Abideen Adeyinka Adekanmi, Adeniyi Sheriffdeen Adekanmi and Uthman Taiwo Adekanmi “Biotreatment of Slaughterhouse Waste Water by Microalgae” United International Journal for Research & Technology (UIJRT), Volume 01, Issue 09, pp. 19-30, 2020. https://uijrt.com/articles/v1i9/UIJRTV1I90003.pdf
ER Publication,
IJETR, IJMCTR,
Journals,
International Journals,
High Impact Journals,
Monthly Journal,
Good quality Journals,
Research,
Research Papers,
Research Article,
Free Journals, Open access Journals,
erpublication.org,
Engineering Journal,
Science Journals,
ABSTRACT- Wastewater treatment is a problem of grave concern in most developing countries. In the last two decades, there has been a lot of research to develop appropriate technologies to alleviate pollution in water resources. Efficient wastewater treatments through conventional methods are expensive and difficult to get optimum results. Currently, phytoremediation is an effective and affordable solution used to remediate toxic pollutants from aquatic ecosystems. The review describes various aquatic plants, which have high potential to remove heavy metals from wastewater. Key-words- Water pollution, Heavy metals, Phytoremediation, Aquatic plants, Wastewater treatment
ER Publication,
IJETR, IJMCTR,
Journals,
International Journals,
High Impact Journals,
Monthly Journal,
Good quality Journals,
Research,
Research Papers,
Research Article,
Free Journals, Open access Journals,
erpublication.org,
Engineering Journal,
Science Journals,
ABSTRACT- Wastewater treatment is a problem of grave concern in most developing countries. In the last two decades, there has been a lot of research to develop appropriate technologies to alleviate pollution in water resources. Efficient wastewater treatments through conventional methods are expensive and difficult to get optimum results. Currently, phytoremediation is an effective and affordable solution used to remediate toxic pollutants from aquatic ecosystems. The review describes various aquatic plants, which have high potential to remove heavy metals from wastewater. Key-words- Water pollution, Heavy metals, Phytoremediation, Aquatic plants, Wastewater treatment
Biosystem treatment approach for seaweed processing wastewater Premier Publishers
Wastewater obtained from the seaweed washing process often contains residual chemicals, as the seaweed is typically washed using chemicals. Here, we used a biosystem to treat wastewater obtained after seaweed processing. The research goals were to determine the effectivity and capacity of this biosystem for reducing chemical oxygen demand (COD), biological oxygen demand (BOD), and nitrites in the wastewater. We planted and prepared the biosystem bin, adapted the plants in the biosystem bin until they were ready for use, and we performed wastewater treatment using the biosystem either with or without the addition of an active bacterial suspension. The results show that addition of the active suspension significantly improved effectivity with respect to COD and nitrites (p<0.05). With respect to COD, BOD, and nitrites, the effectivity of the biosystem with an added active suspension was 83.9, 87.2, and 55.5%, respectively; the effectivity of the biosystem without the active suspension was 79.2, 83.3, and 38.7%, respectively. The capacity of the biosystem with an added active suspension was 13.226, 6.805, and 0.014mg/L/m3hour with respect to reducing COD, BOD, and nitrites, respectively; the capacity of the biosystem without an active suspension was 12.485, 6.496, and 0.009 mg/L/m3hour, respectively.
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
The papers for publication in The International Journal of Engineering& Science are selected through rigorous peer reviews to ensure originality, timeliness, relevance, and readability.
Proximate and heavy metals composition of Plantain (Musa paradisiaca L.) frui...IJEAB
Plantain thrives well in waste dumpsites. These wastes usually contaminate the soil with heavy metals which become absorbed by the plants. The risk of heavy metal toxicity in humans is an issue of serious concern globally. Proximate composition of plantain fruits harvested from three randomly selected waste dumpsites in Uyo metropolis, Nigeria were determined using AOAC standard analytical techniques while their heavy metals (Pb, Cr, Ni, Cu, Co, Cd and As) concentrations and that of their rhizosphere soil were analysed with Unicam Atomic Absorption Spectrophotometer. Proximate analyses results revealed that carbohydrate content was higher in the fruits harvested from the control uncontaminated soil sites (91.61%) than in the fruits harvested from dumpsite soils (87.23%; 87.89%; 88.00%). Dumpsite soils had higher heavy metals concentrations than the control soil. Lead (Pb) was the highest occurring heavy metal in all the dumpsite soils. Fruits harvested from the dumpsite soils had higher heavy metals concentrations than those from the control soil. Pb was the only heavy metal whose concentration in the plantain fruits was higher than the WHO/FAO permissible limit. This work has established that the selected dumpsite soils have been contaminated with heavy metals which have been absorbed by the plantain cultivated there. Cultivation and consumption of plantain from these dumpsite soils should be discouraged.
Use of Microalgae for Phycoremdiation & biodiseal productioniqraakbar8
Several wastewater treatment methods are available.
But, they are not feasible for certain nutrients removal.
Considering these issues, microalgae is best alternate approach.
Photosynthetic , and accumulative capabilities of microalgae are making it especially attractive.
Fungi could offer this benefit in comparison with bacteria in wastewater treatment processes. The biomass produced during fungal wastewater treatment has, potentially, a much higher value than that from the bacterial activated sludge process. The fungi can be availed to derive valuable biochemical and can also be availed as a protein source
International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computational mathematics, Image processing, Civil Engineering, Structural Engineering, Environmental Engineering, VLSI Testing & Low Power VLSI Design etc.
IJRET : International Journal of Research in Engineering and Technology is an international peer reviewed, online journal published by eSAT Publishing House for the enhancement of research in various disciplines of Engineering and Technology. The aim and scope of the journal is to provide an academic medium and an important reference for the advancement and dissemination of research results that support high-level learning, teaching and research in the fields of Engineering and Technology. We bring together Scientists, Academician, Field Engineers, Scholars and Students of related fields of Engineering and Technology
Biosystem treatment approach for seaweed processing wastewater Premier Publishers
Wastewater obtained from the seaweed washing process often contains residual chemicals, as the seaweed is typically washed using chemicals. Here, we used a biosystem to treat wastewater obtained after seaweed processing. The research goals were to determine the effectivity and capacity of this biosystem for reducing chemical oxygen demand (COD), biological oxygen demand (BOD), and nitrites in the wastewater. We planted and prepared the biosystem bin, adapted the plants in the biosystem bin until they were ready for use, and we performed wastewater treatment using the biosystem either with or without the addition of an active bacterial suspension. The results show that addition of the active suspension significantly improved effectivity with respect to COD and nitrites (p<0.05). With respect to COD, BOD, and nitrites, the effectivity of the biosystem with an added active suspension was 83.9, 87.2, and 55.5%, respectively; the effectivity of the biosystem without the active suspension was 79.2, 83.3, and 38.7%, respectively. The capacity of the biosystem with an added active suspension was 13.226, 6.805, and 0.014mg/L/m3hour with respect to reducing COD, BOD, and nitrites, respectively; the capacity of the biosystem without an active suspension was 12.485, 6.496, and 0.009 mg/L/m3hour, respectively.
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
The papers for publication in The International Journal of Engineering& Science are selected through rigorous peer reviews to ensure originality, timeliness, relevance, and readability.
Proximate and heavy metals composition of Plantain (Musa paradisiaca L.) frui...IJEAB
Plantain thrives well in waste dumpsites. These wastes usually contaminate the soil with heavy metals which become absorbed by the plants. The risk of heavy metal toxicity in humans is an issue of serious concern globally. Proximate composition of plantain fruits harvested from three randomly selected waste dumpsites in Uyo metropolis, Nigeria were determined using AOAC standard analytical techniques while their heavy metals (Pb, Cr, Ni, Cu, Co, Cd and As) concentrations and that of their rhizosphere soil were analysed with Unicam Atomic Absorption Spectrophotometer. Proximate analyses results revealed that carbohydrate content was higher in the fruits harvested from the control uncontaminated soil sites (91.61%) than in the fruits harvested from dumpsite soils (87.23%; 87.89%; 88.00%). Dumpsite soils had higher heavy metals concentrations than the control soil. Lead (Pb) was the highest occurring heavy metal in all the dumpsite soils. Fruits harvested from the dumpsite soils had higher heavy metals concentrations than those from the control soil. Pb was the only heavy metal whose concentration in the plantain fruits was higher than the WHO/FAO permissible limit. This work has established that the selected dumpsite soils have been contaminated with heavy metals which have been absorbed by the plantain cultivated there. Cultivation and consumption of plantain from these dumpsite soils should be discouraged.
Use of Microalgae for Phycoremdiation & biodiseal productioniqraakbar8
Several wastewater treatment methods are available.
But, they are not feasible for certain nutrients removal.
Considering these issues, microalgae is best alternate approach.
Photosynthetic , and accumulative capabilities of microalgae are making it especially attractive.
Fungi could offer this benefit in comparison with bacteria in wastewater treatment processes. The biomass produced during fungal wastewater treatment has, potentially, a much higher value than that from the bacterial activated sludge process. The fungi can be availed to derive valuable biochemical and can also be availed as a protein source
International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computational mathematics, Image processing, Civil Engineering, Structural Engineering, Environmental Engineering, VLSI Testing & Low Power VLSI Design etc.
IJRET : International Journal of Research in Engineering and Technology is an international peer reviewed, online journal published by eSAT Publishing House for the enhancement of research in various disciplines of Engineering and Technology. The aim and scope of the journal is to provide an academic medium and an important reference for the advancement and dissemination of research results that support high-level learning, teaching and research in the fields of Engineering and Technology. We bring together Scientists, Academician, Field Engineers, Scholars and Students of related fields of Engineering and Technology
Dissertation ppt biostimulation- a potential practice for wastewater treaat...Sumer Pankaj
Phycoremediation is a green technology that supports the direct use of living green microalgae for in situ, or in place removal, degradation, of contaminants in soils, sludge, sediments, surface water and ground waters by the mechanisms of bio-transformation, bio-accumulation, bio-concentration, bio-sparging.
It can be said by the current study that microalgae has a great potential for the treatment of industrial and municipal wastewaters as compared to the chemical treatments available commercially. Biological systems are much more efficient in cleaning the excess nutrients from the waste water followed by generation of valuable biomass which can be applied in the food, fertilizer, energy production as use of inorganic chemicals like lime and ferrous sulphate generates huge amount of sludge in textile industries, but on the other hand static anaerobic treatment using acclimatized MLSS gives better colour reduction with zero sludge generation. Microalgal cells can be used in free form to treat waste waters containing high C.O.D., high ammonical nitrogen and high TDS. It not only provides a better reduction of chemicals from wastewaters but it also helps to reduce the operational cost of ETP. Microalgaes not only helps to remediate industrial waste waters but also to treat sweage water and to restore natural water bodies like lakes and ponds. As they are active in remediating the chemicals but also it shows an antagonistic effect against some pathogenic germs like total coliforms and fecal coliforms.
These microalgal cells can also be combined with bacterial biomass of activated sludge process to develop an Algal-Bacterial consortium (ALBA) for better enhancement in the reduction of chemicals from the wastewaters as this symbiotic relation of algae and bacteria provides high satiability of the microalgae along with MLSS and faceable in terms of price and economy for instance the bacterial biomass provides carbon dioxide to algal cells for photosynthesis and in return the bacteria acquires oxygen from algae. The harvested biomass from the ETP’s can be used as bio-fertilizers as it consists of appropriate ratio of vital macro and micro nutrients like N,P,K etc. which enhance the growth of plantlets. It can also be used as aqua feeds for shrimps, fishes and molluscs. Furthermore these microlgal cells are non-toxic in the environment as it becomes a part of food chain and do not cause eutrophication. Therefore, micro-algal based treatment is most suitable for the treating the waste waters and restoring the natural water bodies as compared to other chemical treatments.
Distillery Wastewater: it's Impact on Environment and Remedies_ Crimson Publi...CrimsonpublishersEAES
Distillery Wastewater: it's Impact on Environment and Remedies by Pankaj Chowdhary, Nawaz Khan and Ram Naresh Bharagava* in Environmental Analysis & Ecology Studies
Bioremediation of wastewater by microorganismsadetunjiEwa
The term bioremediation has been introduced to describe the process of using biological
agents to remove toxic waste from environment. Bioremediation is the most effective management tool to manage the polluted water and recover contaminated waste water. It is an attractive and successful cleaning technique for polluted environment; it has been used at a number of sites worldwide, with varying degrees of success.
Bioremediation of wastewater by microorganismsadetunjiEwa
ABSTRACT
The term bioremediation has been introduced to describe the process of using biological
agents to remove toxic waste from environment. Bioremediation is the most effective management tool to manage the polluted water and recover contaminated waste water. It is an attractive and successful cleaning technique for polluted environment; it has been used at a number of sites worldwide, with varying degrees of success.
International waste management strategiesAhmed Ali
The waste hierarchy refers to the "3 Rs" reduce, reuse and recycle, which classify waste management strategies according to their desirability in terms of waste minimisation. The waste hierarchy remains the cornerstone of most waste minimisation strategies.
http://socceronlinetv.com/aff-suzuki-cup-2016-final-live/
http://socceronlinetv.com/aff-suzuki-cup-2016-final-live-streaming/
http://socceronlinetv.com/thailand-vs-indonesia-live-streaming/
https://www.linkedin.com/pulse/aff-suzuki-cup-2016-final-live-streaming-thailand-vs-indonesia-ali
https://twitter.com/i/moments/809777680317026304
International waste management strategiesAhmed Ali
The waste hierarchy refers to the "3 Rs" reduce, reuse and recycle, which classify waste management strategies according to their desirability in terms of waste minimisation. The waste hierarchy remains the cornerstone of most waste minimisation strategies.
http://socceronlinetv.com/thailand-vs-indonesia-live-streaming/
http://socceronlinetv.com/aff-suzuki-cup-2016-final-live-streaming/
http://socceronlinetv.com/aff-suzuki-cup-2016-final-live/
International Journal of Engineering and Science Invention (IJESI) inventionjournals
International Journal of Engineering and Science Invention (IJESI) is an international journal intended for professionals and researchers in all fields of computer science and electronics. IJESI publishes research articles and reviews within the whole field Engineering Science and Technology, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online
International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computational mathematics, Image processing, Civil Engineering, Structural Engineering, Environmental Engineering, VLSI Testing & Low Power VLSI Design etc.
T. Srilatha, 2021. Detection of Hazardous Gases Using the Sensors and Passing Alerts to the Neighbourhood Though Mobile Cloud. United International Journal for Research & Technology (UIJRT), 3(1), pp.19-23.
Kurniasari, F. and Riyadi, W.T., 2021. Determinants of Indonesian E-Grocery Shopping Behavior After Covid-19 Pandemic Using the Technology Acceptance Model Approach. United International Journal for Research & Technology (UIJRT), 3(1), pp.12-18.
Olorunnisola, A.O., Richards, A. and Omoniyi, T.E., 2021. A Review on the Renewable Energy from Agricultural and Forest Residues in Nigeria. United International Journal for Research & Technology (UIJRT), 3(1), pp.04-11.
Idowu Olusegun Oladele “Emerging Trends in Private Security Companies (PSCs) and Security Services in Southwest Nigeria” United International Journal for Research & Technology (UIJRT), Volume 01, Issue 09, pp. 04-18, 2020. https://uijrt.com/articles/v1i9/UIJRTV1I90002.pdf
Dr. S. Saravana Kumar “A Systematic Review on the Educational Data Mining and its Implementation in the Applications ” United International Journal for Research & Technology (UIJRT), Volume 01, Issue 09, pp. 01-03, 2020. https://uijrt.com/articles/v1i9/UIJRTV1I90001.pdf
Larry Lanzema Dangana and Halil Zafer Alibaba,“Effects of Thermal Insulation Deficits in Famagusta Buildings” United International Journal for Research & Technology (UIJRT), Volume 01, Issue 07, pp. 05-13, 2020. https://uijrt.com/articles/v1i7/UIJRTV1I70001.pdf
Larry Lanzema Dangana “Feasibility Analysis of Applying Thermal Insulation Composite Wall in Residential Buildings” United International Journal for Research & Technology (UIJRT), Volume 01, Issue 07, pp. 01-04, 2020. https://uijrt.com/articles/v1i7/UIJRTV1I70001.pdf
Salimat Yewande Bakare and Halil Zafer Alibaba,“The Construct of Comfort: A Case Study of Environmental Comfort of University Classrooms” United International Journal for Research & Technology (UIJRT), Volume 01, Issue 06, pp. 19-23, 2020. https://uijrt.com/articles/v1i6/UIJRTV1I60003.pdf
Mulugeta Bantigegn, Achenef Motbainor and Teferi Mekonnon,“Onsite Proper Solid Waste Handling Practices and Associated Factors Among Condominium Residents in Debre-Markos Town, East Gojjam Zone, North West Ethiopia: A Community Based Cross-Sectional Study” United International Journal for Research & Technology (UIJRT), Volume 01, Issue 06, pp. 01-11, 2020. https://uijrt.com/articles/v1i6/UIJRTV1I60001.pdf
The Effects of Flooring Material on Thermal Comfort in a Comparative Study Marble and Parquet Flooring
https://uijrt.com/articles/v1i5/UIJRTV1I50004.pdf
Structuring Alternative Investment in Public Private Partnership Projects Using Islamic Financial Instruments
https://uijrt.com/articles/v1i5/UIJRTV1I50002.pdf
In this paper we discuss NEMO-BSP protocol and TOR architecture. NEMO protocol was initially not designed to handle anonymity of TOR architecture. Due to some of the unique feature of TOR architecture, the use of TOR architecture has been rapidly increased these days. TOR architecture provides anonymity which other network architectures failed to provides. When using a TOR a user feels safe and has no issue of tracking and packet tracing. Therefore whenever a NEMO user uses TOR architecture there are much vulnerability in network. In this paper we outline those security issues in details which arise when a NEMO user uses TOR architecture. We hope in future those issues will be solved and implemented in future so that a user not only remains anonymous while using TOR but also remains secure from various types of vulnerabilities.
Mohd. Altamash Sheikh. “Security Issues of Network Mobility (NEMO) with Tor Architecture” United International Journal for Research & Technology (UIJRT) 1.4 (2019): 25-29.
Cavine Onyango Oguta. “The Mass Culture of the Freshwater Rotifers Brachionus Rubens Ehrenberg 1838 Using Different Algal Species Diets” United International Journal for Research & Technology (UIJRT) 1.4 (2019): 10-24.
Ataullah Muneeb and Matiullah Shinwari. “Customer Relation Management (CRM) and its Impact on Organizational Performance: A Case of Etisalat Telecommunication in Afghanistan” United International Journal for Research & Technology (UIJRT) 1.4 (2019): 01-09
S M Masiul Azam, Md Shahidul Islam, Parvin Shahanaz, Md Shafiqur Rahman and Sarder Md Shahriar Alam. “Molecular Characterization of Brassica Cultivars through RAPD Markers” United International Journal for Research & Technology (UIJRT) 1.3 (2019): 41-45.
Ishfaq Majid. “ICT in Assessment: A Backbone for Teaching and Learning Process” United International Journal for Research & Technology (UIJRT) 1.3 (2019): 38-40.
Health problems associated with the consumption of foods that do not meet the hygiene and epidemiological standards are not of recent date and have been occurring continuously throughout the history of human existence. The incidence of food poisoning and foodborne transmissible diseases is three times more common in-home kitchens and households. Restaurant poisoning generally involves a larger number of people, whereas a home-based one involves individuals or a small number of people, so its likelihood of identification by the competent authority or public health organizations and services are significantly smaller. The development of the household food safety questionnaire (HFSQ) for the general population went through five phases (preparation of the questionnaire, distribution of the questionnaire to panelists and then the respondents, statistical analysis and the formation of the final version of the validated questionnaire). A total of 58 particles that formed the basis of the questionnaire were divided into four segments: demographic (10), knowledge (17), opinion (14) and food safety practice (17). Overall, the validity of the questionnaire in examining practice, knowledge and attitude was determined with Cronbach’s alpha = 0.842. The total number of particles adequate for the questionnaire is 29 questions. This questionnaire is a good instrument for assessing the knowledge, attitudes and practices of food handlers in their households.
Daniel Maestro, Arzija Pašalić, Sabina Šegalo and Amar Žilić. “Development and Validation of the Household Food Safety Questionnaire” United International Journal for Research & Technology (UIJRT) 1.3 (2019): 24-32.
More from United International Journal for Research & Technology (20)
Hybrid optimization of pumped hydro system and solar- Engr. Abdul-Azeez.pdffxintegritypublishin
Advancements in technology unveil a myriad of electrical and electronic breakthroughs geared towards efficiently harnessing limited resources to meet human energy demands. The optimization of hybrid solar PV panels and pumped hydro energy supply systems plays a pivotal role in utilizing natural resources effectively. This initiative not only benefits humanity but also fosters environmental sustainability. The study investigated the design optimization of these hybrid systems, focusing on understanding solar radiation patterns, identifying geographical influences on solar radiation, formulating a mathematical model for system optimization, and determining the optimal configuration of PV panels and pumped hydro storage. Through a comparative analysis approach and eight weeks of data collection, the study addressed key research questions related to solar radiation patterns and optimal system design. The findings highlighted regions with heightened solar radiation levels, showcasing substantial potential for power generation and emphasizing the system's efficiency. Optimizing system design significantly boosted power generation, promoted renewable energy utilization, and enhanced energy storage capacity. The study underscored the benefits of optimizing hybrid solar PV panels and pumped hydro energy supply systems for sustainable energy usage. Optimizing the design of solar PV panels and pumped hydro energy supply systems as examined across diverse climatic conditions in a developing country, not only enhances power generation but also improves the integration of renewable energy sources and boosts energy storage capacities, particularly beneficial for less economically prosperous regions. Additionally, the study provides valuable insights for advancing energy research in economically viable areas. Recommendations included conducting site-specific assessments, utilizing advanced modeling tools, implementing regular maintenance protocols, and enhancing communication among system components.
Immunizing Image Classifiers Against Localized Adversary Attacksgerogepatton
This paper addresses the vulnerability of deep learning models, particularly convolutional neural networks
(CNN)s, to adversarial attacks and presents a proactive training technique designed to counter them. We
introduce a novel volumization algorithm, which transforms 2D images into 3D volumetric representations.
When combined with 3D convolution and deep curriculum learning optimization (CLO), itsignificantly improves
the immunity of models against localized universal attacks by up to 40%. We evaluate our proposed approach
using contemporary CNN architectures and the modified Canadian Institute for Advanced Research (CIFAR-10
and CIFAR-100) and ImageNet Large Scale Visual Recognition Challenge (ILSVRC12) datasets, showcasing
accuracy improvements over previous techniques. The results indicate that the combination of the volumetric
input and curriculum learning holds significant promise for mitigating adversarial attacks without necessitating
adversary training.
Saudi Arabia stands as a titan in the global energy landscape, renowned for its abundant oil and gas resources. It's the largest exporter of petroleum and holds some of the world's most significant reserves. Let's delve into the top 10 oil and gas projects shaping Saudi Arabia's energy future in 2024.
CFD Simulation of By-pass Flow in a HRSG module by R&R Consult.pptxR&R Consult
CFD analysis is incredibly effective at solving mysteries and improving the performance of complex systems!
Here's a great example: At a large natural gas-fired power plant, where they use waste heat to generate steam and energy, they were puzzled that their boiler wasn't producing as much steam as expected.
R&R and Tetra Engineering Group Inc. were asked to solve the issue with reduced steam production.
An inspection had shown that a significant amount of hot flue gas was bypassing the boiler tubes, where the heat was supposed to be transferred.
R&R Consult conducted a CFD analysis, which revealed that 6.3% of the flue gas was bypassing the boiler tubes without transferring heat. The analysis also showed that the flue gas was instead being directed along the sides of the boiler and between the modules that were supposed to capture the heat. This was the cause of the reduced performance.
Based on our results, Tetra Engineering installed covering plates to reduce the bypass flow. This improved the boiler's performance and increased electricity production.
It is always satisfying when we can help solve complex challenges like this. Do your systems also need a check-up or optimization? Give us a call!
Work done in cooperation with James Malloy and David Moelling from Tetra Engineering.
More examples of our work https://www.r-r-consult.dk/en/cases-en/
Event Management System Vb Net Project Report.pdfKamal Acharya
In present era, the scopes of information technology growing with a very fast .We do not see any are untouched from this industry. The scope of information technology has become wider includes: Business and industry. Household Business, Communication, Education, Entertainment, Science, Medicine, Engineering, Distance Learning, Weather Forecasting. Carrier Searching and so on.
My project named “Event Management System” is software that store and maintained all events coordinated in college. It also helpful to print related reports. My project will help to record the events coordinated by faculties with their Name, Event subject, date & details in an efficient & effective ways.
In my system we have to make a system by which a user can record all events coordinated by a particular faculty. In our proposed system some more featured are added which differs it from the existing system such as security.
TECHNICAL TRAINING MANUAL GENERAL FAMILIARIZATION COURSEDuvanRamosGarzon1
AIRCRAFT GENERAL
The Single Aisle is the most advanced family aircraft in service today, with fly-by-wire flight controls.
The A318, A319, A320 and A321 are twin-engine subsonic medium range aircraft.
The family offers a choice of engines
Water scarcity is the lack of fresh water resources to meet the standard water demand. There are two type of water scarcity. One is physical. The other is economic water scarcity.
Biotreatment of Slaughterhouse Waste Water by Microalgae
1. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 19
Biotreatment of Slaughterhouse Waste Water by
Microalgae
Abideen Adeyinka Adekanmi1, Adeniyi Sheriffdeen Adekanmi2 and Uthman Taiwo Adekanmi3
1
Raw Materials Research and Development Council (RMRDC), Nigeria
2
Lautech Teaching Hospital, Osogbo, Nigeria
3
Federal Teaching Hospital, Ido-ekiti, Nigeria
1
yinklab1234@gmail.com, 2
adekaniyi01@yahoo.com, 3
adekanmiuthman@gamil.com
Abstract— Slaughterhouse wastewaters are
characterized by a high organic content, mainly
composed of proteins and fats. Therefore, these
wastewaters should be treated efficiently prior to
discharge into receiving bodies to avoid severe
environmental pollution. The use of natural remediation
methods to remove contaminants from waste water is
becoming more popular. One of the aims of waste water
treatment is to reduce nutrient such as nitrate and
phosphate level in effluent to a protective level of the
receiving water body. This work aimed to characterize
poultry slaughterhouse wastewater generated in Mobi
area, in Ede South local government and assessing
wastewater treatment plants performance by Chlorella
vulgaris ChA and feasibility of wastewater reuse.
Freshly discharge poultry slaughterhouse waste water
sample (PSHWWS) was collected from Mobi area in
Ede and analyzed for the physicochemical parameters
such as pH, Total Dissolved Solid (TDS), Temperature,
dissolved oxygen, total Alkalinity, Biological Oxygen
Demand (BOD), Chemical Oxygen Demand (COD),
ammonia, phosphate and Nitrate by standard methods.
190ml of the sterilized PSHWWS was inoculated with
10ml of C. vulgaris. The inoculated sample was
incubated under 2ft cold fluorescence light for two
weeks and determines the physicochemical parameters
at 7 days interval. The results observed for raw, bio
treated and removal efficiency showed: pH (7.04 and
8.45), TDS (521.45 and 121.80mg/l with 76.64%),
Temperature (30.27 and 27.47oC), Dissolved
oxygen(4.85 and 0.95 mg/l with 80.41%), Total
Alkalinity (143.08 and 55.84 mg/l with 60.97%),
BOD(1480.05 and 486.81mg/l with 67.11%),
COD(1778.24 and 56.84mg/l with 96.80%), ammonia
(78.30 and 33.09 mg/l with 57.74%, phosphate (16.54
and 7.83 with 56.66% and nitrate (454 and 9.29 mg/l
with 97.95%). Chlorella vulgaris showed a potential
removal of pollutant and other wastes from the
slaughterhouse waste water.
Keywords — Poultry, slaughterhouse, waste water, bio
treatment, Chlorella. vulgaris ChA
I.INTRODUCTION
Discharge of waste water from poultry slaughterhouse is
one of the sources of environmental pollution. The
composition of poultry wastes water is not
environmental friendly rather they are hazardous to
immediate environment and aquatic environment. The
adverse effects of this wastes water are not to animals
and living aquatic alone but have affected human life
through consumption of water contaminated with this
wastes as well as spread of diseases. Most practices in
our slaughterhouses do not give room for treatment of
wastes before they are released to the environment. Few
slaughterhouses that prioritize the treatment of poultry
slaughterhouses before discharge to immediate
environment are either involves in partial treatment or
indirectly aggravating the resultant problems links to
waste water as a result of chemical used in treatment
(Akpors and Muchie, 2011).
Poultry slaughterhouse wastewater (PSW) pre-treatment
is germane before sequential biological treatment and
the release of such treated wastewater into freshwater
bodies. If not pre-treated, the PSW may contribute to the
pollution of the environment, and therefore the
contamination of fresh water sources, which can
culminate in a negative impact on human health and
aquatic life. The PSW contains a high concentration of
lipids (fats, grease, oil and fatty acids) as a major
component of organic matter (Commarota and Freire,
2006). Therefore, the implementation of pre-treatment
process (es) is necessary as it is an important step in
improving the wastewater quality prior to further
treatment using anaerobic biological systems. Suitable
pre-treatment systems have been developed for lipid-
containing wastewater from slaughterhouses, with such
techniques being applied prior to the use of primary and
secondary treatment processes, such as anaerobic
digesters for organic matter reduction, nitrification, and
subsequent denitrification for total nitrogen reduction
(Abdel-Rand et al., 2012).
2. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 20
Pre-treatment processes such as dissolved air flotation
systems (DAFs) and grease traps are often applied
(Tanikawa et al., 2016). However, complications can
occur during their utilisation, contributing to the
inefficient removal of lipids which will buildup in the
sludge used in anaerobic processes, reducing their
effectiveness to treat the PSW (Commarota and Freire,
2006). Overall, influent of improperly pre-treated high-
lipid content PSW to downstream wastewater treatment
processes may impede both aerobic and anaerobic
downstream processes (Rigo et al., 2008). In an aerobic
processes, a layer of lipids may be formed which will
interrupt pollutant transformation by the bioremediating
biomass,and also decrease access to dissolved oxygen
(DO) in aerobic processes such as nitrification (Bustillo-
Lecompte et al., 2016).
Furthermore, operational damage which culminates in
process redundancies, due to solidified lipids at low
temperatures during anaerobic treatment, has been
reported in numerous studies for slaughterhouse
wastewater (Commarota and Freire, 2006; Valladão et
al., 2007). Even after successful primary pre-treatment,
further lipid removal might be required in a process
which is environmentally benign. When a DAF system
is utilised as a pre-treatment system, 60-85% of lipids
can be removed (Massé and Masse, 2000), with the rest
passing down to downstream processes. Clearly, the
remaining lipids will thus accumulate in these
downstream PSW bioremediation systems, which will
effectively reduce the efficiency of such processes
overtime. The use of alternative biological methods with
current pre-treatment systems involving enzymes has
been referred to as a promising alternative for further
FOG reduction in effluent from pre-treatment processes,
a technique suitable for high lipid-containing
wastewater such as PSW (Rigo et al., 2008).
Biotreatment involves uses of naturally occurring
biological means and microorganisms to treat
wastewater of its nutrients. Biological wastewater
treatment is mainly carried out by Prokaryotes, Plants
(Lemna sp., water hyacinth, vetiver grass, hydrilla
grass), Microalgae, Protozoan and Rotifers (Bitton,
2005). Biological wastewater treatment is therefore of
utmost importance for the wellbeing of water bodies.
This calls for a continuous development and refinement
of wastewater treatment techniques as part of the effort
to make the world a cleaner place. Microalgae are
microscopic photosynthetic organisms that are found in
both marine and freshwater environments. Their
photosynthetic mechanism is similar to land based
plants, due to a simple cellular structure, submerged in
an aqueous environment where they have efficient
access to water, carbon dioxide and other nutrients, they
are generally more efficient in converting solar energy
into biomass. The use of a wide range of microalgae
such as Chlorella, Scenedesmus, Phormidium,
Botryococcus, Chlamydomonas and Spirulina for
treating wastewater has been reported and efficacy of
this method is promising (Stephens et al., 2010).
The advantage is that while the microalgae will be
removing excess nutrients in the wastewater, there will
be concomitant accumulation of biomass for
downstream processing (Chinnasamy et al., 2010). In a
study by Zhang et al. (2008) Scenedesmus sp. showed
high removal efficiency for inorganic nutrients such as
nitrates and phosphate from domestic effluents. The
potential for microalgae in waste water remediation is
however much wider in scope than its current role (De-
Bashan and Bashan, 2010). Algae, particularly green
unicellular microalgae have been proposed for a long
time as a potential renewable fuel source (Oswald and
Golueke, 1960). In addition, waste water treatment by
microalgae is an eco-friendly process with no secondary
pollution as long as the biomass produced is re used and
allows efficient nutrient recycling (Godos et al., 2003).
Physical and chemical pre-treatment systems are
employed for the delipidation of protein- rich
wastewater from poultry slaughterhouses prior to the
biological treatment of such wastewater for the overall
reduction of FOG, and therefore of total chemical
oxygen demand (COD). However, these treatment
techniques are capital intensive and contribute to the
accumulation of toxicants in wastewater treatment
processes as chemical compounds, e.g. synthetic
chemical flocculants, are used for the removal of FOG.
Hence, bio-treatment (Biological techniques) offer an
innovative, cost-effective and environmentally benign
alternative for the reduction of lipids contained in
wastewater, such as that of poultry slaughterhouses.
Bio-treatment of PSW using biological methods is a
promising alternative pre- treatment technique, although
it has not been studied extensively. The current study is
focus on bio-treatment of poultry slaughterhouse waste
water using Chlorella vulgaris ChA. The objectives of
this research work includes: Analysis of the
physicochemical parameters of poultry slaughterhouse
waste water, Treatment of the poultry waste water with
microalgae (Chlorella vulgaris ChA) and analysis of
the physicochemical parameters of treated poultry
slaughterhouse waste water
II.MATERIALS AND METHODS
3. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 21
A. Poultry Slaughterhouse Waste water Sample
Waste water samples from Poultry slaughtered house
waste water in Mobi Area, Ede South Local
Government, Osun-state, were aseptically collected in
laboratory clean and sterile containers. The area lies
within Latitude 7.700o
N and Longitude 4.450o
E of the
equator. The sample collected was then corked and
transferred to the laboratory for analysis after 1-2hrs of
sample collection.
B. Microalgae sample
The source of microalgae (Chlorella vulgaris ChA) for
bio-treatment was water sample collected from
University of Ibadan fish farm pond.
C. Sterilization of Apparatus
All apparatus used in this study were thoroughly washed
with detergent, rinsed with water, air-dried and sterilized
in hot air oven at 160o
C for two hours. All media used
for isolation, cultivation and identification of micro
algal isolates were sterilized by autoclaving at 121o
C for
15 minutes under pressure.
D. Morphological characterization of microalgae
Isolate was characterized morphologically with the aids
of compound light microscope based on characteristics
like shape, size, cellular structure i.e
unicellular/multicellular, chloroplast, pyrenoid, motility
and nucleated.
E. Molecular Identification of Microalgae
i. DNA EXTRACTION: The genomic DNA of Algae
was isolated using the InstaGeneTM Matrix Genomic
DNA Isolation kit. Below procedure was followed as
required by the kit instruction. The colonies of Isolated
microalgae were picked and immersed in a microfuge
tube contained 1ml of sterile water. The supernatant was
removed by centrifugation iat 10,000–12,000 rpm for 1
minute. This was preceded by addition of 200 μl of Insta
Gene matrix to the pellet and incubation for 15 minutes
at 56 °C. The tube was place in boiling water bath at 100
°C for 8 minutes after vortexing at high speed for 10
seconds. Finally, the content was vortex and spin at high
speed for 10 seconds and 10,000–12,000 rpm for 2
minutes respectively. In result, 20μl of the supernatant
was used per 50 μl PCR reaction.
ii. POLYMERASE CHAIN REACTION: Universal
primers gene fragment was amplified using MJ
Research .PTC-225 Peltier Thermal Cycler through 18S
rRNA ITS Region
iii. PRIMER DETAILS: To 20μl of PCR reaction
solution, 1μl of template DNA was added. Using 18S-
Ca
/18S-Da
/18S C-2b
/18S D-2b
primers The PCR
reaction was performed using 18S-Ca
/18S-Da
/18S C-
2b
/18S D-2b
primers (Table 1) with below conditions :
Initial Denaturation at 94ºC"for"2"min"and"then 35
amplification cycles at 90 ºC for 45sec, 50 ºC for 60sec,
and 72 ºC for 60sec. Final Extension at 72 ºC
"for"10"min. DNA fragments are amplified. Include a
positive control (E.coli genomic DNA) and a negative
control in the PCR
Table 1:18S rRNA PRIMERS USED FOR PCR
REACTION
PRIMER SEQUENCE
18S rRNA
18S-Ca
5’-
TGATCCTTCYGCAGGTTCAC-
3’
18S-Da
5’-
ACCTGGTTGATCCTGCCAG-
3’
18S C-2b
5’-
ATTGGAGGGCAAGTCTGGT-
3’
18S D-2b
5’-
ACTAAGAACGGCCATGCAC-
3’
iv. PURIFICATION OF PCR PRODUCTS: Montage
PCR Clean up kit (Millipore) was used to remove
unincorporated/unattached PCR primers and dNTPs
from PCR products. The sequence of PCR product was
done using 18S-Ca
/18S-Da
/18S C-2b
/18S D-2b
primers.
ABI PRISM® BigDyeTM Terminator Cycle
Sequencing Kits with AmpliTaq® DNA polymerase
(FS enzyme) (Applied Biosystems) were used to
performed sequencing reactions.
v. SEQUENCING PROTOCOL: On each template,
Single-pass sequencing was performed using 18s rRNA
universal primers. Ethanol precipitation protocol was
used for purification of the fluorescent-labelled
fragments from unincorporated terminators. The
samples were subjected to electrophoresis in an ABI
3730xl sequencer (Applied Biosystems) after
suspension in distilled water.
vi. BIOINFORMATICS PROTOCOL: The NCBI blast
similarity search tool was used to blast the rRNA
sequence . The phylogeny analysis of our sequence with
the closely related sequence of blast results was
4. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 22
performed followed by multiple sequence alignment.
The programs MUSCLE 3.7 was used for multiple
alignments of sequences (Edgar, 2004). The program G
blocks 0.91b was used for curing of aligned sequences.
The poorly aligned positions and divergent regions
(removes alignment noise) were eliminated by G blocks
(Talavera and Castresana, 2007). Finally, the program
PhyML 3.0 a LRT was used for phylogeny analysis and
HKY85 as Substitution model. PhyML was shown to be
at least as accurate as other existing phylogeny programs
using simulated data, while being one order of
magnitude faster. PhyML was shown to be at least as
accurate as other existing phylogeny programs using
simulated data, while being one order of magnitude
faster. The program Tree Dyn 198.3 was used for tree
rendering. (Dereeper et al., 2008).
F. Determination of Physicochemical Characteristics of
Waste Water Samples
The physico-chemical parameters of wastewater from
Poultry slaughtered house in Mobi Area, Ede South
Local Government, Osun-state was analyzed using
standard analytical procedure (APHA, 1998). The
physico-chemical parameters analyzed include; pH,
total dissolved solid, temperature, dissolved oxygen
(DO), total alkalinity, biochemical oxygen demand
(BOD), chemical oxygen demand (COD), ammonia,
phosphates and nitrate were also analyzed. The
procedures involved in carrying out the physico-
chemical processes are discussed below:
i. DETERMINATION OF pH: The pH of the waste
water sample was determined using a pH meter (Toledo,
MP220). Each water sample was measured into 100 cm3
beaker and the pH determined by inserting the pH meter
probe after standardization into the beaker and taking the
reading. Standardization of the meter was ensured after
each reading (AOAC, 2006).
ii. DETERMINATION OF TOTAL DISSOLVED
SOLIDS: Total Dissolved Solids (TDS) for each water
sample was determined mathematically as a product of
conductivity multiplied by a constant value, 0.6 (APHA,
1985).
TDS = Conductivity × 0.6.
iii. DETERMINATION OF TEMPERATURE: The
temperature of waste water sample was determined
using a simple Mercury-In-Glass thermometer
(Assistant, DIN 12770) calibrated in degrees centigrade
as described by Edema et al ., 2001 and Dinrifo et al.,
2010.
iv. DETERMINATION OF DISSOLVED OXYGEN
(DO): Dissolved Oxygen (DO) was determined using
the Dissolved Oxygen meter (Model OXi315i),
WTW82362. The dissolve oxygen meter was dipped
into a sample, allowed to be steady and the result was
recorded (APHA, 1985).
v. DETERMINATION OF TOTAL ALKALINITY:
Alkalinity determination was done by measuring fifty
ml of each sample into a onical flask and two drops of
sodium trioxosulphate (ii) added to remove traces of
chlorine. Three drops of mrthyl orange indicator was
then added and titrated with 0.02N tetraoxosulphate (vi)
acid acid in the burette.
Titer value × 20 = Alkalinity (mg/l) (Anon, 2002).
vi. BIOCHEMICAL OXYGEN DEMAND: To
determine the biological oxygen demand (BOD), two
100 ml bottles were obtained with lids and cleaned well.
25 ml sample was taken in each bottle and 75 ml of
distilled was added to the two bottles and were tightly
closed. One bottle was kept in the incubator at 20-22°C
for 5 days. The 10 ml of Manganese sulphate solution
and 2 ml of alkali- iodide solution were added to the
other bottle below the surface of the liquid by using a
syringe. Thereafter the bottles were closed and mixed by
inverting the bottle several times. When the precipitate
settles it leaves a clear supernatant above, the precipitate
was shaken again slowly by inverting the bottle, and
when the setting has produced at least 50 ml supernatant
8 ml of conc. H2SO4 was added. The bottle was closed
and mixed by gentle inversion until dissolution was
completed. 100 ml of the sample was titrated with
0.05M Na2S2O3 solution until a pale yellow solution is
reached, 2 ml of freshly prepared starch solution was
added and titration continued until a blue colour
appeared. The procedure was repeated using 100 ml
distilled water (blank) and this was repeated for
incubated sample after 5 days. The BOD was calculated
as follows:
BOD as mg/L = 16(V1 - V2)
Where:
V1 = ml of Na2S2O3 used for the sample before
incubation;
V2 = ml of Na2S2O3 used for the sample after
incubation.
vii. CHEMICAL OXYGEN DEMAND (COD): COD
analysis was performed using pre-packaged mercury-
5. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 23
free and premixed COD vials based on Section 5220 of
Standard Methods (APHA, 1998, 2012). Three types of
COD vials with the ranges 5- 150, 20-900 and 100-4,500
mgCOD/L were used accordingly. A COD reactor was
preheated to 150°C before testing. During every test, a
2.5 mL sample was carefully added into one COD vial
of ranges 5-150 or 20- 900 mgCOD/L, and 0.5 mL
sample were carefully added into one COD vial of range
100 4,500 mgCOD/L. Then, the vial was thoroughly
shaken by hand. COD standards and a DW blank were
processed exactly the same as the samples. COD vials
containing sample, COD standard, and blank, were
heated in the COD reactor for 2 h at 150±2°C, and then
they were removed from the reactor and placed in a rack
until they cooled and any suspended precipitate in the
vials settled down. After the outsides of vials were
wiped to remove dust, the vials were placed into the
Orbeco Hellige MC500 Multi-Parameter Colorimeter
one by one, to measure their COD concentrations under
a standard curve covering the expected range of sample
concentrations. The wavelength of 440, 600, and 600 nm
were set for the ranges 5-150, 20-900 and 100-4,500
mgCOD/L, respectively. According to the requirements
of the test method for using the COD vials, blanks of the
ranges 20-900 and 100-4,500 mgCOD/L were used to
set the zero in the colorimeter before sample testing.
viii. AMMONIA NITROGEN (NESSLER METHOD):
The Mineral Stabilizer complexes hardness in the
sample, the Polyvinyl Alcohol Dispersing Agent aids
the color formation in the reaction of Nessler Reagent
with ammonium ions. A yellow color is formed
proportional to the ammonia concentration. Test results
were measured at 425 nm. A blank prepared from
deionized water treated and measured equally as the
sample (APHA, 1998).
ix. DETERMINATION OF PHOSPHATE: To 25ml of
the sample was added to 0.5ml of ammonium molybdate
and 2 drops of stannous chloride and mixed by swirling.
A blue color developed within an hour and the intensity
was measured using a spectrophotometer (21D) at 690
nm (APHA, 1998).
The concentration of the phosphate was calculated
Phosphate (mg/l) = A - B X C
Where; A = Absorbance of sample;
B = Absorbance of blank sample,
C = Volume of standard phosphate
x. DETERMINATION OF NITRATE: Test tube was
filled with sample to 20ml mark and one level spoonful
(~ 1.5 ml) of nitratest powder (containing zinc dust 60%
and barium sulphate 40%) and one nitratest tablet
(ammonium chloride) were added and was shaken for a
minute. The tube was allowed to stand for a minute and
was inverted 3-4 times to aid flocculation and was
allowed to stand for two minutes to ensure complete
settlement. The clear solution was dispersed into 10 ml
mark and one nitricol tablet (Sulfanilic acid, acting as
the aromatic amine), was added, crushed, and mixed to
dissolve, then it was allowed to stand for 10 minutes for
color development and readings were taken on the
Photometer (Wagtech) at 570 nm wave length.
G. Experimental Set Ups for conventional bio treatment
of wastewater
To study the role of Microalgae (Chlorella vulgaris
ChA) in wastewater treatment, the following methods
were employed:
Poultry slaughtered house waste water +
Chlorella vulgaris ChA
The experiment were conducted in triplicates and
incubated under the same condition in 250 mL
Erlenmeyer flask for period of 14 days.
H. Inoculation and Sampling
10 mL of exponential growing of Scenedesmus obliquus
SeA was inoculated into three 250 mL Erlenmeyer flask
containing 190ml of Sterilized Poultry slaughtered
house waste water samples. Samples were taken for
physicochemical analysis at interval of 7 days after
inoculation for two weeks.
I. Statistical Analysis
Data obtained were subjected to appropriate statistical
analysis.
III. RESULT AND DISCUSSION
A. Morphological and molecular identification of
microalgae
Isolate UIA consists of small, non-motile unicells
(rarely aggregated into small groups). The cells are
spherical with a single, parietal, cup-shaped (sometimes
plate-like) chloroplast with a single pyrenoid. The cell
wall is generally thin, smooth and planktonic (Table 2).
Isolate UIA was identified as Chlorella vulgaris after
6. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 24
comparing its 18S rRNA sequence to similar sequences
stored in the gene bank of NCBI. Chlorella vulgaris UIA
is 100% closely related to Chlorella vulgaris strain SAG
30.80 (Figure 3).
Table 2: Morphological Characteristics of Microalgae
Morphological characters Isolate
Shape Spherical
Size small
Unicellular/Multicellular Unicellular
Planktonic/Benthic Planktonic
Chloroplast Parietal
Pyrenoid Single
Motility Non-motile
Nucleated Uninucleated
Table 3: Molecular Identification of Microalage based
on partial 18SrRNA gene sequence analysis
Isolate Code Identity Identity from BLAST Percentage similarity (%)
SeA Chlorella sp Chlorella vulgaris SAG 30.80 100
B. Physicochemical properties of Raw and treated
poultry slaughtered waste water
The mean pH values increased gradually from 7.04 to
8.45 for Mobi poultry slaughterhouse waste water
(Figure 1). The pH of the raw poultry slaughterhouse
waste water is 7.04, which is neutral, after 7 days of bio-
treatment the pH increased to 7.85 and 8.45 after 14 days
of treatment with Chlorella vulgaris ChA. The pH
values obtained in this study were within the range of
optimum pH levels for anaerobic digestion (Speece,
1996) and were within the World Health Organisation
(WHO) tolerance limits of 6.0 to 9.0 for the discharged
of wastewater into aquatic environment (Akan et al.,
2010). The initial neutral pH (7.04) that characterized
the onset of this work contradicted the observation made
by Adesemoye et al. (2006) which recorded an acidic
pH in characterization of sampled abattoir effluent. The
anaerobic degradation of organic compounds releases
ammonia, which react with carbon dioxide produced
during the anaerobic process, resulting in ammonium
bicarbonate, which contributes to the increase in pH
values. This phenomenon according to Padilla-Gasca et
al. (2011), can be attributed to a high concentration of
organic compounds present in the poultry
slaughterhouse wastewater which is composed mainly
of proteins (like blood).
Total Dissolved Solid (TDS) recorded for Mobi poultry
slaughterhouse waste water was 521.45 mg/L (Figure
2a). TDS values obtained were generally within 1000
mg/l the upper limit set by WHO (WHO, 2011). The
value later reduced to 442.29 and 121.80 mg/L with
removal efficiencies of 15.18 and 76.64% respectively
after 7 and 14 days of treatment with Chlorella vulgaris
ChA (Figure 2b). The electrical conductivity and total
dissolved solid exhibited similar trend in both abattoir
effluents, this is as a result of the linear relationship that
exist between the two parameters (Radojevic, 1999).
Chemical Oxygen Demand (COD) is considered as the
amount of oxygen consumed by the chemical
breakdown of organic and inorganic matter. The
temperature of Mobi poultry slaughterhouse waste water
is 30.27°C (Figure 4.3). There was a slight decrease in
temperature (28.62 and 29.85°C) after 7 and 14 days of
bio-treatment (Figure 3). The values observed after 7
and 14 days are slightly below the limit value of direct
discharge into the receiving environment (30°C).
Similarly, these values are considered indicative limit
value for water for irrigation (35°C).
The dissolved oxygen (DO) in the various abattoir
effluents were below undetectable concentrations before
the end of the first 14 days interval. This observed
change is due to the nature of the experimental setup and
also as a result of increase in the microorganisms’
activities which used up the available dissolved oxygen.
The dissolved oxygen was on decreased from the onset
with value of 4.85 mg/L to 2.40 mg/L after 7 days and
0.95 was recorded at the end of 14 days (Figure 4a). The
highest reduction efficiency (80.41%) was recorded
after 14 days (Figure 4b). This was as a result of
activities and higher number of microorganisms during
that period.
The value recorded for Total alkalinity in raw Mobi
poultry slaughterhouse waste water is 143.08 mg/L
(Figure 5a). This value is higher than required standard
for discharge into the environment. However, after
period of treatment for 7 and 14 days respectively,
125.64 and 55.84 mg/L were recorded (Figure 4.5a) at
12.19 and 60.97 % reduction efficiencies (Figure 5b).
Figure 1: pH of the Bio treated Raw Poultry
0
2
4
6
8
10
Raw PSHWW Day 7 Day 14
pH
Biotreatment period
7. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 25
Slaughterhouse Wastewater with Chlorella vulgaris
ChA after 7th
and 14th
day of treatment
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater
Figure 2a: Total Dissolved Solids of the Bio treated
Raw Poultry Slaughterhouse Wastewater with Chlorella
vulgaris ChA after 7th
and 14th
day of treatment
Figure 2b: Total Dissolved Solids removal efficiencies
of Chlorella vulgaris after 7 and 14 days of treatment.
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater
Figure 3: Temperature of the Bio treated Raw Poultry
Slaughterhouse Wastewater with Chlorella vulgaris
ChA after 7th
and 14th
day of treatment
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater
Figure 4a: Dissolved Oxygen of the Bio treated Raw
Poultry Slaughterhouse Wastewater with Chlorella
vulgaris ChA after 7th
and 14th
day of treatment
Figure 4b: Dissolved Oxygen Removal efficiencies of
Chlorella vulgaris after 7 and 14 days of treatment
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater
Figure 5a: Total Alkalinity of the Bio treated Raw
Poultry Slaughterhouse Wastewater with Chlorella
0
100
200
300
400
500
600
Raw PSHWW Day 7 Day14
TotalDissolvedSolids
(mg/L)
Biotreatment period
0
50
100
Day 7 Day 14
TotalDissolved
Solids
Reduction(%)
Biotreatment period
0
5
10
15
20
25
30
35
Raw PSHWW Day 7 Day14
Temperature(oC)
Biotreatment period
0
1
2
3
4
5
6
Raw PSHWW Day 7 Day14
DissolvedOxygen
(mg/L)
Biotreatment period
0
20
40
60
80
100
Day 7 Day 14
DissolvedOxygen
Reduction(%)
Biotreatment period
0
20
40
60
80
100
120
140
160
Raw PSHWW Day 7 Day14
TotalAlkalinity
(mg/L)
Biotreatment period
8. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 26
vulgaris ChA after 7th
and 14th
day of treatment
Figure 5b: Total Alkalinity Removal efficiencies of
Chlorella vulgaris after 7 and 14 days of treatment
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater.
Biochemical Oxygen Demand (BOD) recorded at Mobi
poultry slaughterhouse waste water was found to be
lower (1125.63 and 486.81mg/L) after 7 and 14 days of
bio-treatment compare with 1480.05 mg/L obtained for
raw Mobi poultry slaughterhouse waste water (Figure
6a). They had reduction efficiencies of 23.95 and
67.11% after 7 and 14 days of biotreatment Chlorella
vulgaris ChA (Figure 6b).
High degradation rate at the week two(day=14) could
possibly be as a result of the acclimatization of the
microorganisms to the prevailing conditions High
organic material presents in the abattoir wastewater are
an indication of higher BOD and COD. Higher COD and
BOD concentrations recorded at Mobi poultry
slaughterhouse waste water was due to high blood
volume.
This is in conformity with the finding of del Pozo et al.
(2003). This fact had a great influence on the rest of the
parameters and the nature of the wastewaters. Some
information on the wastewater biodegradability can be
gained comparing different measures, example, BOD
and COD where a high ratio of BOD to COD shows a
relatively high biodegradability whereas a low ratio
indicates that the wastewater is more slowly
biodegraded (Vollertsen and Hvitved-Jacobsen, 2002).
The COD observed in this study showed that Mobi
poultry slaughterhouse waste water reduced to 1085.10
.84 and 56 mg/L respectively from initial raw waste
water value of 1778.24 mg/L after 7 and 14 days
treatment with Chlorella vulgaris ChA (Figure 7a) at
removal efficiencies of 38.98 and 96.80 % respectively
(Figure 7b). The rate of reduction of COD of Mobi
poultry slaughterhouse waste water confirms the
effectiveness of degradation process to reduce the
pollutant load contained in the wastewater.
The value recorded for ammonia in this study is 78.30
mg/L for Mobi poultry slaughterhouse waste water,
however there was a decrease in result obtained after
treatment for period of 14 days, with 60.85 and 33.09
mg/L at day 7 and 14 respectively (Figure 8a) as well
as 22.29 and 57.74% reduction efficiencies (Figure 8b).
Phosphate and nitrate are among the prominent
compounds in any abattoir effluent. The levels
phosphate and nitrate compounds were higher in Mobi
poultry slaughterhouse waste water. This may be
attributable to the high fecal contents of the effluents.
Rodier (2009) reported that wastewater samples must
have less than 50 mg/l of nitrates and 0.5 mg/l of
phosphate before its discharge into aquatic environment.
Relatively higher decrease (12.27 and 7.83mg/L Figure
9a) with reduction efficiencies of (25.82 and 56.66 %
Figure 9b at day 7 and 14 respectively) was recorded in
phosphate concentration after bio-treatment against
value observed for raw Mobi poultry slaughterhouse
waste water 16.54 mg/L.
High phosphate levels will result in the eutrophication
of the river. Blood is also the major contributor to the
nitrogen content while phosphorus originates from
stomach contents in the effluent.
The results obtained in this study showed significant
reduction of nitrate in Mobi poultry slaughterhouse
waste water after bio-treatment for period of 14 days
with 11.45 and 9.30 mg/L at day 7 and 14 against 454
mg/L recorded for raw Mobi poultry slaughterhouse
waste water (Figure 10a). The higher percentage
reduction efficiencies were recorded after 7 and 14 days
of bio-treatment (75.45 and 97.95) respectively
(Figure10b).
0
20
40
60
80
Day 7 Day 14
TotalAlkalinity
Reduction(%)
Biotreatment period
0
200
400
600
800
1000
1200
1400
1600
1800
Raw PSHWW Day 7 Day14
BiologicalOxygen
Demand(mg/L)
Biotreatment period
9. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 27
Figure 6a: Biological Oxygen Demand of the Bio treated
Raw Poultry Slaughterhouse Wastewater with Chlorella
vulgaris ChA after 7th
and 14th
day of treatment
Figure 6b: Biological Oxygen Demand Removal
efficiencies of Chlorella vulgaris after 7 and 14 days of
treatment Note: Raw PSHWW= Raw Poultry
Slaughterhouse Wastewater
Figure 7a: Chemical Oxygen Demand of the Bio treated
Raw Poultry Slaughterhouse Wastewater with Chlorella
vulgaris ChA after 7th
and 14th
day of treatment
Figure 7b: Biological Oxygen Demand Removal
efficiencies of Chlorella vulgaris after 7 and 14 days of
treatment
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater
Figure 8a: Ammonia of the Bio treated Raw Poultry
Slaughterhouse Wastewater with Chlorella vulgaris
ChA after 7th
and 14th
day of treatment
Figure 8b: Ammonia Removal efficiencies of Chlorella
vulgaris after 7 and 14 days of treatment
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater
0
20
40
60
80
Day 7 Day 14
Biological
OxygenDemand
Reduction(%)
Biotreatment period
0
200
400
600
800
1000
1200
1400
1600
1800
2000
Raw PSHWW Day 7 Day14
ChemicalOxygenDemand
(mg/L)
Biotreatment period
0
20
40
60
80
100
120
Day 7 Day 14
ChemicalOxygenDemandReduction
(%)
Biotreatment period
0
10
20
30
40
50
60
70
80
90
Raw PSHWW Day 7 Day14
Ammonia(mg/L)
Biotreatment period
0
10
20
30
40
50
60
70
Day 7 Day 14
AmmoniaReduction(%)
Biotreatment period
10. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 28
Figure 9a: Phosphate of the Bio treated Raw Poultry
Slaughterhouse Wastewater with Chlorella vulgaris
ChA after 7th
and 14th
day of treatment
Figure 9b: Phosphate Removal efficiencies of Chlorella
vulgaris after 7 and 14 days of treatment
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater
Figure 10a: Nitrate of the Bio treated Raw Poultry
Slaughterhouse Wastewater with Chlorella vulgaris
ChA after 7th
and 14th
day of treatment
Figure 10b: Nitrate Removal efficiencies of Chlorella
vulgaris after 7 and 14 days of treatment
Note: Raw PSHWW= Raw Poultry Slaughterhouse
Wastewater
IV. CONCLUSION AND RECOMMENDATION
Raw poultry slaughterhouse waste water from Mobi area
in Ede South Local Government was successfully bio-
treated with Microalgae, the values of physicochemical
parameters obtained for the raw poultry slaughterhouse
waste water in this study were reduced to acceptable
standard for discharge to environment after 7 and 14
days of treatment
CONCLUSION
Poultry Slaughterhouses releases effluents that are
heavily loaded with various form organic matter that are
hazardous to environment. The discharge of this waste
into the immediate environment, waterways and aquatic
environment without proper treatment impacts on the
water quality. The physicochemical analysis of the
poultry slaughterhouse wastewater in this study do not
meet National Environmental Standards and Regulation
Enforcement Agency (NESREA) permissible limit, and
therefore not suitable for discharge into environment. It
is therefore essential to adopt appropriate
slaughterhouse wastewater treatment measures to
prevent the contamination of the environment including
surface water and ground water. This study inundates
the fact that untreated abattoir effluents generated at the
mobi poultry slaughterhouse waste water constitute
serious environmental problem to the abattoir
neighborhood and health problem to people within the
area, hence there should be an enforcement of strict
environmental management by regulatory authorities.
0
2
4
6
8
10
12
14
16
18
20
Raw PSHWW Day 7 Day14
Phosphate(mg/L)
Biotreatment period
0
10
20
30
40
50
60
70
Day 7 Day 14
Phosphate
Reduction(%)
Biotreatment period
0
100
200
300
400
500
600
Raw PSHWW Day 7 Day14
Nitrate(mg/L)
Biotreatment period
0
20
40
60
80
100
120
Day 7 Day 14
NitrateReduction(%)
Biotreatment period
11. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 29
RECOMMENDATION
Given none of the studied slaughterhouses can reach the
desirable level of standards, to improve the quality of
slaughterhouse wastewater and use it for agriculture
purposes following items are recommended: minimizing
and recycling byproducts, separation and collection of
blood and gastric contents from raw wastewater and use
in industry such as pharmaceutical industry, collecting
fat from raw wastewater and using them in Soap
industry, biological and chemical treatment of
slaughterhouse wastewater.
Finally, the slaughterhouses are normally controlled by
local bodies, which should follow the standards
prescribed, but due to non-existence of modernized
slaughterhouses, environmental pollution arising out of
the slaughtering activities cannot be controlled. It is
suggested that the local bodies take up modernization of
slaughterhouses and achieve the pollution control
norms.
APPENDIX
Appendix 1: 18SrRNA sequence of Chlorella vulgaris
strain SAG 30.80 with 99% of identity
AGATGAACTTGCGGAAGGATCATTGAATCTAT
CGAATCCACTTTGGTAACCACTCGTCCCCCTCG
TCCGATGTCGCCCTCTCTTAGGGGAGTGCGAT
GCGGCGAGCGTCGGTCCCCTGGCTGTGGCTCC
CCGAGCTGTTGCTCAGGTCCGGCGGGCGTCCC
TTCACATGTGGGACCCCTTCTTTTTGAGGGGAC
CACCCCTTTGGAGGATCCGACGTCGGAAATTT
CAACTCAACTCACCCACCCCAAACTGAAACTT
ATTCTAAAGCACCTTGTGGTTGGCAGCTCGTCT
GCCGTCCACTCCAAACCAAAACAACTCTCAAC
AACGGATATCTTGGCTCCCGTATCGATGAAGA
ACGCAGCGAAATGCGATACGTAGTGTGAATTG
CAGAATTCCGTGAACCTCGAATCTTTGAACGC
AACTTGCGCCTGAGGCTTCGGCCAAAGGCATG
TCTGCCTCAGCGTCGGCTCACCCCCTGCCTCCC
CATCTCCTTTGATTGGGAAGGCGGATCTGACCT
TCCCGGTTCCGCCGGTCACTCGTGATTGGCGCC
GGGTCGGTTGAAGCTCAGAGGTATGAGCATGG
ACCCCGTTCGCAGGGTAATGGCTTGGTAGGTA
GGCATTCCCTACGCATCCTGCCGTTGCCCGAG
GGGACTTTGCTGGAGACCTAGCAGGAATTCGG
ATGCTTGGGCACCCCCCGACACCGAAACTCTT
CATTTCGACCTGAGCTCAGGCAGACTACCCGC
TGTAGGTT
ACKNOWLEDGEMENTS
We are grateful to the Almighty for His divine guidance,
protection, wisdom and for successful completion of
this work.
REFERENCES
[1] N. Abdel Rand, N., Al-Homaidan, A.A. &
Ibraheem, B.M.. Macroalgae and wastewater
treatment. Journal of Biological Science, 2012,
19(3):257-275.
[2] Dereeper, Guignon V, Blanc G, Audic S, Buffet S,
Chevenet F, Dufayard JF, Guindon S, Lefort V,
Lescot M, Claverie JM, Gascuel O. Phylogeny.fr:
robust phylogenetic analysis for the non-specialist.
Nucleic Acids Res.2008 1:36.
[3] R.Edgar RC: MUSCLE: multiple sequence
alignment with high accuracy and high throughput.
Nucleic Acids Res 2004, 32(5):1792-1797.
[4] G. Talavera., and Castresana, J. Improvement of
phylogenies after removing divergent and
ambiguously aligned blocks from protein sequence
alignments. Systematic Biology, 2007 56, 564-577.
[5] M.W.Akan., Paramasivam, M. and Ganguly, M.
Assessment and occurrence of various heavy metals
in surface water of Ganga River around Kolkata: A
study for toxicity and ecological impact.
Environmental monitoring and assessment , 2010,
160: 207- 213.
[6] O.B. Akpor, and Muchie, M. Challenges in
Meeting the MDGs: The Nigerian Drinking Water
Supply and Distribution Sector. Journal of
Environmental Science and Technology, 2011 4:
480-489.
[7] M. Radojevic, Bashkin VN. Practical
environmental analysis. Royal school of chemistry,
Thomas Graham house, science park Cambridge,
UK., 1999 645 p
[8] E. Padilla-Gasca Lopez-Lopez A, Gallardo-Vaidez
J. Evaluation of Stability Factor in the Anaerobic
Treatment of Slaughterhouse Wastewater. J.
Bioremed. Biodegrad., 2011, 2:114.
[9] J.Vollertsen, Hvitved-Jacobsen T. Biodegradability
of wastewater – a method for COD-fractionation.
Water Sci. Technol., 2002 45(3):25-34.
[10] R.Del Pozo, Tas DO, Dulkadiroglu H, Orhon D,
Diez V. Biodegradability of slaughterhouse
wastewater with high blood content under
anaerobic and aerobic conditions. J. Chem.
Technol. Biotechnol, 2003.78:384-391
[11] A.O. Adesemoye,., Opere, B.O. and Makinde,
S.C.O. Microbial content of abattoir wastewater
and its contaminated soil in Lagos, Nigeria. Afr. J.
Biotechnol., 2006 5 (20): 1963-1968
[12] G.Valladão, M. R., Pádua, S. B., Gallani, S.
U., Menezes-Filho, R. N., Dias-
Neto, J., Martins, M.
12. UIJRT | United International Journal for Research & Technology | Volume 01, Issue 09, 2020
All rights are reserved by UIJRT.COM. 30
L. and Pilarski, F.. Paratrichodina
africana (Ciliophora): a pathogenic gill parasite in
farmed Nile tilapia. Veterinary Parasitology, in
press., 2007 doi: 10.1016/j.vetpar.2013.04.043
[13] American Public Health Association (APHA),.
“Standard method for examination of water and
waste water”, 20th Edition. American Public Health
Association,Washington DC Anaerobia. Sao
Paulo, Brasil, 1988. 363-36.
[14] AOAC. Official Methods of Analysis. 18th Edition,
Association of Official Analytical Chemists,
Gaithersburgs, MD., 2006
[15] APHA, (16th edition), Standard Methods for the
Examination of Water
and Wastewater, 1985, p. 1268.
[16] B. Austin,, and Austin D.A. Bacterial Fish
Pathogens.3rd edition. Chichester, UK:
Springer Praxis, 1999
[17] G.Bitton,.Wastewater Microbiology. 3rd
edition.New Jersey: John Wiley & sons,
incorporation, 2005
[18] C.F. Bustillo-Lecompte, & Mehrvar, M. Treatment
of an actual slaughterhouse wastewater by
integration of biological and advanced oxidation
processes: modeling, optimization, and cost-
effectiveness analysis. Journal of Environmental
Management,2016, 182(1): 651-666.
[19] M.C. Cammarota. & Freire, D.M.G. A review on
hydrolytic enzymes in the treatment of wastewater
with high oil and grease content. Bioresource
Technology,2006, 97(17):2195-2210.
[20] S.Chinnasamy, A. Bhatnagar, R.W., Hunt and K.C.
Das,. Microalgae cultivation in a wastewater
dominated by carpet mill effluents for biofuel
applications. Bioresource Technol.,2010 101:
3097-3105.
[21] L. De-Bashan, and Bashan, Y. Immobilized
microalgae for removing pollutants: Review
of practical aspects. Bioresource Technology,
2010 101: 1611- 1627
[22] R.P.Dinrifo, Babatunde SOE, Bankole YO, Demu
QA. PhysicoChemical Properties of Rain Water
Collected from Some Industrial Areas of Lagos
State Nigeria. European Journal of Scientific
Research, EuroJournals Publishing, Inc, pp, 2010,
383-390
[23] N, Edema., Okoloko, G. and Agbogidi, M.
Physicochemical Characteristics of the Water
Soluble Fraction of Ogini well head crude oil and
the effects on Pistia stratiotes Linn. J.Agric.
Environ. Sci, 2001, 2(6):633-638
A. Godos, Blanco, S., García-Encina, P.A.,
Becares, E. and Munozm, R. Long-term
operation of high rate algal ponds for the
bioremediation of piggery wastewaters at
high loading rates. Bioresource
Technology, 2003, 100: 4332-4339
[24] D. Massé & L. Masse. Characterization of
wastewater. Canadian Agricultural
Engineering,2000 42(3):139-146.
[25] W. Oswald, and C.G. Golueke. Biological
transformation of solar energy. Adv. Applied
Microbiology. 1960 2: 223-262. PMID:
13731568
[26] S. Radie, Stipanicev, D., Cvjetko, P., Marijanovic
Rajcic, M., Širac, S., Pevalek-Kozlina, B. and
Pavlica, M. Duckweed Lemna minor as a tool for
testing toxicity and genotoxicity of surface
waters, Ecotoxicology and environmental safety,
2009, 74: 182–187.
[27] E. Rigo, Rigoni, Lodea, P., De Oliveira, D., Freire,
D. M., Treiche, L.H. & DI Luccio, M. 2008.
Comparison of two lipases in the hydrolysis of oil
and grease in wastewater of the swine meat
industry. Industrial & Engineering Chemistry
Research, 47(6):1760-1765.
[28] D. Tanikawa,,Yokote, N., Nakahara, K. &
Yamaguchi, T. Evaluation of Process Performance
for Lipid-rich Wastewater Treatment Using a
Combination System of an Anaerobic Baffled
Reactor and an Aerobic Trickling Filter. Journal of
Water and Environment Technology,2016
14(2):90-95.
[29] E. Zhang, Wang, B., Wang, Q., Zhang, S., and B.
Zhao,. “Ammonia-nitrogen and
orthophosphate removal by immobilized
Scenedesmus sp. isolated from municipal
wastewater for potential use in tertiary
treatment”. Bioresource Technology, 2008 99: 3787
- 3793.