Cryptography KeysCryptography provides confidentiality, inte.docx
•Download as DOCX, PDF•
0 likes•3 views
Cryptography Keys Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use. Let’s say you work for one of the following types of industry: Manufacturing Government Research Service Consulting After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week. .
Report
Share
Report
Share
Recommended
Cryptography provides confidentiality, integrity authentication,.docx
Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use.
Let’s say you work for one of the following types of industry:
Manufacturing
Government
Research
Service
Consulting
After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.
.
In responding to your peers’ posts, assess your peers’ recommendatio.docx
In responding to your peers’ posts, assess your peers’ recommendations and discuss whether additional modifications are needed. BUT respond according to the post if need be.
1.Nice post on the role of the cryptographic algorithm.
One good thing you need to be aware is the fact that these algorithms can be utilized in a way to strengthen organizations existing plan by providing an additional layer of prevention especially as it relates to network security, but as Olzak (2012) notes, before looking at when and what to encrypt, it is important to understand where encryption fits in the overall security controls architecture. In your own view, do you think that encryption adds additional overhead and cost to the data process?
2.(CH)The Role that most cryptographic algorithms play is pretty essential to big organizations
and most computer users. When using the internet on a daily basis its main objective is to keep your system secure and keep information private from other users. There are many Cryptographic algorithms, that have specific purposes on how they are implemented. One of the most common algorithms is RSA ( Rivest-Shamir-Adleman) mostly common known as asymmetric cryptography. The way it works is it uses one private key and one public key (which is everyone is able to Access). While both keys are able to encrypt the message, the way to decrypt it is by using the opposite key you used from the beginning. This particular algorithm can be used to strengthen and organization's existing plan by adding confidentiality and authenticity to secure a stable connection over the network the organization uses at hand. One of the other main encryptions used by Organizations is symmetric algorithms which converts plaintext data into indecipherable text using only one single key. These Type of algorithms provide a quick and simple solution, although it may be quick but if a third party accesses the key it easily decrypts the message, almost making the algorithm one the most accessible for third parties to obtain.
3.
Cryptographic algorithms are sequences of processes, or rules
, used to encipher and decipher messages in a cryptographic system
(What are Cryptographic Algorithms?, 2017).
These algorithms protect data of an organization.
Many algorithms use encryption and decryption to help secure communications.
Encryption converts plain-text into cipher-text and decryption converts cipher-text into plain-text.
There are various cryptographic algorithms and they mostly fit into the symmetric or asymmetric category.
These algorithms have been used for many years to strengthen an organization.
For an organization, these algorithms protect data so that unwanted people can’t access it.
In other words, it provides authentication.
Making sure only access is granted by those authorized and limiting the amount of people that can access the data.
In addition, cryptographic algorithms make sure a company prote.
What i learned at issa international summit 2019
This session will discuss what attendees learned at The ISSA International Summit 2019, held on October 1-2 at in Irving/Dallas, TX.
Learn from one of the presenters at this conference and what cybersecurity professionals got to share and learn from the leaders in the industry.
Over the last 30 years ISSA international has grown into the global community of choice for international cybersecurity professionals. With over 100 domestic and international chapters, members have world wide support with daily cyber threats that are becoming increasingly intricate and difficult to prevent, detect, and re-mediate.
Unit 1 Information Security.docx
Information security is the practice of securing information from unauthorized access, disruption, or modification. It involves implementing tools and strategies to protect personal and organizational data. The key principles of information security are confidentiality, integrity, and availability, known as the CIA triad. Technical, organizational, human, and physical measures work together to safeguard information through methods like access controls, encryption, firewalls, security policies, and employee training. The overall goal of information security is to protect sensitive data from threats while ensuring it remains available to authorized users.
Essay QuestionsAnswer all questions below in a single document, pr.docx
Essay Questions
Answer all questions below in a single document, preferably below the corresponding topic.
Responses should be no longer than half a page.
One
1. A security program should address issues from a strategic, tactical, and operational view. The
security program should be integrated at every level of the enterprise’s architecture. List a
security program in each level and provide a list of security activities or controls applied in these
levels. Support your list with real-world application data.
2. The objectives of security are to provide availability, integrity, and confidentiality protection to
data and resources. List examples of these security states where an asset could lose these
security states when attacked, compromised, or became vulnerable. Your examples could
include fictitious assets that have undergone some changes.
3. Risk assessment can be completed in a qualitative or quantitative manner. Explain each risk
assessment methodology and provide an example of each.
Two
1. Access controls are security features that are usually considered the first line of defense in
asset protection. They are used to dictate how subjects access objects, and their main goal is to
protect the objects from unauthorized access.
These controls can be administrative, physical, or technical in nature and should be applied in a
layered approach, ensuring that an intruder would have to compromise more than one
countermeasure to access critical assets. Explain each of these controls of administrative,
physical, and technical with examples of real-world applications.
2. Access control defines how users should be identified, authenticated, and authorized. These
issues are carried out differently in different access control models and technologies, and it is up
to the organization to determine which best fits its business and security needs. Explain each of
these access control models with examples of real-world applications.
3. The architecture of a computer system is very important and comprises many topics. The
system has to ensure that memory is properly segregated and protected, ensure that only
authorized subjects access objects, ensure that untrusted processes cannot perform activities
that would put other processes at risk, control the flow of information, and define a domain of
resources for each subject. It also must ensure that if the computer experiences any type of
disruption, it will not result in an insecure state. Many of these issues are dealt with in the
system’s security policy, and the security model is built to support the requirements of this
policy. Given these definitions, provide an example where you could better design computer
architecture to secure the computer system with real-world applications. You may use fictitious
examples to support your argument.
Three
1. Our distributed environments have put much more responsibility on the individual user, facility
management, and administrative procedures and controls than in th.
An Ultimate Guide On Cyber Security Solutions.pdf
Cyber security is essential, but why? Who are the best Cybersecurity service providers
for your company? In this era where data is everything and everyone adopts digitalisation,
it is necessary to focus on security operations centres and IT service providers for organisations.
200 IT Secutiry Job Interview Question
This document contains 200 interview questions for IT security professionals categorized into different cybersecurity roles. The questions evaluate a broad range of technical skills, understanding of cybersecurity terminology, technology, and ability to think and solve problems. They cover general topics like information security principles, attacks, vulnerabilities, security frameworks, controls and governance as well as specific topics in network security, application security, security architecture, risk management, security testing and incident response.
What is Cybersecurity and career paths.
Dive into the world of cybersecurity with our latest blog post, "Navigating the Digital Frontier: Exploring Cybersecurity and Its Lucrative Career Opportunities." 🛡️💻
In today's interconnected digital landscape, the significance of cybersecurity cannot be underestimated. Our blog takes you on a journey to understand the essence of cybersecurity - the art and science of safeguarding computer systems, networks, and data from cyber threats. Discover the pivotal role it plays in maintaining confidentiality, integrity, and availability of information in an age where technology shapes every aspect of our lives.
Are you intrigued by the idea of becoming a guardian of the digital realm? Our blog unveils the plethora of exciting career opportunities that cybersecurity offers. From cybersecurity analysts who monitor and respond to security incidents, to ethical hackers who use their skills for good, and security architects who design robust defense systems – the possibilities are as diverse as your interests.
The digital age calls for modern heroes - those who can defend against hackers, thwart data breaches, and ensure the secure transmission of information. As you read through our blog, you'll gain insights into the skills and knowledge required to thrive in this field. Explore the roles of security consultants who provide expert guidance, incident responders who act swiftly in times of crisis, and cryptographers who create secure communication methods.
Are you ready to embrace a career that not only promises personal growth but also contributes to the digital safety of our interconnected world? Join us in uncovering the dynamic world of cybersecurity and discover how you can play a crucial role in shaping a secure digital future. Read our blog now and become part of the next generation of cybersecurity experts! 🌐🔒🚀
Recommended
Cryptography provides confidentiality, integrity authentication,.docx
Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use.
Let’s say you work for one of the following types of industry:
Manufacturing
Government
Research
Service
Consulting
After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.
.
In responding to your peers’ posts, assess your peers’ recommendatio.docx
In responding to your peers’ posts, assess your peers’ recommendations and discuss whether additional modifications are needed. BUT respond according to the post if need be.
1.Nice post on the role of the cryptographic algorithm.
One good thing you need to be aware is the fact that these algorithms can be utilized in a way to strengthen organizations existing plan by providing an additional layer of prevention especially as it relates to network security, but as Olzak (2012) notes, before looking at when and what to encrypt, it is important to understand where encryption fits in the overall security controls architecture. In your own view, do you think that encryption adds additional overhead and cost to the data process?
2.(CH)The Role that most cryptographic algorithms play is pretty essential to big organizations
and most computer users. When using the internet on a daily basis its main objective is to keep your system secure and keep information private from other users. There are many Cryptographic algorithms, that have specific purposes on how they are implemented. One of the most common algorithms is RSA ( Rivest-Shamir-Adleman) mostly common known as asymmetric cryptography. The way it works is it uses one private key and one public key (which is everyone is able to Access). While both keys are able to encrypt the message, the way to decrypt it is by using the opposite key you used from the beginning. This particular algorithm can be used to strengthen and organization's existing plan by adding confidentiality and authenticity to secure a stable connection over the network the organization uses at hand. One of the other main encryptions used by Organizations is symmetric algorithms which converts plaintext data into indecipherable text using only one single key. These Type of algorithms provide a quick and simple solution, although it may be quick but if a third party accesses the key it easily decrypts the message, almost making the algorithm one the most accessible for third parties to obtain.
3.
Cryptographic algorithms are sequences of processes, or rules
, used to encipher and decipher messages in a cryptographic system
(What are Cryptographic Algorithms?, 2017).
These algorithms protect data of an organization.
Many algorithms use encryption and decryption to help secure communications.
Encryption converts plain-text into cipher-text and decryption converts cipher-text into plain-text.
There are various cryptographic algorithms and they mostly fit into the symmetric or asymmetric category.
These algorithms have been used for many years to strengthen an organization.
For an organization, these algorithms protect data so that unwanted people can’t access it.
In other words, it provides authentication.
Making sure only access is granted by those authorized and limiting the amount of people that can access the data.
In addition, cryptographic algorithms make sure a company prote.
What i learned at issa international summit 2019
This session will discuss what attendees learned at The ISSA International Summit 2019, held on October 1-2 at in Irving/Dallas, TX.
Learn from one of the presenters at this conference and what cybersecurity professionals got to share and learn from the leaders in the industry.
Over the last 30 years ISSA international has grown into the global community of choice for international cybersecurity professionals. With over 100 domestic and international chapters, members have world wide support with daily cyber threats that are becoming increasingly intricate and difficult to prevent, detect, and re-mediate.
Unit 1 Information Security.docx
Information security is the practice of securing information from unauthorized access, disruption, or modification. It involves implementing tools and strategies to protect personal and organizational data. The key principles of information security are confidentiality, integrity, and availability, known as the CIA triad. Technical, organizational, human, and physical measures work together to safeguard information through methods like access controls, encryption, firewalls, security policies, and employee training. The overall goal of information security is to protect sensitive data from threats while ensuring it remains available to authorized users.
Essay QuestionsAnswer all questions below in a single document, pr.docx
Essay Questions
Answer all questions below in a single document, preferably below the corresponding topic.
Responses should be no longer than half a page.
One
1. A security program should address issues from a strategic, tactical, and operational view. The
security program should be integrated at every level of the enterprise’s architecture. List a
security program in each level and provide a list of security activities or controls applied in these
levels. Support your list with real-world application data.
2. The objectives of security are to provide availability, integrity, and confidentiality protection to
data and resources. List examples of these security states where an asset could lose these
security states when attacked, compromised, or became vulnerable. Your examples could
include fictitious assets that have undergone some changes.
3. Risk assessment can be completed in a qualitative or quantitative manner. Explain each risk
assessment methodology and provide an example of each.
Two
1. Access controls are security features that are usually considered the first line of defense in
asset protection. They are used to dictate how subjects access objects, and their main goal is to
protect the objects from unauthorized access.
These controls can be administrative, physical, or technical in nature and should be applied in a
layered approach, ensuring that an intruder would have to compromise more than one
countermeasure to access critical assets. Explain each of these controls of administrative,
physical, and technical with examples of real-world applications.
2. Access control defines how users should be identified, authenticated, and authorized. These
issues are carried out differently in different access control models and technologies, and it is up
to the organization to determine which best fits its business and security needs. Explain each of
these access control models with examples of real-world applications.
3. The architecture of a computer system is very important and comprises many topics. The
system has to ensure that memory is properly segregated and protected, ensure that only
authorized subjects access objects, ensure that untrusted processes cannot perform activities
that would put other processes at risk, control the flow of information, and define a domain of
resources for each subject. It also must ensure that if the computer experiences any type of
disruption, it will not result in an insecure state. Many of these issues are dealt with in the
system’s security policy, and the security model is built to support the requirements of this
policy. Given these definitions, provide an example where you could better design computer
architecture to secure the computer system with real-world applications. You may use fictitious
examples to support your argument.
Three
1. Our distributed environments have put much more responsibility on the individual user, facility
management, and administrative procedures and controls than in th.
An Ultimate Guide On Cyber Security Solutions.pdf
Cyber security is essential, but why? Who are the best Cybersecurity service providers
for your company? In this era where data is everything and everyone adopts digitalisation,
it is necessary to focus on security operations centres and IT service providers for organisations.
200 IT Secutiry Job Interview Question
This document contains 200 interview questions for IT security professionals categorized into different cybersecurity roles. The questions evaluate a broad range of technical skills, understanding of cybersecurity terminology, technology, and ability to think and solve problems. They cover general topics like information security principles, attacks, vulnerabilities, security frameworks, controls and governance as well as specific topics in network security, application security, security architecture, risk management, security testing and incident response.
What is Cybersecurity and career paths.
Dive into the world of cybersecurity with our latest blog post, "Navigating the Digital Frontier: Exploring Cybersecurity and Its Lucrative Career Opportunities." 🛡️💻
In today's interconnected digital landscape, the significance of cybersecurity cannot be underestimated. Our blog takes you on a journey to understand the essence of cybersecurity - the art and science of safeguarding computer systems, networks, and data from cyber threats. Discover the pivotal role it plays in maintaining confidentiality, integrity, and availability of information in an age where technology shapes every aspect of our lives.
Are you intrigued by the idea of becoming a guardian of the digital realm? Our blog unveils the plethora of exciting career opportunities that cybersecurity offers. From cybersecurity analysts who monitor and respond to security incidents, to ethical hackers who use their skills for good, and security architects who design robust defense systems – the possibilities are as diverse as your interests.
The digital age calls for modern heroes - those who can defend against hackers, thwart data breaches, and ensure the secure transmission of information. As you read through our blog, you'll gain insights into the skills and knowledge required to thrive in this field. Explore the roles of security consultants who provide expert guidance, incident responders who act swiftly in times of crisis, and cryptographers who create secure communication methods.
Are you ready to embrace a career that not only promises personal growth but also contributes to the digital safety of our interconnected world? Join us in uncovering the dynamic world of cybersecurity and discover how you can play a crucial role in shaping a secure digital future. Read our blog now and become part of the next generation of cybersecurity experts! 🌐🔒🚀
INTERVIEW QUESTION FOR IT AUDITOR
Information technology is an essential component of any modern business;
therefore, many businesses or organizations hire IT Auditors. IT Auditors are
professionals who analyze a company’s systems to protect the firm’s information.
They guarantee that processes and systems operate correctly and efficiently while
being secure
7 Experts on Implementing Azure Sentinel
Azure Sentinel is a security information and event management solution hosted in the Azure public cloud. It integrates data from various security tools and enables consolidation, correlation, querying, and analysis of security data. Key advice from experts includes choosing the right data sources to optimize security performance while managing costs, learning to apply analytics rules and create custom queries, and taking advantage of Azure Sentinel's automation and orchestration capabilities. Managing automated responses and remediations requires careful consideration.
Optimizing Security Operations: 5 Keys to Success
Organizations are suffering from cyber fatigue, with too many alerts, too many technologies, and not enough people. Many security operations center (SOC) teams are underskilled and overworked, making it extremely difficult to streamline operations and decrease the time it takes to detect and remediate security incidents.
Addressing these challenges requires a shift in the tactics and strategies deployed in SOCs. But building an effective SOC is hard; many companies struggle first with implementation and then with figuring out how to take their security operations to the next level.
Read to learn:
--Advantages and disadvantages of different SOC models
--Tips for leveraging advanced analytics tools
--Best practices for incorporating automation and orchestration
--How to boost incident response capabilities, and measure your efforts
--How the NIST Cybersecurity Framework and CIS Controls can help you establish a strong foundation
Start building your roadmap to a next-generation SOC.
Security Fundamentals and Threat Modelling
This session will take you through the basic fundamentals and terminologies of security in our applications along with the latest security and threat trends. We will also discuss what is Threat Modelling and how we can perform it on our architectures without being an actual expert.
Technology Issues and Cybersecurity Strategies
This document discusses technology issues and cybersecurity strategies. It emphasizes that security is a process, not a product, and involves people, policies, and technology working together. Some key strategies discussed are identifying sensitive data assets, implementing layered security through practices like strong passwords and security awareness training, and protecting data through encryption and access controls. The document also stresses preparing for incidents through testing response plans and having cyberinsurance.
Encryption During Communication
This document discusses encryption and secure communication. It explains that encryption encodes messages using algorithms and keys so that only authorized parties can decode it, preventing unauthorized access. The two main types of encryption algorithms are symmetric, for sending information, and asymmetric, for sending both information and keys. Standards like ISO/IEC 27001 provide requirements for establishing and maintaining an effective information security management system to address risks through controls like encryption. PECB offers training and certification services related to ISO standards to help organizations securely implement management systems.
10 Best Practices for Implementing DevOps Security
In the world of software development, DevOps has become a popular methodology that emphasizes collaboration between development and operations teams to enable faster and more reliable software delivery. However, implementing DevOps securely is crucial to protecting sensitive data and maintaining regulatory compliance. In this blog post, we'll discuss the top 10 best practices for implementing DevOps security.
Cybersecurity Audit
Here is a brief description of cybersecurity audit and the best practices for it. To know more about cybersecurity audit and information security management, click here: https://www.eccouncil.org/information-security-management/
Encrypt-Everything-eB.pdf
1. The document provides an overview of best practices for implementing enterprise-wide data encryption and protection. It discusses challenges like explosive data growth, evolving compliance requirements, operational complexity, and increasing threats.
2. The document recommends a data-centric security approach that applies protection to data itself regardless of location. This includes discovering and classifying sensitive data, encrypting data in motion and at rest, and centralized key and policy management.
3. Effective data security requires discovering where sensitive data resides, encrypting that data, managing encryption keys centrally, and implementing access policies to control data use.
Top Cyber Threat Intelligence Tools in 2021.pdf
Cyber threat intelligence is used for collecting necessary information about new and old threat actors from various sources. The collected data is analyzed, processed, and converted into useful threat intelligence.
https://www.infosectrain.com/courses/certified-threat-intelligence-analyst-ctia-certification-training/
CISSP Domain 03 Security Architecture and Engineering.pptx
CISSP Domain 03 Security Architecture and Engineering.pptx
Data security to protect pci data flow ulf mattsson - insecure-mag-40
There are innumerable ways that data thieves can attack and penetrate your network. As the saying goes - it’s not if your systems will be breached, but when. Every organization, especially those that handle PCI data, should operate under the assumption that sooner or later, they will be breached.
The new best practices to protect sensitive data and the data flow throughout the enterprise are designed with this assumption in mind. They are about reducing risk of data loss, and responding quickly to attacks when they occur.
First, minimize the amount of sensitive data you collect and store. Some elements, such
as PIN numbers and CVV/CVC codes, are prohibited from being stored, but in general, if you’re not using certain data but you store it anyways, you’re only increasing risk with no returns. If you are using it, or planning to, minimize the number of systems that store or process sensitive data. This will make it easier to protect it, as you will have less to defend. The next step is to implement some sort of data security, as required by PCI DSS regulations. While access controls provide a basic level of protection, they do nothing to protect the data flow, and the PCI council has recognized a need to go beyond them. Data security is applied in one of two ways: coarse-grained security at the volume or file level; and fine-grained security at the column or field-level.
Information Systems.pptx
This document provides an overview of information systems and security topics including computer security, authentication mechanisms, firewalls, computer crimes, social impacts of computers, computer viruses, worms, digital signatures and certificates. It discusses information security principles of confidentiality, integrity and availability. It also covers specific authentication mechanisms like passwords, multi-factor authentication, certificates, tokens and biometrics. Additionally, it defines what a firewall is and how it works to inspect and block unauthorized network traffic based on packet rules.
Project Quality-SIPOCSelect a process of your choice and creat.docx
Project Quality-SIPOC
Select a process of your choice and create a SIPOC for this process. Explain the utility of a SIPOC in the context of project management.
(
Application security in large enterprises (part 2)
Student Name:
) (
Instructor Name
)
Detailed Description:
Large enterprises of a thousand persons or more often have distinctly distinct data security architectures than lesser businesses. Typically they treat their data security as if they were still little companies.
This paper endeavors to demonstrate that not only do large businesses have an entire ecology of focused programs, specific to large businesses and their needs, but that this software has distinct security implications than buyer or small enterprise software. identifying these dissimilarities, and analyzing the way this can be taken advantage of by an attacker, is the key to both striking and keeping safe a large enterprise.
The Web applications are the important part of your business every day, they help you handle your intellectual property, increase your sales, and keep the trust of your customers. But there's the problem that applications re fast becoming the preferred attack vector of hackers. For this you really need something that makes your application secure.
And, with the persistent condition of today's attacks, applications can easily be get infected when security is not considered and scoped into each phase of the software development life cycle, from design to development to testing and ongoing maintenance of the application. When you take a holistic approach to your application security, you actually enhance your ability to produce and manage stable, secure applications. Applications need training and testing from the leading team of ethical hackers, for this there should be an authentic plan to recover these issues that can help an organization to plan, test, build and run applications smartly and safely.
Large enterprises of a thousand people or even more have distinctly different information security architectures than many other smaller companies. Actually, they treat their information security as if they were still small companies.
We are going to discuss some attempts to demonstrate that not only do large companies have an entire ecology of specialized software, specific to large companies and their needs, but that this software has different security implications than consumer or small business software for the applications. Recognizing these differences, and examining the way this can be taken advantage of by an attacker, is the key to both attacking and defending a large enterprise. It’s really important to cover up the security procedures in the large enterprise.
Key Features:
· Web application security checking from development through output
· Security check web APIs and world wide web services that support your enterprise
· Effortlessly organize, view and share security-test outcomes and histories
· Endow broader lifecycle adoption th ...
What is Security Orchestration?
Those in the know understand that security orchestration and its benefits stretch much further than simple security automation to bring together the various tools and techniques used by security operations. Yes, it’s easy to see why security orchestration and automation are used in the same breath – they certainly go together. And really, would you want one without the other?
Visit - https://www.siemplify.co/
Take the First Steps Toward Endpoint Security Protection
Endpoint security is the process of protecting networked devices, such as PCs, laptops, servers, and mobile devices, from unauthorized access. It usually consists of a combination of hardware, software, and user training.
The future of cyber security
The document discusses how security operations centers are adopting machine learning and artificial intelligence technologies to automate cybersecurity tasks like detecting threats, analyzing vast amounts of data, and responding quickly to incidents. It provides examples of how Oracle's cloud-based cybersecurity applications incorporate machine learning algorithms to continuously learn normal behavior, detect anomalies, and automate responses. The document advocates for adopting an intelligent, adaptive security framework that relies on AI and machine learning rather than static rules to manage hybrid cloud environments.
OpenText Cyber Resilience Fastrak
Ensuring cyber resilience presents different risk points and many challenges. Not all organizations possess the internal capabilities and expertise necessary to strategize, execute, and safeguard their attack surface. By identifying vulnerabilities, deploying tools, and educating users, cybersecurity services can make the digital environment safer for all.
Our Cyber Resilience FasTrak provides three flexible options for personalized
protection. Select the service that is right for your organization:
- Improve cyber defenses with a Security Health Check
- Uncover hidden threats with AI powered Threat Hunting Service
- Don’t be scared, be prepared with Incident Response Simulation
Module 1Introduction to cyber security.pptx
This document provides an overview of a course on fundamentals of cybersecurity. The course objectives are to provide theoretical and practical knowledge of cyber attacks, cyber law, intellectual property, cyber crimes, and web security. It covers 5 modules: introduction to cybersecurity, cyber attacks and protection tools, cyber risks and incident management, overviews of firewalls, and artificial intelligence in cybersecurity. Key topics include importance of cybersecurity, cybersecurity challenges, ethical hacking tools and processes, and methods for authentication, access control, intrusion detection, and prevention.
Microsoft Security adoptionguide for the enterprise
The document provides an overview and guidance for organizations to strengthen their security posture while maximizing their existing Microsoft security investments. It discusses adopting a Zero Trust approach and using Microsoft Sentinel and Microsoft 365 Defender to gain visibility and defend against threats across an organization's digital estate. It also outlines recommendations for getting started with Microsoft Secure Score and provides training opportunities for security operations teams to gain necessary skills to address common security challenges.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to Cryptography KeysCryptography provides confidentiality, inte.docx
INTERVIEW QUESTION FOR IT AUDITOR
Information technology is an essential component of any modern business;
therefore, many businesses or organizations hire IT Auditors. IT Auditors are
professionals who analyze a company’s systems to protect the firm’s information.
They guarantee that processes and systems operate correctly and efficiently while
being secure
7 Experts on Implementing Azure Sentinel
Azure Sentinel is a security information and event management solution hosted in the Azure public cloud. It integrates data from various security tools and enables consolidation, correlation, querying, and analysis of security data. Key advice from experts includes choosing the right data sources to optimize security performance while managing costs, learning to apply analytics rules and create custom queries, and taking advantage of Azure Sentinel's automation and orchestration capabilities. Managing automated responses and remediations requires careful consideration.
Optimizing Security Operations: 5 Keys to Success
Organizations are suffering from cyber fatigue, with too many alerts, too many technologies, and not enough people. Many security operations center (SOC) teams are underskilled and overworked, making it extremely difficult to streamline operations and decrease the time it takes to detect and remediate security incidents.
Addressing these challenges requires a shift in the tactics and strategies deployed in SOCs. But building an effective SOC is hard; many companies struggle first with implementation and then with figuring out how to take their security operations to the next level.
Read to learn:
--Advantages and disadvantages of different SOC models
--Tips for leveraging advanced analytics tools
--Best practices for incorporating automation and orchestration
--How to boost incident response capabilities, and measure your efforts
--How the NIST Cybersecurity Framework and CIS Controls can help you establish a strong foundation
Start building your roadmap to a next-generation SOC.
Security Fundamentals and Threat Modelling
This session will take you through the basic fundamentals and terminologies of security in our applications along with the latest security and threat trends. We will also discuss what is Threat Modelling and how we can perform it on our architectures without being an actual expert.
Technology Issues and Cybersecurity Strategies
This document discusses technology issues and cybersecurity strategies. It emphasizes that security is a process, not a product, and involves people, policies, and technology working together. Some key strategies discussed are identifying sensitive data assets, implementing layered security through practices like strong passwords and security awareness training, and protecting data through encryption and access controls. The document also stresses preparing for incidents through testing response plans and having cyberinsurance.
Encryption During Communication
This document discusses encryption and secure communication. It explains that encryption encodes messages using algorithms and keys so that only authorized parties can decode it, preventing unauthorized access. The two main types of encryption algorithms are symmetric, for sending information, and asymmetric, for sending both information and keys. Standards like ISO/IEC 27001 provide requirements for establishing and maintaining an effective information security management system to address risks through controls like encryption. PECB offers training and certification services related to ISO standards to help organizations securely implement management systems.
10 Best Practices for Implementing DevOps Security
In the world of software development, DevOps has become a popular methodology that emphasizes collaboration between development and operations teams to enable faster and more reliable software delivery. However, implementing DevOps securely is crucial to protecting sensitive data and maintaining regulatory compliance. In this blog post, we'll discuss the top 10 best practices for implementing DevOps security.
Cybersecurity Audit
Here is a brief description of cybersecurity audit and the best practices for it. To know more about cybersecurity audit and information security management, click here: https://www.eccouncil.org/information-security-management/
Encrypt-Everything-eB.pdf
1. The document provides an overview of best practices for implementing enterprise-wide data encryption and protection. It discusses challenges like explosive data growth, evolving compliance requirements, operational complexity, and increasing threats.
2. The document recommends a data-centric security approach that applies protection to data itself regardless of location. This includes discovering and classifying sensitive data, encrypting data in motion and at rest, and centralized key and policy management.
3. Effective data security requires discovering where sensitive data resides, encrypting that data, managing encryption keys centrally, and implementing access policies to control data use.
Top Cyber Threat Intelligence Tools in 2021.pdf
Cyber threat intelligence is used for collecting necessary information about new and old threat actors from various sources. The collected data is analyzed, processed, and converted into useful threat intelligence.
https://www.infosectrain.com/courses/certified-threat-intelligence-analyst-ctia-certification-training/
CISSP Domain 03 Security Architecture and Engineering.pptx
CISSP Domain 03 Security Architecture and Engineering.pptx
Data security to protect pci data flow ulf mattsson - insecure-mag-40
There are innumerable ways that data thieves can attack and penetrate your network. As the saying goes - it’s not if your systems will be breached, but when. Every organization, especially those that handle PCI data, should operate under the assumption that sooner or later, they will be breached.
The new best practices to protect sensitive data and the data flow throughout the enterprise are designed with this assumption in mind. They are about reducing risk of data loss, and responding quickly to attacks when they occur.
First, minimize the amount of sensitive data you collect and store. Some elements, such
as PIN numbers and CVV/CVC codes, are prohibited from being stored, but in general, if you’re not using certain data but you store it anyways, you’re only increasing risk with no returns. If you are using it, or planning to, minimize the number of systems that store or process sensitive data. This will make it easier to protect it, as you will have less to defend. The next step is to implement some sort of data security, as required by PCI DSS regulations. While access controls provide a basic level of protection, they do nothing to protect the data flow, and the PCI council has recognized a need to go beyond them. Data security is applied in one of two ways: coarse-grained security at the volume or file level; and fine-grained security at the column or field-level.
Information Systems.pptx
This document provides an overview of information systems and security topics including computer security, authentication mechanisms, firewalls, computer crimes, social impacts of computers, computer viruses, worms, digital signatures and certificates. It discusses information security principles of confidentiality, integrity and availability. It also covers specific authentication mechanisms like passwords, multi-factor authentication, certificates, tokens and biometrics. Additionally, it defines what a firewall is and how it works to inspect and block unauthorized network traffic based on packet rules.
Project Quality-SIPOCSelect a process of your choice and creat.docx
Project Quality-SIPOC
Select a process of your choice and create a SIPOC for this process. Explain the utility of a SIPOC in the context of project management.
(
Application security in large enterprises (part 2)
Student Name:
) (
Instructor Name
)
Detailed Description:
Large enterprises of a thousand persons or more often have distinctly distinct data security architectures than lesser businesses. Typically they treat their data security as if they were still little companies.
This paper endeavors to demonstrate that not only do large businesses have an entire ecology of focused programs, specific to large businesses and their needs, but that this software has distinct security implications than buyer or small enterprise software. identifying these dissimilarities, and analyzing the way this can be taken advantage of by an attacker, is the key to both striking and keeping safe a large enterprise.
The Web applications are the important part of your business every day, they help you handle your intellectual property, increase your sales, and keep the trust of your customers. But there's the problem that applications re fast becoming the preferred attack vector of hackers. For this you really need something that makes your application secure.
And, with the persistent condition of today's attacks, applications can easily be get infected when security is not considered and scoped into each phase of the software development life cycle, from design to development to testing and ongoing maintenance of the application. When you take a holistic approach to your application security, you actually enhance your ability to produce and manage stable, secure applications. Applications need training and testing from the leading team of ethical hackers, for this there should be an authentic plan to recover these issues that can help an organization to plan, test, build and run applications smartly and safely.
Large enterprises of a thousand people or even more have distinctly different information security architectures than many other smaller companies. Actually, they treat their information security as if they were still small companies.
We are going to discuss some attempts to demonstrate that not only do large companies have an entire ecology of specialized software, specific to large companies and their needs, but that this software has different security implications than consumer or small business software for the applications. Recognizing these differences, and examining the way this can be taken advantage of by an attacker, is the key to both attacking and defending a large enterprise. It’s really important to cover up the security procedures in the large enterprise.
Key Features:
· Web application security checking from development through output
· Security check web APIs and world wide web services that support your enterprise
· Effortlessly organize, view and share security-test outcomes and histories
· Endow broader lifecycle adoption th ...
What is Security Orchestration?
Those in the know understand that security orchestration and its benefits stretch much further than simple security automation to bring together the various tools and techniques used by security operations. Yes, it’s easy to see why security orchestration and automation are used in the same breath – they certainly go together. And really, would you want one without the other?
Visit - https://www.siemplify.co/
Take the First Steps Toward Endpoint Security Protection
Endpoint security is the process of protecting networked devices, such as PCs, laptops, servers, and mobile devices, from unauthorized access. It usually consists of a combination of hardware, software, and user training.
The future of cyber security
The document discusses how security operations centers are adopting machine learning and artificial intelligence technologies to automate cybersecurity tasks like detecting threats, analyzing vast amounts of data, and responding quickly to incidents. It provides examples of how Oracle's cloud-based cybersecurity applications incorporate machine learning algorithms to continuously learn normal behavior, detect anomalies, and automate responses. The document advocates for adopting an intelligent, adaptive security framework that relies on AI and machine learning rather than static rules to manage hybrid cloud environments.
OpenText Cyber Resilience Fastrak
Ensuring cyber resilience presents different risk points and many challenges. Not all organizations possess the internal capabilities and expertise necessary to strategize, execute, and safeguard their attack surface. By identifying vulnerabilities, deploying tools, and educating users, cybersecurity services can make the digital environment safer for all.
Our Cyber Resilience FasTrak provides three flexible options for personalized
protection. Select the service that is right for your organization:
- Improve cyber defenses with a Security Health Check
- Uncover hidden threats with AI powered Threat Hunting Service
- Don’t be scared, be prepared with Incident Response Simulation
Module 1Introduction to cyber security.pptx
This document provides an overview of a course on fundamentals of cybersecurity. The course objectives are to provide theoretical and practical knowledge of cyber attacks, cyber law, intellectual property, cyber crimes, and web security. It covers 5 modules: introduction to cybersecurity, cyber attacks and protection tools, cyber risks and incident management, overviews of firewalls, and artificial intelligence in cybersecurity. Key topics include importance of cybersecurity, cybersecurity challenges, ethical hacking tools and processes, and methods for authentication, access control, intrusion detection, and prevention.
Microsoft Security adoptionguide for the enterprise
The document provides an overview and guidance for organizations to strengthen their security posture while maximizing their existing Microsoft security investments. It discusses adopting a Zero Trust approach and using Microsoft Sentinel and Microsoft 365 Defender to gain visibility and defend against threats across an organization's digital estate. It also outlines recommendations for getting started with Microsoft Secure Score and provides training opportunities for security operations teams to gain necessary skills to address common security challenges.
Similar to Cryptography KeysCryptography provides confidentiality, inte.docx (20)
10 Best Practices for Implementing DevOps Security
10 Best Practices for Implementing DevOps Security
CISSP Domain 03 Security Architecture and Engineering.pptx
CISSP Domain 03 Security Architecture and Engineering.pptx
Data security to protect pci data flow ulf mattsson - insecure-mag-40
Data security to protect pci data flow ulf mattsson - insecure-mag-40
Project Quality-SIPOCSelect a process of your choice and creat.docx
Project Quality-SIPOCSelect a process of your choice and creat.docx
Take the First Steps Toward Endpoint Security Protection
Take the First Steps Toward Endpoint Security Protection
Microsoft Security adoptionguide for the enterprise
Microsoft Security adoptionguide for the enterprise
More from mydrynan
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docx
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docx
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
Cryptography
Lesson 10
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
© (ISC)2 ® 2010, All Rights Reserved
For Personal Use of (ISC)2 Seminar Attendee Only
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
CISSP-ISSEP® Bootcamp Seminar v10
Technical Management
Public Key Infrastructure
Chapter 7
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
2
Key Management
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
3
2
Usage Control
5
6
7
Storage
Recovery
Escrow
8
Zeroization
1
3
Creation
Change and Expiry
4
Distribution
Creation
Automated key generation
Truly random
Suitable length
Key encrypting keys
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
4
Key Usage Control
Management has a vested interest in what activities or content may be hidden in cryptographically protected communications or files
They may create a policy that allows management to audit or decrypt encrypted data at their discretion
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
5
Key Change and Expiry
In any environment, plans should be made to update keys periodically
Generating symmetric keys is easy, but delivering them is expensive since you will be delivering [N*(N-1)]/2 keys to N users
Expiry
Expiry ensures that a key is never overused
Expiry based upon:
Amount of traffic
Amount of traffic over time
Time-in-use
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
6
Distribution
Out of band
Public key encryption
Secret key construction
Secret key delivery
Key Distribution Centers (KDC)
Certificates
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
7
Storage
Trusted hardware
Smartcards
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
8
Recovery
Split knowledge
Multi-party key recovery (MPR)
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise.
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCI 352 - Digital Forensics
Assignment #1
Spring 2020
Due Date: Tuesday, February 25, 2020
Total Points: 100
You are going to write a Python program that represents a command line version of a hexadecimal editor.
This program will be similar to the Linux built-in command line hexadecimal editors such as xxd and
hexdump.
The program will first ask the user to enter the name of any file you want to read. Your program will then
print the binary contents of the file into the standard output (screen). The output will be divided into three
main sections: the offset values in decimal, sixteen space-separated hexadecimal bytes, followed by the
same sixteen bytes but in ASCII value. The figure below shows an example of the first 48 bytes of an
output, and the three different sections:
Notice that in the 2nd section there a space between the 8th and 9th byte. Each output line represents 16 bytes.
The first column shows the decimal offset, where the first byte from the first line represents the 0th byte;
the second line starts with byte 16th and so on. The final section only shows the printable ASCII characters.
These are the ASCII characters can be printed on the screen (usually they are the characters with ASCII
values between 0x20 and 0x7EThe rest of the unprintable bytes are replaced by a period ('.'). The following
built-in Python functions will be useful in this situation: chr, hex, ord. More information about these
functions can be found here: https://docs.python.org/3/library/functions.html
What to hand in
Submit your program electronically through D2L. Please hand in the Python program (.py file or.ipynb)
offset
Hexadecimal Values
ASCII Values
https://docs.python.org/3/library/functions.html
© 2016 by Pearson Education, Inc.
*
THINK CRITICALLY, FACIONE & GITTENS
Chapter 12
Comparative Reasoning
© 2016 by Pearson Education, Inc.
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Learning OutcomesExplain comparative reasoning and how it impacts our understanding of novel situationsApply correctly the five criteria for the evaluation of comparative reasoningDescribe the uses, benefits, and risks of comparative reasoning
Learning OutcomesChapter first explains comparative reasoning and how it impacts our understanding of novel situations.It then applies correctly the five criteria for the evaluation of comparative reasoning.The chapter finally describes the uses, benefits, and risks of comparative reasoning.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Chapter Opening Video
Chapter Opening VideoThe video talks about comparative reasoning.It shows the importance of identifying and evaluating the comparative reasoning and the analogies.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
This is Like That—Recognizing Comparative ReasoningOur minds crave patternsComparative, ideological, and emp.
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docx
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docx
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
More from mydrynan (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSCI 714 Software Project Planning and EstimationLec.docx
CSCI 714 Software Project Planning and EstimationLec.docx
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSC-321 Final Writing Assignment In this assignment, you .docx
CSC-321 Final Writing Assignment In this assignment, you .docx
Cryptography is the application of algorithms to ensure the confiden.docx
Cryptography is the application of algorithms to ensure the confiden.docx
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
Recently uploaded
NIPER 2024 MEMORY BASED QUESTIONS.ANSWERS TO NIPER 2024 QUESTIONS.NIPER JEE 2...
NIPER JEE PYQ
NIPER JEE QUESTIONS
MOST FREQUENTLY ASK QUESTIONS
NIPER MEMORY BASED QUWSTIONS
A Visual Guide to 1 Samuel | A Tale of Two Hearts
These slides walk through the story of 1 Samuel. Samuel is the last judge of Israel. The people reject God and want a king. Saul is anointed as the first king, but he is not a good king. David, the shepherd boy is anointed and Saul is envious of him. David shows honor while Saul continues to self destruct.
How to Setup Default Value for a Field in Odoo 17
In Odoo, we can set a default value for a field during the creation of a record for a model. We have many methods in odoo for setting a default value to the field.
220711130083 SUBHASHREE RAKSHIT Internet resources for social science
Internet resources for social science
Accounting for Restricted Grants When and How To Record Properly
In this webinar, member learned how to stay in compliance with generally accepted accounting principles (GAAP) for restricted grants.
Temple of Asclepius in Thrace. Excavation results
The temple and the sanctuary around were dedicated to Asklepios Zmidrenus. This name has been known since 1875 when an inscription dedicated to him was discovered in Rome. The inscription is dated in 227 AD and was left by soldiers originating from the city of Philippopolis (modern Plovdiv).
How to Fix [Errno 98] address already in use
This slide will represent the cause of the error “[Errno 98] address already in use” and the troubleshooting steps to resolve this error in Odoo.
Level 3 NCEA - NZ: A Nation In the Making 1872 - 1900 SML.ppt
The History of NZ 1870-1900.
Making of a Nation.
From the NZ Wars to Liberals,
Richard Seddon, George Grey,
Social Laboratory, New Zealand,
Confiscations, Kotahitanga, Kingitanga, Parliament, Suffrage, Repudiation, Economic Change, Agriculture, Gold Mining, Timber, Flax, Sheep, Dairying,
Gender and Mental Health - Counselling and Family Therapy Applications and In...
A proprietary approach developed by bringing together the best of learning theories from Psychology, design principles from the world of visualization, and pedagogical methods from over a decade of training experience, that enables you to: Learn better, faster!
Elevate Your Nonprofit's Online Presence_ A Guide to Effective SEO Strategies...
Whether you're new to SEO or looking to refine your existing strategies, this webinar will provide you with actionable insights and practical tips to elevate your nonprofit's online presence.
Andreas Schleicher presents PISA 2022 Volume III - Creative Thinking - 18 Jun...
Andreas Schleicher, Director of Education and Skills at the OECD presents at the launch of PISA 2022 Volume III - Creative Minds, Creative Schools on 18 June 2024.
Educational Technology in the Health Sciences
Plenary presentation at the NTTC Inter-university Workshop, 18 June 2024, Manila Prince Hotel.
THE SACRIFICE HOW PRO-PALESTINE PROTESTS STUDENTS ARE SACRIFICING TO CHANGE T...
The recent surge in pro-Palestine student activism has prompted significant responses from universities, ranging from negotiations and divestment commitments to increased transparency about investments in companies supporting the war on Gaza. This activism has led to the cessation of student encampments but also highlighted the substantial sacrifices made by students, including academic disruptions and personal risks. The primary drivers of these protests are poor university administration, lack of transparency, and inadequate communication between officials and students. This study examines the profound emotional, psychological, and professional impacts on students engaged in pro-Palestine protests, focusing on Generation Z's (Gen-Z) activism dynamics. This paper explores the significant sacrifices made by these students and even the professors supporting the pro-Palestine movement, with a focus on recent global movements. Through an in-depth analysis of printed and electronic media, the study examines the impacts of these sacrifices on the academic and personal lives of those involved. The paper highlights examples from various universities, demonstrating student activism's long-term and short-term effects, including disciplinary actions, social backlash, and career implications. The researchers also explore the broader implications of student sacrifices. The findings reveal that these sacrifices are driven by a profound commitment to justice and human rights, and are influenced by the increasing availability of information, peer interactions, and personal convictions. The study also discusses the broader implications of this activism, comparing it to historical precedents and assessing its potential to influence policy and public opinion. The emotional and psychological toll on student activists is significant, but their sense of purpose and community support mitigates some of these challenges. However, the researchers call for acknowledging the broader Impact of these sacrifices on the future global movement of FreePalestine.
Wound healing PPT
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
Recently uploaded (20)
NIPER 2024 MEMORY BASED QUESTIONS.ANSWERS TO NIPER 2024 QUESTIONS.NIPER JEE 2...
NIPER 2024 MEMORY BASED QUESTIONS.ANSWERS TO NIPER 2024 QUESTIONS.NIPER JEE 2...
220711130083 SUBHASHREE RAKSHIT Internet resources for social science
220711130083 SUBHASHREE RAKSHIT Internet resources for social science
220711130088 Sumi Basak Virtual University EPC 3.pptx
220711130088 Sumi Basak Virtual University EPC 3.pptx
Accounting for Restricted Grants When and How To Record Properly
Accounting for Restricted Grants When and How To Record Properly
Level 3 NCEA - NZ: A Nation In the Making 1872 - 1900 SML.ppt
Level 3 NCEA - NZ: A Nation In the Making 1872 - 1900 SML.ppt
Gender and Mental Health - Counselling and Family Therapy Applications and In...
Gender and Mental Health - Counselling and Family Therapy Applications and In...
Elevate Your Nonprofit's Online Presence_ A Guide to Effective SEO Strategies...
Elevate Your Nonprofit's Online Presence_ A Guide to Effective SEO Strategies...
Andreas Schleicher presents PISA 2022 Volume III - Creative Thinking - 18 Jun...
Andreas Schleicher presents PISA 2022 Volume III - Creative Thinking - 18 Jun...
THE SACRIFICE HOW PRO-PALESTINE PROTESTS STUDENTS ARE SACRIFICING TO CHANGE T...
THE SACRIFICE HOW PRO-PALESTINE PROTESTS STUDENTS ARE SACRIFICING TO CHANGE T...
spot a liar (Haiqa 146).pptx Technical writhing and presentation skills
spot a liar (Haiqa 146).pptx Technical writhing and presentation skills
Cryptography KeysCryptography provides confidentiality, inte.docx
- 1. Cryptography Keys Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use. Let’s say you work for one of the following types of industry: Manufacturing Government Research Service Consulting After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.