Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Ch 5.3 DNA

1,039 views

Published on

DNA

Published in: Education
  • Be the first to comment

Ch 5.3 DNA

  1. 1. Ch. 5.3: DNA & Genetics
  2. 2. 1. What scientists have contributed to our understanding of DNA? 2. What is the structure of DNA? 3. What is the role of RNA in protein production? 4. How do changes in the sequence of DNA affect traits? Focus Questions
  3. 3. Before the 1950s, we knew that:  Inherited characteristics are determine by genes.  Genes are passed from one generation to the next.  Genes are part of a chromosome.  Cells divide. Before they divide, they have to copy their structures, organelles, & their genetic information. 1. What scientists contributed to our understanding of DNA?
  4. 4. 1. What scientists contributed to our understanding of DNA?
  5. 5. 1. What is DNA? • An organism’s genetic material, made up of nucleotides • deoxyribonucleic acid • A gene is a segment of DNA on a chromosome that provides directions for making proteins. 1. What scientists contributed to our understanding of DNA?
  6. 6. 2. Rosalind Franklin (1920-1958) • Made significant advances in X-ray diffraction techniques with DNA • Her images showed that DNA had a spiral shape 1. What scientists contributed to our understanding of DNA?
  7. 7. 2. Maurice Wilkins (1916-2004) • Worked with Rosalind Franklin with X-ray diffraction studies of DNA • Shared info. with Watson & Crick 1. What scientists contributed to our understanding of DNA?
  8. 8. Erwin Chargaff (1905-2002) • Investigated composition of DNA • In 1950, he discovered base- pairings of A-T & G-C 1. What scientists contributed to our understanding of DNA?
  9. 9. 3. James Watson (1928) & Francis Crick (1916-2004) • Worked together to determine DNA’s structure • Determined DNA’s double helix shape • Watson, Crick, & Wilkins were awarded the Nobel Prize in 1962 (Franklin passed away beforehand) 1. What scientists contributed to our understanding of DNA?
  10. 10. 4. DNA is shaped like a double helix, which is like a twisted ladder. 2. What is the structure of DNA?
  11. 11. 5. A nucleotide is a molecule made of:  Nitrogen base, • 6. There are 4 nitrogen bases: adenine (A), cytosine (C), thymine (T), and guanine (G) • Nitrogen bases bond and form the rungs of the ladder.  Sugar-phosphate group • Sugar-phosphate groups form the sides of the DNA ladder. 2. What is the structure of DNA?
  12. 12. 7. Certain bases always bond together: A – T and C – G. 2. What is the structure of DNA? 8.
  13. 13. DNA – What does my code look like? Computer Code: 10010100111010001100101001110010111100101001 00100100101110010100010101001001010010101001 0010100101001010100101001010010101010101001 010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAG ATAAACTAGAGAGACCCTTTAAAACACACAGAGATA GACAGAAAAACAATAGACAGATACAGATAGACATAA AAAATTTTTTGGGAAA…millions and millions of bases…
  14. 14. Practice DNA Base Pairs A T T A C A C TT A A T
  15. 15. In DNA, which of the following is paired with guanine? a. b. c. d. 0 000 a. Adenine b. Cytosine c. Thymine d. Uracil 45
  16. 16. In DNA, which of the following is paired with Adenine? a. b. c. d. 0 000 a. Adenine b. Cytosine c. Guanine d. Thymine 45
  17. 17. In DNA, which of the following is paired with Cytosine? a. b. c. d. 0 000 a. Adenine b. Cytosine c. Guanine d. Thymine 45
  18. 18. 9. Replication is the process of copying a DNA molecule to make another DNA molecule. 2. What is the structure of DNA?
  19. 19. What is the product of replication? a. b. c. d. 0 000 a. DNA b. RNA c. mRNA d. Proteins 45
  20. 20. DNA replication – helix unzips
  21. 21. DNA replication – helix unzips
  22. 22. DNA replication – two strands are separated
  23. 23. DNA replication – each side is now a template
  24. 24. DNA replication – two identical strands of DNA Original DNA strands
  25. 25. DNA replication Newly assembled DNA strands
  26. 26. 10. Mutation occurs when the sequence of nucleotides is changed in a gene.  Insertion – more added  Deletion – some deleted  Substitution – some swapped mutation from Latin mutare, means “to change” 3. How do changes in the sequence of DNA affect traits?
  27. 27. • The 46 human chromosomes contain between 20,000 and 25,000 genes that are copied during replication. • Mutations can be triggered by exposure to X-rays, ultraviolet light, radioactive materials, and some kinds of chemicals. 3. How do changes in the sequence of DNA affect traits?
  28. 28. The 3 types of mutations are substitution, insertion, and deletion. 3. How do changes in the sequence of DNA affect traits?
  29. 29. Which of the following describes the mutation that occurs when three base pairs are added? a. b. c. d. 0 000 a. Insertion b. Substitution c. Transgression d. Deletion 45
  30. 30. Which of the following describes an error made during the copying of DNA? a. b. c. d. 0 000 a. Transcription b. Replication c. Translation d. Mutation 45
  31. 31. • The effects of a mutation depend on where in the DNA sequence the mutation happens and the type of mutation. • Some mutations in human DNA cause genetic disorders. • Some mutations can be beneficial for the organism, even helping it survive diseases. – If a person only has 1 sickle cell allele (not both), they are more resistant to malaria. – If a person is born with Type AB blood, they can accept donations from all other blood types. 3. How do changes in the sequence of DNA affect traits?
  32. 32. In DNA, which of the following is true? A. B. C. D. 0 000 A. adenine bonds with guanine B. cytosine bonds with adenine C. thymine bonds with adenine D. none of the above 45

×