SlideShare a Scribd company logo
Journal of Laboratory Automation
2016, Vol. 21(1) 37­–48
© 2015 Society for Laboratory
Automation and Screening
DOI: 10.1177/2211068215601637
jala.sagepub.com
Original Report
Introduction
The use of laboratory animals in research drives functional
genomics and the community’s understanding of gene func-
tion through organismal mutagenesis.1
By manipulating ani-
mal genomes, researchers can elucidate the etiology of cancer
and other highly impactful human diseases.2
Mice, in these set-
tings, are often used as a model organism because there is
translational correlation between observations recorded from
investigation of a mutant mouse to the potentiality of produc-
ing a marketable human drug treatment based on such data.3
Moreover, the mouse is a practical research animal: It is one of
the smallest mammals, has a short generation time of 10 weeks
from being born to giving birth, and is typically a prolific
breeder generating 5–10 pups per litter.4
Scientists are rou-
tinely able to replace endogenous mouse genes for their human
counterparts, thus “humanizing” them, allowing researchers to
generate results more directly applicable to human disease.5,6
Changes to a mouse’s genome can be introduced through
the manipulation of embryonic stem cells to create chimeric
mice, some of which will possess the ability to potentiate
the introduced mutation through germline breeding.7
These
changes have been classically introduced by random chemi-
cal mutagenesis or through pronuclear injection of a foreign
transgene that is randomly integrated into the genome.8
For
the past 25 years, locus-specific genomic manipulation has
been carried out by electroporating mouse embryonic stem
cells with a DNA construct containing flanking homology
arms that drive incorporation into the genome via homolo-
gous recombination pathways.9
Use of the Cre/loxP or
Tet-On/Tet-Off systems enables creation of conditionally
expressive models, allowing researchers to control both
spatial and temporal expression of modified loci.10–12
Novel
601637JLAXXX10.1177/2211068215601637Journal of Laboratory AutomationCain-Hom et al.
research-article2015
1
Department of Transgenic Technology, Genentech Inc., San Francisco,
CA, USA
Received Mar 4, 2015.
Corresponding Author:
J. Colin Cox, Department of Transgenic Technology, Genentech Inc., 1
DNA Way, MS 300, South San Francisco, CA 94080, USA.
Email: cox.colin@gene.com
Mammalian Genotyping Using Acoustic
Droplet Ejection for Enhanced Data
Reproducibility, Superior Throughput, and
Minimized Cross-Contamination
Carol Cain-Hom1
, Ryan Pabalate1
, Anna Pham1
, Hetal N. Patel1
,
Rhonda Wiler1
, and J. Colin Cox1
Abstract
Genetically engineered animal models are major tools of a drug discovery pipeline because they facilitate understanding of
the molecular and biochemical basis of disease. These highly complex models of human disease often require increasingly
convoluted genetic analysis. With growing needs for throughput and consistency, we find that traditional aspiration-and-
dispense liquid-handling robots no longer have the required speed, quality, or reproducibility.
We present an adaptation and installation of an acoustic droplet ejection (ADE) liquid-handling system for ultra-
high-throughput screening of genetically engineered models. An ADE system is fully integrated with existing laboratory
processes and platforms to facilitate execution of PCR and quantitative PCR (qPCR) reactions. Such a configuration
permits interrogation of highly complex genetic models in a variety of backgrounds. Our findings demonstrate that a single
ADE system replaces 8–10 traditional liquid-handling robots while increasing quality and reproducibility.
We demonstrate significant improvements achieved by transitioning to an ADE device: extremely low detectable cross-
contamination in PCR and qPCR despite extensive use, greatly increased data reproducibility (large increases in data
quality and Cq consistency), lowered reaction volumes for large cost savings, and nearly a magnitude increase in speed
per instrument. We show several comparisons between traditional- and ADE-based pipetting for a qPCR-based workflow.
Keywords
genotyping, acoustic droplet ejection, RT-PCR, Echo, ADE
by guest on January 30, 2016jla.sagepub.comDownloaded from
38	 Journal of Laboratory Automation 21(1)
and emerging techniques use nucleases conjugated to a spe-
cific DNA binding domain, such as zinc-finger nucleases13
or the Cas9/CRISPR system.14
Of particular interest,
CRISPR has been proven to create multiple mutations in a
mouse in a single step15
and has been demonstrated to cre-
ate a variety of construct types.16
Modified organisms require careful and accurate geno-
typing to identify founding animals and continue produc-
tion through a colony’s lifetime. Like any large-scale effort
with high degrees of complexity, such operations directly
benefit from laboratory automation efforts. Lab robotics
have been used previously to carry out PCR-based genotyp-
ing of mice,17
SNP typing of blood18
and forensic19
samples,
high-resolution melting experiments,20
characterizing
mutated yeast strains,21
genotyping bacterial pathogens,22
performing DNA extraction,20
and automating sequencing
of human disease loci.23
We use lab automation systems to
carry out the bulk of our laboratory’s work: the extraction of
gDNA from ~350,000 samples to assemble >1 M PCR and
qPCR reactions to facilitate analysis of ~800,000 genotypes
per annum.
Previously, we have relied on traditional liquid-handling
robots, using standard aspirate-and-dispense pipetting tech-
nology, to assemble our molecular amplification reactions.
We found that increasing workloads do not scale well on
these platforms; more work requires the installation of more
robots, consuming a good deal of resources (i.e., lab space
and funding). In previous observations and detailed here,
we find these robots do not always produce the precision
desired, nor do they rigorously prevent cross-contamination
between samples. Moreover, there has been little transfor-
mative progress in aspirate-and-dispense technology.
Although incremental progress continues to be made, the
landscape of using robots to transfer liquids using dispos-
able or fixed tips has changed little in the past 15 years. The
introduction of acoustic droplet ejection (ADE) pipettors
drastically changes this landscape.
The history and physics of ADE are well documented in
this journal issue. In brief, energy is acoustically transferred
from a transducer into a microplate containing reagent to be
transferred. This focused energy results in the ejection of a
small droplet (here, 25 nl) that travels directly upward into
an upside-down recipient plate, which captures the droplet
via surface tension.24
Hundreds of droplets can be fired each
second and flown in a very precise manner without any
physical contact being made between the device and the
reagent, greatly reducing cross-contamination.25
Recent
developments to ADE liquid handlers in the past two years
have made these devices accessible to the genomic arena.
We have installed and used ADE lab robotics to carry out
the genotyping of several hundred thousand genetically
engineered rodents. Genotyping is carried out across two
platforms: PCR-based fragment analysis and real-time or
quantitative PCR (qPCR). Below, we present our initial
testing and evaluate this liquid handling platform in the
context of increasing precision while simultaneously reduc-
ing cross-contamination to a great extent. In addition, we
discuss other benefits by adopting this technology: very
large throughput increases, reduction of primer and probe
handling, and potential applications of this technology for
other molecular biology–based applications.
Materials and Methods
Robotic Assembly Platforms
Aspirate-and-dispense liquid-handling robot: Tecan Evo
robots were used as representative traditional laboratory
pipetting robots and were outfitted with standard diameter
system tubing, 0.5 ml syringes, and Span-8 Teflon-coated
fixed tips. Tips are cleaned between reagents via dispensing
of 50 ml distilled water into the wash station, followed by
tip washing with 5 ml distilled water into the shallow wash
station cleaner. System tubing is scrubbed with detergent,
and fixed tips are bleach-treated according to the manufac-
turer’s instructions. The Evo worksurface is outfitted with
labware to hold Eppendorf tubes containing master mix and
assays, gDNA source plates, and 96-well destination PCR
plates.
Acoustic droplet ejection pipettor and supplementary
robotics: Labcyte Echo 525s were chosen to assemble
qPCR reactions by using acoustic droplet ejection. Our con-
figuration contains two Echo 525s accessed by an Access
robotic arm workstation (Fig. 1). The Access deck houses
peripherals necessary for an unattended amplification reac-
tion assembly: a Thermo-Fisher Scientific Combi NL
Universal for bulk dispensing of mastermix and water, a
Nexus Xpeel microplate desealer to remove microplate
adhesive seals, an Agilent PlateLoc Sealer to seal fully
assembled PCR plates, and anAgilent Microplate Centrifuge
to reset reagent menisci before acoustic transfer.
Precision Testing with a qPCR Platform
(Rosa26 Locus)
A pool of gDNA was created from extractions of ~1000 wild-
type mice from preps created using the DNeasy 96 Blood &
Tissue Kit (Qiagen, Venlo, the Netherlands). gDNA template
concentrations in these reactions on the Evo (20 µl) and Echo
(5 µl) platforms were approximately 8 µM. Reactions were
assembled in the following manner: 400 nM forward and
reverse primers, 150 nM probe, and 1× Type-It Fast SNP PCR
Master Mix + ROX dye (Qiagen). Nucleotide sequences for
these oligos are as follows: Rosa26WT forward: CCCGCCC
ATCTTCTAGAAAGA; Rosa26WT reverse: CTGGGCCTG
GGAGAATCC; and Rosa26WT probe: /56-FAM/TTCCCCC
TCTTCCCTCGTGATCTGC/3IABkFQ/. The endogenous
control assay is composed of the following: ApoB forward
by guest on January 30, 2016jla.sagepub.comDownloaded from
Cain-Hom et al.	 39
primer: CACGTGGGCTCCAGCATT; ApoB reverse primer:
TCACCAGTCATTTCTGCCTTTG (oIMR1544, oIMR3580;
Jackson Laboratory, Bar Harbor, Maine); and ApoB probe:
VIC-CCAATGGTCGGCACTGCTCAA-MGBNFQ (ABI/
Life Technologies, Carlsbad, CA). No-template-control
(NTC) reactions contained distilled water in place of gDNA
template. Assays were cycled on a 7900HT Fast Real-Time
PCR System (ABI/Life Technologies) and were analyzed
using SDS 2.4.1 (ABI/Life Technologies). Assays were
thermal cycled as follows: initial denaturation (95 °C, 5′)
followed by 35 cycles of PCR (95 °C, 60″; 60 °C, 30″; and
72 °C, 60″).
Contamination Testing with a qPCR Platform
(Cre Locus)
Genomic DNA from Cre+
positive mice were purified using
the Agencourt DNAdvance kit (Beckman Coulter, Brea,
CA) executed on a Biomek FXP
liquid handler (Beckman
Coulter). gDNA from 560 animals all harboring a Cre
Figure 1.  Schematic of a high-
throughput mammalian genotyping
reaction assembly platform using
acoustic droplet ejection. Shown is a
top-down view (top) and a front-
facing view (bottom). The platform
consists of two Labcyte Echo 525s
serviced by an Access robotic arm. In
addition to providing reagent delivery
to the acoustic dispensers, the arm
also serves accessory peripherals:
a microplate sealer, microplate
desealer, microplate centrifuge,
low-volume bulk plate dispenser, and
microplate storage hotels.
by guest on January 30, 2016jla.sagepub.comDownloaded from
40	 Journal of Laboratory Automation 21(1)
transgene were pooled to make a Cre+
positive gDNA
“pooled” stock. In addition, 192 mouse gDNA samples
were identified as Cre-harboring samples to represent indi-
vidual (versus pooled) samples. qPCR assays were assem-
bled on the Tecan Evo in 96-well plates to a final volume of
20 µl; the Labcyte 525 was used to construct reactions in a
384-well plates to a final volume of 5 µl. Experimental and
NTC reactions were arranged in an alternating checker-
board pattern. gDNA template concentrations in these reac-
tions on the Evo and Echo platforms were approximately 8
µM and 5 µM, respectively.
The reactions were assembled in the following manner: 400
nM forward and reverse primers, 150 nM probe, and 1×
Type-It Fast SNP PCR Master Mix + ROX dye (Qiagen).
Nucleotide sequences for these transgene oligos are as follows:
Cre forward primer: GCGGTCTGGCAGTAAAAACTATC;
Cre reverse primer: GTGAAACAGCATTGCTGTCACTT
(oIMR1084, oIMR1085; Jackson Laboratory); and Cre probe:
FAM/AA+ACATGC+T/ZEN/TCA+TCG+TCGG/3IABkFQ
(a plus sign preceding the nucleotides indicates LNA bases;
IDT, Coralville, IA). The endogenous control assay was com-
posed of the following: ApoB forward primer: CACGTGGG
CTCCAGCATT; ApoB reverse primer: TCACCAGTCATT
TCTGCCTTTG (oIMR1544, oIMR3580; Jackson Labora-
tory); and ApoB probe: HEX/CC+A+ATGG+TC/ZEN/
GGGCAC+TG/3IABkFQ (IDT; a plus sign preceding the
nucleotides indicates LNA bases). NTC reactions contained
distilled water in place of gDNAtemplate.Assays were cycled
on a C1000 CFX Touch optical thermalcycler (BioRad) and
were analyzed using CFX Manager 3.1 (BioRad).Assays were
thermal cycled as follows: initial denaturation (95 °C, 5′) fol-
lowed by 50 cycles of PCR (95 °C, 60″; 60 °C, 30″; and 72 °C,
60″).
Contamination Testing with a PCR / Fragment
Analysis Platform (PS2 Locus)
Genomic DNA from PS2+
positive mice were purified
using the Agencourt DNAdvance kit (Beckman Coulter)
executed on a Biomek FXP
liquid handler (Beckman
Coulter). gDNA from 143 animals all harboring a PS2
transgene were pooled to make a PS2+
positive gDNA
“pooled” stock. qPCR assays were assembled on the Tecan
Evo in 96-well plates to a final volume of 20 µl; the Labcyte
525 was used to construct reactions in 384-well plates to a
final volume of 5 µl. Experimental and NTC reactions were
arranged in an alternating checkerboard pattern. gDNA
template concentrations in these reactions on the Evo and
Echo platforms were approximately 8 µM and 5 µM,
respectively.
The reactions were assembled in the following manner:
625 nM forward and reverse primers and 1× Type-It Fast
SNP PCR Master Mix + ROX dye (Qiagen). Nucleotide
sequences for these oligos are as follows: PS2 forward
primer: /56-FAM/TCATTGGCTTGTGTCTGACCCT; PS2
reverse primer: GCTTTCAACGTCAGTAGGACAA; IL8R
forward primer: /56-FAM/CTTCGCTGTCGTCCTTGTCT;
and IL8R reverse primer: AGCCATGATCCTGAGAAGTC
CAT. NTC reactions contained distilled water in place of
the gDNA template. 96-well Evo-assembled assays were
cycled on a GeneAmp PCR 9700 System (ABI/LifeTech),
whereas Echo-assembled reactions were cycled on a C1000
CFX Touch.
Assays were thermal cycled as follows: initial denatur-
ation (95 °C, 5′) followed by 30 cycles of PCR (95 °C, 60″;
60 °C, 30″; and 72 °C, 60″). PCR assays were analyzed using
a 3730XL DNA Analyzer (ABI/Life Technologies). POP-7
Performance Optimized Polymer (ABI/Life Technologies)
was used as a matrix within a 50 cm capillary array. GeneScan
600 LIZ size standard (ABI/Life Technologies) was used as a
system control; a 30× dilution of the size standard was car-
ried out in HiDi Formamide (ABI/Life Technologies) and
used to dilute PCR samples by 21×. Ten microliters of the
diluted assays were loaded onto the DNA Analyzer. Data
were analyzed using Gene Mapper 4.0 software (ABI/Life
Technologies).
Results and Discussion
Evaluation of Data Consistency
A traditional liquid handler was directly compared to an
acoustic-based dispenser to evaluate qPCR reaction assem-
bly. Initially, we evaluated the consistency and robustness
of analyzing large cohorts of genetically modified mice on
each platform. We randomly chose a large cohort of mice
containing ~1000 individuals in roughly a dozen colonies
containing the same modified locus. After pooling those
samples together to create a “master” DNA source, we then
set up qPCR reactions containing primer and probes to
interrogate two endogenous control genes (Rosa26 and
ApoB). Care was taken to minimize sources of variability
that could be imparted from other aspects of reaction assem-
bly, such as those attributable to using different lots of assay
reagents, assembling master mixes in multiple sessions, and
so on. Reactions were assembled as described and cycled
35 times while monitoring accumulation of probe signals.
Results are depicted in Figure 2; amplification curves
are shown for each probe channel [i.e., VIC fluorophore
(Apo) and FAM fluorophore (Rosa26)] plotted for each
robotic assembly platform (Fig. 2a). These same data are
presented as an endpoint scatterplot in which the Rosa26
signal is plotted on the X-axis and the ApoB probe signal on
the Y-axis (Fig. 2b). Data resulting fromADE-based assem-
bly demonstrate a higher level of precision than that of tra-
ditionally assembled reactions in both amplification curves
and scatterplots. Specifically, amplification curves (Fig. 2a)
by guest on January 30, 2016jla.sagepub.comDownloaded from
Cain-Hom et al.	 41
for the ADE-assembled reactions demonstrate more similar
Cq values than those assembled with a classical liquid han-
dler (summarized in Table 1). In this experiment, both
detectors displayed superior standard deviations between
samples when assembled by ADE versus traditional robots.
This is one of many illustrations of an increase in precision
and reproducibility when applying ADE technology to
genomic applications.
Differences in data quality are more apparent when
viewed as a scatterplot (Fig. 2b). Reactions created by tra-
ditional pipetting platforms demonstrate a greater variabil-
ity in the scattercloud (left) than with ADE-assembled
reactions (right). The ratiometric distance between the NTC
signals (black crosses) and the lowest positive RFU values
(green circles) are nearly doubled between the two plat-
forms for both probes. Moreover, three data samples from
the classically assembled reactions are ambiguous and
require reanalysis; zero samples from the ADE platform
were seen to be uncertain. In the context of a mammalian
genotyping laboratory, this is highly impactful. Unlike cell-
based work in which it is commonly accepted that some
data points will drop out due to the nature of high-through-
put workflows, this remains an intractable issue in a vivar-
ium setting. Compassionate welfare standards and strict
adherence to the 3R principles26–28
and Institutional Animal
Care and Use Committee procedures dictate that, in many
A
B
FAM
Cycles
RFU
RFU
1.000E+1
1.000
1.000E-1
1.000E-2
1.000E-3
15 25 35
1.000E+1
1.000
1.000E-1
1.000E-2
1.000E-3
15 25 35
VIC
1.000E+1
1.000
1.000E-1
1.000E-2
1.000E-3
15 25 35
Cycles
Cycles
RFU
RFU
ADE
1.000E+1
1.000
1.000E-1
1.000E-2
1.000E-3
15 25 35
Traditional
Cycles
Traditional
ADE
Cycles
ADETraditional
1 7 14
0.2
2.5
4.5
1 7 14
0.2
2.5
4.5
FAM (Rosa26) RFU FAM (Rosa26) RFU
VIC(ApoB)RFU
VIC(ApoB)RFU
Figure 2.  Comparison of
quantitative PCR (qPCR)-based
genotyping data quality by
platform. Amplification curves
(A) and cluster plots (B) are
depicted for both traditional- and
acoustic droplet ejection (ADE)-
assembled reactions. (A) Curves
are illustrated for FAM (top) and
VIC (bottom) channels; the green
line shows the Cq threshold (0.4).
(B) The same data are interpreted
as a cluster plot. Black Xs are
no-template controls (NTCs),
green dots represent experimental
samples, and red dots (highlighted
by a blue circle) denote ambiguous
data samples that cannot be clearly
assigned a genotype.
by guest on January 30, 2016jla.sagepub.comDownloaded from
42	 Journal of Laboratory Automation 21(1)
cases, an animal’s genotype must be evaluated to properly
determine the appropriate course of action for that individ-
ual. Significant numbers of samples requiring reanalysis
not only create additional burden and extended turnaround
times for a genetic analysis laboratory but also increase the
workload of a colony resource and management team car-
ing for the genetic models. Reduction of samples requiring
reanalysis is an understated boon when performing analysis
of animal models. Overall, improved clustering yields not
only a reduced reanalysis load but also more rapid and
straightforward cohort-based data analysis.
Evaluation of Cross-Contamination in
Quantitative PCR
One of the many compelling reasons to transition from a
classic to ADE-based reaction setup is the giant reduction in
observable cross-contamination.29,30
In our first tests with
acoustic-based dispense technology (data not shown), we
examined cross-contamination in limited fashion at 35
amplification cycles. Our initial results were promising:
16 of 96 (16.7%) NTC reactions assembled by a tradi-
tional laboratory robot were found to be contaminated
with exogenous gDNA, whereas none of 168 reactions
(0%) assembled by ADE demonstrated any apparent cross-
contamination. Because these data seemed so remarkable,
we wished for a more thorough investigation and so initi-
ated the following study.
We performed this study to evaluate cross-contamination
in two different modes. To examine only platform-to-
platform variability, we ran several series of reactions com-
posed of a single source of gDNA pooled from a large
cohort of mice all sharing the same modified locus. This
facilitates simple comparisons between platforms. To better
mirror actual mammalian genotyping operations, we
repeated these series using individual and unique gDNA
samples. This was done to account for the animal-to-animal
and cohort-to-cohort variability that is observed when
genotyping inbred laboratory strains. We identified many
individual gDNA samples containing the same transgene
(Cre recombinase) under various endogenous mammalian
promoters and probed for it using an endogenous locus
(ApoB) as a positive control. The result of this project is
shown in Figures 3 and 4.
Scatterplots are displayed at a typical amount of PCR
amplification (i.e., 32 cycles; Fig. 3, top row) and an
extreme amount of cycling to clearly observe contamina-
tion (50 cycles; Fig. 3, bottom row). Reactions assembled
using classical robotics (Fig. 3, left column) are compared
to ADE-assembled reactions (Fig. 3, right column). The
results between platforms are striking. In viewing the com-
parison between platforms at 32 cycles, theADE-assembled
reactions show no sign of amplification in NTC controls
(red dots, N = 192). In contrast, nearly all (97.9%) NTC
reactions created by the traditional pipetting platform dem-
onstrated appreciable levels of amplification. At certain lev-
els, this causes reanalysis of certain cohorts when a
particular NTC is no longer statistically significant from
the positive amplification signals in that grouping. In addi-
tion, the relative signal intensity is nearly double with the
ADE-created reactions interrogating the noncontrol probe
(Cre, X-axis). Once again, we observe a large and meaning-
ful increase in the signal-to-noise (S:N) ratios between the
different pipetting technologies.
This trend is more evident at very high levels of amplifi-
cation (50 PCR cycles). Here, virtually all classically
assembled samples now exhibit nearly indistinguishable
amounts of amplification on both Cre and Apo assays
(188/192 replicates, 98.0%). In direct comparison, only a
couple of reactions were positive for the Cre assay (X-axis;
2/192 replicates, 1.0%), whereas none were for the endog-
enous control gene. This impressive reduction in contami-
nation directly results in less ambiguous data and sharply
decreases the number of animals requiring reanalysis.
We repeated the above study with individual gDNAsam-
ples to more accurately mimic variability observed between
individual animals. Scatterplots are again shown with rou-
tine amounts of PCR amplification (32 cycles; Fig. 4, top
row) and an excessive amount of cycling to clearly observe
contamination (50 cycles; Fig. 4, bottom row). Reactions
Table 1.  Summary of qPCR Quality Metrics by Assembly Platform.
Traditional Pipetting ADE-Based Pipetting
Sample size
370
(4× 96-well plates)
378
(1× 384-well plate)
Channel FAM VIC FAM VIC
Average Cq 23.94 25.94 23.67 24.51
Minimum Cq 22.96 24.02 23.23 23.97
Maximum Cq 28.84 30.73 24.09 25.21
Standard deviation ±0.41 ±0.74 ±0.16 ±0.18
Average, minimum, and maximum Cq values are provided for FAM and VIC channels, as well as standard deviations. ADE, acoustic droplet ejection;
qPRC, quantitative PCR.
by guest on January 30, 2016jla.sagepub.comDownloaded from
Cain-Hom et al.	 43
created using traditional platforms (Fig. 4, left column) are
contrasted to reactions assembled by an acoustic pipettor
(Fig. 4, right column). As with the pooled gDNA sample,
comparisons between the two technologies remain particu-
larly compelling. At a routine amount of amplification (32
cycles), the ADE-assembled reactions again show no
observable amplification in NTC controls (red dots, N =
192) and yield unambiguous results. Many NTC samples
(138/192, 71.9%) show appreciable accumulation of signal
on the X-axis [FAM fluorophore (Cre)].
Although displaying a mild increase in variability, the
extreme diagnostic cycling at 50 rounds of PCR mirrors that
of the 32 cycles of amplification (above) observed with the
pooled sample. These individual, genetically modified
mouse samples assembled by ADE show very little appar-
ent contamination with very high cycling (Figure 4): One
NTC sample displays as positive for Cre detection (FAM
fluorophore, 1/192, 0.5%), whereas six NTC samples dis-
play as positive for the Apo allele (HEX fluorophore, 6/192,
3.1%). No NTC reactions constructed acoustically demon-
strated a detectable signal in both channels. In stark con-
trast, all but one NTC reaction created by a traditional
laboratory robot displayed observable amplification after
50 PCR cycles (191/192, 99.5%). The vast majority of
NTCs exhibited strong amplification in both channels
(180/192; 93.8%) with a small subset of samples showing
only Cre detection (11/192; 5.7%). The data for both 32 and
50 amplification cycles are summarized in Figure 5.
As shown in Figure 4, several of the NTC reactions
directly overlap with experimental samples rendering statis-
tical analysis impossible. In the context of a very-high-
throughput genetic analysis laboratory, this can be a critical
50 cycles
32 cycles
1000 400030002000 60005000
0
2500
2000
1500
1000
500
3000
3500
0
Traditional
HEX(ApoB)RFU
FAM (Cre) RFU
1000 400030002000 60005000
0
2500
2000
1500
1000
500
3000
3500
0
ADE
HEX(ApoB)RFU
FAM (Cre) RFU
1000 400030002000 60005000
0
2500
2000
1500
1000
500
3000
3500
0
ADE
HEX(ApoB)RFU
FAM (Cre) RFU
1000 400030002000 60005000
0
2500
2000
1500
1000
500
3000
3500
0
HEX(ApoB)RFU
FAM (Cre) RFU
Traditional
gDNA samples
NTCs
gDNA samples
NTCs
gDNA samples
NTCs
gDNA samples
NTCs
Figure 3.  Comparison of contamination observed when performing quantitative PCR (qPCR)-based genotyping using a single, pooled
gDNA sample. Cluster plots are shown for 32 cycles of amplification (top) and 50 cycles (bottom). Reactions were assembled by a
traditional robot (left column) or an acoustic droplet ejection (ADE) robot (right column). Blue dots represent positive samples; red
dots are no-template controls (NTCs).
by guest on January 30, 2016jla.sagepub.comDownloaded from
44	 Journal of Laboratory Automation 21(1)
success point for a given assay or colony when this occurs
at normal cycling values. Often, there is a need for all assays
and protocols to follow a standard operating procedure to
maximize the amount of samples that can be accurately ana-
lyzed each day. A liquid-handling system that yields less
obscure data provides results in a context of a higher level
of scientific integrity while simultaneously reducing the
amount of reanalysis required.
Evaluation of Cross-Contamination in CE-Based
Fragment Analysis
As mentioned, our laboratory uses both fragment-based PCR
genotyping as well as quantitative PCR (results described
above). We sought to determine whether use of ADE liquid
handlers resulted in the same gains in data consistency and
cross-contamination reduction. PCR reactions were assem-
bled on both robotic platforms to interrogate PS2, a transgene
known to play a role in amyloid precursor protein processing,
along with IL8R, an endogenous control amplicon targeting
the interleukin 8 (IL8) receptor locus. After assembly, reac-
tions were cycled 30 times and processed on an electropho-
retic capillary-based genetic analyzer. Electropherograms
representing typical data observed in this cohort are illus-
trated in Figure 6. Reactions were assembled by a classical
pipetting robot (Fig. 6, top row) and an ADE device (Fig. 6,
bottom row). gDNA from animals known to harbor the PS2
transgene were used (Fig. 6, left column) alongside NTC
reactions (Fig. 6, right column).
Although the fragment peaks from the PS2+
animals (Fig.
6a,c) are clear, the signal intensity of theADE-assembled PCR
reactions are more intense. We observe cross-contamination
50 cycles
32 cycles
ADE
1000 400030002000 60005000
0
1000
500
0
HEX(ApoB)RFU
FAM (Cre) RFU
3500
3000
2500
2000
1500
gDNA samples
NTCs
Traditional
0
HEX(ApoB)RFU
1000 400030002000 600050000
FAM (Cre) RFU
2500
2000
1500
1000
500
3000
3500
gDNA samples
NTCs
0
2500
2000
1500
1000
500
3000
3500
HEX(ApoB)RFU
Traditional
1000 400030002000 600050000
FAM (Cre) RFU
gDNA samples
NTCs
ADE
1000 400030002000 60005000
0
2500
2000
1500
1000
500
3000
3500
0
HEX(ApoB)RFU
FAM (Cre) RFU
gDNA samples
NTCs
Figure 4.  Comparison of contamination observed when performing quantitative PCR (qPCR)-based genotyping using many individual
gDNA samples. Cluster plots are shown for 32 cycles of amplification (top) and 50 cycles (bottom). Reactions were assembled by a
traditional robot (left column) or an acoustic droplet ejection (ADE) robot (right column). Blue dots represent positive samples; red
dots are no-template controls (NTCs).
by guest on January 30, 2016jla.sagepub.comDownloaded from
Cain-Hom et al.	 45
results on the PCR fragment platform similarly to the qPCR
platform data provided above. NTC reactions created by an
aspirate-and-dispense robot illustrate ample contamination
signals (Fig. 6b) compared to those created by an ADE robot
displaying undetectable amounts of contamination (Fig. 6d).
Notably, there is a large difference in S:N between positive and
negative gDNA samples on the two assembly platforms. S:N
between positive samples and NTCs is ~2.3 and ~8.3, respec-
tively, for the PS2 and IL8R loci. In contrast, with undetectable
contamination in the no-template control reactions, the S:N for
positive and negative reactions assembled byADE approaches
infinity.
We assembled 96 test reactions on the traditional robotic
system (48 positives, 48 NTCs) and 384 reactions on the
acoustic dispenser (192 positives, 192 NTCs). Again, we
found most reactions set up by the classical robotic system
were significantly contaminated (44/48, 91.7%), whereas
none of the 192 control reactions constructed via ADE pos-
sessed detectable contamination. It should be noted that dif-
ferent levels of contamination result in unique outcomes
dependent on the assay. In this case, the level of observed
contamination, although undesired, still results in the ability
to call the genotype with a fair degree of confidence. An
analyst evaluating these data could determine that there is
still decent S:N between NTCs and experimental samples
and conclude animal genotypes. However, working in such
a mode retards analysis speed while increasing risk and
errors in human interpretation.
In general, we noted that contamination of the blanks was
often dependent on the last reagent pipetted before aspirating
water for the “template” in an NTC reaction. Despite following
manufacturer’s instructions for maintenance and operational
procedures, if the last reagent pipetted was a gDNAsource, we
observed contaminated NTCs despite thorough tip washing. In
contrast, if water was transferred previously and then water
was transferred again, that NTC was often observed to have
little or no detectable contamination. This suggests that, in cer-
tain cases, fixed tips combined with the use of standard wash-
ing protocols may be insufficient for particular genomics
applications.
Conclusions
We have illustrated the large differences in data quality and
precision that can transpire from adaptation of anADE instru-
ment. Moreover, the observed reduction in contamination
and its effects on data interpretation and analysis can be
highly impactful, especially in terms of carrying out genotyp-
ing of genetically modified animals. In addition to its preci-
sion,ADE liquid handlers clearly excel in throughput as well.
All of our ADE experiments in this body of work required
10–11 minutes to cherrypick 384 gDNA samples to their cor-
responding assays. In contrast, these same experiments car-
ried out on an aspirate-and-dispense platform required 64–67
minutes to complete. In our workflow, this equates a single
ADE dispenser being as productive as six or seven traditional
laboratory pipetting robots. This is notable considering that
the classic platforms did not have the ability to spin-down
plates, remove adhesive seals, or place new seals on plates;
these functions were carried out by laboratory personnel and
did not factor into the above time calculations. In contrast,
the 10–11-minute workflow of the ADE instrument does
include those steps, making the instrument much more
“walk-away” than the classic robotic platforms.
Traditional
IndividualPooled
ADE
IndividualPooled
200
150
100
50
0
32 cycles
Numberofwells
200
150
100
50
0
Traditional
IndividualPooled
ADE
IndividualPooled
50 cycles
Numberofwells
HEX (ApoB)
FAM (Cre)
A B
HEX (ApoB)
FAM (Cre)
Figure 5.  Summary of contaminated wells by assembly platform. In this illustration, a well is considered to present contamination
when displaying >500 relative fluorescent units (RFUs) at the given PCR cycle value: (A) 32 cycles; and (B) 50 cycles. FAM signal (Cre
locus) is red; HEX signal (ApoB locus) is blue. Each graph illustrates contaminated wells when assembled with traditional technology
(left portion) or an acoustic droplet ejection (ADE) device (right portion).
by guest on January 30, 2016jla.sagepub.comDownloaded from
46	 Journal of Laboratory Automation 21(1)
ADE pipettors have been demonstrated to operate more
quickly and with more precision than traditional laboratory
robots while greatly reducing contamination. With such a
large difference between the two platforms, we expect ADE
devices to rapidly start replacing routine applications using
traditional pipetting robots, such as those used to assemble
PCR and qPCR reactions. Not only are the operational met-
rics of these devices quite advanced beyond what is com-
mercially available, but also the return on investment (ROI)
can be quite high, enabling straightforward facilitation of
these devices in commercial enterprises. We took advantage
of the platform to transition our genotyping reactions from
20 µl in 96-well plates to 3–5 µl reactions in 384-well plates.
This equates to an annual reduction in master mix of 75%
and reduction in assay reagents by roughly 50% (rather than
75% as might be expected, owning to the dead volume
required in an ADE source plate).
Moreover, we were able to resolve a large resource commit-
ment by transitioning to an ADE-based process. A given PCR
assay from our inventory may be composed of 2–4 primers; a
qPCR assay will contain 3–8 oligonucleotides (2–5 primers
and 1–3 probes). Previously, it took a technician’s entire effort
to maintain our library of ~800 genotyping assays, composed
of several thousand oligonucleotide tubes. These required
assay stock generation from which dilutions would be made
and placed on the traditional pipetting platforms in an on-
demand situation. Currently, we now order all assays premixed
and aliquoted in 384-well source plates, requiring nearly no
preparation to prepare for an ADE instrument. This facilitates
the redirection of a technician’s efforts to more productive
C
A
D
B
PS2IL8R
10000
6000
3000
0
150 250 350
Fragment size (bp)
10000
6000
3000
0
10000
6000
3000
0
PS2IL8R
IL8R
10000
6000
3000
0
Fragment size (bp)
150 250 350
150 250 350
Fragment size (bp)
150 250 350
Fragment size (bp)
RFU
RFU
RFU
RFU
Traditional
ADE
Traditional
ADE
IL8R
PS2
PS2
Figure 6.  Comparison of contamination observed when performing PCR fragment-based genotyping. Electropherograms are
displayed for reactions assembled on a traditional liquid handler (top row) and an acoustic pipettor (bottom row). Samples positive for
(A,C) the PS2 transgene were interrogated alongside (B,D) corresponding NTCs. PS2 bins are pink; the endogenous control locus
(IL8R) bins are gray.
by guest on January 30, 2016jla.sagepub.comDownloaded from
Cain-Hom et al.	 47
endeavors, such as data analysis instead of manual pipetting.
Because of these reagent and personnel savings, a genomics
lab could expect an ADE dispenser with accessory robotic
peripherals to achieve its ROI in 1–2 years.
In addition, this body of work demonstrates the ability of
ADE devices to assemble PCR and qPCR reactions with an
impressive amount of contamination reduction. There are
various sources of potential contamination in an automated
laboratory; samples can become contaminated during DNA
extraction,31
while reaction assembly takes place,32
or even
during thermal cycling.33
It is possible that if we had used a
classical liquid handler with disposable pipette tips, rather
than fixed tips, we could observe different or reduced pat-
terns of contamination in the above experiments. In an high-
throughput laboratory, however, disposable tips are often
avoided. Setting up more than 1 million reactions annually
could require many million disposable tips adding a signifi-
cant increase to cost per genotype. Moreover, tips and tip
waste occupy valuable real estate on a robot’s worksurface,
decreasing a device’s per-run density. Finally, plastic tips
have been shown to leach bioactive compounds into the
assembled assays, affecting experimental outcomes.34–36
ADE technology has broad applications across the fields
of molecular biology, genomics, and drug discovery. For
instance, a workflow has been recently described that would
apply next-generation sequencing (NGS) techniques to
characterizing on- and off-target CRIPSR editing events in
a genome.37
Portions of such a process, notably multiplex-
ing and barcoding steps, could be quite amenable to an
acoustic-based liquid handler. Although it could be more
challenging to use ADE technology for certain operations
(e.g., transferring microbeads or cell suspensions), it
becomes straightforward to envision replacing classical
robotic systems with ones containing ADE robots for rou-
tine source-to-destination cherrypicking. In short, ADE
devices could potentially carry out a large diversity of
molecular biology applications, especially those processes
that most benefit from rapid pipetting and a high degree of
precision, or those sensitive to potential contamination
sources.
Acknowledgments
We would like to thank additional laboratory members who con-
tributed to this effort: Deborah Siler, Maria Martinez, Gregg Sy,
and Emily Hunley. The following colleagues provided a great deal
of expertise in transitioning to an acoustic-based workflow:
Timothy D. Dawes, Richie Rodriguez, Peter Thana, Justin
Bramwell, Randy Dyer, Howard Lee, and Mike Travis. Finally,
we are thankful to Ichiro Matsumura for guidance.
Declaration of Conflicting Interests
The authors declared no potential conflicts of interest with respect
to the research, authorship, and/or publication of this article.
Funding
The authors disclosed receipt of the following financial support
for the research, authorship, and/or publication of this article: This
study was completed using internal funding sources.
References
	1.	Sung, Y. H.; Song, J.; Lee, H. W. Functional Genomics
Approach Using Mice. J. Biochem. Mol. Biol. 2004, 37, 122–
132.
	2.	Frese, K. K.; Tuveson, D. A. Maximizing Mouse Cancer
Models. Nat. Rev. Cancer. 2007, 7, 645–658.
	 3.	 Zambrowicz, B. P.; Sands, A. T. Knockouts Model the 100
Best-Selling Drugs—Will They Model the Next 100? Nat.
Rev. Drug Discov. 2003, 2, 38–51.
	4.	Silver, L. M. Mouse Genetics: Concepts and Application.
Oxford University Press: New York, 1995; pp 1–14.
	 5.	 Nebert, D. W.; Dalton, T. P.; Stuart, G. W.; et al. “Gene-Swap
Knock-In” Cassette in Mice to Study Allelic Differences in
Human Genes. Ann. N. Y. Acad. Sci. 2000, 919, 148–170.
	6.	Xie, W.; Barwick, J. L.; Downes, M.; et al. Humanized
Xenobiotic Response in Mice Expressing Nuclear Receptor
SXR. Nature. 2000, 406, 435–439.
	7.	Phillips, M. I.; Tang, Y. L. Genetic Modification of Stem
Cells for Transplantation. Adv. Drug. Deliv. Rev. 2008, 60,
160–172.
	8.	Silver, L. M. Mouse Genetics: Concepts and Applications.
Oxford University Press: New York, 1995; pp 114–132.
	 9.	 Mortensen, R. Overview of Gene Targeting by Homologous
Recombination. Curr. Protoc. Mol. Biol. 2006, 23, unit 23 21.
	10.	 Kuhn, R.; Torres, R. M. Cre/loxP Recombination System and
Gene Targeting. Methods. Mol. Biol. 2002, 180, 175–204.
	11.	 Brault, V.; Besson, V.; Magnol, L.; et al. Cre/loxP-Mediated
Chromosome Engineering of the Mouse Genome. Handb.
Exp. Pharmacol. 2007, 29–48.
	12.	 Sun, Y.; Chen, X.; Xiao, D. Tetracycline-Inducible Expression
Systems: New Strategies and Practices in the Transgenic Mouse
Modeling. Acta Biochim. Biophys. Sinica. 2007, 39, 235–246.
	13.	 Belizario, J. E.; Akamini, P.; Wolf, P.; et al. New Routes for
Transgenesis of the Mouse. J. Appl. Genet. 2012, 53, 295–
315.
	14.	Cong, L.; Ran, F. A.; Cox, D.; et al. Multiplex Genome
Engineering Using CRISPR/Cas Systems. Science. 2013,
339, 819–823.
	15.	Wang, H.; Yang, H.; Shivalila, C. S.; et al. One-Step
Generation of Mice Carrying Mutations in Multiple Genes
by CRISPR/Cas-Mediated Genome Engineering. Cell. 2013,
153, 910–918.
	16.	Yang, H.; Wang, H.; Jaenisch, R. Generating Genetically
Modified Mice Using CRISPR/Cas-Mediated Genome
Engineering. Nat. Protoc. 2014, 9, 1956–1968.
	17.	 Linask, K. L.; Lo, C. W. High-Throughput Mouse Genotyping
Using Robotics Automation. Biotechniques. 2005, 38, 219–
223.
	18.	 Le Goff, G. C.; Bres, J. C.; Rigal, D.; et al. Robust, High-
Throughput Solution for Blood Group Genotyping. Anal.
Chem. 2010, 82, 6185–6192.
by guest on January 30, 2016jla.sagepub.comDownloaded from
48	 Journal of Laboratory Automation 21(1)
	19.	 Stangegaard, M.; Tomas, C.; Hansen, A. J.; et al. Biomek-3000
and GenPlex SNP Genotyping in Forensic Genetics. J. Assoc.
Lab. Automation. 2008, 13, 297–303.
	20.	 Seipp, M. T.; Herrmann, M.; Wittwer, C. T. Automated DNA
Extraction, Quantification, Dilution, and PCR Preparation for
Genotyping by High-Resolution Melting. J. Biomol. Tech.
2010, 21, 163–166.
	21.	 Franco-Duarte,R.;Mendes,I.;Gomes,A.C.;etal.Genotyping
of Saccharomyces cerevisiae Strains by Interdelta Sequence
Typing Using Automated Microfluidics. Electrophoresis.
2011, 32, 1447–1455.
	22.	 O’Farrell,B.;Haase,J.K.;Velayudhan,V.;etal.Transforming
Microbial Genotyping: A Robotic Pipeline for Genotyping
Bacterial Strains. PLoS One. 2012, 7, e48022.
	23.	 Bortot, B.; Athanasakis, E.; Brun, F.; et al. High-Throughput
Genotyping Robot-Assisted Method for Mutation Detection
in Patients with Hypertrophic Cardiomyopathy. Diagn. Mol.
Pathol. 2011, 20, 175–179.
	24.	 Ellson, R.; Mutz, M.; Browning, B.; et al. Transfer of Low
Nanoliter Volumes between Microplates Using Focused
Acoustics-Automation Considerations. J. Assoc. Lab.
Automation. 2003, 8, 29–34.
	25.	Barco, J. Flexible qPCR Assay Assembly Liquid Handler
Designed to Reduce Contamination Risk and Operational
Costs. GEN. Apr 1, 2013.
	26.	Parker, R. M.; Browne, W. J. The Place of Experimental
Design and Statistics in the 3Rs. Ilar. J. 2014, 55, 477–485.
	27.	 Russell, W. M. The Development of the Three Rs Concept.
Altern. Lab Anim. 1995, 23, 298–304.
	28.	Griffin, G.; Clark, J. M.; Zurlo, J.; et al. Scientific Uses
of Animals: Harm-Benefit Analysis and Complementary
Approaches to Implementing the Three Rs. Rev. Sci. Tech.
2014, 33, 265–272.
	29.	 Griffith, D.; Northwood, R.; Owen, P.; et al. Implementation
and Development of an Automated, Ultra-High-Capacity,
Acoustic, Flexible Dispensing Platform for Assay-Ready
Plate Delivery. J. Lab. Autom. 2012, 17, 348–358.
	30.	Quintero, C.; Rosenstein, C.; Hughes, B.; et al. Quality
Control Procedures for Dose-Response Curve Generation
Using Nanoliter Dispense Technologies. J. Biomol. Screen.
2007, 12, 891–899.
	31.	Perry, M. D.; White, P. L.; Barnes, R. A. Comparison of
Four Automated Nucleic Acid Extraction Platforms for
the Recovery of DNA from Aspergillus fumigatus. J. Med.
Microbiol. 2014, 63, 1160–1166.
	32.	Fregeau, C. J.; Yensen, C.; Elliott, J.; et al. Optimized
Configuration of Fixed-Tip Robotic Liquid-Handling Stations
for the Elimination of Biological Sample Cross-Contamination.
J. Assoc. Lab. Automation. 2007, 12, 339–354.
	33.	 Stals, A.; Werbrouck, H.; Baert, L.; et al. Laboratory Efforts to
Eliminate Contamination Problems in the Real-Time RT-PCR
Detection of Noroviruses. J. Microbiol. Methods 2009, 77, 72–76.
	34.	 Watson, J.; Greenough, E. B.; Leet, J. E.; et al. Extraction,
Identification, and Functional Characterization of a Bioactive
Substance from Automated Compound-Handling Plastic
Tips. J. Biomol. Screen. 2009, 14, 566–572.
	35.	McDonald, G. R.; Hudson, A. L.; Dunn, S. M.; et al.
Bioactive Contaminants Leach from Disposable Laboratory
Plasticware. Science. 2008, 322, 917.
	36.	 Olivieri, A.; Degenhardt, O. S.; McDonald, G. R.; et al. On
the Disruption of Biochemical and Biological Assays by
Chemicals Leaching from Disposable Laboratory Plasticware.
Can. J. Physiol. Pharmacol. 2012, 90, 697–703.
	37.	Singh, P.; Schimenti, J. C.; Bolcun-Filas, E. A Mouse
Geneticist’s Practical Guide to CRISPR Applications. Genetics
2015, 199, 1–15.
by guest on January 30, 2016jla.sagepub.comDownloaded from

More Related Content

What's hot

High-throughput Sequencing Analysis and Function Prediction of Lung Microbiot...
High-throughput Sequencing Analysis and Function Prediction of Lung Microbiot...High-throughput Sequencing Analysis and Function Prediction of Lung Microbiot...
High-throughput Sequencing Analysis and Function Prediction of Lung Microbiot...
Healthcare and Medical Sciences
 
Dr. Sid Thakur - Antimicrobial Resistance: Do We Know Everything?
Dr. Sid Thakur - Antimicrobial Resistance: Do We Know Everything?Dr. Sid Thakur - Antimicrobial Resistance: Do We Know Everything?
Dr. Sid Thakur - Antimicrobial Resistance: Do We Know Everything?
John Blue
 
Seminario biologia molecular
Seminario biologia molecularSeminario biologia molecular
Seminario biologia molecular
isabelpalaciom
 
Legionella Laboratory Testing | Biosan Laboratories
Legionella Laboratory Testing | Biosan LaboratoriesLegionella Laboratory Testing | Biosan Laboratories
Legionella Laboratory Testing | Biosan Laboratories
Anthony Lewis
 
Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....
Jonathan Eisen
 
Design and Evaluation of a 16S-based Integrated Solution to Study Bacterial D...
Design and Evaluation of a 16S-based Integrated Solution to Study Bacterial D...Design and Evaluation of a 16S-based Integrated Solution to Study Bacterial D...
Design and Evaluation of a 16S-based Integrated Solution to Study Bacterial D...
Thermo Fisher Scientific
 
Isolation and Identification of MDRO's in the Rio Grande River Poster
Isolation and Identification of MDRO's in the Rio Grande River PosterIsolation and Identification of MDRO's in the Rio Grande River Poster
Isolation and Identification of MDRO's in the Rio Grande River Poster
KayleeWersant
 
Blue crab hemolymph report, Dec 2014
Blue crab hemolymph report, Dec 2014Blue crab hemolymph report, Dec 2014
Blue crab hemolymph report, Dec 2014
Joseph Barnes
 
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
IJEAB
 
Abundance & Fate of Fecal Indicators, Pathogens & Antibiotic Resistant Bacter...
Abundance & Fate of Fecal Indicators, Pathogens & Antibiotic Resistant Bacter...Abundance & Fate of Fecal Indicators, Pathogens & Antibiotic Resistant Bacter...
Abundance & Fate of Fecal Indicators, Pathogens & Antibiotic Resistant Bacter...
LPE Learning Center
 
05 costa
05 costa05 costa
05 costa
fruitbreedomics
 
Lary nel b. abao lamp application to virology report
Lary nel b. abao lamp application to virology reportLary nel b. abao lamp application to virology report
Lary nel b. abao lamp application to virology report
Obihiro University of Agriculture and Veterinary Medicine
 
Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative GenomicsMicrobial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Jonathan Eisen
 
็Hepatitis C virus discovery to cure
็Hepatitis C virus discovery to cure็Hepatitis C virus discovery to cure
็Hepatitis C virus discovery to cure
Pattie Pattie
 
Profiling Hospital-Acquired Pathogens and Antibiotic Resistance Genes Webinar
Profiling Hospital-Acquired Pathogens and Antibiotic Resistance Genes WebinarProfiling Hospital-Acquired Pathogens and Antibiotic Resistance Genes Webinar
Profiling Hospital-Acquired Pathogens and Antibiotic Resistance Genes Webinar
QIAGEN
 
2014 SUCR Poster
2014 SUCR Poster2014 SUCR Poster
2014 SUCR Poster
Alexis Gramera
 
Bacterial Pathogen Genomics at NCBI
Bacterial Pathogen Genomics at NCBIBacterial Pathogen Genomics at NCBI
Bacterial Pathogen Genomics at NCBI
nist-spin
 
Coding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS eraCoding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS era
Lex Nederbragt
 
HIV Abbott 2014
HIV Abbott 2014HIV Abbott 2014
HIV Abbott 2014
Shelley Hossenlopp
 
BCCDC Watershed Metagenomics Project: Viral Biomarkers 2013
BCCDC Watershed Metagenomics Project: Viral Biomarkers 2013BCCDC Watershed Metagenomics Project: Viral Biomarkers 2013
BCCDC Watershed Metagenomics Project: Viral Biomarkers 2013
mitchawe
 

What's hot (20)

High-throughput Sequencing Analysis and Function Prediction of Lung Microbiot...
High-throughput Sequencing Analysis and Function Prediction of Lung Microbiot...High-throughput Sequencing Analysis and Function Prediction of Lung Microbiot...
High-throughput Sequencing Analysis and Function Prediction of Lung Microbiot...
 
Dr. Sid Thakur - Antimicrobial Resistance: Do We Know Everything?
Dr. Sid Thakur - Antimicrobial Resistance: Do We Know Everything?Dr. Sid Thakur - Antimicrobial Resistance: Do We Know Everything?
Dr. Sid Thakur - Antimicrobial Resistance: Do We Know Everything?
 
Seminario biologia molecular
Seminario biologia molecularSeminario biologia molecular
Seminario biologia molecular
 
Legionella Laboratory Testing | Biosan Laboratories
Legionella Laboratory Testing | Biosan LaboratoriesLegionella Laboratory Testing | Biosan Laboratories
Legionella Laboratory Testing | Biosan Laboratories
 
Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....
 
Design and Evaluation of a 16S-based Integrated Solution to Study Bacterial D...
Design and Evaluation of a 16S-based Integrated Solution to Study Bacterial D...Design and Evaluation of a 16S-based Integrated Solution to Study Bacterial D...
Design and Evaluation of a 16S-based Integrated Solution to Study Bacterial D...
 
Isolation and Identification of MDRO's in the Rio Grande River Poster
Isolation and Identification of MDRO's in the Rio Grande River PosterIsolation and Identification of MDRO's in the Rio Grande River Poster
Isolation and Identification of MDRO's in the Rio Grande River Poster
 
Blue crab hemolymph report, Dec 2014
Blue crab hemolymph report, Dec 2014Blue crab hemolymph report, Dec 2014
Blue crab hemolymph report, Dec 2014
 
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
 
Abundance & Fate of Fecal Indicators, Pathogens & Antibiotic Resistant Bacter...
Abundance & Fate of Fecal Indicators, Pathogens & Antibiotic Resistant Bacter...Abundance & Fate of Fecal Indicators, Pathogens & Antibiotic Resistant Bacter...
Abundance & Fate of Fecal Indicators, Pathogens & Antibiotic Resistant Bacter...
 
05 costa
05 costa05 costa
05 costa
 
Lary nel b. abao lamp application to virology report
Lary nel b. abao lamp application to virology reportLary nel b. abao lamp application to virology report
Lary nel b. abao lamp application to virology report
 
Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative GenomicsMicrobial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
 
็Hepatitis C virus discovery to cure
็Hepatitis C virus discovery to cure็Hepatitis C virus discovery to cure
็Hepatitis C virus discovery to cure
 
Profiling Hospital-Acquired Pathogens and Antibiotic Resistance Genes Webinar
Profiling Hospital-Acquired Pathogens and Antibiotic Resistance Genes WebinarProfiling Hospital-Acquired Pathogens and Antibiotic Resistance Genes Webinar
Profiling Hospital-Acquired Pathogens and Antibiotic Resistance Genes Webinar
 
2014 SUCR Poster
2014 SUCR Poster2014 SUCR Poster
2014 SUCR Poster
 
Bacterial Pathogen Genomics at NCBI
Bacterial Pathogen Genomics at NCBIBacterial Pathogen Genomics at NCBI
Bacterial Pathogen Genomics at NCBI
 
Coding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS eraCoding & Best Practice in Programming in the NGS era
Coding & Best Practice in Programming in the NGS era
 
HIV Abbott 2014
HIV Abbott 2014HIV Abbott 2014
HIV Abbott 2014
 
BCCDC Watershed Metagenomics Project: Viral Biomarkers 2013
BCCDC Watershed Metagenomics Project: Viral Biomarkers 2013BCCDC Watershed Metagenomics Project: Viral Biomarkers 2013
BCCDC Watershed Metagenomics Project: Viral Biomarkers 2013
 

Viewers also liked

Break through
Break throughBreak through
Break through
Cameron DeGale
 
Austin Mckinsey's Resume for summer 2015 internships
Austin Mckinsey's Resume for summer 2015 internshipsAustin Mckinsey's Resume for summer 2015 internships
Austin Mckinsey's Resume for summer 2015 internships
Austin Mckinsey
 
Cox2009-TnT_creation_in_vitro_coupled_transcription_and_translation_reactions...
Cox2009-TnT_creation_in_vitro_coupled_transcription_and_translation_reactions...Cox2009-TnT_creation_in_vitro_coupled_transcription_and_translation_reactions...
Cox2009-TnT_creation_in_vitro_coupled_transcription_and_translation_reactions...
J. Colin Cox
 
Delitos aduaneros
Delitos aduanerosDelitos aduaneros
Delitos aduaneros
Sharaid Cervantes
 
Depersonas ampros
Depersonas amprosDepersonas ampros
Depersonas ampros
Red TERRAE
 
Gincana manhã
Gincana   manhãGincana   manhã
Gincana manhã
CemIvoSilveira
 
Oxidative phosphorylation
Oxidative phosphorylationOxidative phosphorylation
Oxidative phosphorylation
Dr Muhammad Mustansar
 
Culture shock
Culture shockCulture shock
Culture shock
Hywel Evans
 
How to save activity Step by Step
How to save activity Step by Step How to save activity Step by Step
How to save activity Step by Step
nermine amin
 
Abnormal pap smear ศิริราช ppt
Abnormal pap smear ศิริราช pptAbnormal pap smear ศิริราช ppt
Abnormal pap smear ศิริราช pptvora kun
 

Viewers also liked (10)

Break through
Break throughBreak through
Break through
 
Austin Mckinsey's Resume for summer 2015 internships
Austin Mckinsey's Resume for summer 2015 internshipsAustin Mckinsey's Resume for summer 2015 internships
Austin Mckinsey's Resume for summer 2015 internships
 
Cox2009-TnT_creation_in_vitro_coupled_transcription_and_translation_reactions...
Cox2009-TnT_creation_in_vitro_coupled_transcription_and_translation_reactions...Cox2009-TnT_creation_in_vitro_coupled_transcription_and_translation_reactions...
Cox2009-TnT_creation_in_vitro_coupled_transcription_and_translation_reactions...
 
Delitos aduaneros
Delitos aduanerosDelitos aduaneros
Delitos aduaneros
 
Depersonas ampros
Depersonas amprosDepersonas ampros
Depersonas ampros
 
Gincana manhã
Gincana   manhãGincana   manhã
Gincana manhã
 
Oxidative phosphorylation
Oxidative phosphorylationOxidative phosphorylation
Oxidative phosphorylation
 
Culture shock
Culture shockCulture shock
Culture shock
 
How to save activity Step by Step
How to save activity Step by Step How to save activity Step by Step
How to save activity Step by Step
 
Abnormal pap smear ศิริราช ppt
Abnormal pap smear ศิริราช pptAbnormal pap smear ศิริราช ppt
Abnormal pap smear ศิริราช ppt
 

Similar to Journal of Laboratory Automation-2016-Cain-Hom-37-48

Genovesio et al j biomol screen 2011-genovesio-1087057111415521
Genovesio et al j biomol screen 2011-genovesio-1087057111415521Genovesio et al j biomol screen 2011-genovesio-1087057111415521
Genovesio et al j biomol screen 2011-genovesio-1087057111415521
Neil Emans, Ph.D
 
Using In Silico Tools in Repurposing Drugs for Neglected and Orphan Diseases
Using In Silico Tools in Repurposing Drugs for Neglected and Orphan DiseasesUsing In Silico Tools in Repurposing Drugs for Neglected and Orphan Diseases
Using In Silico Tools in Repurposing Drugs for Neglected and Orphan Diseases
Sean Ekins
 
Molecular Environmental Microbiology.ppt
Molecular Environmental Microbiology.pptMolecular Environmental Microbiology.ppt
Molecular Environmental Microbiology.ppt
Huma Hameed
 
CrossGen-Merck manuscript
CrossGen-Merck manuscriptCrossGen-Merck manuscript
CrossGen-Merck manuscript
Kush Sharma
 
Array_nmeth.3507
Array_nmeth.3507Array_nmeth.3507
Array_nmeth.3507
Aana Hahn
 
2014 Taverna Tutorial Introduction to eScience and workflows
2014 Taverna Tutorial Introduction to eScience and workflows2014 Taverna Tutorial Introduction to eScience and workflows
2014 Taverna Tutorial Introduction to eScience and workflows
myGrid team
 
The Importance Of Animal Uses In Animals
The Importance Of Animal Uses In AnimalsThe Importance Of Animal Uses In Animals
The Importance Of Animal Uses In Animals
Jessica Lopez
 
Real time pcr assay for rapid detection and quantification of campylobacter j...
Real time pcr assay for rapid detection and quantification of campylobacter j...Real time pcr assay for rapid detection and quantification of campylobacter j...
Real time pcr assay for rapid detection and quantification of campylobacter j...
Tiensae Teshome
 
Next Generation Sequencing methods
Next Generation Sequencing methods Next Generation Sequencing methods
Next Generation Sequencing methods
Zohaib HUSSAIN
 
Dr. Amy Managh, Loughborough University
Dr. Amy Managh, Loughborough UniversityDr. Amy Managh, Loughborough University
Dr. Amy Managh, Loughborough University
Trinity College Dublin
 
Nature - 454 Sequencing
Nature - 454 SequencingNature - 454 Sequencing
Nature - 454 Sequencing
Michael Weiner
 
Processing Amplicon Sequence Data for the Analysis of Microbial Communities
Processing Amplicon Sequence Data for the Analysis of Microbial CommunitiesProcessing Amplicon Sequence Data for the Analysis of Microbial Communities
Processing Amplicon Sequence Data for the Analysis of Microbial Communities
Martin Hartmann
 
labchip_dtaller
labchip_dtallerlabchip_dtaller
labchip_dtaller
Danny Taller
 
JBEI Highlights June 2015
JBEI Highlights June 2015JBEI Highlights June 2015
JBEI Highlights June 2015
Irina Silva
 
Computational Toxicity in 21st Century Safety Sciences
Computational Toxicity in 21st Century Safety SciencesComputational Toxicity in 21st Century Safety Sciences
Computational Toxicity in 21st Century Safety Sciences
U.S. EPA Office of Research and Development
 
Automated platform for multiparameter stimulus response studies of metabolic ...
Automated platform for multiparameter stimulus response studies of metabolic ...Automated platform for multiparameter stimulus response studies of metabolic ...
Automated platform for multiparameter stimulus response studies of metabolic ...
Shashaanka Ashili
 
UK CV new
UK CV newUK CV new
Sensing metabolites for the monitoring of tissue engineered construct cellula...
Sensing metabolites for the monitoring of tissue engineered construct cellula...Sensing metabolites for the monitoring of tissue engineered construct cellula...
Sensing metabolites for the monitoring of tissue engineered construct cellula...
Antoine DEGOIX
 
Computational Biophysics in the Petascale Computing Era
Computational Biophysics in the Petascale Computing EraComputational Biophysics in the Petascale Computing Era
Computational Biophysics in the Petascale Computing Era
inside-BigData.com
 
Evaluation of Automated COBAS AMPLICOR PCR System for Detection of Several In...
Evaluation of Automated COBAS AMPLICOR PCR System for Detection of Several In...Evaluation of Automated COBAS AMPLICOR PCR System for Detection of Several In...
Evaluation of Automated COBAS AMPLICOR PCR System for Detection of Several In...
Alberto Cuadrado
 

Similar to Journal of Laboratory Automation-2016-Cain-Hom-37-48 (20)

Genovesio et al j biomol screen 2011-genovesio-1087057111415521
Genovesio et al j biomol screen 2011-genovesio-1087057111415521Genovesio et al j biomol screen 2011-genovesio-1087057111415521
Genovesio et al j biomol screen 2011-genovesio-1087057111415521
 
Using In Silico Tools in Repurposing Drugs for Neglected and Orphan Diseases
Using In Silico Tools in Repurposing Drugs for Neglected and Orphan DiseasesUsing In Silico Tools in Repurposing Drugs for Neglected and Orphan Diseases
Using In Silico Tools in Repurposing Drugs for Neglected and Orphan Diseases
 
Molecular Environmental Microbiology.ppt
Molecular Environmental Microbiology.pptMolecular Environmental Microbiology.ppt
Molecular Environmental Microbiology.ppt
 
CrossGen-Merck manuscript
CrossGen-Merck manuscriptCrossGen-Merck manuscript
CrossGen-Merck manuscript
 
Array_nmeth.3507
Array_nmeth.3507Array_nmeth.3507
Array_nmeth.3507
 
2014 Taverna Tutorial Introduction to eScience and workflows
2014 Taverna Tutorial Introduction to eScience and workflows2014 Taverna Tutorial Introduction to eScience and workflows
2014 Taverna Tutorial Introduction to eScience and workflows
 
The Importance Of Animal Uses In Animals
The Importance Of Animal Uses In AnimalsThe Importance Of Animal Uses In Animals
The Importance Of Animal Uses In Animals
 
Real time pcr assay for rapid detection and quantification of campylobacter j...
Real time pcr assay for rapid detection and quantification of campylobacter j...Real time pcr assay for rapid detection and quantification of campylobacter j...
Real time pcr assay for rapid detection and quantification of campylobacter j...
 
Next Generation Sequencing methods
Next Generation Sequencing methods Next Generation Sequencing methods
Next Generation Sequencing methods
 
Dr. Amy Managh, Loughborough University
Dr. Amy Managh, Loughborough UniversityDr. Amy Managh, Loughborough University
Dr. Amy Managh, Loughborough University
 
Nature - 454 Sequencing
Nature - 454 SequencingNature - 454 Sequencing
Nature - 454 Sequencing
 
Processing Amplicon Sequence Data for the Analysis of Microbial Communities
Processing Amplicon Sequence Data for the Analysis of Microbial CommunitiesProcessing Amplicon Sequence Data for the Analysis of Microbial Communities
Processing Amplicon Sequence Data for the Analysis of Microbial Communities
 
labchip_dtaller
labchip_dtallerlabchip_dtaller
labchip_dtaller
 
JBEI Highlights June 2015
JBEI Highlights June 2015JBEI Highlights June 2015
JBEI Highlights June 2015
 
Computational Toxicity in 21st Century Safety Sciences
Computational Toxicity in 21st Century Safety SciencesComputational Toxicity in 21st Century Safety Sciences
Computational Toxicity in 21st Century Safety Sciences
 
Automated platform for multiparameter stimulus response studies of metabolic ...
Automated platform for multiparameter stimulus response studies of metabolic ...Automated platform for multiparameter stimulus response studies of metabolic ...
Automated platform for multiparameter stimulus response studies of metabolic ...
 
UK CV new
UK CV newUK CV new
UK CV new
 
Sensing metabolites for the monitoring of tissue engineered construct cellula...
Sensing metabolites for the monitoring of tissue engineered construct cellula...Sensing metabolites for the monitoring of tissue engineered construct cellula...
Sensing metabolites for the monitoring of tissue engineered construct cellula...
 
Computational Biophysics in the Petascale Computing Era
Computational Biophysics in the Petascale Computing EraComputational Biophysics in the Petascale Computing Era
Computational Biophysics in the Petascale Computing Era
 
Evaluation of Automated COBAS AMPLICOR PCR System for Detection of Several In...
Evaluation of Automated COBAS AMPLICOR PCR System for Detection of Several In...Evaluation of Automated COBAS AMPLICOR PCR System for Detection of Several In...
Evaluation of Automated COBAS AMPLICOR PCR System for Detection of Several In...
 

More from J. Colin Cox

Cox2002-Automated_selection_of_aptamers_against_protein_targets_translated_in...
Cox2002-Automated_selection_of_aptamers_against_protein_targets_translated_in...Cox2002-Automated_selection_of_aptamers_against_protein_targets_translated_in...
Cox2002-Automated_selection_of_aptamers_against_protein_targets_translated_in...
J. Colin Cox
 
Qiu1998-The_gain_of_three_mitochondrial_introns_identifies_liverworts_as_the_...
Qiu1998-The_gain_of_three_mitochondrial_introns_identifies_liverworts_as_the_...Qiu1998-The_gain_of_three_mitochondrial_introns_identifies_liverworts_as_the_...
Qiu1998-The_gain_of_three_mitochondrial_introns_identifies_liverworts_as_the_...
J. Colin Cox
 
Cox1998-Automated_RNA_selection.
Cox1998-Automated_RNA_selection.Cox1998-Automated_RNA_selection.
Cox1998-Automated_RNA_selection.
J. Colin Cox
 
Cox2004-Probing_specificity_of_RNAribonucleoprotein_interactions_through_in_v...
Cox2004-Probing_specificity_of_RNAribonucleoprotein_interactions_through_in_v...Cox2004-Probing_specificity_of_RNAribonucleoprotein_interactions_through_in_v...
Cox2004-Probing_specificity_of_RNAribonucleoprotein_interactions_through_in_v...
J. Colin Cox
 
Allert2010-Multifactorial_determinants_of_protein_expression_in_prokaryotic_o...
Allert2010-Multifactorial_determinants_of_protein_expression_in_prokaryotic_o...Allert2010-Multifactorial_determinants_of_protein_expression_in_prokaryotic_o...
Allert2010-Multifactorial_determinants_of_protein_expression_in_prokaryotic_o...
J. Colin Cox
 
Cox2007-Protein_fabrication_automation
Cox2007-Protein_fabrication_automationCox2007-Protein_fabrication_automation
Cox2007-Protein_fabrication_automation
J. Colin Cox
 
Cox2008-Gene_Synthesis_with_a_Bioautomation_Mermade_DNA_synthesizer_and_Tecan...
Cox2008-Gene_Synthesis_with_a_Bioautomation_Mermade_DNA_synthesizer_and_Tecan...Cox2008-Gene_Synthesis_with_a_Bioautomation_Mermade_DNA_synthesizer_and_Tecan...
Cox2008-Gene_Synthesis_with_a_Bioautomation_Mermade_DNA_synthesizer_and_Tecan...
J. Colin Cox
 

More from J. Colin Cox (7)

Cox2002-Automated_selection_of_aptamers_against_protein_targets_translated_in...
Cox2002-Automated_selection_of_aptamers_against_protein_targets_translated_in...Cox2002-Automated_selection_of_aptamers_against_protein_targets_translated_in...
Cox2002-Automated_selection_of_aptamers_against_protein_targets_translated_in...
 
Qiu1998-The_gain_of_three_mitochondrial_introns_identifies_liverworts_as_the_...
Qiu1998-The_gain_of_three_mitochondrial_introns_identifies_liverworts_as_the_...Qiu1998-The_gain_of_three_mitochondrial_introns_identifies_liverworts_as_the_...
Qiu1998-The_gain_of_three_mitochondrial_introns_identifies_liverworts_as_the_...
 
Cox1998-Automated_RNA_selection.
Cox1998-Automated_RNA_selection.Cox1998-Automated_RNA_selection.
Cox1998-Automated_RNA_selection.
 
Cox2004-Probing_specificity_of_RNAribonucleoprotein_interactions_through_in_v...
Cox2004-Probing_specificity_of_RNAribonucleoprotein_interactions_through_in_v...Cox2004-Probing_specificity_of_RNAribonucleoprotein_interactions_through_in_v...
Cox2004-Probing_specificity_of_RNAribonucleoprotein_interactions_through_in_v...
 
Allert2010-Multifactorial_determinants_of_protein_expression_in_prokaryotic_o...
Allert2010-Multifactorial_determinants_of_protein_expression_in_prokaryotic_o...Allert2010-Multifactorial_determinants_of_protein_expression_in_prokaryotic_o...
Allert2010-Multifactorial_determinants_of_protein_expression_in_prokaryotic_o...
 
Cox2007-Protein_fabrication_automation
Cox2007-Protein_fabrication_automationCox2007-Protein_fabrication_automation
Cox2007-Protein_fabrication_automation
 
Cox2008-Gene_Synthesis_with_a_Bioautomation_Mermade_DNA_synthesizer_and_Tecan...
Cox2008-Gene_Synthesis_with_a_Bioautomation_Mermade_DNA_synthesizer_and_Tecan...Cox2008-Gene_Synthesis_with_a_Bioautomation_Mermade_DNA_synthesizer_and_Tecan...
Cox2008-Gene_Synthesis_with_a_Bioautomation_Mermade_DNA_synthesizer_and_Tecan...
 

Journal of Laboratory Automation-2016-Cain-Hom-37-48

  • 1. Journal of Laboratory Automation 2016, Vol. 21(1) 37­–48 © 2015 Society for Laboratory Automation and Screening DOI: 10.1177/2211068215601637 jala.sagepub.com Original Report Introduction The use of laboratory animals in research drives functional genomics and the community’s understanding of gene func- tion through organismal mutagenesis.1 By manipulating ani- mal genomes, researchers can elucidate the etiology of cancer and other highly impactful human diseases.2 Mice, in these set- tings, are often used as a model organism because there is translational correlation between observations recorded from investigation of a mutant mouse to the potentiality of produc- ing a marketable human drug treatment based on such data.3 Moreover, the mouse is a practical research animal: It is one of the smallest mammals, has a short generation time of 10 weeks from being born to giving birth, and is typically a prolific breeder generating 5–10 pups per litter.4 Scientists are rou- tinely able to replace endogenous mouse genes for their human counterparts, thus “humanizing” them, allowing researchers to generate results more directly applicable to human disease.5,6 Changes to a mouse’s genome can be introduced through the manipulation of embryonic stem cells to create chimeric mice, some of which will possess the ability to potentiate the introduced mutation through germline breeding.7 These changes have been classically introduced by random chemi- cal mutagenesis or through pronuclear injection of a foreign transgene that is randomly integrated into the genome.8 For the past 25 years, locus-specific genomic manipulation has been carried out by electroporating mouse embryonic stem cells with a DNA construct containing flanking homology arms that drive incorporation into the genome via homolo- gous recombination pathways.9 Use of the Cre/loxP or Tet-On/Tet-Off systems enables creation of conditionally expressive models, allowing researchers to control both spatial and temporal expression of modified loci.10–12 Novel 601637JLAXXX10.1177/2211068215601637Journal of Laboratory AutomationCain-Hom et al. research-article2015 1 Department of Transgenic Technology, Genentech Inc., San Francisco, CA, USA Received Mar 4, 2015. Corresponding Author: J. Colin Cox, Department of Transgenic Technology, Genentech Inc., 1 DNA Way, MS 300, South San Francisco, CA 94080, USA. Email: cox.colin@gene.com Mammalian Genotyping Using Acoustic Droplet Ejection for Enhanced Data Reproducibility, Superior Throughput, and Minimized Cross-Contamination Carol Cain-Hom1 , Ryan Pabalate1 , Anna Pham1 , Hetal N. Patel1 , Rhonda Wiler1 , and J. Colin Cox1 Abstract Genetically engineered animal models are major tools of a drug discovery pipeline because they facilitate understanding of the molecular and biochemical basis of disease. These highly complex models of human disease often require increasingly convoluted genetic analysis. With growing needs for throughput and consistency, we find that traditional aspiration-and- dispense liquid-handling robots no longer have the required speed, quality, or reproducibility. We present an adaptation and installation of an acoustic droplet ejection (ADE) liquid-handling system for ultra- high-throughput screening of genetically engineered models. An ADE system is fully integrated with existing laboratory processes and platforms to facilitate execution of PCR and quantitative PCR (qPCR) reactions. Such a configuration permits interrogation of highly complex genetic models in a variety of backgrounds. Our findings demonstrate that a single ADE system replaces 8–10 traditional liquid-handling robots while increasing quality and reproducibility. We demonstrate significant improvements achieved by transitioning to an ADE device: extremely low detectable cross- contamination in PCR and qPCR despite extensive use, greatly increased data reproducibility (large increases in data quality and Cq consistency), lowered reaction volumes for large cost savings, and nearly a magnitude increase in speed per instrument. We show several comparisons between traditional- and ADE-based pipetting for a qPCR-based workflow. Keywords genotyping, acoustic droplet ejection, RT-PCR, Echo, ADE by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 2. 38 Journal of Laboratory Automation 21(1) and emerging techniques use nucleases conjugated to a spe- cific DNA binding domain, such as zinc-finger nucleases13 or the Cas9/CRISPR system.14 Of particular interest, CRISPR has been proven to create multiple mutations in a mouse in a single step15 and has been demonstrated to cre- ate a variety of construct types.16 Modified organisms require careful and accurate geno- typing to identify founding animals and continue produc- tion through a colony’s lifetime. Like any large-scale effort with high degrees of complexity, such operations directly benefit from laboratory automation efforts. Lab robotics have been used previously to carry out PCR-based genotyp- ing of mice,17 SNP typing of blood18 and forensic19 samples, high-resolution melting experiments,20 characterizing mutated yeast strains,21 genotyping bacterial pathogens,22 performing DNA extraction,20 and automating sequencing of human disease loci.23 We use lab automation systems to carry out the bulk of our laboratory’s work: the extraction of gDNA from ~350,000 samples to assemble >1 M PCR and qPCR reactions to facilitate analysis of ~800,000 genotypes per annum. Previously, we have relied on traditional liquid-handling robots, using standard aspirate-and-dispense pipetting tech- nology, to assemble our molecular amplification reactions. We found that increasing workloads do not scale well on these platforms; more work requires the installation of more robots, consuming a good deal of resources (i.e., lab space and funding). In previous observations and detailed here, we find these robots do not always produce the precision desired, nor do they rigorously prevent cross-contamination between samples. Moreover, there has been little transfor- mative progress in aspirate-and-dispense technology. Although incremental progress continues to be made, the landscape of using robots to transfer liquids using dispos- able or fixed tips has changed little in the past 15 years. The introduction of acoustic droplet ejection (ADE) pipettors drastically changes this landscape. The history and physics of ADE are well documented in this journal issue. In brief, energy is acoustically transferred from a transducer into a microplate containing reagent to be transferred. This focused energy results in the ejection of a small droplet (here, 25 nl) that travels directly upward into an upside-down recipient plate, which captures the droplet via surface tension.24 Hundreds of droplets can be fired each second and flown in a very precise manner without any physical contact being made between the device and the reagent, greatly reducing cross-contamination.25 Recent developments to ADE liquid handlers in the past two years have made these devices accessible to the genomic arena. We have installed and used ADE lab robotics to carry out the genotyping of several hundred thousand genetically engineered rodents. Genotyping is carried out across two platforms: PCR-based fragment analysis and real-time or quantitative PCR (qPCR). Below, we present our initial testing and evaluate this liquid handling platform in the context of increasing precision while simultaneously reduc- ing cross-contamination to a great extent. In addition, we discuss other benefits by adopting this technology: very large throughput increases, reduction of primer and probe handling, and potential applications of this technology for other molecular biology–based applications. Materials and Methods Robotic Assembly Platforms Aspirate-and-dispense liquid-handling robot: Tecan Evo robots were used as representative traditional laboratory pipetting robots and were outfitted with standard diameter system tubing, 0.5 ml syringes, and Span-8 Teflon-coated fixed tips. Tips are cleaned between reagents via dispensing of 50 ml distilled water into the wash station, followed by tip washing with 5 ml distilled water into the shallow wash station cleaner. System tubing is scrubbed with detergent, and fixed tips are bleach-treated according to the manufac- turer’s instructions. The Evo worksurface is outfitted with labware to hold Eppendorf tubes containing master mix and assays, gDNA source plates, and 96-well destination PCR plates. Acoustic droplet ejection pipettor and supplementary robotics: Labcyte Echo 525s were chosen to assemble qPCR reactions by using acoustic droplet ejection. Our con- figuration contains two Echo 525s accessed by an Access robotic arm workstation (Fig. 1). The Access deck houses peripherals necessary for an unattended amplification reac- tion assembly: a Thermo-Fisher Scientific Combi NL Universal for bulk dispensing of mastermix and water, a Nexus Xpeel microplate desealer to remove microplate adhesive seals, an Agilent PlateLoc Sealer to seal fully assembled PCR plates, and anAgilent Microplate Centrifuge to reset reagent menisci before acoustic transfer. Precision Testing with a qPCR Platform (Rosa26 Locus) A pool of gDNA was created from extractions of ~1000 wild- type mice from preps created using the DNeasy 96 Blood & Tissue Kit (Qiagen, Venlo, the Netherlands). gDNA template concentrations in these reactions on the Evo (20 µl) and Echo (5 µl) platforms were approximately 8 µM. Reactions were assembled in the following manner: 400 nM forward and reverse primers, 150 nM probe, and 1× Type-It Fast SNP PCR Master Mix + ROX dye (Qiagen). Nucleotide sequences for these oligos are as follows: Rosa26WT forward: CCCGCCC ATCTTCTAGAAAGA; Rosa26WT reverse: CTGGGCCTG GGAGAATCC; and Rosa26WT probe: /56-FAM/TTCCCCC TCTTCCCTCGTGATCTGC/3IABkFQ/. The endogenous control assay is composed of the following: ApoB forward by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 3. Cain-Hom et al. 39 primer: CACGTGGGCTCCAGCATT; ApoB reverse primer: TCACCAGTCATTTCTGCCTTTG (oIMR1544, oIMR3580; Jackson Laboratory, Bar Harbor, Maine); and ApoB probe: VIC-CCAATGGTCGGCACTGCTCAA-MGBNFQ (ABI/ Life Technologies, Carlsbad, CA). No-template-control (NTC) reactions contained distilled water in place of gDNA template. Assays were cycled on a 7900HT Fast Real-Time PCR System (ABI/Life Technologies) and were analyzed using SDS 2.4.1 (ABI/Life Technologies). Assays were thermal cycled as follows: initial denaturation (95 °C, 5′) followed by 35 cycles of PCR (95 °C, 60″; 60 °C, 30″; and 72 °C, 60″). Contamination Testing with a qPCR Platform (Cre Locus) Genomic DNA from Cre+ positive mice were purified using the Agencourt DNAdvance kit (Beckman Coulter, Brea, CA) executed on a Biomek FXP liquid handler (Beckman Coulter). gDNA from 560 animals all harboring a Cre Figure 1.  Schematic of a high- throughput mammalian genotyping reaction assembly platform using acoustic droplet ejection. Shown is a top-down view (top) and a front- facing view (bottom). The platform consists of two Labcyte Echo 525s serviced by an Access robotic arm. In addition to providing reagent delivery to the acoustic dispensers, the arm also serves accessory peripherals: a microplate sealer, microplate desealer, microplate centrifuge, low-volume bulk plate dispenser, and microplate storage hotels. by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 4. 40 Journal of Laboratory Automation 21(1) transgene were pooled to make a Cre+ positive gDNA “pooled” stock. In addition, 192 mouse gDNA samples were identified as Cre-harboring samples to represent indi- vidual (versus pooled) samples. qPCR assays were assem- bled on the Tecan Evo in 96-well plates to a final volume of 20 µl; the Labcyte 525 was used to construct reactions in a 384-well plates to a final volume of 5 µl. Experimental and NTC reactions were arranged in an alternating checker- board pattern. gDNA template concentrations in these reac- tions on the Evo and Echo platforms were approximately 8 µM and 5 µM, respectively. The reactions were assembled in the following manner: 400 nM forward and reverse primers, 150 nM probe, and 1× Type-It Fast SNP PCR Master Mix + ROX dye (Qiagen). Nucleotide sequences for these transgene oligos are as follows: Cre forward primer: GCGGTCTGGCAGTAAAAACTATC; Cre reverse primer: GTGAAACAGCATTGCTGTCACTT (oIMR1084, oIMR1085; Jackson Laboratory); and Cre probe: FAM/AA+ACATGC+T/ZEN/TCA+TCG+TCGG/3IABkFQ (a plus sign preceding the nucleotides indicates LNA bases; IDT, Coralville, IA). The endogenous control assay was com- posed of the following: ApoB forward primer: CACGTGGG CTCCAGCATT; ApoB reverse primer: TCACCAGTCATT TCTGCCTTTG (oIMR1544, oIMR3580; Jackson Labora- tory); and ApoB probe: HEX/CC+A+ATGG+TC/ZEN/ GGGCAC+TG/3IABkFQ (IDT; a plus sign preceding the nucleotides indicates LNA bases). NTC reactions contained distilled water in place of gDNAtemplate.Assays were cycled on a C1000 CFX Touch optical thermalcycler (BioRad) and were analyzed using CFX Manager 3.1 (BioRad).Assays were thermal cycled as follows: initial denaturation (95 °C, 5′) fol- lowed by 50 cycles of PCR (95 °C, 60″; 60 °C, 30″; and 72 °C, 60″). Contamination Testing with a PCR / Fragment Analysis Platform (PS2 Locus) Genomic DNA from PS2+ positive mice were purified using the Agencourt DNAdvance kit (Beckman Coulter) executed on a Biomek FXP liquid handler (Beckman Coulter). gDNA from 143 animals all harboring a PS2 transgene were pooled to make a PS2+ positive gDNA “pooled” stock. qPCR assays were assembled on the Tecan Evo in 96-well plates to a final volume of 20 µl; the Labcyte 525 was used to construct reactions in 384-well plates to a final volume of 5 µl. Experimental and NTC reactions were arranged in an alternating checkerboard pattern. gDNA template concentrations in these reactions on the Evo and Echo platforms were approximately 8 µM and 5 µM, respectively. The reactions were assembled in the following manner: 625 nM forward and reverse primers and 1× Type-It Fast SNP PCR Master Mix + ROX dye (Qiagen). Nucleotide sequences for these oligos are as follows: PS2 forward primer: /56-FAM/TCATTGGCTTGTGTCTGACCCT; PS2 reverse primer: GCTTTCAACGTCAGTAGGACAA; IL8R forward primer: /56-FAM/CTTCGCTGTCGTCCTTGTCT; and IL8R reverse primer: AGCCATGATCCTGAGAAGTC CAT. NTC reactions contained distilled water in place of the gDNA template. 96-well Evo-assembled assays were cycled on a GeneAmp PCR 9700 System (ABI/LifeTech), whereas Echo-assembled reactions were cycled on a C1000 CFX Touch. Assays were thermal cycled as follows: initial denatur- ation (95 °C, 5′) followed by 30 cycles of PCR (95 °C, 60″; 60 °C, 30″; and 72 °C, 60″). PCR assays were analyzed using a 3730XL DNA Analyzer (ABI/Life Technologies). POP-7 Performance Optimized Polymer (ABI/Life Technologies) was used as a matrix within a 50 cm capillary array. GeneScan 600 LIZ size standard (ABI/Life Technologies) was used as a system control; a 30× dilution of the size standard was car- ried out in HiDi Formamide (ABI/Life Technologies) and used to dilute PCR samples by 21×. Ten microliters of the diluted assays were loaded onto the DNA Analyzer. Data were analyzed using Gene Mapper 4.0 software (ABI/Life Technologies). Results and Discussion Evaluation of Data Consistency A traditional liquid handler was directly compared to an acoustic-based dispenser to evaluate qPCR reaction assem- bly. Initially, we evaluated the consistency and robustness of analyzing large cohorts of genetically modified mice on each platform. We randomly chose a large cohort of mice containing ~1000 individuals in roughly a dozen colonies containing the same modified locus. After pooling those samples together to create a “master” DNA source, we then set up qPCR reactions containing primer and probes to interrogate two endogenous control genes (Rosa26 and ApoB). Care was taken to minimize sources of variability that could be imparted from other aspects of reaction assem- bly, such as those attributable to using different lots of assay reagents, assembling master mixes in multiple sessions, and so on. Reactions were assembled as described and cycled 35 times while monitoring accumulation of probe signals. Results are depicted in Figure 2; amplification curves are shown for each probe channel [i.e., VIC fluorophore (Apo) and FAM fluorophore (Rosa26)] plotted for each robotic assembly platform (Fig. 2a). These same data are presented as an endpoint scatterplot in which the Rosa26 signal is plotted on the X-axis and the ApoB probe signal on the Y-axis (Fig. 2b). Data resulting fromADE-based assem- bly demonstrate a higher level of precision than that of tra- ditionally assembled reactions in both amplification curves and scatterplots. Specifically, amplification curves (Fig. 2a) by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 5. Cain-Hom et al. 41 for the ADE-assembled reactions demonstrate more similar Cq values than those assembled with a classical liquid han- dler (summarized in Table 1). In this experiment, both detectors displayed superior standard deviations between samples when assembled by ADE versus traditional robots. This is one of many illustrations of an increase in precision and reproducibility when applying ADE technology to genomic applications. Differences in data quality are more apparent when viewed as a scatterplot (Fig. 2b). Reactions created by tra- ditional pipetting platforms demonstrate a greater variabil- ity in the scattercloud (left) than with ADE-assembled reactions (right). The ratiometric distance between the NTC signals (black crosses) and the lowest positive RFU values (green circles) are nearly doubled between the two plat- forms for both probes. Moreover, three data samples from the classically assembled reactions are ambiguous and require reanalysis; zero samples from the ADE platform were seen to be uncertain. In the context of a mammalian genotyping laboratory, this is highly impactful. Unlike cell- based work in which it is commonly accepted that some data points will drop out due to the nature of high-through- put workflows, this remains an intractable issue in a vivar- ium setting. Compassionate welfare standards and strict adherence to the 3R principles26–28 and Institutional Animal Care and Use Committee procedures dictate that, in many A B FAM Cycles RFU RFU 1.000E+1 1.000 1.000E-1 1.000E-2 1.000E-3 15 25 35 1.000E+1 1.000 1.000E-1 1.000E-2 1.000E-3 15 25 35 VIC 1.000E+1 1.000 1.000E-1 1.000E-2 1.000E-3 15 25 35 Cycles Cycles RFU RFU ADE 1.000E+1 1.000 1.000E-1 1.000E-2 1.000E-3 15 25 35 Traditional Cycles Traditional ADE Cycles ADETraditional 1 7 14 0.2 2.5 4.5 1 7 14 0.2 2.5 4.5 FAM (Rosa26) RFU FAM (Rosa26) RFU VIC(ApoB)RFU VIC(ApoB)RFU Figure 2.  Comparison of quantitative PCR (qPCR)-based genotyping data quality by platform. Amplification curves (A) and cluster plots (B) are depicted for both traditional- and acoustic droplet ejection (ADE)- assembled reactions. (A) Curves are illustrated for FAM (top) and VIC (bottom) channels; the green line shows the Cq threshold (0.4). (B) The same data are interpreted as a cluster plot. Black Xs are no-template controls (NTCs), green dots represent experimental samples, and red dots (highlighted by a blue circle) denote ambiguous data samples that cannot be clearly assigned a genotype. by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 6. 42 Journal of Laboratory Automation 21(1) cases, an animal’s genotype must be evaluated to properly determine the appropriate course of action for that individ- ual. Significant numbers of samples requiring reanalysis not only create additional burden and extended turnaround times for a genetic analysis laboratory but also increase the workload of a colony resource and management team car- ing for the genetic models. Reduction of samples requiring reanalysis is an understated boon when performing analysis of animal models. Overall, improved clustering yields not only a reduced reanalysis load but also more rapid and straightforward cohort-based data analysis. Evaluation of Cross-Contamination in Quantitative PCR One of the many compelling reasons to transition from a classic to ADE-based reaction setup is the giant reduction in observable cross-contamination.29,30 In our first tests with acoustic-based dispense technology (data not shown), we examined cross-contamination in limited fashion at 35 amplification cycles. Our initial results were promising: 16 of 96 (16.7%) NTC reactions assembled by a tradi- tional laboratory robot were found to be contaminated with exogenous gDNA, whereas none of 168 reactions (0%) assembled by ADE demonstrated any apparent cross- contamination. Because these data seemed so remarkable, we wished for a more thorough investigation and so initi- ated the following study. We performed this study to evaluate cross-contamination in two different modes. To examine only platform-to- platform variability, we ran several series of reactions com- posed of a single source of gDNA pooled from a large cohort of mice all sharing the same modified locus. This facilitates simple comparisons between platforms. To better mirror actual mammalian genotyping operations, we repeated these series using individual and unique gDNA samples. This was done to account for the animal-to-animal and cohort-to-cohort variability that is observed when genotyping inbred laboratory strains. We identified many individual gDNA samples containing the same transgene (Cre recombinase) under various endogenous mammalian promoters and probed for it using an endogenous locus (ApoB) as a positive control. The result of this project is shown in Figures 3 and 4. Scatterplots are displayed at a typical amount of PCR amplification (i.e., 32 cycles; Fig. 3, top row) and an extreme amount of cycling to clearly observe contamina- tion (50 cycles; Fig. 3, bottom row). Reactions assembled using classical robotics (Fig. 3, left column) are compared to ADE-assembled reactions (Fig. 3, right column). The results between platforms are striking. In viewing the com- parison between platforms at 32 cycles, theADE-assembled reactions show no sign of amplification in NTC controls (red dots, N = 192). In contrast, nearly all (97.9%) NTC reactions created by the traditional pipetting platform dem- onstrated appreciable levels of amplification. At certain lev- els, this causes reanalysis of certain cohorts when a particular NTC is no longer statistically significant from the positive amplification signals in that grouping. In addi- tion, the relative signal intensity is nearly double with the ADE-created reactions interrogating the noncontrol probe (Cre, X-axis). Once again, we observe a large and meaning- ful increase in the signal-to-noise (S:N) ratios between the different pipetting technologies. This trend is more evident at very high levels of amplifi- cation (50 PCR cycles). Here, virtually all classically assembled samples now exhibit nearly indistinguishable amounts of amplification on both Cre and Apo assays (188/192 replicates, 98.0%). In direct comparison, only a couple of reactions were positive for the Cre assay (X-axis; 2/192 replicates, 1.0%), whereas none were for the endog- enous control gene. This impressive reduction in contami- nation directly results in less ambiguous data and sharply decreases the number of animals requiring reanalysis. We repeated the above study with individual gDNAsam- ples to more accurately mimic variability observed between individual animals. Scatterplots are again shown with rou- tine amounts of PCR amplification (32 cycles; Fig. 4, top row) and an excessive amount of cycling to clearly observe contamination (50 cycles; Fig. 4, bottom row). Reactions Table 1.  Summary of qPCR Quality Metrics by Assembly Platform. Traditional Pipetting ADE-Based Pipetting Sample size 370 (4× 96-well plates) 378 (1× 384-well plate) Channel FAM VIC FAM VIC Average Cq 23.94 25.94 23.67 24.51 Minimum Cq 22.96 24.02 23.23 23.97 Maximum Cq 28.84 30.73 24.09 25.21 Standard deviation ±0.41 ±0.74 ±0.16 ±0.18 Average, minimum, and maximum Cq values are provided for FAM and VIC channels, as well as standard deviations. ADE, acoustic droplet ejection; qPRC, quantitative PCR. by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 7. Cain-Hom et al. 43 created using traditional platforms (Fig. 4, left column) are contrasted to reactions assembled by an acoustic pipettor (Fig. 4, right column). As with the pooled gDNA sample, comparisons between the two technologies remain particu- larly compelling. At a routine amount of amplification (32 cycles), the ADE-assembled reactions again show no observable amplification in NTC controls (red dots, N = 192) and yield unambiguous results. Many NTC samples (138/192, 71.9%) show appreciable accumulation of signal on the X-axis [FAM fluorophore (Cre)]. Although displaying a mild increase in variability, the extreme diagnostic cycling at 50 rounds of PCR mirrors that of the 32 cycles of amplification (above) observed with the pooled sample. These individual, genetically modified mouse samples assembled by ADE show very little appar- ent contamination with very high cycling (Figure 4): One NTC sample displays as positive for Cre detection (FAM fluorophore, 1/192, 0.5%), whereas six NTC samples dis- play as positive for the Apo allele (HEX fluorophore, 6/192, 3.1%). No NTC reactions constructed acoustically demon- strated a detectable signal in both channels. In stark con- trast, all but one NTC reaction created by a traditional laboratory robot displayed observable amplification after 50 PCR cycles (191/192, 99.5%). The vast majority of NTCs exhibited strong amplification in both channels (180/192; 93.8%) with a small subset of samples showing only Cre detection (11/192; 5.7%). The data for both 32 and 50 amplification cycles are summarized in Figure 5. As shown in Figure 4, several of the NTC reactions directly overlap with experimental samples rendering statis- tical analysis impossible. In the context of a very-high- throughput genetic analysis laboratory, this can be a critical 50 cycles 32 cycles 1000 400030002000 60005000 0 2500 2000 1500 1000 500 3000 3500 0 Traditional HEX(ApoB)RFU FAM (Cre) RFU 1000 400030002000 60005000 0 2500 2000 1500 1000 500 3000 3500 0 ADE HEX(ApoB)RFU FAM (Cre) RFU 1000 400030002000 60005000 0 2500 2000 1500 1000 500 3000 3500 0 ADE HEX(ApoB)RFU FAM (Cre) RFU 1000 400030002000 60005000 0 2500 2000 1500 1000 500 3000 3500 0 HEX(ApoB)RFU FAM (Cre) RFU Traditional gDNA samples NTCs gDNA samples NTCs gDNA samples NTCs gDNA samples NTCs Figure 3.  Comparison of contamination observed when performing quantitative PCR (qPCR)-based genotyping using a single, pooled gDNA sample. Cluster plots are shown for 32 cycles of amplification (top) and 50 cycles (bottom). Reactions were assembled by a traditional robot (left column) or an acoustic droplet ejection (ADE) robot (right column). Blue dots represent positive samples; red dots are no-template controls (NTCs). by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 8. 44 Journal of Laboratory Automation 21(1) success point for a given assay or colony when this occurs at normal cycling values. Often, there is a need for all assays and protocols to follow a standard operating procedure to maximize the amount of samples that can be accurately ana- lyzed each day. A liquid-handling system that yields less obscure data provides results in a context of a higher level of scientific integrity while simultaneously reducing the amount of reanalysis required. Evaluation of Cross-Contamination in CE-Based Fragment Analysis As mentioned, our laboratory uses both fragment-based PCR genotyping as well as quantitative PCR (results described above). We sought to determine whether use of ADE liquid handlers resulted in the same gains in data consistency and cross-contamination reduction. PCR reactions were assem- bled on both robotic platforms to interrogate PS2, a transgene known to play a role in amyloid precursor protein processing, along with IL8R, an endogenous control amplicon targeting the interleukin 8 (IL8) receptor locus. After assembly, reac- tions were cycled 30 times and processed on an electropho- retic capillary-based genetic analyzer. Electropherograms representing typical data observed in this cohort are illus- trated in Figure 6. Reactions were assembled by a classical pipetting robot (Fig. 6, top row) and an ADE device (Fig. 6, bottom row). gDNA from animals known to harbor the PS2 transgene were used (Fig. 6, left column) alongside NTC reactions (Fig. 6, right column). Although the fragment peaks from the PS2+ animals (Fig. 6a,c) are clear, the signal intensity of theADE-assembled PCR reactions are more intense. We observe cross-contamination 50 cycles 32 cycles ADE 1000 400030002000 60005000 0 1000 500 0 HEX(ApoB)RFU FAM (Cre) RFU 3500 3000 2500 2000 1500 gDNA samples NTCs Traditional 0 HEX(ApoB)RFU 1000 400030002000 600050000 FAM (Cre) RFU 2500 2000 1500 1000 500 3000 3500 gDNA samples NTCs 0 2500 2000 1500 1000 500 3000 3500 HEX(ApoB)RFU Traditional 1000 400030002000 600050000 FAM (Cre) RFU gDNA samples NTCs ADE 1000 400030002000 60005000 0 2500 2000 1500 1000 500 3000 3500 0 HEX(ApoB)RFU FAM (Cre) RFU gDNA samples NTCs Figure 4.  Comparison of contamination observed when performing quantitative PCR (qPCR)-based genotyping using many individual gDNA samples. Cluster plots are shown for 32 cycles of amplification (top) and 50 cycles (bottom). Reactions were assembled by a traditional robot (left column) or an acoustic droplet ejection (ADE) robot (right column). Blue dots represent positive samples; red dots are no-template controls (NTCs). by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 9. Cain-Hom et al. 45 results on the PCR fragment platform similarly to the qPCR platform data provided above. NTC reactions created by an aspirate-and-dispense robot illustrate ample contamination signals (Fig. 6b) compared to those created by an ADE robot displaying undetectable amounts of contamination (Fig. 6d). Notably, there is a large difference in S:N between positive and negative gDNA samples on the two assembly platforms. S:N between positive samples and NTCs is ~2.3 and ~8.3, respec- tively, for the PS2 and IL8R loci. In contrast, with undetectable contamination in the no-template control reactions, the S:N for positive and negative reactions assembled byADE approaches infinity. We assembled 96 test reactions on the traditional robotic system (48 positives, 48 NTCs) and 384 reactions on the acoustic dispenser (192 positives, 192 NTCs). Again, we found most reactions set up by the classical robotic system were significantly contaminated (44/48, 91.7%), whereas none of the 192 control reactions constructed via ADE pos- sessed detectable contamination. It should be noted that dif- ferent levels of contamination result in unique outcomes dependent on the assay. In this case, the level of observed contamination, although undesired, still results in the ability to call the genotype with a fair degree of confidence. An analyst evaluating these data could determine that there is still decent S:N between NTCs and experimental samples and conclude animal genotypes. However, working in such a mode retards analysis speed while increasing risk and errors in human interpretation. In general, we noted that contamination of the blanks was often dependent on the last reagent pipetted before aspirating water for the “template” in an NTC reaction. Despite following manufacturer’s instructions for maintenance and operational procedures, if the last reagent pipetted was a gDNAsource, we observed contaminated NTCs despite thorough tip washing. In contrast, if water was transferred previously and then water was transferred again, that NTC was often observed to have little or no detectable contamination. This suggests that, in cer- tain cases, fixed tips combined with the use of standard wash- ing protocols may be insufficient for particular genomics applications. Conclusions We have illustrated the large differences in data quality and precision that can transpire from adaptation of anADE instru- ment. Moreover, the observed reduction in contamination and its effects on data interpretation and analysis can be highly impactful, especially in terms of carrying out genotyp- ing of genetically modified animals. In addition to its preci- sion,ADE liquid handlers clearly excel in throughput as well. All of our ADE experiments in this body of work required 10–11 minutes to cherrypick 384 gDNA samples to their cor- responding assays. In contrast, these same experiments car- ried out on an aspirate-and-dispense platform required 64–67 minutes to complete. In our workflow, this equates a single ADE dispenser being as productive as six or seven traditional laboratory pipetting robots. This is notable considering that the classic platforms did not have the ability to spin-down plates, remove adhesive seals, or place new seals on plates; these functions were carried out by laboratory personnel and did not factor into the above time calculations. In contrast, the 10–11-minute workflow of the ADE instrument does include those steps, making the instrument much more “walk-away” than the classic robotic platforms. Traditional IndividualPooled ADE IndividualPooled 200 150 100 50 0 32 cycles Numberofwells 200 150 100 50 0 Traditional IndividualPooled ADE IndividualPooled 50 cycles Numberofwells HEX (ApoB) FAM (Cre) A B HEX (ApoB) FAM (Cre) Figure 5.  Summary of contaminated wells by assembly platform. In this illustration, a well is considered to present contamination when displaying >500 relative fluorescent units (RFUs) at the given PCR cycle value: (A) 32 cycles; and (B) 50 cycles. FAM signal (Cre locus) is red; HEX signal (ApoB locus) is blue. Each graph illustrates contaminated wells when assembled with traditional technology (left portion) or an acoustic droplet ejection (ADE) device (right portion). by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 10. 46 Journal of Laboratory Automation 21(1) ADE pipettors have been demonstrated to operate more quickly and with more precision than traditional laboratory robots while greatly reducing contamination. With such a large difference between the two platforms, we expect ADE devices to rapidly start replacing routine applications using traditional pipetting robots, such as those used to assemble PCR and qPCR reactions. Not only are the operational met- rics of these devices quite advanced beyond what is com- mercially available, but also the return on investment (ROI) can be quite high, enabling straightforward facilitation of these devices in commercial enterprises. We took advantage of the platform to transition our genotyping reactions from 20 µl in 96-well plates to 3–5 µl reactions in 384-well plates. This equates to an annual reduction in master mix of 75% and reduction in assay reagents by roughly 50% (rather than 75% as might be expected, owning to the dead volume required in an ADE source plate). Moreover, we were able to resolve a large resource commit- ment by transitioning to an ADE-based process. A given PCR assay from our inventory may be composed of 2–4 primers; a qPCR assay will contain 3–8 oligonucleotides (2–5 primers and 1–3 probes). Previously, it took a technician’s entire effort to maintain our library of ~800 genotyping assays, composed of several thousand oligonucleotide tubes. These required assay stock generation from which dilutions would be made and placed on the traditional pipetting platforms in an on- demand situation. Currently, we now order all assays premixed and aliquoted in 384-well source plates, requiring nearly no preparation to prepare for an ADE instrument. This facilitates the redirection of a technician’s efforts to more productive C A D B PS2IL8R 10000 6000 3000 0 150 250 350 Fragment size (bp) 10000 6000 3000 0 10000 6000 3000 0 PS2IL8R IL8R 10000 6000 3000 0 Fragment size (bp) 150 250 350 150 250 350 Fragment size (bp) 150 250 350 Fragment size (bp) RFU RFU RFU RFU Traditional ADE Traditional ADE IL8R PS2 PS2 Figure 6.  Comparison of contamination observed when performing PCR fragment-based genotyping. Electropherograms are displayed for reactions assembled on a traditional liquid handler (top row) and an acoustic pipettor (bottom row). Samples positive for (A,C) the PS2 transgene were interrogated alongside (B,D) corresponding NTCs. PS2 bins are pink; the endogenous control locus (IL8R) bins are gray. by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 11. Cain-Hom et al. 47 endeavors, such as data analysis instead of manual pipetting. Because of these reagent and personnel savings, a genomics lab could expect an ADE dispenser with accessory robotic peripherals to achieve its ROI in 1–2 years. In addition, this body of work demonstrates the ability of ADE devices to assemble PCR and qPCR reactions with an impressive amount of contamination reduction. There are various sources of potential contamination in an automated laboratory; samples can become contaminated during DNA extraction,31 while reaction assembly takes place,32 or even during thermal cycling.33 It is possible that if we had used a classical liquid handler with disposable pipette tips, rather than fixed tips, we could observe different or reduced pat- terns of contamination in the above experiments. In an high- throughput laboratory, however, disposable tips are often avoided. Setting up more than 1 million reactions annually could require many million disposable tips adding a signifi- cant increase to cost per genotype. Moreover, tips and tip waste occupy valuable real estate on a robot’s worksurface, decreasing a device’s per-run density. Finally, plastic tips have been shown to leach bioactive compounds into the assembled assays, affecting experimental outcomes.34–36 ADE technology has broad applications across the fields of molecular biology, genomics, and drug discovery. For instance, a workflow has been recently described that would apply next-generation sequencing (NGS) techniques to characterizing on- and off-target CRIPSR editing events in a genome.37 Portions of such a process, notably multiplex- ing and barcoding steps, could be quite amenable to an acoustic-based liquid handler. Although it could be more challenging to use ADE technology for certain operations (e.g., transferring microbeads or cell suspensions), it becomes straightforward to envision replacing classical robotic systems with ones containing ADE robots for rou- tine source-to-destination cherrypicking. In short, ADE devices could potentially carry out a large diversity of molecular biology applications, especially those processes that most benefit from rapid pipetting and a high degree of precision, or those sensitive to potential contamination sources. Acknowledgments We would like to thank additional laboratory members who con- tributed to this effort: Deborah Siler, Maria Martinez, Gregg Sy, and Emily Hunley. The following colleagues provided a great deal of expertise in transitioning to an acoustic-based workflow: Timothy D. Dawes, Richie Rodriguez, Peter Thana, Justin Bramwell, Randy Dyer, Howard Lee, and Mike Travis. Finally, we are thankful to Ichiro Matsumura for guidance. Declaration of Conflicting Interests The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. Funding The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was completed using internal funding sources. References 1. Sung, Y. H.; Song, J.; Lee, H. W. Functional Genomics Approach Using Mice. J. Biochem. Mol. Biol. 2004, 37, 122– 132. 2. Frese, K. K.; Tuveson, D. A. Maximizing Mouse Cancer Models. Nat. Rev. Cancer. 2007, 7, 645–658. 3. Zambrowicz, B. P.; Sands, A. T. Knockouts Model the 100 Best-Selling Drugs—Will They Model the Next 100? Nat. Rev. Drug Discov. 2003, 2, 38–51. 4. Silver, L. M. Mouse Genetics: Concepts and Application. Oxford University Press: New York, 1995; pp 1–14. 5. Nebert, D. W.; Dalton, T. P.; Stuart, G. W.; et al. “Gene-Swap Knock-In” Cassette in Mice to Study Allelic Differences in Human Genes. Ann. N. Y. Acad. Sci. 2000, 919, 148–170. 6. Xie, W.; Barwick, J. L.; Downes, M.; et al. Humanized Xenobiotic Response in Mice Expressing Nuclear Receptor SXR. Nature. 2000, 406, 435–439. 7. Phillips, M. I.; Tang, Y. L. Genetic Modification of Stem Cells for Transplantation. Adv. Drug. Deliv. Rev. 2008, 60, 160–172. 8. Silver, L. M. Mouse Genetics: Concepts and Applications. Oxford University Press: New York, 1995; pp 114–132. 9. Mortensen, R. Overview of Gene Targeting by Homologous Recombination. Curr. Protoc. Mol. Biol. 2006, 23, unit 23 21. 10. Kuhn, R.; Torres, R. M. Cre/loxP Recombination System and Gene Targeting. Methods. Mol. Biol. 2002, 180, 175–204. 11. Brault, V.; Besson, V.; Magnol, L.; et al. Cre/loxP-Mediated Chromosome Engineering of the Mouse Genome. Handb. Exp. Pharmacol. 2007, 29–48. 12. Sun, Y.; Chen, X.; Xiao, D. Tetracycline-Inducible Expression Systems: New Strategies and Practices in the Transgenic Mouse Modeling. Acta Biochim. Biophys. Sinica. 2007, 39, 235–246. 13. Belizario, J. E.; Akamini, P.; Wolf, P.; et al. New Routes for Transgenesis of the Mouse. J. Appl. Genet. 2012, 53, 295– 315. 14. Cong, L.; Ran, F. A.; Cox, D.; et al. Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013, 339, 819–823. 15. Wang, H.; Yang, H.; Shivalila, C. S.; et al. One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering. Cell. 2013, 153, 910–918. 16. Yang, H.; Wang, H.; Jaenisch, R. Generating Genetically Modified Mice Using CRISPR/Cas-Mediated Genome Engineering. Nat. Protoc. 2014, 9, 1956–1968. 17. Linask, K. L.; Lo, C. W. High-Throughput Mouse Genotyping Using Robotics Automation. Biotechniques. 2005, 38, 219– 223. 18. Le Goff, G. C.; Bres, J. C.; Rigal, D.; et al. Robust, High- Throughput Solution for Blood Group Genotyping. Anal. Chem. 2010, 82, 6185–6192. by guest on January 30, 2016jla.sagepub.comDownloaded from
  • 12. 48 Journal of Laboratory Automation 21(1) 19. Stangegaard, M.; Tomas, C.; Hansen, A. J.; et al. Biomek-3000 and GenPlex SNP Genotyping in Forensic Genetics. J. Assoc. Lab. Automation. 2008, 13, 297–303. 20. Seipp, M. T.; Herrmann, M.; Wittwer, C. T. Automated DNA Extraction, Quantification, Dilution, and PCR Preparation for Genotyping by High-Resolution Melting. J. Biomol. Tech. 2010, 21, 163–166. 21. Franco-Duarte,R.;Mendes,I.;Gomes,A.C.;etal.Genotyping of Saccharomyces cerevisiae Strains by Interdelta Sequence Typing Using Automated Microfluidics. Electrophoresis. 2011, 32, 1447–1455. 22. O’Farrell,B.;Haase,J.K.;Velayudhan,V.;etal.Transforming Microbial Genotyping: A Robotic Pipeline for Genotyping Bacterial Strains. PLoS One. 2012, 7, e48022. 23. Bortot, B.; Athanasakis, E.; Brun, F.; et al. High-Throughput Genotyping Robot-Assisted Method for Mutation Detection in Patients with Hypertrophic Cardiomyopathy. Diagn. Mol. Pathol. 2011, 20, 175–179. 24. Ellson, R.; Mutz, M.; Browning, B.; et al. Transfer of Low Nanoliter Volumes between Microplates Using Focused Acoustics-Automation Considerations. J. Assoc. Lab. Automation. 2003, 8, 29–34. 25. Barco, J. Flexible qPCR Assay Assembly Liquid Handler Designed to Reduce Contamination Risk and Operational Costs. GEN. Apr 1, 2013. 26. Parker, R. M.; Browne, W. J. The Place of Experimental Design and Statistics in the 3Rs. Ilar. J. 2014, 55, 477–485. 27. Russell, W. M. The Development of the Three Rs Concept. Altern. Lab Anim. 1995, 23, 298–304. 28. Griffin, G.; Clark, J. M.; Zurlo, J.; et al. Scientific Uses of Animals: Harm-Benefit Analysis and Complementary Approaches to Implementing the Three Rs. Rev. Sci. Tech. 2014, 33, 265–272. 29. Griffith, D.; Northwood, R.; Owen, P.; et al. Implementation and Development of an Automated, Ultra-High-Capacity, Acoustic, Flexible Dispensing Platform for Assay-Ready Plate Delivery. J. Lab. Autom. 2012, 17, 348–358. 30. Quintero, C.; Rosenstein, C.; Hughes, B.; et al. Quality Control Procedures for Dose-Response Curve Generation Using Nanoliter Dispense Technologies. J. Biomol. Screen. 2007, 12, 891–899. 31. Perry, M. D.; White, P. L.; Barnes, R. A. Comparison of Four Automated Nucleic Acid Extraction Platforms for the Recovery of DNA from Aspergillus fumigatus. J. Med. Microbiol. 2014, 63, 1160–1166. 32. Fregeau, C. J.; Yensen, C.; Elliott, J.; et al. Optimized Configuration of Fixed-Tip Robotic Liquid-Handling Stations for the Elimination of Biological Sample Cross-Contamination. J. Assoc. Lab. Automation. 2007, 12, 339–354. 33. Stals, A.; Werbrouck, H.; Baert, L.; et al. Laboratory Efforts to Eliminate Contamination Problems in the Real-Time RT-PCR Detection of Noroviruses. J. Microbiol. Methods 2009, 77, 72–76. 34. Watson, J.; Greenough, E. B.; Leet, J. E.; et al. Extraction, Identification, and Functional Characterization of a Bioactive Substance from Automated Compound-Handling Plastic Tips. J. Biomol. Screen. 2009, 14, 566–572. 35. McDonald, G. R.; Hudson, A. L.; Dunn, S. M.; et al. Bioactive Contaminants Leach from Disposable Laboratory Plasticware. Science. 2008, 322, 917. 36. Olivieri, A.; Degenhardt, O. S.; McDonald, G. R.; et al. On the Disruption of Biochemical and Biological Assays by Chemicals Leaching from Disposable Laboratory Plasticware. Can. J. Physiol. Pharmacol. 2012, 90, 697–703. 37. Singh, P.; Schimenti, J. C.; Bolcun-Filas, E. A Mouse Geneticist’s Practical Guide to CRISPR Applications. Genetics 2015, 199, 1–15. by guest on January 30, 2016jla.sagepub.comDownloaded from