This document discusses the BLAST algorithm for comparing biological sequences. It explains that BLAST allows rapid sequence comparison of a query sequence against a database. BLAST is fast, accurate, and accessible online. The document then describes the four main components of a BLAST search: choosing the query sequence, BLAST program, database, and optional parameters. It provides details on how to interpret BLAST search results, including the expect value, and how BLAST works by compiling word pairs from the query and database in three phases of searching and alignment.
This document discusses FASTA and BLAST algorithms for database searching to find similar sequences to a query. It explains that FASTA uses a "hit and extend" method to search for short identical matches, while BLAST searches for words above a threshold score rather than exact matches. BLAST is generally faster than FASTA and Smith-Waterman as it uses heuristics. The document provides details on how BLAST works including compiling a word list, searching the database for hits, and extending hits into alignments.
The document discusses database searching algorithms like FASTA and BLAST. It explains the mathematical concepts behind BLAST like using Erdos-Renyi theory to model random sequence alignments and calculate the expected length of the longest random match. It also describes the Karlin-Alschul equation used in BLAST to calculate the statistical significance of matches as the expected number of alignments (E) based on the size of the search space and alignment score. The document provides details on parameters and scoring approaches used in database searching algorithms.
The document discusses database searching algorithms like FASTA and BLAST. It explains that FASTA uses heuristics to search for exact word matches and join high-scoring regions, while BLAST uses heuristics to compile a neighborhood of high-scoring words and then search for these words in the database to find local alignments faster than dynamic programming. It also discusses parameters that influence the speed and sensitivity of the searches.
This document provides an overview of the BLAST algorithm used for comparing biological sequences and identifying sequence similarities. It describes how BLAST works by generating words from a query sequence and searching a database for exact matches. Significant matches are extended locally to identify Maximal Segment Pairs (MSPs) based on scoring. MSPs are evaluated and ranked using E-values, which estimate the statistical significance of matches. The document also discusses different BLAST programs and provides examples of running BLAST searches and interpreting results. Homework assignments are included applying BLAST to specific sequence analysis tasks.
The document provides information about various bioinformatics lessons that will take place on Thursdays, including topics like biological databases, sequence alignments, database searching using FASTA and BLAST, phylogenetics, and protein structure. It also includes details about database searching methods like dynamic programming, FASTA, BLAST, and parameters that can be adjusted for BLAST searches.
The document discusses BLAST (Basic Local Alignment Search Tool), an algorithm used to compare a query DNA or protein sequence against a database of sequences. BLAST works by identifying exact or approximate matches between words of 3-11 letters in the query and database sequences. Matches are extended to find local alignments with high scores. Significant alignments are identified based on their score and the expected number of matches by chance (E-value). The document provides examples of how BLAST finds local alignments and calculates E-values. It also describes different BLAST programs and suggestions for using BLAST.
Presentation for blast algorithm bio-informaticezahid6
Presentation for BLAST algorithm
Publisher Md.Zahid Hasan
Bio-informatics blast is the use of computational tools for the process of acquisition, visualization, analysis and distribution of these datasets obtained by imaging modalities.
This document provides an overview of the BLAST algorithm for calculating sequence similarity and its various outputs. BLAST (Basic Local Alignment Search Tool) finds local alignments between biological sequences and produces outputs in various formats including pairwise alignments, hit tables, and structured outputs like ASN.1 and XML. It works by creating a lookup table of words from the query and scanning the database for matches to initiate gapped or ungapped extensions. The document discusses strategies for improving BLAST throughput, such as using MegaBLAST for very similar sequences, increasing word size thresholds, and concatenating queries to minimize database scanning.
This document discusses FASTA and BLAST algorithms for database searching to find similar sequences to a query. It explains that FASTA uses a "hit and extend" method to search for short identical matches, while BLAST searches for words above a threshold score rather than exact matches. BLAST is generally faster than FASTA and Smith-Waterman as it uses heuristics. The document provides details on how BLAST works including compiling a word list, searching the database for hits, and extending hits into alignments.
The document discusses database searching algorithms like FASTA and BLAST. It explains the mathematical concepts behind BLAST like using Erdos-Renyi theory to model random sequence alignments and calculate the expected length of the longest random match. It also describes the Karlin-Alschul equation used in BLAST to calculate the statistical significance of matches as the expected number of alignments (E) based on the size of the search space and alignment score. The document provides details on parameters and scoring approaches used in database searching algorithms.
The document discusses database searching algorithms like FASTA and BLAST. It explains that FASTA uses heuristics to search for exact word matches and join high-scoring regions, while BLAST uses heuristics to compile a neighborhood of high-scoring words and then search for these words in the database to find local alignments faster than dynamic programming. It also discusses parameters that influence the speed and sensitivity of the searches.
This document provides an overview of the BLAST algorithm used for comparing biological sequences and identifying sequence similarities. It describes how BLAST works by generating words from a query sequence and searching a database for exact matches. Significant matches are extended locally to identify Maximal Segment Pairs (MSPs) based on scoring. MSPs are evaluated and ranked using E-values, which estimate the statistical significance of matches. The document also discusses different BLAST programs and provides examples of running BLAST searches and interpreting results. Homework assignments are included applying BLAST to specific sequence analysis tasks.
The document provides information about various bioinformatics lessons that will take place on Thursdays, including topics like biological databases, sequence alignments, database searching using FASTA and BLAST, phylogenetics, and protein structure. It also includes details about database searching methods like dynamic programming, FASTA, BLAST, and parameters that can be adjusted for BLAST searches.
The document discusses BLAST (Basic Local Alignment Search Tool), an algorithm used to compare a query DNA or protein sequence against a database of sequences. BLAST works by identifying exact or approximate matches between words of 3-11 letters in the query and database sequences. Matches are extended to find local alignments with high scores. Significant alignments are identified based on their score and the expected number of matches by chance (E-value). The document provides examples of how BLAST finds local alignments and calculates E-values. It also describes different BLAST programs and suggestions for using BLAST.
Presentation for blast algorithm bio-informaticezahid6
Presentation for BLAST algorithm
Publisher Md.Zahid Hasan
Bio-informatics blast is the use of computational tools for the process of acquisition, visualization, analysis and distribution of these datasets obtained by imaging modalities.
This document provides an overview of the BLAST algorithm for calculating sequence similarity and its various outputs. BLAST (Basic Local Alignment Search Tool) finds local alignments between biological sequences and produces outputs in various formats including pairwise alignments, hit tables, and structured outputs like ASN.1 and XML. It works by creating a lookup table of words from the query and scanning the database for matches to initiate gapped or ungapped extensions. The document discusses strategies for improving BLAST throughput, such as using MegaBLAST for very similar sequences, increasing word size thresholds, and concatenating queries to minimize database scanning.
BLAST is a sequence comparison algorithm that is used to compare a query sequence against databases to find optimal local alignments. It breaks sequences into fragments and seeks matches between them, which is faster than full sequence alignment. The main types of BLAST programs are blastn, blastp, psi-blast, blastx, tblastx, tblastn, and megablast. BLAST's algorithm involves removing repeats, making a word list, finding matches, and extending matches to report significant alignments. It outputs alignments and statistics like E-values and bit scores. BLAST can identify species, locate domains, establish phylogeny, and enable comparison of sequences.
BLAST is a program that compares a query DNA or protein sequence against a database to find sequences that resemble the query above a certain threshold. It works by breaking the query into short words and searching the database for those words, then extending any matches. The output includes alignments of high-scoring segment pairs and statistical measures like E-values and bit scores to indicate match significance. BLAST is faster than FASTA and more specific due to low complexity filtering.
The document discusses algorithms for database searching and sequence alignment. It introduces BLAST and FASTA, two widely used algorithms for database searching. BLAST works by finding short words in sequences that score above a threshold and then extending any alignments found. FASTA uses a "hit and extend" heuristic to find locally similar regions. The document then discusses the statistical models that BLAST uses to calculate expected values and rank matching sequences by significance. It describes how BLAST models alignments as coin tosses to apply the Erdös-Rényi theorem and derive the Karlin-Altschul equation for calculating expected values.
The document discusses various sequence comparison techniques including pairwise alignment, local alignment, global alignment, and multiple alignment. It describes heuristic methods like FASTA and BLAST that are faster than dynamic programming but may miss optimal alignments. It provides details on the FASTA algorithm including finding identical words, re-scoring, joining segments, and dynamic programming. It also explains the BLAST algorithm and steps including query preprocessing, database scanning, and hit extension. Specialized BLAST databases and tools are also listed.
This document summarizes key concepts in sequence alignment including:
1) Sequence alignment involves finding the linear correspondence between symbols in one sequence to another that maximizes similarity. Dynamic programming is commonly used to compute optimal alignments.
2) BLAST is an extremely fast database search tool that uses heuristics like word matching to find local alignments and statistical analysis to assess significance.
3) Multiple sequence alignments make conserved features more apparent but are more difficult to compute than pairwise alignments. Progressive alignment gradually merges pairwise alignments based on a phylogenetic tree.
The document provides an introduction to BLAST (Basic Local Alignment Search Tool), which is an algorithm used to compare gene and protein sequences to those in public databases. It discusses the types of BLAST programs, the BLAST algorithm, input/output, how to perform a BLAST search, and the functions and objectives of BLAST. Specifically, BLAST is faster than previous sequence comparison methods, it outputs alignments and statistical values to evaluate matches, and its main objectives are to identify related sequences and locate domains through local alignments.
FASTA is a sequence alignment tool that was developed before BLAST. It uses a hashing strategy to find matches between k-tuples, or short stretches of identical residues, in query and target sequences. FASTA breaks sequences down into k-tuples and searches target databases to find similarities. While faster than dynamic programming, FASTA and BLAST may not find optimal alignments or true homologs.
The document discusses sequence alignment and database searching techniques. It provides code examples and explanations for the Needleman-Wunsch algorithm, dynamic programming, FASTA, and BLAST. For BLAST, it explains the key steps of breaking sequences into words, searching the database for word matches, and extending matches to find high-scoring pairs and hits between query and database sequences. Parameters like word threshold, word size, extension cutoff, and E-value are also discussed for customizing BLAST searches.
Genome and exome sequencing can be used to identify genetic variants that cause rare diseases. Whole genome sequencing requires 30-50X coverage to sequence the entire genome, while exome sequencing only sequences the 1-2% of the genome that is the exome, or protein-coding regions. Read mapping is used to align sequencing reads to the reference genome and is computationally intensive. Variant detection methods like spaced seeds and Burrows-Wheeler transforms are used to identify SNPs and indels, while structural variation can be detected using tools like BreakDancer that analyze read pairs and soft-clipped reads.
BLAST is a tool that compares a query DNA or protein sequence against sequence databases to find regions of similarity. It uses a heuristic algorithm that scans databases quickly to find matching sequences. BLAST helps scientists infer functional and evolutionary relationships between sequences and identify members of gene families. It was developed as an improvement over previous alignment tools as it is faster and can process the large volumes of sequence data that were accumulating. There are several variants of BLAST that can search nucleotide or protein databases using different query types.
FASTA is a bioinformatic tool for fast sequence searching that allows for comparison of a query sequence against a database to find similar sequences. It uses heuristic methods like focusing on diagonal areas of alignment matrices to achieve high sensitivity searches at high speed. The FASTA algorithm works by first finding regions of identity, rescoring matches using substitution matrices, joining matching segments while eliminating low scoring segments, and constructing an optimal alignment using dynamic programming.
Objectives are an understanding of:
▶ Homology search tools
▶ E-values
▶ how BLAST works
▶ how profile HMMs (hmmer) work
▶ which is the right tool for different questions
This document discusses various methods for aligning and comparing biological sequences like DNA and proteins, including local vs global alignment, exact vs heuristic algorithms, and tools like BLAST, PSI-BLAST, and statistical tests for assessing the significance of sequence similarities. Local alignment finds short similar regions, while global alignment considers the full sequence length. Exact methods are rigorous but slow, while heuristics sacrifice completeness for speed. BLAST uses ungapped segment pairs to identify regions for gapped extension and alignment. PSI-BLAST iteratively reweights sequences based on multiple alignments to identify more distant homologs. Statistical tests compare observed sequence similarities to random expectations to assess biological significance.
This document discusses biological database searching. It begins by defining biological databases as organized collections of persistent biological data that can be queried and retrieved. Examples are provided such as GenBank and SwissProt. Database searching involves using a query sequence to find related sequences in the database based on homology. Parameters like E-values and bit scores are used to define the significance of matches. Popular search algorithms like BLAST and FASTA first use heuristics to find high-scoring regions before applying dynamic programming for alignment.
The document describes the BLAST algorithm for comparing biological sequences. BLAST stands for Basic Local Alignment Search Tool. It allows for fast comparison of a query sequence against large databases. BLAST uses heuristics to find locally similar regions between sequences and scores alignments based on identities without considering gaps. This rapid approximation allows BLAST to be applied to search large databases on common computers, providing a significant improvement over previous algorithms. The document outlines the methods used in BLAST, including compiling high-scoring words from the query, scanning the database for hits, and extending hits to determine significant alignments. It also discusses evaluating the statistical significance of results and how parameters like word length and score thresholds can impact BLAST's speed and accuracy.
This document provides information about different types of BLAST programs including BLASTN and TBLASTN. It discusses how BLASTN performs nucleotide sequence comparisons and TBLASTN translates nucleotide databases to protein sequences. The document also provides examples of running BLASTN and TBLASTN searches and analyzing the results, with screenshots of the outputs.
The document outlines topics that will be covered in a bioinformatics course, including biological databases, sequence alignments, database searching, phylogenetics, protein structure, gene prediction, gene ontologies, hidden Markov models, and non-coding RNA. It then provides more details on topics like using sequence similarity to gather information from unknown protein sequences, finding conserved patterns in alignments using profiles and hidden Markov models, and challenges around gene prediction from raw genomic sequences.
This presentation introduces BLAST (Basic Local Alignment Search Tool) which is used to compare gene and protein sequences against databases. It discusses the types of BLAST programs including blastn, blastp, and PSI-BLAST. The BLAST algorithm works by removing repeats, making a word list from the query, searching the database for matches, and extending matches. BLAST output includes alignments and statistical values. Key functions of BLAST are locating domains, establishing phylogeny, DNA mapping, and comparison. The objectives are to enable comparison of a query to database sequences and identify related matches above a threshold.
David Russo worked in the Wang Lab during summer 2010 where he improved an existing program called Patser that identifies conserved regions in DNA that could serve as transcription factor binding sites. He analyzed potential binding sites for transcription factors in the IL22 gene by running sequences through Patser with and without integrating conservation scores. The results identified several transcription factors where Patser, Patser/PhastCons, and Patser/PhyloP identified binding sites in the same regions.
CHINA’S GEO-ECONOMIC OUTREACH IN CENTRAL ASIAN COUNTRIES AND FUTURE PROSPECTjpsjournal1
The rivalry between prominent international actors for dominance over Central Asia's hydrocarbon
reserves and the ancient silk trade route, along with China's diplomatic endeavours in the area, has been
referred to as the "New Great Game." This research centres on the power struggle, considering
geopolitical, geostrategic, and geoeconomic variables. Topics including trade, political hegemony, oil
politics, and conventional and nontraditional security are all explored and explained by the researcher.
Using Mackinder's Heartland, Spykman Rimland, and Hegemonic Stability theories, examines China's role
in Central Asia. This study adheres to the empirical epistemological method and has taken care of
objectivity. This study analyze primary and secondary research documents critically to elaborate role of
china’s geo economic outreach in central Asian countries and its future prospect. China is thriving in trade,
pipeline politics, and winning states, according to this study, thanks to important instruments like the
Shanghai Cooperation Organisation and the Belt and Road Economic Initiative. According to this study,
China is seeing significant success in commerce, pipeline politics, and gaining influence on other
governments. This success may be attributed to the effective utilisation of key tools such as the Shanghai
Cooperation Organisation and the Belt and Road Economic Initiative.
BLAST is a sequence comparison algorithm that is used to compare a query sequence against databases to find optimal local alignments. It breaks sequences into fragments and seeks matches between them, which is faster than full sequence alignment. The main types of BLAST programs are blastn, blastp, psi-blast, blastx, tblastx, tblastn, and megablast. BLAST's algorithm involves removing repeats, making a word list, finding matches, and extending matches to report significant alignments. It outputs alignments and statistics like E-values and bit scores. BLAST can identify species, locate domains, establish phylogeny, and enable comparison of sequences.
BLAST is a program that compares a query DNA or protein sequence against a database to find sequences that resemble the query above a certain threshold. It works by breaking the query into short words and searching the database for those words, then extending any matches. The output includes alignments of high-scoring segment pairs and statistical measures like E-values and bit scores to indicate match significance. BLAST is faster than FASTA and more specific due to low complexity filtering.
The document discusses algorithms for database searching and sequence alignment. It introduces BLAST and FASTA, two widely used algorithms for database searching. BLAST works by finding short words in sequences that score above a threshold and then extending any alignments found. FASTA uses a "hit and extend" heuristic to find locally similar regions. The document then discusses the statistical models that BLAST uses to calculate expected values and rank matching sequences by significance. It describes how BLAST models alignments as coin tosses to apply the Erdös-Rényi theorem and derive the Karlin-Altschul equation for calculating expected values.
The document discusses various sequence comparison techniques including pairwise alignment, local alignment, global alignment, and multiple alignment. It describes heuristic methods like FASTA and BLAST that are faster than dynamic programming but may miss optimal alignments. It provides details on the FASTA algorithm including finding identical words, re-scoring, joining segments, and dynamic programming. It also explains the BLAST algorithm and steps including query preprocessing, database scanning, and hit extension. Specialized BLAST databases and tools are also listed.
This document summarizes key concepts in sequence alignment including:
1) Sequence alignment involves finding the linear correspondence between symbols in one sequence to another that maximizes similarity. Dynamic programming is commonly used to compute optimal alignments.
2) BLAST is an extremely fast database search tool that uses heuristics like word matching to find local alignments and statistical analysis to assess significance.
3) Multiple sequence alignments make conserved features more apparent but are more difficult to compute than pairwise alignments. Progressive alignment gradually merges pairwise alignments based on a phylogenetic tree.
The document provides an introduction to BLAST (Basic Local Alignment Search Tool), which is an algorithm used to compare gene and protein sequences to those in public databases. It discusses the types of BLAST programs, the BLAST algorithm, input/output, how to perform a BLAST search, and the functions and objectives of BLAST. Specifically, BLAST is faster than previous sequence comparison methods, it outputs alignments and statistical values to evaluate matches, and its main objectives are to identify related sequences and locate domains through local alignments.
FASTA is a sequence alignment tool that was developed before BLAST. It uses a hashing strategy to find matches between k-tuples, or short stretches of identical residues, in query and target sequences. FASTA breaks sequences down into k-tuples and searches target databases to find similarities. While faster than dynamic programming, FASTA and BLAST may not find optimal alignments or true homologs.
The document discusses sequence alignment and database searching techniques. It provides code examples and explanations for the Needleman-Wunsch algorithm, dynamic programming, FASTA, and BLAST. For BLAST, it explains the key steps of breaking sequences into words, searching the database for word matches, and extending matches to find high-scoring pairs and hits between query and database sequences. Parameters like word threshold, word size, extension cutoff, and E-value are also discussed for customizing BLAST searches.
Genome and exome sequencing can be used to identify genetic variants that cause rare diseases. Whole genome sequencing requires 30-50X coverage to sequence the entire genome, while exome sequencing only sequences the 1-2% of the genome that is the exome, or protein-coding regions. Read mapping is used to align sequencing reads to the reference genome and is computationally intensive. Variant detection methods like spaced seeds and Burrows-Wheeler transforms are used to identify SNPs and indels, while structural variation can be detected using tools like BreakDancer that analyze read pairs and soft-clipped reads.
BLAST is a tool that compares a query DNA or protein sequence against sequence databases to find regions of similarity. It uses a heuristic algorithm that scans databases quickly to find matching sequences. BLAST helps scientists infer functional and evolutionary relationships between sequences and identify members of gene families. It was developed as an improvement over previous alignment tools as it is faster and can process the large volumes of sequence data that were accumulating. There are several variants of BLAST that can search nucleotide or protein databases using different query types.
FASTA is a bioinformatic tool for fast sequence searching that allows for comparison of a query sequence against a database to find similar sequences. It uses heuristic methods like focusing on diagonal areas of alignment matrices to achieve high sensitivity searches at high speed. The FASTA algorithm works by first finding regions of identity, rescoring matches using substitution matrices, joining matching segments while eliminating low scoring segments, and constructing an optimal alignment using dynamic programming.
Objectives are an understanding of:
▶ Homology search tools
▶ E-values
▶ how BLAST works
▶ how profile HMMs (hmmer) work
▶ which is the right tool for different questions
This document discusses various methods for aligning and comparing biological sequences like DNA and proteins, including local vs global alignment, exact vs heuristic algorithms, and tools like BLAST, PSI-BLAST, and statistical tests for assessing the significance of sequence similarities. Local alignment finds short similar regions, while global alignment considers the full sequence length. Exact methods are rigorous but slow, while heuristics sacrifice completeness for speed. BLAST uses ungapped segment pairs to identify regions for gapped extension and alignment. PSI-BLAST iteratively reweights sequences based on multiple alignments to identify more distant homologs. Statistical tests compare observed sequence similarities to random expectations to assess biological significance.
This document discusses biological database searching. It begins by defining biological databases as organized collections of persistent biological data that can be queried and retrieved. Examples are provided such as GenBank and SwissProt. Database searching involves using a query sequence to find related sequences in the database based on homology. Parameters like E-values and bit scores are used to define the significance of matches. Popular search algorithms like BLAST and FASTA first use heuristics to find high-scoring regions before applying dynamic programming for alignment.
The document describes the BLAST algorithm for comparing biological sequences. BLAST stands for Basic Local Alignment Search Tool. It allows for fast comparison of a query sequence against large databases. BLAST uses heuristics to find locally similar regions between sequences and scores alignments based on identities without considering gaps. This rapid approximation allows BLAST to be applied to search large databases on common computers, providing a significant improvement over previous algorithms. The document outlines the methods used in BLAST, including compiling high-scoring words from the query, scanning the database for hits, and extending hits to determine significant alignments. It also discusses evaluating the statistical significance of results and how parameters like word length and score thresholds can impact BLAST's speed and accuracy.
This document provides information about different types of BLAST programs including BLASTN and TBLASTN. It discusses how BLASTN performs nucleotide sequence comparisons and TBLASTN translates nucleotide databases to protein sequences. The document also provides examples of running BLASTN and TBLASTN searches and analyzing the results, with screenshots of the outputs.
The document outlines topics that will be covered in a bioinformatics course, including biological databases, sequence alignments, database searching, phylogenetics, protein structure, gene prediction, gene ontologies, hidden Markov models, and non-coding RNA. It then provides more details on topics like using sequence similarity to gather information from unknown protein sequences, finding conserved patterns in alignments using profiles and hidden Markov models, and challenges around gene prediction from raw genomic sequences.
This presentation introduces BLAST (Basic Local Alignment Search Tool) which is used to compare gene and protein sequences against databases. It discusses the types of BLAST programs including blastn, blastp, and PSI-BLAST. The BLAST algorithm works by removing repeats, making a word list from the query, searching the database for matches, and extending matches. BLAST output includes alignments and statistical values. Key functions of BLAST are locating domains, establishing phylogeny, DNA mapping, and comparison. The objectives are to enable comparison of a query to database sequences and identify related matches above a threshold.
David Russo worked in the Wang Lab during summer 2010 where he improved an existing program called Patser that identifies conserved regions in DNA that could serve as transcription factor binding sites. He analyzed potential binding sites for transcription factors in the IL22 gene by running sequences through Patser with and without integrating conservation scores. The results identified several transcription factors where Patser, Patser/PhastCons, and Patser/PhyloP identified binding sites in the same regions.
CHINA’S GEO-ECONOMIC OUTREACH IN CENTRAL ASIAN COUNTRIES AND FUTURE PROSPECTjpsjournal1
The rivalry between prominent international actors for dominance over Central Asia's hydrocarbon
reserves and the ancient silk trade route, along with China's diplomatic endeavours in the area, has been
referred to as the "New Great Game." This research centres on the power struggle, considering
geopolitical, geostrategic, and geoeconomic variables. Topics including trade, political hegemony, oil
politics, and conventional and nontraditional security are all explored and explained by the researcher.
Using Mackinder's Heartland, Spykman Rimland, and Hegemonic Stability theories, examines China's role
in Central Asia. This study adheres to the empirical epistemological method and has taken care of
objectivity. This study analyze primary and secondary research documents critically to elaborate role of
china’s geo economic outreach in central Asian countries and its future prospect. China is thriving in trade,
pipeline politics, and winning states, according to this study, thanks to important instruments like the
Shanghai Cooperation Organisation and the Belt and Road Economic Initiative. According to this study,
China is seeing significant success in commerce, pipeline politics, and gaining influence on other
governments. This success may be attributed to the effective utilisation of key tools such as the Shanghai
Cooperation Organisation and the Belt and Road Economic Initiative.
Embedded machine learning-based road conditions and driving behavior monitoringIJECEIAES
Car accident rates have increased in recent years, resulting in losses in human lives, properties, and other financial costs. An embedded machine learning-based system is developed to address this critical issue. The system can monitor road conditions, detect driving patterns, and identify aggressive driving behaviors. The system is based on neural networks trained on a comprehensive dataset of driving events, driving styles, and road conditions. The system effectively detects potential risks and helps mitigate the frequency and impact of accidents. The primary goal is to ensure the safety of drivers and vehicles. Collecting data involved gathering information on three key road events: normal street and normal drive, speed bumps, circular yellow speed bumps, and three aggressive driving actions: sudden start, sudden stop, and sudden entry. The gathered data is processed and analyzed using a machine learning system designed for limited power and memory devices. The developed system resulted in 91.9% accuracy, 93.6% precision, and 92% recall. The achieved inference time on an Arduino Nano 33 BLE Sense with a 32-bit CPU running at 64 MHz is 34 ms and requires 2.6 kB peak RAM and 139.9 kB program flash memory, making it suitable for resource-constrained embedded systems.
Literature Review Basics and Understanding Reference Management.pptxDr Ramhari Poudyal
Three-day training on academic research focuses on analytical tools at United Technical College, supported by the University Grant Commission, Nepal. 24-26 May 2024
Advanced control scheme of doubly fed induction generator for wind turbine us...IJECEIAES
This paper describes a speed control device for generating electrical energy on an electricity network based on the doubly fed induction generator (DFIG) used for wind power conversion systems. At first, a double-fed induction generator model was constructed. A control law is formulated to govern the flow of energy between the stator of a DFIG and the energy network using three types of controllers: proportional integral (PI), sliding mode controller (SMC) and second order sliding mode controller (SOSMC). Their different results in terms of power reference tracking, reaction to unexpected speed fluctuations, sensitivity to perturbations, and resilience against machine parameter alterations are compared. MATLAB/Simulink was used to conduct the simulations for the preceding study. Multiple simulations have shown very satisfying results, and the investigations demonstrate the efficacy and power-enhancing capabilities of the suggested control system.
Harnessing WebAssembly for Real-time Stateless Streaming PipelinesChristina Lin
Traditionally, dealing with real-time data pipelines has involved significant overhead, even for straightforward tasks like data transformation or masking. However, in this talk, we’ll venture into the dynamic realm of WebAssembly (WASM) and discover how it can revolutionize the creation of stateless streaming pipelines within a Kafka (Redpanda) broker. These pipelines are adept at managing low-latency, high-data-volume scenarios.
DEEP LEARNING FOR SMART GRID INTRUSION DETECTION: A HYBRID CNN-LSTM-BASED MODELgerogepatton
As digital technology becomes more deeply embedded in power systems, protecting the communication
networks of Smart Grids (SG) has emerged as a critical concern. Distributed Network Protocol 3 (DNP3)
represents a multi-tiered application layer protocol extensively utilized in Supervisory Control and Data
Acquisition (SCADA)-based smart grids to facilitate real-time data gathering and control functionalities.
Robust Intrusion Detection Systems (IDS) are necessary for early threat detection and mitigation because
of the interconnection of these networks, which makes them vulnerable to a variety of cyberattacks. To
solve this issue, this paper develops a hybrid Deep Learning (DL) model specifically designed for intrusion
detection in smart grids. The proposed approach is a combination of the Convolutional Neural Network
(CNN) and the Long-Short-Term Memory algorithms (LSTM). We employed a recent intrusion detection
dataset (DNP3), which focuses on unauthorized commands and Denial of Service (DoS) cyberattacks, to
train and test our model. The results of our experiments show that our CNN-LSTM method is much better
at finding smart grid intrusions than other deep learning algorithms used for classification. In addition,
our proposed approach improves accuracy, precision, recall, and F1 score, achieving a high detection
accuracy rate of 99.50%.
DEEP LEARNING FOR SMART GRID INTRUSION DETECTION: A HYBRID CNN-LSTM-BASED MODEL
_BLAST.ppt
1. Biology 224
Tom Peavy
Sept 21 & 23, 2009
Slides derived from Bioinformatics and Functional Genomics
by Jonathan Pevsner>
BLAST:
Basic local alignment
search tool
2. BLAST
BLAST (Basic Local Alignment Search Tool)
allows rapid sequence comparison of a query
sequence against a database.
The BLAST algorithm is fast, accurate,
and web-accessible.
Based on heuristic searching (word or k-tuple methods
instead of dynamic programming such as global or
local methods)
3. Why use BLAST?
BLAST searching is fundamental to understanding
the relatedness of any favorite query sequence
to other known proteins or DNA sequences.
Applications include
• identifying orthologs and paralogs
• discovering new genes or proteins
• discovering variants of genes or proteins
• investigating expressed sequence tags (ESTs)
• exploring protein structure and function
4. Four components to a BLAST search
(1) Choose the sequence (query)
(2) Select the BLAST program
(3) Choose the database to search
(4) Choose optional parameters
Then click “BLAST”
7. Choose the BLAST program
Program Input Database
1
blastn DNA DNA
1
blastp protein protein
6
blastx DNA protein
6
tblastn protein DNA
36
tblastx DNA DNA
8. DNA potentially encodes six proteins
5’ CAT CAA
5’ ATC AAC
5’ TCA ACT
5’ GTG GGT
5’ TGG GTA
5’ GGG TAG
5’ CATCAACTACAACTCCAAAGACACCCTTACACATCAACAAACCTACCCAC 3’
3’ GTAGTTGATGTTGAGGTTTCTGTGGGAATGTGTAGTTGTTTGGATGGGTG 5’
9. Step 3: choose the database
nr = non-redundant (most general database)
dbest = database of expressed sequence tags
dbsts = database of sequence tag sites
gss = genomic survey sequences
htgs = high throughput genomic sequence
page 92-93
12. BLAST: optional parameters
You can...
• choose the organism to search
• turn filtering on/off
• change the substitution matrix
• change the expect (e) value
• change the word size
• change the output (max # sequences)
15. Fig. 4.8
page 96
More significant
hits with filtering
turned off…
…and longer
alignments
16. (a) Query: human insulin NP_000198
Program: blastp
Database: C. elegans RefSeq
Default settings:
Unfiltered (“composition-based statistics”)
Our starting point: search human insulin against worm
RefSeq proteins by blastp using default parameters
17. (b) Query: human insulin NP_000198
Program: blastp
Database: C. elegans RefSeq
Option: No compositional adjustment
Note that the bit score, Expect value, and percent identity
all change with the “no compositional adjustment” option
18. (c) Query: human insulin NP_000198
Program: blastp
Database: C. elegans RefSeq
Option: conditional compositional score matrix adjustment
Note that the bit score, Expect value, and percent identity
all change with the compositional score matrix adjustment
19. (d) Query: human insulin NP_000198
Program: blastp
Database: C. elegans RefSeq
Option: Filter low complexity regions
Note that the bit score, Expect value, and percent identity
all change with the filter option
20. (e) Query: human insulin NP_000198
Program: blastp
Database: C. elegans RefSeq
Option: Mask for lookup table only
Note that the bit score, Expect value, and percent identity
could change with the “mask for lookup table only” option
30. expect value E = number of different alignments
with scores equal to or greater than some score S
that are expected to occur in a database search
by chance.
E value of 1 indicates that in a database of this size,
one match with a similar score is expected to
occur by chance.
31. How a BLAST search works
“The central idea of the BLAST
algorithm is to confine attention
to segment pairs that contain a
word pair of length w with a score
of at least T.”
Altschul et al. (1990)
(Note: FASTA uses k-tuple instead of the BLAST term w)
32. How the original BLAST algorithm works:
three phases
Phase 1: compile a list of word pairs (w=3)
above threshold T
Example: for a human RBP query
…FSGTWYA… (query word is in red)
A list of words (w=3) is:
FSG SGT GTW TWY WYA
YSG TGT ATW SWY WFA
FTG SVT GSW TWF WYS
33. Pairwise alignment scores
are determined using a
scoring matrix such as
Blosum62
A 4
R -1 5
N -2 0 6
D -2 -2 1 6
C 0 -3 -3 -3 9
Q -1 1 0 0 -3 5
E -1 0 0 2 -4 2 5
G 0 -2 0 -1 -3 -2 -2 6
H -2 0 1 -1 -3 0 0 -2 8
I -1 -3 -3 -3 -1 -3 -3 -4 -3 4
L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4
K -1 2 0 -1 -1 1 1 -2 -1 -3 -2 5
M -1 -2 -2 -3 -1 0 -2 -3 -2 1 2 -1 5
F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 6
P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7
S 1 -1 1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 4
T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1 1 5
W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4 -3 -2 11
Y -2 -2 -2 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2 7
V 0 -3 -3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3 -1 4
A R N D C Q E G H I L K M F P S T W Y V
34. Phase 1: compile a list of words (w=3)
GTW 6,5,11 22
neighborhood ASW 6,1,11 18
word hits ATW 0,5,11 16
> threshold NTW 0,5,11 16
GTY 6,5,2 13
GNW 10
neighborhood GAW 9
word hits
< below threshold
(T=11)
35. How a BLAST search works: 3 phases
Phase 2:
Scan the database for entries that match the compiled list.
This is fast and relatively easy.
36. How a BLAST search works: 3 phases
Phase 3: when you manage to find a hit
(i.e. a match between a “word” and a database
entry), extend the hit in either direction.
Keep track of the score (use a scoring matrix)
Stop when the score drops below some cutoff.
KENFDKARFSGTWYAMAKKDPEG 50 RBP (query)
MKGLDIQKVAGTWYSLAMAASD. 44 lactoglobulin (hit)
Hit!
extend
extend
37. How a BLAST search works: 3 phases
Phase 3:
In the original (1990) implementation of BLAST,
hits were extended in either direction.
In a 1997 refinement of BLAST, two independent
hits are required. The hits must occur in close
proximity to each other. With this modification,
only one seventh as many extensions occur,
greatly speeding the time required for a search.
38. How a BLAST search works: threshold
You can modify the threshold parameter.
The default value for blastp is 11.
To change it, enter “-f 16” or “-f 5” in the
advanced options.
42. For blastn, the word size is typically 7, 11, or 15 (EXACT match).
Changing word size is like changing threshold of proteins.
w=15 gives fewer matches and is faster than w=11 or w=7.
For megablast, the word size is 28 and can be adjusted to 64.
What will this do? Megablast is VERY fast for finding closely
related DNA sequences!
43. How to interpret a BLAST search: expect value
It is important to assess the statistical significance
of search results.
For global alignments, the statistics are poorly understood.
For local alignments (including BLAST search results),
the statistics are well understood. The scores follow
an extreme value distribution (EVD) rather than a
normal distribution.
46. The expect value E is the number of alignments
with scores greater than or equal to score S
that are expected to occur by chance in a
database search.
An E value is related to a probability value p.
The key equation describing an E value is:
E = Kmn e-lS
How to interpret a BLAST search: expect value
47. This equation is derived from a description
of the extreme value distribution
S = the score
E = the expect value = the number
of HSPs expected to occur with
a score of at least S
m, n = the length of two sequences
l, K = Karlin Altschul statistics
E = Kmn e-lS
48. Some properties of the equation E = Kmn e-lS
• The value of E decreases exponentially with increasing S
(higher S values correspond to better alignments). Very
high scores correspond to very low E values.
•The E value for aligning a pair of random sequences must
be negative! Otherwise, long random alignments would
acquire great scores
• Parameter K describes the search space (database).
• For E=1, one match with a similar score is expected to
occur by chance. For a very much larger or smaller
database, you would expect E to vary accordingly
49. From raw scores to bit scores
• There are two kinds of scores:
raw scores (calculated from a substitution matrix) and
bit scores (normalized scores)
• Bit scores are comparable between different searches
because they are normalized to account for the use
of different scoring matrices and different database sizes
S’ = bit score = (lS - lnK) / ln2
The E value corresponding to a given bit score is:
E = mn 2 -S’
Bit scores allow you to compare results between different
database searches, even using different scoring matrices.
50. The expect value E is the “number of alignments
with scores greater than or equal to score S
that are expected to occur by chance in a
database search.”
A p value is the “probability of a chance alignment
occuring with the score in question or better.”
p = 1 - e-E
How to interpret BLAST: E values and p values
51. Very small E values are very similar to p values.
E values of about 1 to 10 are far easier to interpret
than corresponding p values.
E p
10 0.99995460
5 0.99326205
2 0.86466472
1 0.63212056
0.1 0.09516258 (about 0.1)
0.05 0.04877058 (about 0.05)
0.001 0.00099950 (about 0.001)
0.0001 0.0001000
How to interpret BLAST: E values and p values
52. threshold score = 11
parameters
BLOSUM matrix
Effective search space
= mn
= length of query x db length
10.0 is the E value
gap penalties
53. Search space= represents all sites at which query can
align to database sequences
However need to calculate Effective Search Space
since the ends of a sequence are less likely to align
in an average-sized alginment
Effective search space= (m-L)(n-L)
Where L = length of an average sized alignment
(Altschul and Gish, 1996)
57. Sometimes a real match has an E value > 1
…try a reciprocal BLAST to confirm
58. Sometimes a similar E value occurs for a
short exact match and long less exact match
59. Assessing whether proteins are homologous
RBP4 and PAEP:
Low bit score, E value 0.49, 24% identity (“twilight zone”).
But they are indeed homologous. Try a BLAST search
with PAEP as a query, and you will find many other lipocalins.