The document summarizes the evolution of genome data over time at the National Center for Biotechnology Information (NCBI). It describes how the amount of genome data and number of users has grown exponentially since 1989. It also discusses advances in genome assembly, including representing structural variation and alternate loci. The development of the Genome Reference Consortium to maintain updated genome assemblies deposited in public archives is also covered.
The document discusses the evolution of genomic resources at the National Center for Biotechnology Information (NCBI) over the past 22 years. It shows graphs of the growth in data volumes for resources like GenBank, users accessing services, and the number of human variations cataloged in dbSNP. Key resources highlighted include PubMed, BLAST, Entrez, GenBank, dbSNP, Reference Sequence (RefSeq), Genome Remapping Service, Sequence Read Archive, and more. The document outlines NCBI's role in organizing and providing access to genomic and biomedical literature data.
This document summarizes research characterizing DNA methylation in the Pacific oyster Crassostrea gigas. High-throughput bisulfite sequencing was used to analyze DNA methylation patterns at high resolution. Several genes were found to have different levels and patterns of methylation across tissues and developmental stages. The results provide evidence that DNA methylation plays an important regulatory role and may be involved in environmental responses in C. gigas. Future work will investigate how epigenetic mechanisms are affected by environmental stressors.
The document characterized DNA methylation in the Pacific oyster (Crassostrea gigas). Results showed DNA methylation is present and predictive analysis aligned with experimental measurements. High-throughput bisulfite sequencing of gill tissue revealed methylation in exons, introns, and intergenic regions. Methylation levels correlated negatively with gene expression. Comparisons between tissues identified differentially methylated regions, with half in gene bodies. Methylation may distinguish housekeeping from inducible genes and have a role in tissue-specific functions.
This document discusses the process of analyzing sequencing data from the NA12878 reference sample. It describes the 3 phases required to turn raw sequencing reads into usable variant calls: 1) NGS data processing, 2) variant discovery and genotyping, and 3) integrative analysis. Phase 1 involves tasks like mapping, local realignment, and duplicate marking to produce analysis-ready reads. Phase 2 identifies SNPs, indels and structural variants. Phase 3 performs quality control and combines results with other data. The document emphasizes the extensive processing needed to produce reliable variant calls from raw sequencing data.
Consortium to produce_bio_fuels_from_jatropha[1]ehiosa
This document summarizes a consortium project between institutions in Japan, Indonesia, and Botswana to develop Jatropha plants that can produce clean biofuel through molecular breeding. The goals are to increase Jatropha productivity and develop plants that absorb more carbon dioxide. Participating organizations will work on molecular breeding techniques, field testing in different environments, and evaluating fuel production from higher yielding Jatropha varieties. The end goal is to assist energy needs in Asia and Africa through a sustainable Jatropha biofuel production system.
This document provides a summary of a talk on metagenome assembly. [1] Digital normalization is introduced as an approach that discards redundant reads prior to assembly to reduce data size and eliminate errors, improving scaling. [2] Two soil metagenome datasets totaling over 1,800 gigabase pairs were assembled, generating over 4.5 million contigs and estimating the equivalent of around 1,200 bacterial genomes. [3] While assembly approaches are improving, interpreting the function of genes from unknown organisms remains a major challenge.
This study uses microfluidic devices containing wells connected by tunnels to culture neuronal networks and control the direction of connections. Multi-electrode array recordings of neuronal activity from the wells are analyzed using Granger causality to validate its ability to determine connectivity directionality. The results show that Granger causality correctly identified unidirectional propagation of activity from older to younger neuronal populations through the tunnels. However, the analysis is sensitive to the time scale used, and both the bin size and time constant must match the time scale of interactions between neurons.
NCBO Webinar: Translating unstructured, crowdsourced content into structured ...Andrew Su
The use of crowdsourcing in biology is gaining popularity as a mechanism to tackle challenges of massive scale. However, to maximize participation and lower the barriers to entry, contributions to crowdsourcing efforts are typically not well-structured, which makes computing on these data challenging and difficult. The presentation will discuss strategies for translating this unstructured content into structured data. Three vignettes (in varying degrees of completion) will be described, one each from our Gene Wiki [1], BioGPS [2], and serious gaming [3] initiatives.
[1]: http://en.wikipedia.org/wiki/Portal:Gene_Wiki
[2]: http://biogps.org
[3]: http://genegames.org
The document discusses the evolution of genomic resources at the National Center for Biotechnology Information (NCBI) over the past 22 years. It shows graphs of the growth in data volumes for resources like GenBank, users accessing services, and the number of human variations cataloged in dbSNP. Key resources highlighted include PubMed, BLAST, Entrez, GenBank, dbSNP, Reference Sequence (RefSeq), Genome Remapping Service, Sequence Read Archive, and more. The document outlines NCBI's role in organizing and providing access to genomic and biomedical literature data.
This document summarizes research characterizing DNA methylation in the Pacific oyster Crassostrea gigas. High-throughput bisulfite sequencing was used to analyze DNA methylation patterns at high resolution. Several genes were found to have different levels and patterns of methylation across tissues and developmental stages. The results provide evidence that DNA methylation plays an important regulatory role and may be involved in environmental responses in C. gigas. Future work will investigate how epigenetic mechanisms are affected by environmental stressors.
The document characterized DNA methylation in the Pacific oyster (Crassostrea gigas). Results showed DNA methylation is present and predictive analysis aligned with experimental measurements. High-throughput bisulfite sequencing of gill tissue revealed methylation in exons, introns, and intergenic regions. Methylation levels correlated negatively with gene expression. Comparisons between tissues identified differentially methylated regions, with half in gene bodies. Methylation may distinguish housekeeping from inducible genes and have a role in tissue-specific functions.
This document discusses the process of analyzing sequencing data from the NA12878 reference sample. It describes the 3 phases required to turn raw sequencing reads into usable variant calls: 1) NGS data processing, 2) variant discovery and genotyping, and 3) integrative analysis. Phase 1 involves tasks like mapping, local realignment, and duplicate marking to produce analysis-ready reads. Phase 2 identifies SNPs, indels and structural variants. Phase 3 performs quality control and combines results with other data. The document emphasizes the extensive processing needed to produce reliable variant calls from raw sequencing data.
Consortium to produce_bio_fuels_from_jatropha[1]ehiosa
This document summarizes a consortium project between institutions in Japan, Indonesia, and Botswana to develop Jatropha plants that can produce clean biofuel through molecular breeding. The goals are to increase Jatropha productivity and develop plants that absorb more carbon dioxide. Participating organizations will work on molecular breeding techniques, field testing in different environments, and evaluating fuel production from higher yielding Jatropha varieties. The end goal is to assist energy needs in Asia and Africa through a sustainable Jatropha biofuel production system.
This document provides a summary of a talk on metagenome assembly. [1] Digital normalization is introduced as an approach that discards redundant reads prior to assembly to reduce data size and eliminate errors, improving scaling. [2] Two soil metagenome datasets totaling over 1,800 gigabase pairs were assembled, generating over 4.5 million contigs and estimating the equivalent of around 1,200 bacterial genomes. [3] While assembly approaches are improving, interpreting the function of genes from unknown organisms remains a major challenge.
This study uses microfluidic devices containing wells connected by tunnels to culture neuronal networks and control the direction of connections. Multi-electrode array recordings of neuronal activity from the wells are analyzed using Granger causality to validate its ability to determine connectivity directionality. The results show that Granger causality correctly identified unidirectional propagation of activity from older to younger neuronal populations through the tunnels. However, the analysis is sensitive to the time scale used, and both the bin size and time constant must match the time scale of interactions between neurons.
NCBO Webinar: Translating unstructured, crowdsourced content into structured ...Andrew Su
The use of crowdsourcing in biology is gaining popularity as a mechanism to tackle challenges of massive scale. However, to maximize participation and lower the barriers to entry, contributions to crowdsourcing efforts are typically not well-structured, which makes computing on these data challenging and difficult. The presentation will discuss strategies for translating this unstructured content into structured data. Three vignettes (in varying degrees of completion) will be described, one each from our Gene Wiki [1], BioGPS [2], and serious gaming [3] initiatives.
[1]: http://en.wikipedia.org/wiki/Portal:Gene_Wiki
[2]: http://biogps.org
[3]: http://genegames.org
The document describes the sequencing of the wheat genome, specifically chromosome 3B. Key points:
1. An international effort led by the IWGSC sequenced individual wheat chromosomes including 3B using a physical map-based approach.
2. Sequencing of the 1Gb chromosome 3B generated over 1000 scaffolds covering 995Mb with an N50 of 463kb. Genes and markers were annotated.
3. The sequenced and ordered chromosome 3B provides a foundation for accelerating wheat improvement through map-based cloning, marker development, and integrating genetic and genomic resources.
The document discusses RNA-seq analysis. It begins with an introduction to Mikael Huss, a bioinformatics scientist, and provides an overview of how genomics, RNA profiles, protein profiles, and interactomics relate within systems biology. The document then discusses how gene expression analysis can provide insights into basic research questions regarding tissue and cell identity, as well as insights into diseases by identifying genes that are over- or under-expressed in patients. Finally, it provides a brief overview of the typical workflow for RNA-seq analysis, which involves mapping RNA sequencing reads to a reference genome or transcriptome.
This document provides information about a QIIME workshop. It includes instructions on how to get started with QIIME, an overview of the typical QIIME analysis pipeline from raw sequencing data to results, and details on specific QIIME tools and files like the mapping file, OTU table, and parameters file. The document also discusses moving image analysis of the human microbiome using QIIME.
Stephen Friend Nature Genetics Colloquium 2012-03-24Sage Base
This document proposes using data intensive science to build models of disease within a shared computing environment or "commons". It notes that current disease models often oversimplify complex conditions. Five pilot projects are described that could leverage shared clinical and genomic data as well as model building to better represent diseases: 1) sharing comparator arm data from clinical trials, 2) a federated aging analysis project, 3) portable legal consent, 4) a Sage Congress modeling competition, and 5) the BRIDGE initiative for democratizing medical research. The document argues this approach could accelerate disease understanding and new therapy development.
The document discusses the BioHDF project which aims to develop scalable data infrastructure for bioinformatics using HDF5. It notes that next generation DNA sequencing is producing vast amounts of complex data that is challenging to analyze and compare across samples due to lack of consistent data models and structured storage. The BioHDF project seeks to address this by developing HDF5 domain extensions and tools to organize, index, annotate and access sequencing data in a way that enables more efficient analysis, visualization and exploration of results within and between samples.
Stephen Friend Fanconi Anemia Research Fund 2012-01-21Sage Base
This document summarizes Stephen Friend's presentation on using data intensive science and bionetworks to build better maps of human diseases. It discusses how collecting and integrating massive amounts of molecular and clinical data using open information systems and computing could enable the development of more comprehensive and probabilistic causal models of diseases. These evolving disease maps may help identify causal genes and pathways involved in various conditions. The presentation outlines Sage Bionetworks' mission to create a commons for scientists to collaborate on building and refining such integrative bionetworks to accelerate the elimination of human disease.
The document summarizes a presentation about developing open access tools to maximize the value of genomic data through the Genome Commons. The Genome Commons Database will be a repository of variants and associated traits. The Genome Commons Navigator will integrate this data and external tools to facilitate basic research, clinical applications, and more. Participation in the Critical Assessment of Genome Interpretation initiative aims to improve predictions of variant impacts on molecular, cellular and organismal phenotypes. Analysis of variants in folate pathway genes found classes of effects on yeast growth and folate remediation.
The National Center for Biotechnology Information (NCBI) was created in 1988 as part of the National Library of Medicine at NIH. It establishes public databases for biological research, develops software tools for sequence analysis, and disseminates biomedical information from its location in Bethesda, MD. NCBI houses several integrated databases including PubMed, GenBank, RefSeq, and UniGene that contain literature, sequences, gene information, and more.
The GeneArt® Gene Synthesis service consists of chemical synthesis, cloning, and sequence verification of virtually any desired genetic sequence. You will receive a bacterial stab and/or purified plasmid containing your synthesized gene—ready for downstream applications.
Whether you have limited cloning experience or simply want to save time, the GeneArt® Gene Synthesis service helps you move your ideas from the planning stage to the laboratory more quickly. Benefit from our experience in successfully producing over 180,000 constructs for customers as diverse as large pharmaceutical companies, biotechnology start-ups, and basic research institutions. The comparison shown in the figure below highlights the time and effort saved compared to traditional cloning. For more information visit:
https://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/gene-synthesis.html?CID=genesynthesis-SS-12312
The document discusses next generation sequencing methods and RNA sequencing. It covers topics like sequencing formats, data analysis workflows including mapping, clustering, assembly programs, finding new genes and correcting existing ones. It discusses input file types, calculating sequencing depth, available tools for alignment, output file formats, assembly programs, splice junction prediction, and applications of RNA sequencing like gene expression analysis and annotation.
Microarrays allow researchers to examine gene expression patterns across thousands of genes simultaneously. A microarray contains probes for known genes that are used to detect complementary mRNA in a biological sample. Microarrays can be used to study gene expression differences between normal and diseased tissues, classify tumor subtypes, and diagnose cancers. They also show promise for personalized cancer treatment by predicting patient prognosis and response to therapy.
NCBI has developed a powerful suite of online biomedical and bioinformatics resources, including old friends like PubMed and OMIM and newer resources such as Genome. This collection of databases and tools are widely used by scientists and medical professionals across the world. With such a wealth of information, it is easy to get overwhelmed. Join us for an overview to NCBI resources for the information professional with an emphasis on biodata connectivity. No science degree required!
Scratchpads in the Biodiversity Informatics LandscapeVince Smith
Roberts, D., Harman, K., Rycroft, S.D. & Smith, V.S. Stockholm Biodiversity Informatics Symposium 2008, Swedish Museum of Natural History, Stockholm, Sweden 1-4 December 2008.
Unison: Enabling easy, rapid, and comprehensive proteomic miningReece Hart
Unison is an online database and data integration platform that aggregates proteomic and genomic data from multiple sources and provides over 200 million precomputed predictions on protein sequences, domains, structures, and more. It aims to enable easy, rapid, and comprehensive proteomic mining through semantic integration of distinct data types and automated querying of predictions. Custom data mining projects using Unison have led to discoveries about proteins like Bcl-2 that regulate apoptosis.
This document describes a comparative analysis of the human gut microbiota of Koreans using barcoded pyrosequencing. It finds that the Korean gut microbiome has high diversity at the species and strain levels, with over 800 species-level phylotypes identified on average per individual. The analysis identifies 14 core genera that are consistently present across Korean guts, including Bacteroides, Prevotella, Clostridium, and Ruminococcus. The phylum-level diversity of the Korean gut microbiome is similar to other human populations.
This document discusses lessons learned from building cancer models and realities around sharing, rewards, and affordability. It notes that oncogenes only make good targets in particular molecular contexts, as seen with the EGFR story. Predicting treatment response to known oncogenes is complex and requires detailed understanding of how different genetic backgrounds function. It also discusses preliminary probabilistic models being used to identify genes causal for disease. Extensive publications now substantiate the scientific approach of using probabilistic causal bionetwork models for diseases like metabolism, cardiovascular disease, and bone diseases. Sage Bionetworks is working to build an information commons for biological functions through collaborative disease maps and data repositories to better relate genetic features of cancer to drug efficacy and
Presentation of Eugeni Belda (LABGeM-Genoscope) at the Biocuration 2012 conference (Georgetown University, Washington DC): From bacterial genome annotation to metabolic pathway curation
The document discusses ways to improve the diagnostic yield of exome sequencing by addressing limitations in analytical and clinical validity. It notes that standard exomes do not fully cover the exome or reference genomes, and clinical interpretation is limited by incomplete knowledge in the literature and databases. Improving coverage, integrating more information sources, and enhancing data processing could help uncover more diagnostic variants.
This document provides information about variation resources available from the National Center for Biotechnology Information (NCBI). It lists the staff members who work on variation resources and key collaborators. It describes some of the major databases hosted by NCBI that contain genetic variation data, including dbSNP, dbVar, ClinVar and GTR. It also summarizes some of the tools and viewers available for exploring genetic variation data from NCBI.
The document describes the sequencing of the wheat genome, specifically chromosome 3B. Key points:
1. An international effort led by the IWGSC sequenced individual wheat chromosomes including 3B using a physical map-based approach.
2. Sequencing of the 1Gb chromosome 3B generated over 1000 scaffolds covering 995Mb with an N50 of 463kb. Genes and markers were annotated.
3. The sequenced and ordered chromosome 3B provides a foundation for accelerating wheat improvement through map-based cloning, marker development, and integrating genetic and genomic resources.
The document discusses RNA-seq analysis. It begins with an introduction to Mikael Huss, a bioinformatics scientist, and provides an overview of how genomics, RNA profiles, protein profiles, and interactomics relate within systems biology. The document then discusses how gene expression analysis can provide insights into basic research questions regarding tissue and cell identity, as well as insights into diseases by identifying genes that are over- or under-expressed in patients. Finally, it provides a brief overview of the typical workflow for RNA-seq analysis, which involves mapping RNA sequencing reads to a reference genome or transcriptome.
This document provides information about a QIIME workshop. It includes instructions on how to get started with QIIME, an overview of the typical QIIME analysis pipeline from raw sequencing data to results, and details on specific QIIME tools and files like the mapping file, OTU table, and parameters file. The document also discusses moving image analysis of the human microbiome using QIIME.
Stephen Friend Nature Genetics Colloquium 2012-03-24Sage Base
This document proposes using data intensive science to build models of disease within a shared computing environment or "commons". It notes that current disease models often oversimplify complex conditions. Five pilot projects are described that could leverage shared clinical and genomic data as well as model building to better represent diseases: 1) sharing comparator arm data from clinical trials, 2) a federated aging analysis project, 3) portable legal consent, 4) a Sage Congress modeling competition, and 5) the BRIDGE initiative for democratizing medical research. The document argues this approach could accelerate disease understanding and new therapy development.
The document discusses the BioHDF project which aims to develop scalable data infrastructure for bioinformatics using HDF5. It notes that next generation DNA sequencing is producing vast amounts of complex data that is challenging to analyze and compare across samples due to lack of consistent data models and structured storage. The BioHDF project seeks to address this by developing HDF5 domain extensions and tools to organize, index, annotate and access sequencing data in a way that enables more efficient analysis, visualization and exploration of results within and between samples.
Stephen Friend Fanconi Anemia Research Fund 2012-01-21Sage Base
This document summarizes Stephen Friend's presentation on using data intensive science and bionetworks to build better maps of human diseases. It discusses how collecting and integrating massive amounts of molecular and clinical data using open information systems and computing could enable the development of more comprehensive and probabilistic causal models of diseases. These evolving disease maps may help identify causal genes and pathways involved in various conditions. The presentation outlines Sage Bionetworks' mission to create a commons for scientists to collaborate on building and refining such integrative bionetworks to accelerate the elimination of human disease.
The document summarizes a presentation about developing open access tools to maximize the value of genomic data through the Genome Commons. The Genome Commons Database will be a repository of variants and associated traits. The Genome Commons Navigator will integrate this data and external tools to facilitate basic research, clinical applications, and more. Participation in the Critical Assessment of Genome Interpretation initiative aims to improve predictions of variant impacts on molecular, cellular and organismal phenotypes. Analysis of variants in folate pathway genes found classes of effects on yeast growth and folate remediation.
The National Center for Biotechnology Information (NCBI) was created in 1988 as part of the National Library of Medicine at NIH. It establishes public databases for biological research, develops software tools for sequence analysis, and disseminates biomedical information from its location in Bethesda, MD. NCBI houses several integrated databases including PubMed, GenBank, RefSeq, and UniGene that contain literature, sequences, gene information, and more.
The GeneArt® Gene Synthesis service consists of chemical synthesis, cloning, and sequence verification of virtually any desired genetic sequence. You will receive a bacterial stab and/or purified plasmid containing your synthesized gene—ready for downstream applications.
Whether you have limited cloning experience or simply want to save time, the GeneArt® Gene Synthesis service helps you move your ideas from the planning stage to the laboratory more quickly. Benefit from our experience in successfully producing over 180,000 constructs for customers as diverse as large pharmaceutical companies, biotechnology start-ups, and basic research institutions. The comparison shown in the figure below highlights the time and effort saved compared to traditional cloning. For more information visit:
https://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Cloning/gene-synthesis.html?CID=genesynthesis-SS-12312
The document discusses next generation sequencing methods and RNA sequencing. It covers topics like sequencing formats, data analysis workflows including mapping, clustering, assembly programs, finding new genes and correcting existing ones. It discusses input file types, calculating sequencing depth, available tools for alignment, output file formats, assembly programs, splice junction prediction, and applications of RNA sequencing like gene expression analysis and annotation.
Microarrays allow researchers to examine gene expression patterns across thousands of genes simultaneously. A microarray contains probes for known genes that are used to detect complementary mRNA in a biological sample. Microarrays can be used to study gene expression differences between normal and diseased tissues, classify tumor subtypes, and diagnose cancers. They also show promise for personalized cancer treatment by predicting patient prognosis and response to therapy.
NCBI has developed a powerful suite of online biomedical and bioinformatics resources, including old friends like PubMed and OMIM and newer resources such as Genome. This collection of databases and tools are widely used by scientists and medical professionals across the world. With such a wealth of information, it is easy to get overwhelmed. Join us for an overview to NCBI resources for the information professional with an emphasis on biodata connectivity. No science degree required!
Scratchpads in the Biodiversity Informatics LandscapeVince Smith
Roberts, D., Harman, K., Rycroft, S.D. & Smith, V.S. Stockholm Biodiversity Informatics Symposium 2008, Swedish Museum of Natural History, Stockholm, Sweden 1-4 December 2008.
Unison: Enabling easy, rapid, and comprehensive proteomic miningReece Hart
Unison is an online database and data integration platform that aggregates proteomic and genomic data from multiple sources and provides over 200 million precomputed predictions on protein sequences, domains, structures, and more. It aims to enable easy, rapid, and comprehensive proteomic mining through semantic integration of distinct data types and automated querying of predictions. Custom data mining projects using Unison have led to discoveries about proteins like Bcl-2 that regulate apoptosis.
This document describes a comparative analysis of the human gut microbiota of Koreans using barcoded pyrosequencing. It finds that the Korean gut microbiome has high diversity at the species and strain levels, with over 800 species-level phylotypes identified on average per individual. The analysis identifies 14 core genera that are consistently present across Korean guts, including Bacteroides, Prevotella, Clostridium, and Ruminococcus. The phylum-level diversity of the Korean gut microbiome is similar to other human populations.
This document discusses lessons learned from building cancer models and realities around sharing, rewards, and affordability. It notes that oncogenes only make good targets in particular molecular contexts, as seen with the EGFR story. Predicting treatment response to known oncogenes is complex and requires detailed understanding of how different genetic backgrounds function. It also discusses preliminary probabilistic models being used to identify genes causal for disease. Extensive publications now substantiate the scientific approach of using probabilistic causal bionetwork models for diseases like metabolism, cardiovascular disease, and bone diseases. Sage Bionetworks is working to build an information commons for biological functions through collaborative disease maps and data repositories to better relate genetic features of cancer to drug efficacy and
Presentation of Eugeni Belda (LABGeM-Genoscope) at the Biocuration 2012 conference (Georgetown University, Washington DC): From bacterial genome annotation to metabolic pathway curation
The document discusses ways to improve the diagnostic yield of exome sequencing by addressing limitations in analytical and clinical validity. It notes that standard exomes do not fully cover the exome or reference genomes, and clinical interpretation is limited by incomplete knowledge in the literature and databases. Improving coverage, integrating more information sources, and enhancing data processing could help uncover more diagnostic variants.
This document provides information about variation resources available from the National Center for Biotechnology Information (NCBI). It lists the staff members who work on variation resources and key collaborators. It describes some of the major databases hosted by NCBI that contain genetic variation data, including dbSNP, dbVar, ClinVar and GTR. It also summarizes some of the tools and viewers available for exploring genetic variation data from NCBI.
The document discusses the human reference genome assembly. It provides information on what a reference assembly is, how it is constructed, and how it has evolved over time. Key points include:
- The reference assembly is a model of the human genome built from many sequencing reads and is continually improved.
- Early assemblies had gaps and errors that have been improved on in newer releases. The current primary assembly is GRCh38.
- Alternate loci are now included to represent structural and haplotype variations not in the primary assembly.
- The reference assembly is important for mapping variants and interpreting genomic data.
This document discusses analyzing individual genomes and the human reference genome assembly. It provides an overview of how the reference assembly is constructed from sequencing data and improved over time. Key points discussed include how gaps are filled, alternate loci are represented, and new sequences are added to improve representation of structural and sequence variation.
This document discusses the reference genome assembly and how it is changing. It provides an overview of why the reference assembly matters, how the assembly is constructed and updated, and tools for finding assembly and variation data. Key points include: the assembly is a model that may have gaps; the human reference assembly has been updated several times; alternate loci are used to represent structural variants and haplotypes; and ongoing work involves adding novel sequence and fixing rare incorrect bases or assembly problems.
This document discusses the GeT-RM Project and Browser, which provides a resource for clinical testing laboratories to submit and analyze genomic variant call data. It lists the project team members and participating laboratories. The GeT-RM Browser allows laboratories to analyze variant call concordance and validation data across different sequencing platforms. Looking forward, the project aims to improve analysis tools and the browser interface with features like consensus genotype sets, investigation of discordant regions, and improved gene navigation.
This document discusses improvements to the human reference genome assembly (GRCh38) which will be released in September 2013. It highlights several key areas of focus for the new assembly including adding novel sequence from alternate loci, improving problematic regions through patching, increasing contiguity, and masking regions of high identity to aid read alignment and variant calling. The overall goal is to provide a more complete and accurate representation of the human genome sequence.
This document summarizes the challenges of integrating historical human genetic variation data from analog formats into digital genomic databases. It discusses issues with standardizing phenotypic data, variant call formats from clinical labs, reference assemblies, and defining mutations consistently. Harmonizing these diverse data sources will improve access and interpretation of human genetic variation.
This document discusses the Human Genome Project and summarizes two studies related to human genomes. The first study analyzed genetic variation in human meiotic recombination. The second studied population stratification of a common gene deletion polymorphism. Figures from both published studies are included to illustrate their findings.
The document discusses the human reference genome assembly, noting that it is a composite model that is not static, as new versions are periodically released with changes to sequence and coordinates. It emphasizes that accession versions are important for data management when the reference updates, and that tools are available to help with identifying changes between assemblies. The human reference assembly aims to represent the composite human genome but continues to be improved over time.
This document discusses improving the accuracy of variant identification by evolving the reference assembly. It describes how the reference assembly is updated through patches that add novel sequence, coordinate remapping between versions, and collaboration between groups to centralize assembly data. The goal is to facilitate reporting and fixing problems while building tools and managing data.
This document summarizes work on representing genomes and identifying genetic variants. It discusses challenges in genome assembly due to structural variation between haplotypes and the need for new assembly models that represent multiple haplotypes. It also describes the Genome Reference Consortium's efforts to improve the human reference genome sequence through patching and releasing alternate loci and haplotypes. This includes releasing over 70 patches to fix errors and add novel sequences, with patches being released quarterly.
This document discusses the evolution of genome references at the National Center for Biotechnology Information (NCBI). It describes how genomic data is stored and tracked in GenBank, and how reference assemblies are developed and annotated through collaborations between NCBI, other genome centers, and the research community. The goal is to provide consistent, high-quality reference genomes and annotations across multiple assemblies.
The document summarizes an IMGS 2011 bioinformatics workshop. It discusses next-generation sequencing technologies including Roche 454, Illumina/Solexa, and AB SOLiD. It also covers topics like sequence alignments, file formats, tools for analysis including BWA and TopHat, and visualization. The document provides links to video tutorials and resources on sequencing technologies, alignments, and analyzing RNA-seq data.
This is the talk I gave at the 4th annual Sequencing, Finishing, Analysis in the Future meeting. I tried to record my talk onto the slides based on the recording from the meeting, but it didn't work well. You can view the talk here: http://www.scivee.tv/node/11410 to hook the words up to the slides.
UiPath Test Automation using UiPath Test Suite series, part 5DianaGray10
Welcome to UiPath Test Automation using UiPath Test Suite series part 5. In this session, we will cover CI/CD with devops.
Topics covered:
CI/CD with in UiPath
End-to-end overview of CI/CD pipeline with Azure devops
Speaker:
Lyndsey Byblow, Test Suite Sales Engineer @ UiPath, Inc.
Dr. Sean Tan, Head of Data Science, Changi Airport Group
Discover how Changi Airport Group (CAG) leverages graph technologies and generative AI to revolutionize their search capabilities. This session delves into the unique search needs of CAG’s diverse passengers and customers, showcasing how graph data structures enhance the accuracy and relevance of AI-generated search results, mitigating the risk of “hallucinations” and improving the overall customer journey.
GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using Deplo...James Anderson
Effective Application Security in Software Delivery lifecycle using Deployment Firewall and DBOM
The modern software delivery process (or the CI/CD process) includes many tools, distributed teams, open-source code, and cloud platforms. Constant focus on speed to release software to market, along with the traditional slow and manual security checks has caused gaps in continuous security as an important piece in the software supply chain. Today organizations feel more susceptible to external and internal cyber threats due to the vast attack surface in their applications supply chain and the lack of end-to-end governance and risk management.
The software team must secure its software delivery process to avoid vulnerability and security breaches. This needs to be achieved with existing tool chains and without extensive rework of the delivery processes. This talk will present strategies and techniques for providing visibility into the true risk of the existing vulnerabilities, preventing the introduction of security issues in the software, resolving vulnerabilities in production environments quickly, and capturing the deployment bill of materials (DBOM).
Speakers:
Bob Boule
Robert Boule is a technology enthusiast with PASSION for technology and making things work along with a knack for helping others understand how things work. He comes with around 20 years of solution engineering experience in application security, software continuous delivery, and SaaS platforms. He is known for his dynamic presentations in CI/CD and application security integrated in software delivery lifecycle.
Gopinath Rebala
Gopinath Rebala is the CTO of OpsMx, where he has overall responsibility for the machine learning and data processing architectures for Secure Software Delivery. Gopi also has a strong connection with our customers, leading design and architecture for strategic implementations. Gopi is a frequent speaker and well-known leader in continuous delivery and integrating security into software delivery.
Generative AI Deep Dive: Advancing from Proof of Concept to ProductionAggregage
Join Maher Hanafi, VP of Engineering at Betterworks, in this new session where he'll share a practical framework to transform Gen AI prototypes into impactful products! He'll delve into the complexities of data collection and management, model selection and optimization, and ensuring security, scalability, and responsible use.
Full-RAG: A modern architecture for hyper-personalizationZilliz
Mike Del Balso, CEO & Co-Founder at Tecton, presents "Full RAG," a novel approach to AI recommendation systems, aiming to push beyond the limitations of traditional models through a deep integration of contextual insights and real-time data, leveraging the Retrieval-Augmented Generation architecture. This talk will outline Full RAG's potential to significantly enhance personalization, address engineering challenges such as data management and model training, and introduce data enrichment with reranking as a key solution. Attendees will gain crucial insights into the importance of hyperpersonalization in AI, the capabilities of Full RAG for advanced personalization, and strategies for managing complex data integrations for deploying cutting-edge AI solutions.
Alt. GDG Cloud Southlake #33: Boule & Rebala: Effective AppSec in SDLC using ...James Anderson
Effective Application Security in Software Delivery lifecycle using Deployment Firewall and DBOM
The modern software delivery process (or the CI/CD process) includes many tools, distributed teams, open-source code, and cloud platforms. Constant focus on speed to release software to market, along with the traditional slow and manual security checks has caused gaps in continuous security as an important piece in the software supply chain. Today organizations feel more susceptible to external and internal cyber threats due to the vast attack surface in their applications supply chain and the lack of end-to-end governance and risk management.
The software team must secure its software delivery process to avoid vulnerability and security breaches. This needs to be achieved with existing tool chains and without extensive rework of the delivery processes. This talk will present strategies and techniques for providing visibility into the true risk of the existing vulnerabilities, preventing the introduction of security issues in the software, resolving vulnerabilities in production environments quickly, and capturing the deployment bill of materials (DBOM).
Speakers:
Bob Boule
Robert Boule is a technology enthusiast with PASSION for technology and making things work along with a knack for helping others understand how things work. He comes with around 20 years of solution engineering experience in application security, software continuous delivery, and SaaS platforms. He is known for his dynamic presentations in CI/CD and application security integrated in software delivery lifecycle.
Gopinath Rebala
Gopinath Rebala is the CTO of OpsMx, where he has overall responsibility for the machine learning and data processing architectures for Secure Software Delivery. Gopi also has a strong connection with our customers, leading design and architecture for strategic implementations. Gopi is a frequent speaker and well-known leader in continuous delivery and integrating security into software delivery.
GraphSummit Singapore | The Art of the Possible with Graph - Q2 2024Neo4j
Neha Bajwa, Vice President of Product Marketing, Neo4j
Join us as we explore breakthrough innovations enabled by interconnected data and AI. Discover firsthand how organizations use relationships in data to uncover contextual insights and solve our most pressing challenges – from optimizing supply chains, detecting fraud, and improving customer experiences to accelerating drug discoveries.
GridMate - End to end testing is a critical piece to ensure quality and avoid...ThomasParaiso2
End to end testing is a critical piece to ensure quality and avoid regressions. In this session, we share our journey building an E2E testing pipeline for GridMate components (LWC and Aura) using Cypress, JSForce, FakerJS…
In his public lecture, Christian Timmerer provides insights into the fascinating history of video streaming, starting from its humble beginnings before YouTube to the groundbreaking technologies that now dominate platforms like Netflix and ORF ON. Timmerer also presents provocative contributions of his own that have significantly influenced the industry. He concludes by looking at future challenges and invites the audience to join in a discussion.
GraphSummit Singapore | The Future of Agility: Supercharging Digital Transfor...Neo4j
Leonard Jayamohan, Partner & Generative AI Lead, Deloitte
This keynote will reveal how Deloitte leverages Neo4j’s graph power for groundbreaking digital twin solutions, achieving a staggering 100x performance boost. Discover the essential role knowledge graphs play in successful generative AI implementations. Plus, get an exclusive look at an innovative Neo4j + Generative AI solution Deloitte is developing in-house.
“An Outlook of the Ongoing and Future Relationship between Blockchain Technologies and Process-aware Information Systems.” Invited talk at the joint workshop on Blockchain for Information Systems (BC4IS) and Blockchain for Trusted Data Sharing (B4TDS), co-located with with the 36th International Conference on Advanced Information Systems Engineering (CAiSE), 3 June 2024, Limassol, Cyprus.
Sudheer Mechineni, Head of Application Frameworks, Standard Chartered Bank
Discover how Standard Chartered Bank harnessed the power of Neo4j to transform complex data access challenges into a dynamic, scalable graph database solution. This keynote will cover their journey from initial adoption to deploying a fully automated, enterprise-grade causal cluster, highlighting key strategies for modelling organisational changes and ensuring robust disaster recovery. Learn how these innovations have not only enhanced Standard Chartered Bank’s data infrastructure but also positioned them as pioneers in the banking sector’s adoption of graph technology.
LF Energy Webinar: Electrical Grid Modelling and Simulation Through PowSyBl -...DanBrown980551
Do you want to learn how to model and simulate an electrical network from scratch in under an hour?
Then welcome to this PowSyBl workshop, hosted by Rte, the French Transmission System Operator (TSO)!
During the webinar, you will discover the PowSyBl ecosystem as well as handle and study an electrical network through an interactive Python notebook.
PowSyBl is an open source project hosted by LF Energy, which offers a comprehensive set of features for electrical grid modelling and simulation. Among other advanced features, PowSyBl provides:
- A fully editable and extendable library for grid component modelling;
- Visualization tools to display your network;
- Grid simulation tools, such as power flows, security analyses (with or without remedial actions) and sensitivity analyses;
The framework is mostly written in Java, with a Python binding so that Python developers can access PowSyBl functionalities as well.
What you will learn during the webinar:
- For beginners: discover PowSyBl's functionalities through a quick general presentation and the notebook, without needing any expert coding skills;
- For advanced developers: master the skills to efficiently apply PowSyBl functionalities to your real-world scenarios.
Maruthi Prithivirajan, Head of ASEAN & IN Solution Architecture, Neo4j
Get an inside look at the latest Neo4j innovations that enable relationship-driven intelligence at scale. Learn more about the newest cloud integrations and product enhancements that make Neo4j an essential choice for developers building apps with interconnected data and generative AI.
Unlocking Productivity: Leveraging the Potential of Copilot in Microsoft 365, a presentation by Christoforos Vlachos, Senior Solutions Manager – Modern Workplace, Uni Systems
9. GRC Beginnings
Distributed data
Old Assembly Model
Genome not in INSDC Database
10. Build sequence contigs based on contigs
defined in TPF.
Check for orientation consistencies
Select switch points
Instantiate sequence for further analysis
Switch point
Consensus sequence
15. Distributed data
Centralized Data
Old Assembly Model
Genome not in INSDC Database
16. Large-Scale Variation Complicates Genome Assembly
Sequences from haplotype 1
Sequences from haplotype 2
Old Assembly model: compress into a consensus
New Assembly model: represent both haplotypes
19. UGT2B17 MHC MAPT GRCh37 (hg19)
7 alternate haplotypes
at the MHC
Alternate loci released as:
FASTA
AGP
Alignment to chromosome
http://genomereference.org
20.
21. Assembly (e.g. GRCh37)
PAR Non-nuclear
Primary assembly unit
Assembly (e.g. MT)
ALT ALT ALT
Genomic 1 2 3
Region
(MHC)
Genomic
ALT ALT ALT
Region 4 5 6
(UGT2B17)
Genomic
Region
ALT
ALT
(MAPT) 7
8
ALT
9
24. Oh No! Not a new
version of the human
genome!
http://genomereference.org
25.
26. Assembly (e.g. GRCh37.p5)
PAR Non-nuclear
Primary assembly unit
Assembly (e.g. MT)
ALT ALT ALT
Genomic 1 2 3
Region
(MHC)
Genomic
ALT ALT ALT
Region 4 5 6
(UGT2B17)
Genomic
Region
ALT
ALT
(MAPT) 7
Genomic 8
Region
(ABO)
Genomic ALT
Region 9
(SMA)
Genomic
Region
(PECAM1)
Patches
…
27. TBC1D3C TBC1D3 TBC1D3H
TBC1D3C
Myo19 region (17q21)
28. 70 Fix PATCHES: Chromosome will update in GRCh38
(adds >1 Mb of novel sequence to the assembly)
71 Novel PATCHES: Additional sequence added
(adds >800K of novel sequence to the assembly)
Releasing patches quarterly
29. Distributed data
Centralized Data
Old Assembly Model
Updated Assembly Model
Genome not in INSDC Database
Genome in INSDC Database
30. Data Archives
GenBank
Data in a common format
Data in a single location (and mirrored)
Most quality checked prior to deposition
Robust data tracking mechanism (accession.version)
Data owned by submitter
31. Data tracking
ABC14-1065514J1
Date Phase Gaps Length
FP565796.1 21-Oct-2009 1 1
FP565796.2 14-Oct-2010 1 0
FP565796.3 07-Nov-2010 3 0
39. Assembly (e.g. GRCh37.p5)
GCA_000001405.6 /GCF_000001405.17
ALT GCA_000001345.1/
Primary GCA_000001305.1/ 4 GCF_000001345.1
Assembly GCF_000001305.13
ALT GCA_000001355.1/
5 GCF_000001355.1
Non-nuclear GCA_000006015.1/ ALT GCA_000001365.1/
assembly unit GCF_000006015.1 6 GCF_000001365.2
(e.g. MT)
ALT GCA_000001375.1/
7 GCF_000001375.1
ALT GCA_000001315.1/
1 GCF_000001315.1
ALT GCA_000001385.1/
8 GCF_000001385.1
ALT GCA_000001325.1/
2 GCF_000001325.2
ALT GCA_000001395.1/
9 GCF_000001395.1
ALT GCA_000001335.1/
3 GCF_000001335.1 GCA_000005045.5
Patches
GCF_000005045.4
40. GenBank vs RefSeq
Submitter Owned RefSeq Owned
Redundancy Non-Redundant
Updated rarely Curated
INSDC Not INSDC
BRCA1
83 genomic records 3 genomic records
31 mRNA records 5 mRNA records
27 protein records 1 RNA record
5 protein records
41.
42. RefSeq for Assemblies
Typical assembly edits
Addition of non-nuclear (e.g. MT) assembly units
Removal of contamination
Drop unlocalized/unplaced scaffolds
Mask contamination that is placed on chromosome
48. Genome Data is MORE than just the Genome
ATGCGTGCAAAATGCAGTGAGT
ATGCGTGCAAAATGCAGTGAGT
ATGCGTGCAAAATGCAGTGAGT
ATGCGTGCAAAATGCAGTGAGT
NM_000336.2:c.800C>T
52. Thanks!
The Genome Reference Consortium
The Genome Center at Washington University
The Wellcome Trust Sanger Institute
The European Bioinformatics Institute
The National Center for Biotechnology Information
Church group at NCBI For Slides:
Valerie Schneider Francoise Thibaud-Nissen
Nathan Bouk Evan Eichler
Hsiu-Chuan Chen Steve Sherry
Peter Meric
Victor Ananiev
Chao Chen
John Lopez
John Garner
Tim Hefferon
NCBI
Cliff Clausen
Editor's Notes
Alignments refer to pairs of sequence. Once you know how a pair of sequences go together, you can look at stringing the pairs along into a contig. The contig is essentially the consensus sequence that is produced from the components.To create a contig, we use the steps shown on this slide.What are switch points? As you create the consensus sequence of the contig, the switch points tell you where to stop using the sequence from one component and begin using the sequence from the next.
Show alignment of a feature from first slide to show how far down the chromosome it has moved…
Keeping track of people is way easier than keeping track of assemblies.