during
annealing: FAM, Cy3, Texas Red, and Cy5. This rapid real-time PCR
assay runs ca. 40 min.
No template (NTC) and positive controls (103
–105
ND5, ND2, or
cytb amplicon copies) were used for all assays. For a sample to be
considered positive, its CT value had to be 5 CT values less than all
negative control reactions and its corresponding amplification curve
had to exhibit the three distinct phases of real-time PCR: lag, linear,
and plateau. Positive signals below 100 copies per reaction for the
multiplex (human, bovine and swine) and 10 copies per reaction for
Fig. 1. Standard curves for mitochondrial real-time PCR assays. The composite of two identical experiments (performed on separate days) is shown. Mitochondrial copies of DNA
from dog (A), cat (B), Canada goose (C) and white-tailed deer (D) were diluted 10-fold in RT-PCR water (Ambion, Austin, TX) to construct the standard curves. Threshold values (CT)
were plotted against the corresponding mitochondrial copy numbers, and the linear range, the slope (m) and goodness-of-fit of the linear regression coefficient (r2
) were
determined. The PCR amplification efficiencies were 93.5, 95.5,104.4, and 105.8% for dog, cat, Canada goose and white-tailed deer, respectively. PCR efficiencies were calculated by
the formula: E=(10(− 1/slope)
)−1.
3J.M. Caldwell, J.F. Levine / Journal of Microbiological Methods xxx (2009) xxx–xxx
ARTICLE IN PRESS
Please cite this article as: Caldwell, J.M., Levine, J.F., Domestic wastewater influent profiling using mitochondrial real-time PCR for source
tracking animal contamination, J. Microbiol. Methods (2009), doi:10.1016/j.mimet.2008.11.007
4. singleplex assays (dog, cat, Canada goose, white-tailed deer) were
discarded as noise. Internal amplification controls (IAC) were
employed to check for PCR inhibitors: 103
copies of human ND5
amplicon were added to a sample aliquot and compared to the human
mitochondrial copy number standard curve or another IAC sample
with only water and master mix added.
2.8. Amplicon sequencing
Real-time PCR amplicons and mitochondrial clones of dog, cat,
Canada goose and white-tailed deer were sequenced following the
recommended protocol with the ABI BigDye v. 3.1 sequencing kit
(Applied Biosystems; Foster City, CA). Sequencing reactions were
purified using an ethanol/ammonium acetate precipitation protocol
(Irwin et al., 2003) and visualized using an ABI 3130XL Automated
Sequencer (Applied Biosystems, Foster City, CA). Sequences were
compiled in Sequencher version 4.5 (Gene Codes Corp., Ann Arbor, MI)
and NCBI BLASTsearches were performed to verify sequence identities.
2.9. Statistical analyses
Amplification efficiency (E) of the PCR assay was determined for
pet and wildlife primer/probe sets using the slope of the standard
curve: E=(10−1/slope
)−1. Data analysis of the real-time PCR standard
curves was performed using Origin software version 7.5 (OriginLab
Corp., Northampton, MA). Least squares linear regression coefficient of
determination (r2
, goodness-of-fit) and slope were used to assess the
quality of each real-time primer and probe set (Fig. 1).
Pearson correlation coefficient analysis using SAS 9.1 software was
used to compare bacterial, chemical and spectrophotometric para-
meters with human, bovine, and dog mtDNA concentrations by site
(Table 3).
3. Results
3.1. Linear range and amplification efficiency of real-time PCR assays
Standard curves were generated using serial dilutions of known
mitochondrial ND5, ND2 or cytb copies to determine the linear range
and amplification efficiencies of the real-time PCR assay for dog, cat,
Canada goose and white-tailed deer (Sections 2.5 and 2.6). Linear
ranges between 101
and 107
copies were noted for dog and cat,100
and
107
for Canada goose and white-tailed deer (Fig. 1). These are
comparable to ranges in clinical real-time PCR literature. Polymerase
chain reaction amplification efficiencies for dog, cat, Canada goose and
white-tailed deer were 94, 96, 104 and 106%, respectively (Fig. 1).
Linear regression coefficients (r2
) were 0.99 for all standard curves
except for cat (r2
=0.97). Linear range and efficiencies for multiplex
real-time PCR (human, bovine and swine) were determined pre-
viously (Caldwell et al., 2007).
3.2. PCR assay specificity for dog, cat, Canada goose and white-tailed deer
Mitochondrial clones created for standard curves of dog, cat,
Canada goose and white-tailed deer (NCBI accession numbers
EU078704–EU078707) exhibited 99, 97, 98, and 97% sequence identity,
respectively, to their species of origin when subjected to NCBI BLAST
analysis (data not shown). Amplicons (77–143 bp) were found to have
100% identity to their designated species when subjected to NCBI
BLAST analysis (data not shown). Detection of mitochondrial DNA was
species-specific for new primer/probe sets in fecal samples with no
cross-reactions with other species tested nor human, bovine, swine,
horse, sheep, goat, turkey, duck, chicken, or tilapia (data not shown).
White-tailed deer was also tested against llama with no cross-reaction.
3.3. Mitochondrial DNA detection in influents
A freeze/thaw method followed by a brief heat treatment (99 °C,
300 rpm for 5 min) was used to extract DNA from wastewater
influents. The heat treatment was found to improve detection results
in complex effluent samples. Multiplex (human, bovine and swine
together) and singleplex (dog, cat, Canada goose, and white-tailed
deer separately) real-time PCR using species-specific primers and
probes were used to detect, quantify and characterize mtDNA in
wastewater influents from two local municipal plants.
Human and dog mtDNA signals were detected in all 24 influent
samples taken over a period of approximately 6 months (Tables 2A
and 2B), although dog signals under 10 copies/reaction were not
included due to previously determined lower limits (Section 2.7),
(Caldwell et al., 2007). Also, sample 1 at the South Cary facility
exhibited only 76 human copies/reaction (Table 2B) which was below
the previously set lower limit of 100 copies for human mtDNA
detection in the multiplex assay. Mean human mtDNA copies/ml were
1.2×105
and 7.3×104
for Holly Springs (HS) and South Cary (SC)
WWTF, respectively. Mean dog mtDNA copies/ml were approximately
Table 2A
Holly Springs WWTF mitochondrial copies/ml influenta
Sample Human Bovine Swine Dog Cat Deer Canada goose
1 2.3×104
2.5×104
0 ⁎ ⁎ 0 0
2 1.3×105
5.5×104
1.5×104
⁎ 0 0 0
3 1.1×105
4.3×103
0 ⁎ 0 ⁎ 0
4 1.4×105
⁎ ⁎ 8.9×102
0 0 0
5 2.5×105
1.9×105
0 3.7×102
0 0 0
6 2.1×104
1.3×105
0 8.3×102
0 0 0
7 2.0×105
3.6×104
0 4.4×102
0 0 0
8 3.8×104
3.9×104
7.6×103
7.8×102
0 0 ⁎
9 1.7×105
8.0×104
0 7.7×102
0 ⁎ ⁎
10 1.9×105
2.5×104
0 ⁎ 0 0 0
11 8.9×104
0 0 3.1×103
0 7.9×102
0
12 3.7×104
0 0 4.3×102
0 0 3.8×102
Mean 1.2×105
4.8×104
1.9×103
6.4×102
0 6.6×101
3.1×101
SD 0.8×105
5.8×104
4.6×103
8.6×102
0 2.3×102
1.1×102
Italics = Only 1 out of 3 reps had CT N0. ⁎Positive reading below predetermined lower
limits (Section 2.7).
a
Detection of mtDNA in crude preparations of domestic and light industrial
wastewater influents taken weekly from 1/9/07 to 6/26/07. DNA was extracted using
freeze/thaw method followed by heating at 99 °C, 300 rpm for 5 min and assayed by
multiplex real-time PCR (human, bovine, swine) or singleplex real-time PCR (dog, cat,
deer, Canada goose) using species-specific primer and probe sets. All numbers corrected
by concentration factors.
Table 2B
South Cary WWTF mitochondrial copies/ml influenta
Sample Human Bovine Swine Dog Cat Deer Canada goose
1 2.2×103b
0 0 ⁎ 0 0 0
2 5.5×104
0 0 3.3×102
0 0 ⁎
3 3.4×104
6.2×103
0 5.2×102
0 0 0
4 1.4×105
0 0 4.9×102
0 0 0
5 4.5×104
0 0 4.9×102
0 0 0
6 1.7×105
1.0×105
⁎ 6.6×102
0 0 0
7 1.5×105
0 0 8.4×102
0 0 0
8 4.6×104
⁎ 0 3.4×102
0 ⁎ ⁎
9 9.1×104
⁎ 0 3.6×102
⁎ ⁎ 0
10 5.9×104
1.7×104
0 2.9×102
1.3×103
⁎ 0
11 5.5×104
2.4×103
0 5.0×102
⁎ ⁎ ⁎
12 3.4×104
1.2×103
0 1.5×102
0 ⁎ ⁎
Mean 7.3×104
1.1×104
0 4.2×102
1.1×102
0 0
SD 5.3×104
2.9×104
0 2.2×102
3.8×102
0 0
Italics = Only 1 out of 3 reps had CT N0. ⁎Positive reading below predetermined lower
limits (Section 2.7).
a
Detection of mtDNA in crude preparations of domestic and light industrial
wastewater influents taken weekly from 1/9/07 to 6/26/07. DNA was extracted using
freeze/thaw method followed by heating at 99 °C, 300 rpm for 5 min and assayed by
multiplex real-time PCR (human, bovine, swine) or singleplex real-time PCR (dog, cat,
deer, Canada goose) using species-specific primer and probe sets. All numbers corrected
by concentration factors.
b
76 copies/reaction.
4 J.M. Caldwell, J.F. Levine / Journal of Microbiological Methods xxx (2009) xxx–xxx
ARTICLE IN PRESS
Please cite this article as: Caldwell, J.M., Levine, J.F., Domestic wastewater influent profiling using mitochondrial real-time PCR for source
tracking animal contamination, J. Microbiol. Methods (2009), doi:10.1016/j.mimet.2008.11.007
5. 200 times lower than human signal at 6.4×102
and 4.2×102
,
respectively. With one exception, all human and dog replicates
(three for each sample) had CT values N0. Bovine mtDNA signal
(mean of both plants=3.0×104
copies/ml) was less consistent having 9
out of 12 and 5 out of 12 positive samples for HS and SC, respectively.
Swine mtDNA (mean=1.9×103
copies/ml for HS) was intermittent,
found in only 2 positives out of 24 total samples and in only 1/3
replicates in one of the 2 positive samples. The bovine signal was
approximately 1 and the swine approximately 2 orders of magnitude
lower than the human mtDNA signal. Cat mtDNA (1.1×102
copies/ml)
was found only once in SC and at lower levels than dog. Deer and
Canada goose signals (6.6×101
and 3.1×101
copies/ml, respectively)
each had 1 positive out of 24 samples (Tables 2A and 2B).
3.4. Correlations between mtDNA concentrations and other parameters
Human mtDNA concentration (copies/ml) was positively corre-
lated with ammonia concentration (P=0.01) and initial OD600 reading
(P=0.02) at Holly Springs WWTF only (Table 3). Bovine mtDNA was
positively correlated with biological oxygen demand (BOD) (P=0.02),
final DNA concentration (P=0.03), initial and final humic acid (P=0.01,
P=0.01), and final OD600 (P=0.03) at Holly Springs WWTF and total
suspended solids (TSS) (P=0.04, P=0.09) at HS and SC plant,
respectively. Fecal coliforms were not correlated with mtDNA of any
species assayed. No other significant (Pb0.05) correlations were
apparent in influents from the South Cary (SC) facility.
4. Discussion
Wastewater treatment systems use a variety of vital biotechnolo-
gical and natural processes to treat fecal waste and render the liquids
safe for release into local streams or land applications. If a wastewater
system fails due to environmental catastrophes, mechanical malfunc-
tions or mismanagement, methods are required to trace the location
and extent of the breach. However, when enteric organisms are
documented in surface waters, their origin is sometimes not readily
apparent or difficult to pinpoint with bacterial methods (Yan et al.,
2007). Amplification of eukaryotic mitochondrial DNA (mtDNA)
identifies the source directly and can be used after culture and
chemical methods to characterize contaminants. We used real-time
PCR to characterize and quantify mtDNA in domestic wastewater
influent (untreated sewage) using primer/probe sets for human,
bovine, swine, dog, cat, Canada goose and white-tailed deer. These
species mtDNA values provide a baseline for identifying unintentional
discharges of influent from domestic wastewater facilities and
differentiating among other mammalian effluents such as hog lagoon
wastes or dairy barn run-off. Mitochondrial DNA shed from the
epithelial cells of eukaryotic hosts can be used in conjunction with
more traditional bacterial source tracking methods to directly identify
the fecal source contaminating environmental surface waters.
The triplex mitochondrial real-time PCR assay (human, bovine,
swine) was used previously to quantify animal waste effluents
(Caldwell et al., 2007). Human signal was diluted 115-fold in domestic
wastewater: 1.1×107
copies/g feces (Caldwell et al., 2007) compared
to 9.6×104
copies/ml influent, (mean value of two WWTF influents,
Tables 2A and 2B). In the same article, carry-over mtDNA signal from
beef consumed was found in human feces at least two orders of
magnitude less than the signal for human mtDNA (2×104
and
3×105
copies/g feces). Bovine signal is similar in domestic wastewater
(mean of both plants=3.0×104
copies/ml, Tables 2A and 2B) as
compared to human carry-over mtDNA in feces. Bovine mtDNA
concentration shows no dilution in influent, as is the case with human
mtDNA. Swine mtDNA exhibited no carry-over signal in human feces
(Caldwell et al., 2007) but averaged 1.9×103
copies/ml influent in two
out of 24 samples. Therefore, real-time PCR signals from bovine and
swine mtDNA in domestic wastewater are probably primarily from
food waste flushed down the sink and not carryover in feces.
The most surprising result of these effluent profiles was the con-
sistent signal from dog mtDNA in domestic wastewater. The
Humane Society of the United States (http://www.hsus.org/pets/
issues_affecting_our_pets/pet_overpopulation_and_owership_statis-
tics/us_pet_ownership_statistics.html) cites 73 million owned dogs in
the US. The American Pet Products Manufacturers Association states
that 45% of dogs in the 2000 census were large dogs of 40 lb or more
(http://www.usatoday.com/news/science/2002-06-07-dog-usat.
htm). Therefore, the potential for large volumes of dog waste is
indisputable; but apparently many dog owners flush dog waste
down the sanitary drain. In many suburban areas, dog owners are
required to pick up their pet's feces. Toilet disposal of this waste
may account for this consistent dog mtDNA signal in domestic
influent. Cat mtDNA signal only occurred once in 24 samples.
Therefore, cat owners are not flushing cat waste as often as dog
owners, the total volume of cat feces is considerably less than
canine feces, or total cat mtDNA is below detectable levels for real-
time PCR.
Canada goose and white-tailed deer mtDNA were intended to be
negative controls for these domestic wastewater influent studies.
However, each wild species had one positive sample in HS plant
(Table 2A). Although, the goose mtDNA signal was positive in only 1
out of 3 replicates of the same sample (Table 2A). Chimeric ampli-
fication of complex DNA mixtures could give spurious results such as
these. Low, intermittent, and inconsistent (only one positive out of
three replicates) real-time PCR signals should be evaluated conser-
vatively. Due to small sampling size and complex biological back-
grounds, it can be challenging to assess environmental samples with
quantitative molecular techniques.
Human mtDNA can be attributed to human feces and possibly
bath or wash water from homes and small businesses. Bovine and
swine signal might come from human feces carry-over (Caldwell
et al., 2007) but more likely from meats, grease and animal products
washed down kitchen drains. Dog signal is not as strong as human,
bovine or swine signal, but consistent at ca. 102
copies/ml influent
and is probably a result of flushing of dog feces in household toilets
after daily walks and “accidents”. Cat signal comes from flushing
feces from the cat box; the lower amounts for cat might reflect lower
feces weights of the smaller mammals. Deer and Canada goose signal
were not expected and could be caused by chimeric PCR amplifica-
tion. For source tracking purposes, a combination of human
(105
copies/ml) and dog mtDNA signal (102
copies/ml) could be
indicative of municipal domestic wastewater contamination of
environmental waters.
Table 3
Comparison of influent parameters at Holly Springs WWTF
Mitochondrial copies/ml influent
Human Bovine
r P r P
Fecal coliforms (CFU/ml) 0.31 0.32 −0.05 0.88
BOD (mg/l) 0.09 0.79 0.66 0.02
TSS (mg/l) 0.19 0.55 0.60 0.04
Ammonia (mg/l) 0.70 0.01 0.43 0.16
Final DNA (260 nm) 0.23 0.47 0.62 0.03
Initial humic acid (340 nm) 0.43 0.17 0.68 0.01
Final humic acid (340 nm) 0.37 0.24 0.69 0.01
Initial OD600 0.65 0.02 0.15 0.64
Final OD600 0.56 0.06 0.64 0.03
r = Pearson correlation coefficient; Pb0.05 in bold type (N=12). Dog mitochondrial
copies/ml influent showed no significant positive or negative correlations. Total P, total
N and initial DNA concentration showed no significant positive or negative correlations
with either human or bovine mitochondrial copies/ml influent. Initial and final refer to
before and after centrifugation, respectively. South Cary WWTF had no correlations at
Pb0.05. BOD = Biological oxygen demand; TSS = total suspended solids.
5J.M. Caldwell, J.F. Levine / Journal of Microbiological Methods xxx (2009) xxx–xxx
ARTICLE IN PRESS
Please cite this article as: Caldwell, J.M., Levine, J.F., Domestic wastewater influent profiling using mitochondrial real-time PCR for source
tracking animal contamination, J. Microbiol. Methods (2009), doi:10.1016/j.mimet.2008.11.007
6. Other researchers (Plummer and Long, 2007) have demonstrated
statistically that one measure each of particulate matter (turbidity,
particle counts), organic matter (total organic carbon, dissolved organic
carbon, UV254 absorbance), and indicator organisms (fecal coliforms,
enterococci) was adequate for characterizing source water quality. In
this study, ammonia concentration at one WWTF exhibited a strong
positive correlation with human mtDNA concentration. Neither human
nor bovine mtDNA concentration exhibited a significant correlation
with fecal coliforms (Table 3). Yet, human mtDNA showed a strong
positive correlation to initial OD600 reading (P=0.02) and bovine mtDNA
likewise to final OD600 reading (P=0.03). We interpret this as a strong
correlation to total bacteria in the influent, since OD600 is commonly
used to quantify bacterial cell concentrations in cultures. However, it is
possible that TSS (total suspended solids) could confound the OD600
reading. Bovine mtDNA also had strong positive correlations with TSS
(P=0.04), final DNA (P=0.03), initial and final humic acid (P=0.01 for
both) while human mtDNA did not. Correlations with total suspended
solids and both humic acid readings point to discarded food products as
the primary source for bovine mtDNA. Strong ammonia and initial
OD600 correlations suggest human waste, urine and feces, respectively,
as the primary indicators or components of human mtDNA.
Humic acid concentration can be calculated from standard curves
and absorbancy readings at 340 nm (Lakay et al., 2007). We used
340 nm as a quick indicator of humic acid, an organic contaminant and
potential PCR-inhibitory compound that can co-purify with DNA. We
found no PCR inhibition as tested by internal amplification controls
and therefore could not relate inhibition to humic acid concentration.
No significant correlations between mtDNA concentrations and
other influent parameters were noted at the South Cary WWTF. This
could reflect variations in laboratory techniques or personnel, or the
influent compositions from each site.
This study provides a baseline profile of domestic wastewater
influent for mtDNA-based differentiation of sources of fecal contam-
ination. Further studies are needed to create mtDNA profiles of
residential septic systems, agricultural and wildlife sources of fecal
contamination. Comparison of these profiles with other molecular,
bacterial, chemical and spectrophotometric parameters will refine our
ability to source track fecal contamination in surface waters.
Acknowledgments
Funds supporting these studies were provided by the United States
Department of Agriculture Cooperative State Research, Education and
Extension Service (USDA CSREES); National Research Initiative
Epidemiological Approaches to Food Safety Program and the USDA
CSREES supported Food Safety Research and Response Network: a
USDA Cooperative Agricultural Project. We thank Leisha Collins and
Tony Szempruch for their assistance in the collection and processing
of influent; Amy Moore and the staff of the Town of Holly Springs
Department of Water Quality, Cecil Martin and Kelly Spainhour of the
South Cary Water Reclamation Facility for influent samples and
influent chemical data.
References
Andreasson, H., Gyllensten, U., Allen, M., 2002. Real-time DNA quantification of nuclear
and mitochondrial DNA in forensic analysis. BioTechniques 33, 407–411.
AWWA, APHA, WEF, 1992. Standard Methods for the Examination of Water and
Wastewater, 18th ed.
AWWA, APHA, WEF, 1999. Standard Methods for the Examination of Water and
Wastewater, 20th ed.
Caldwell, J.M., Raley, M.E., Levine, J.F., 2007. Mitochondrial multiplex real-time PCR as a
source tracking method in fecal-contaminated effluents. Environ. Sci. Technol. 41,
3277–3283.
Cebula, T.A., Payne, W.L., Feng, P., 1995. Simultaneous identification of strains of
Escherichia coli serotype O157:H7 and their shiga-like toxin type by mismatch
amplification mutation assay-multiplex PCR. J. Clin. Microbiol. 33, 248–250.
Gerber, A.S., Loggins, R., Kumar, S., Dowling, T.E., 2001. Does nonneutral evolutions
shape observed patterns of DNA variation in animal mitochondrial genomes? Annu.
Rev. Genet. 35, 539–566.
Irwin, D.L., Mitchelson, K.R., Findlay, I., 2003. PCR product cleanup methods for capillary
electrophoresis. BioTechniques 34, 932–936.
Iyengar, V., Albaugh, G.P., Lohani, A., Nair, P.P., 1991. Human stools as a source of viable
colonic epithelial cells. FASEB J. 5, 2856–2859.
Lakay, F.M., Botha, A., Prior, B.A., 2007. Comparative analysis of environmental DNA
extraction and purification methods from different humic acid-rich soils. J. Appl.
Microbiol. 102, 1364–5072.
Martellini, A., Payment, P., Villemur, R., 2005. Use of eukaryotic mitochondrial DNA to
differentiate human, bovine, porcine and ovine sources in fecally contaminated
surface water. Water Res. 39, 541–548.
National Pollutant Discharge Elimination System. 2008. U.S. EPA.
Plummer, J.D., Long, S.C., 2007. Monitoring source water for microbial contamination:
evaluation of water quality measures. Water Res., doi:10.1016/j.watres.2007.05.004.
Ram, J.L., Thompson, B., Turner, C., Nechvatal, J.M., Sheehan, H., Bobrin, J., 2007.
Identification of pets and raccoons as sources of bacterial contamination of urban
storm sewers using a sequence-based bacterial source tracking method. Water Res.,
doi:10.1016/j.watres.2007.04.013.
Siewicki, T.C., Pullaro, T., Pan, W., McDaniel, S., Glenn, R., Stewart, J., 2007. Models of total
and presumed wildlife sources of fecal coliforms bacteria in coastal ponds. J.
Environ. Manag. 82, 120–132.
Somarelli, J.A., Makarewicz, J.C., Sia, R., Simon, R., 2007. Wildlife identified as major
source of Escherichia coli in agriculturally dominated watersheds by BOX A1R-
derived genetic fingerprints. J. Environ. Manag. 82, 60–65.
Yan, T., Hamilton, M.J., Sadowsky, M.J., 2007. High-throughput and quantitative
procedure for determining sources of Escherichia coli in waterways by using host-
specific DNA marker genes. Appl. Environ. Microbiol. 73, 890–896.
6 J.M. Caldwell, J.F. Levine / Journal of Microbiological Methods xxx (2009) xxx–xxx
ARTICLE IN PRESS
Please cite this article as: Caldwell, J.M., Levine, J.F., Domestic wastewater influent profiling using mitochondrial real-time PCR for source
tracking animal contamination, J. Microbiol. Methods (2009), doi:10.1016/j.mimet.2008.11.007