https://www.biomedscidirect.com/2835/bioremediation-and-information-technologies-for-sustainable-management?utm=articles
Bioremediation and information technologies for sustainable management
Authors:Jyoti Prakash, Aryan Shukla , Ruchi Yadav
Int J Biol Med Res. 2023; 14(4): 7702-7711 | Abstract | PDF File
Bioremediation is a method which utilizing the life forms to kill or expel contamination from waste. It is vital to comprehend that this type of waste remediation utilizes no poisonous chemicals, in spite of the fact that it might utilize a living organism that can be detrimental in specific situations. In other words, we can say that bioremediation is the use of living microorganisms to degrade environmental pollutants or to prevent environment from pollution. It is an important technology for removing pollutants from the environment and thus restoring the original natural surroundings so that the environment can be prevent from pollution. It can be divided into three phases or levels. Firstly, by natural attenuation in which the contaminants are reduced by native microorganisms without any human augmentation, secondly the biostimulation is employed where nutrients and oxygen are applied in the systems to improve their effectiveness and to accelerate the process of biodegradation. Finally, during bioaugmentation microorganisms are added in the systems. The techniques of bioremediation are now widely being applied to remove the pollutants or contaminants from the environment. Types of BioremediationThere are much more than nine types of bioremediation, yet the accompanying are the most well known ways in which it is utilized. The list of some of the bioremediation techniques are as follows Phytoremediation Phytoremediation is a process of utilization of plants to expel contaminants. The plants can draw the contaminants from the soil and water into their structures and clutch them, adequately expelling them from soil or water.Bioventing Bioventing is an in situ remediation technique that includes blowing of air through soil to expand oxygen rates in the waste. It works well with light contaminants as which can evaporate easily. It is a very efficient approach to neutralize certain oxygen sensitive metals or chemicals with the help of microorganisms.Bioleaching This technique includes expelling metals from soil with the help of living life forms especially bacteria. Certain sorts of life forms attract to heavy metals and other type of contaminants and ingest them. This technique has widely being used to remove the metals like lead, zinc, cobalt, lead, gold etc.Landfarming This technique involves placing the contaminants soil in a biocell which is consisting of a linear surrounded by a berm. After that the soil placed on the linear and turned periodically to help the microorganism to breakdown the pollutants.Bioreactor The utilization of uniquely outlined containers to hold the waste while bioremediation happens.Composting Containing waste so a characteristic decay and remediation process happens.Bioaugmentation Adding microorganisms and living organisms to fortify the same in waste to permit them to assume control and purify the region.Rhizofiltration The utilization of plants to expel metals in water.Biostimulation The utilization of organisms int
Los plaguicidas han sido identificados como los principales contaminantes de varias vías fluviales. Al estar clasificados como posibles compuestos disruptores endocrinos, los pesticidas en el sistema acuoso son altamente peligrosos para los organismos acuáticos y el ecosistema.
Bioremediation is the process in which the micro-organisms are used to degrade the pollutants from the environment. Plants and micro-organisms are used to clean up the environment. Bioremediation is carried out by microbes and their metabolisms are used to remove the contaminants. Microbes have the ability to resolve the issue of contaminated ecosystem1. To improve or better living style the degradation of contaminated areas is very important. Importance of the biodegradation is increasing due to the expensiveness of the chemicals. So bioremediation is the best choice. The effluents should be degraded from the environment because they are very dangerous and have a bad impact on human beings. These pollutants sink into the water and cause pollution. These pollutants are treated with the help of microbes in bioremediation process. It is the best method because it is cost effective and eco-friendly. Different techniques of bioremediation are used to convert toxic substances into less toxic substances.
Bioremediation is the process in which the micro-organisms are used to degrade the pollutants from the environment. Plants and micro-organisms are used to clean up the environment. Bioremediation is carried out by microbes and their metabolisms are used to remove the contaminants. Microbes have the ability to resolve the issue of contaminated ecosystem1. To improve or better living style the degradation of contaminated areas is very important. Importance of the biodegradation is increasing due to the expensiveness of the chemicals. So bioremediation is the best choice. The effluents should be degraded from the environment because they are very dangerous and have a bad impact on human beings. These pollutants sink into the water and cause pollution. These pollutants are treated with the help of microbes in bioremediation process. It is the best method because it is cost effective and eco-friendly. Different techniques of bioremediation are used to convert toxic substances into less toxic substances.
Plant Design for bioplastic production from Microalgae in Pakistan.pdfMianHusnainIqbal2
Microalgae is an organism that belongs to the unicellular eukaryotic protists, prokaryotic
cyanobacteria, and blue-green algae. It have withdrawn a great attention of industrialists due to
its remarkable properties. According to the recent searches microalgae have more than 25.000
forms of species among which 15 has major use as a resource of many industrial products. Many
environmental friendly green plant processes have been develope in order to minimize the waste
and for energy saving such as Phytoremediation. Which is an excellent recovery system for
many resources. Via this process the recovery of microalgae species from aquaculture wastes is
done and the microalgae is then used as source of industrial biopolymers having excellent
characteristics.
Bioremediation is a method which utilizing the life forms to kill or expel contamination from waste. It is vital to comprehend that this type of waste remediation utilizes no poisonous chemicals, in spite of the fact that it might utilize a living organism that can be detrimental in specific situations. In other words, we can say that bioremediation is the use of living microorganisms to degrade environmental pollutants or to prevent environment from pollution. It is an important technology for removing pollutants from the environment and thus restoring the original natural surroundings so that the environment can be prevent from pollution. It can be divided into three phases or levels. Firstly, by natural attenuation in which the contaminants are reduced by native microorganisms without any human augmentation, secondly the biostimulation is employed where nutrients and oxygen are applied in the systems to improve their effectiveness and to accelerate the process of biodegradation. Finally, during bioaugmentation microorganisms are added in the systems. The techniques of bioremediation are now widely being applied to remove the pollutants or contaminants from the environment. Types of BioremediationThere are much more than nine types of bioremediation, yet the accompanying are the most well known ways in which it is utilized. The list of some of the bioremediation techniques are as follows Phytoremediation Phytoremediation is a process of utilization of plants to expel contaminants. The plants can draw the contaminants from the soil and water into their structures and clutch them, adequately expelling them from soil or water.Bioventing Bioventing is an in situ remediation technique that includes blowing of air through soil to expand oxygen rates in the waste. It works well with light contaminants as which can evaporate easily. It is a very efficient approach to neutralize certain oxygen sensitive metals or chemicals with the help of microorganisms.Bioleaching This technique includes expelling metals from soil with the help of living life forms especially bacteria. Certain sorts of life forms attract to heavy metals and other type of contaminants and ingest them. This technique has widely being used to remove the metals like lead, zinc, cobalt, lead, gold etc.Landfarming This technique involves placing the contaminants soil in a biocell which is consisting of a linear surrounded by a berm. After that the soil placed on the linear and turned periodically to help the microorganism to breakdown the pollutants.Bioreactor The utilization of uniquely outlined containers to hold the waste while bioremediation happens.Composting Containing waste so a characteristic decay and remediation process happens.Bioaugmentation Adding microorganisms and living organisms to fortify the same in waste to permit them to assume control and purify the region.Rhizofiltration The utilization of plants to expel metals in water.Biostimulation The utilization of organisms int
Los plaguicidas han sido identificados como los principales contaminantes de varias vías fluviales. Al estar clasificados como posibles compuestos disruptores endocrinos, los pesticidas en el sistema acuoso son altamente peligrosos para los organismos acuáticos y el ecosistema.
Bioremediation is the process in which the micro-organisms are used to degrade the pollutants from the environment. Plants and micro-organisms are used to clean up the environment. Bioremediation is carried out by microbes and their metabolisms are used to remove the contaminants. Microbes have the ability to resolve the issue of contaminated ecosystem1. To improve or better living style the degradation of contaminated areas is very important. Importance of the biodegradation is increasing due to the expensiveness of the chemicals. So bioremediation is the best choice. The effluents should be degraded from the environment because they are very dangerous and have a bad impact on human beings. These pollutants sink into the water and cause pollution. These pollutants are treated with the help of microbes in bioremediation process. It is the best method because it is cost effective and eco-friendly. Different techniques of bioremediation are used to convert toxic substances into less toxic substances.
Bioremediation is the process in which the micro-organisms are used to degrade the pollutants from the environment. Plants and micro-organisms are used to clean up the environment. Bioremediation is carried out by microbes and their metabolisms are used to remove the contaminants. Microbes have the ability to resolve the issue of contaminated ecosystem1. To improve or better living style the degradation of contaminated areas is very important. Importance of the biodegradation is increasing due to the expensiveness of the chemicals. So bioremediation is the best choice. The effluents should be degraded from the environment because they are very dangerous and have a bad impact on human beings. These pollutants sink into the water and cause pollution. These pollutants are treated with the help of microbes in bioremediation process. It is the best method because it is cost effective and eco-friendly. Different techniques of bioremediation are used to convert toxic substances into less toxic substances.
Plant Design for bioplastic production from Microalgae in Pakistan.pdfMianHusnainIqbal2
Microalgae is an organism that belongs to the unicellular eukaryotic protists, prokaryotic
cyanobacteria, and blue-green algae. It have withdrawn a great attention of industrialists due to
its remarkable properties. According to the recent searches microalgae have more than 25.000
forms of species among which 15 has major use as a resource of many industrial products. Many
environmental friendly green plant processes have been develope in order to minimize the waste
and for energy saving such as Phytoremediation. Which is an excellent recovery system for
many resources. Via this process the recovery of microalgae species from aquaculture wastes is
done and the microalgae is then used as source of industrial biopolymers having excellent
characteristics.
Role of microorganisms in waste recycling centre and the warmth of cherished memories of the day i vowed to never try anything love again and I hope to contribute to innovative things that I have been saying about my life and prosperity baby girl and I am not a scammer to be honest with you and I love you babe and I love you babe and I love you babe and I love you so much my queen and I love you
Treatment of Industrial Wastewater by Nonviable Biomass –A ReviewIJERA Editor
The present paper is a review paper on use of viable biomass of Industrial waste water treatment. there are many industry that use that latest technology such as the use of synthetic dyes for textile. However, a variety of synthetic dyestuff released by the textile industry has been posing a threat to the safety of the environment due the presence of a large number of toxic contaminants such as organic waste, acids, bases and organic pollutants. Therefore, the government began to control the pollution created by the industry to tighten the re gulation and enforcement by forcing the industry to treat waste before discharge to the environment. There are many methods have been used to treat this waste. However, it requires a treatment that really works not only at low cost with require minimal or no pre-treatment at all, but it must also be environmentally friendly, minimum sludge production and cleaner. This study used biological method to explore the usability of the microorganisms i.e. bacteria, Lactobacil lusde lbruckii for the removal of dyes from aqueous solutions. The ability of microorganism to decolorize and metabolise dyes has long been also the use of bioremediation based technology for treating textile waste water has attracted interest. The effects of different parameters such as pH, temperature and initial dye concentration were studied and the effectiveness of this method to remove the dye solution was determined by measuring the percentage of color removal
Multidrug resistance pattern of bacteria isolated from domestic and tannery w...iosrjce
The objective of this study was to screen for the microorganisms in the domestic wastes and tannery
effluents and characterize it’s antibiogram to know the prevalence of resistant pathogens. A total of 109 isolates
of 16 different genera were isolated from 38 samples by aerobic culture method. Fourteen and ninety-five
isolates were obtained from six domestic wastes and 32 tannery waste samples, respectively. The isolates
belonged to the genus Micrococcus (18.3%), Alcaligens (15.6%), Staphylococcus (11.0%), Enterobacter (4.6%),
Shigella (14.7%), Klebsiella (6.4%), Haemophilus (4.6%), Citrobacter (3.7%), Actinobacillus (3.7%),
Escherichia (4.6%), Corynebacterium (4.6%) and others (8.2%). It was interesting to notice that most of the
isolates were Gram-negative bacillus (63.3%) and few were Gram-positive cocci (36.7%). Pathogenic
microorganisms from domestic wastes and tannery effluents have been identified and reported. Most of the
isolates were resistant to chloramphenicol, nalidixic acid, nitrofurontoin and cefixime. Levofloxacin and
imipenem were effective against 108 (99.5%) of the isolates. Multi drug resistance was observed in most of the
isolates. Some isolates were found in both domestic and tannery waste samples, but their antibiotic resistance
patterns were not similar. Serratia spp. and two Bacillus spp. with different antibiogram pattern were found only in tannery waste samples. The significant number of Multiple Antibiotic Resistant (MAR) bacteria was observed in both the samples. Human infections caused by these bacteria could be difficult to treat with available drugs.
Bioremediation of wastewater by microorganismsadetunjiEwa
The term bioremediation has been introduced to describe the process of using biological
agents to remove toxic waste from environment. Bioremediation is the most effective management tool to manage the polluted water and recover contaminated waste water. It is an attractive and successful cleaning technique for polluted environment; it has been used at a number of sites worldwide, with varying degrees of success.
Bioremediation of wastewater by microorganismsadetunjiEwa
ABSTRACT
The term bioremediation has been introduced to describe the process of using biological
agents to remove toxic waste from environment. Bioremediation is the most effective management tool to manage the polluted water and recover contaminated waste water. It is an attractive and successful cleaning technique for polluted environment; it has been used at a number of sites worldwide, with varying degrees of success.
• Bioremediation – process of cleaning up environmental sites contaminated with chemical pollutants by using living organisms to degrade hazardous materials into less toxic substances
Role of Geomicrobiology and Biogeochemistry for Bioremediation to Clean the E...CrimsonpublishersEAES
Role of Geomicrobiology and Biogeochemistry for Bioremediation to Clean the Environment by Durgesh Kumar Jaiswal and Jay Prakash Verma* Environmental Analysis & Ecology Studies
Porocarcinoma of the nose- reconstructed with seagull flap
Authors:Balasubramaniam, Ramanandham, Pradeep, Sivakumar, Kalpa Pandya
Int J Biol Med Res. 2024; 15(1): 7760-7763
https://www.biomedscidirect.com/2847/porocarcinoma-of-the-nose-reconstructed-with-seagull-flap
Surgical excision of infiltrative mammary lipoma in a twelve-year old local breed of bitch through modified radical mastectomy
Authors:Melkamu Birhanu Meharu & Jiregna Dugassa Kittesa
Int J Biol Med Res. 2024; 15(1): 7756-7759
https://www.biomedscidirect.com/2848/surgical-excision-of-infiltrative-mammary-lipoma-in-a-twelve-year-old-local-breed-of-bitch-through-modified-radical-mastectomy
More Related Content
Similar to Bioremediation and information technologies for sustainable management.pdf
Role of microorganisms in waste recycling centre and the warmth of cherished memories of the day i vowed to never try anything love again and I hope to contribute to innovative things that I have been saying about my life and prosperity baby girl and I am not a scammer to be honest with you and I love you babe and I love you babe and I love you babe and I love you so much my queen and I love you
Treatment of Industrial Wastewater by Nonviable Biomass –A ReviewIJERA Editor
The present paper is a review paper on use of viable biomass of Industrial waste water treatment. there are many industry that use that latest technology such as the use of synthetic dyes for textile. However, a variety of synthetic dyestuff released by the textile industry has been posing a threat to the safety of the environment due the presence of a large number of toxic contaminants such as organic waste, acids, bases and organic pollutants. Therefore, the government began to control the pollution created by the industry to tighten the re gulation and enforcement by forcing the industry to treat waste before discharge to the environment. There are many methods have been used to treat this waste. However, it requires a treatment that really works not only at low cost with require minimal or no pre-treatment at all, but it must also be environmentally friendly, minimum sludge production and cleaner. This study used biological method to explore the usability of the microorganisms i.e. bacteria, Lactobacil lusde lbruckii for the removal of dyes from aqueous solutions. The ability of microorganism to decolorize and metabolise dyes has long been also the use of bioremediation based technology for treating textile waste water has attracted interest. The effects of different parameters such as pH, temperature and initial dye concentration were studied and the effectiveness of this method to remove the dye solution was determined by measuring the percentage of color removal
Multidrug resistance pattern of bacteria isolated from domestic and tannery w...iosrjce
The objective of this study was to screen for the microorganisms in the domestic wastes and tannery
effluents and characterize it’s antibiogram to know the prevalence of resistant pathogens. A total of 109 isolates
of 16 different genera were isolated from 38 samples by aerobic culture method. Fourteen and ninety-five
isolates were obtained from six domestic wastes and 32 tannery waste samples, respectively. The isolates
belonged to the genus Micrococcus (18.3%), Alcaligens (15.6%), Staphylococcus (11.0%), Enterobacter (4.6%),
Shigella (14.7%), Klebsiella (6.4%), Haemophilus (4.6%), Citrobacter (3.7%), Actinobacillus (3.7%),
Escherichia (4.6%), Corynebacterium (4.6%) and others (8.2%). It was interesting to notice that most of the
isolates were Gram-negative bacillus (63.3%) and few were Gram-positive cocci (36.7%). Pathogenic
microorganisms from domestic wastes and tannery effluents have been identified and reported. Most of the
isolates were resistant to chloramphenicol, nalidixic acid, nitrofurontoin and cefixime. Levofloxacin and
imipenem were effective against 108 (99.5%) of the isolates. Multi drug resistance was observed in most of the
isolates. Some isolates were found in both domestic and tannery waste samples, but their antibiotic resistance
patterns were not similar. Serratia spp. and two Bacillus spp. with different antibiogram pattern were found only in tannery waste samples. The significant number of Multiple Antibiotic Resistant (MAR) bacteria was observed in both the samples. Human infections caused by these bacteria could be difficult to treat with available drugs.
Bioremediation of wastewater by microorganismsadetunjiEwa
The term bioremediation has been introduced to describe the process of using biological
agents to remove toxic waste from environment. Bioremediation is the most effective management tool to manage the polluted water and recover contaminated waste water. It is an attractive and successful cleaning technique for polluted environment; it has been used at a number of sites worldwide, with varying degrees of success.
Bioremediation of wastewater by microorganismsadetunjiEwa
ABSTRACT
The term bioremediation has been introduced to describe the process of using biological
agents to remove toxic waste from environment. Bioremediation is the most effective management tool to manage the polluted water and recover contaminated waste water. It is an attractive and successful cleaning technique for polluted environment; it has been used at a number of sites worldwide, with varying degrees of success.
• Bioremediation – process of cleaning up environmental sites contaminated with chemical pollutants by using living organisms to degrade hazardous materials into less toxic substances
Role of Geomicrobiology and Biogeochemistry for Bioremediation to Clean the E...CrimsonpublishersEAES
Role of Geomicrobiology and Biogeochemistry for Bioremediation to Clean the Environment by Durgesh Kumar Jaiswal and Jay Prakash Verma* Environmental Analysis & Ecology Studies
Porocarcinoma of the nose- reconstructed with seagull flap
Authors:Balasubramaniam, Ramanandham, Pradeep, Sivakumar, Kalpa Pandya
Int J Biol Med Res. 2024; 15(1): 7760-7763
https://www.biomedscidirect.com/2847/porocarcinoma-of-the-nose-reconstructed-with-seagull-flap
Surgical excision of infiltrative mammary lipoma in a twelve-year old local breed of bitch through modified radical mastectomy
Authors:Melkamu Birhanu Meharu & Jiregna Dugassa Kittesa
Int J Biol Med Res. 2024; 15(1): 7756-7759
https://www.biomedscidirect.com/2848/surgical-excision-of-infiltrative-mammary-lipoma-in-a-twelve-year-old-local-breed-of-bitch-through-modified-radical-mastectomy
Adapting to adversity: insights from a stand-alone human immunodeficiency virus testing centre in india during the covid-19 pandemic
Authors:Sumathi Muralidhar*, Abhishek Lachyan
Int J Biol Med Res. 2024; 15(1): 7750-7755
https://www.biomedscidirect.com/2857/adapting-to-adversity-insights-from-a-stand-alone-human-immunodeficiency-virus-testing-centre-in-india-during-the-covid-19-pandemic
Assessment of trend of mortality due to poisoning in the northern zone of india and comparison with other international & national researches
Authors:Naveen Sharma, Kunal Khanna, Kuldeep Kumar, Tarun Dagar, Sandeep Kumar Giri, Vijay Pal Khanagwal
Int J Biol Med Res. 2024; 15(1): 7741-7745
https://www.biomedscidirect.com/2824/assessment-of-trend-of-mortality-due-to-poisoning-in-the-northern-zone-of-india-and-comparison-with-other-international-national-researches
Pulmonary function and respiratory symptoms among petrol station workers in debre tabor town, northwest ethiopia, 2023
Authors:Deribew Abebaw Abuhay
Int J Biol Med Res. 2024; 15(1): 7724-7730
https://www.biomedscidirect.com/2853/pulmonary-function-and-respiratory-symptoms-among-petrol-station-workers-in-debre-tabor-town-northwest-ethiopia-2023
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Medical segregation cohort study of bio – medical waste management
Authors:Naval Kishor Lodha, Krishna Murari, Biramchand Mewara, Gopal Sharma, Mahendra varma
Int J Biol Med Res. 2023; 14(4): 7699-7701 | Abstract | PDF File
https://www.biomedscidirect.com/2829/an-overview-of-coronavirus-disease-covid-19?utm=articles
An overview of coronavirus disease (covid-19)
Authors:Emy Jancy Rani J.
Int J Biol Med Res. 2023; 14(4): 7687-7691 | Abstract | PDF File
Prevalence and associated risk factor of bovine calves coccidiosis in nekemt city, oromia, western ethiopia
Authors:Walkite Furgasa , Sosina Dawit , Shibiru Wako and Adisu Dube
Int J Biol Med Res. 2023; 14(4): 7660-7664 | Abstract | PDF File
Serum interleukin - 6 level among sudanese patients with chronic kidney disease
Authors:Safaa I.A Nasr , Rbab A.M Adam , Hala M.M Ibrahim , Afra S.A Abdelgadir , Ibrahim Alkider , Solomon M. Gamde , Simon P. Abriba
Int J Biol Med Res. 2023; 14(4): 7652-7654 | Abstract | PDF File
Assessment of cardiac histology and hematological parameters in adult male wistar rats exposed to exhaust emissions from gasoline generators
Authors:Akinpelu MORONKEJI, Frederick O AKINBO
Int J Biol Med Res. 2023; 14(4): 7638-7642 | Abstract | PDF File
Navigating Challenges: Mental Health, Legislation, and the Prison System in B...Guillermo Rivera
This conference will delve into the intricate intersections between mental health, legal frameworks, and the prison system in Bolivia. It aims to provide a comprehensive overview of the current challenges faced by mental health professionals working within the legislative and correctional landscapes. Topics of discussion will include the prevalence and impact of mental health issues among the incarcerated population, the effectiveness of existing mental health policies and legislation, and potential reforms to enhance the mental health support system within prisons.
R3 Stem Cells and Kidney Repair A New Horizon in Nephrology.pptxR3 Stem Cell
R3 Stem Cells and Kidney Repair: A New Horizon in Nephrology" explores groundbreaking advancements in the use of R3 stem cells for kidney disease treatment. This insightful piece delves into the potential of these cells to regenerate damaged kidney tissue, offering new hope for patients and reshaping the future of nephrology.
QA Paediatric dentistry department, Hospital Melaka 2020Azreen Aj
QA study - To improve the 6th monthly recall rate post-comprehensive dental treatment under general anaesthesia in paediatric dentistry department, Hospital Melaka
How many patients does case series should have In comparison to case reports.pdfpubrica101
Pubrica’s team of researchers and writers create scientific and medical research articles, which may be important resources for authors and practitioners. Pubrica medical writers assist you in creating and revising the introduction by alerting the reader to gaps in the chosen study subject. Our professionals understand the order in which the hypothesis topic is followed by the broad subject, the issue, and the backdrop.
https://pubrica.com/academy/case-study-or-series/how-many-patients-does-case-series-should-have-in-comparison-to-case-reports/
CHAPTER 1 SEMESTER V - ROLE OF PEADIATRIC NURSE.pdfSachin Sharma
Pediatric nurses play a vital role in the health and well-being of children. Their responsibilities are wide-ranging, and their objectives can be categorized into several key areas:
1. Direct Patient Care:
Objective: Provide comprehensive and compassionate care to infants, children, and adolescents in various healthcare settings (hospitals, clinics, etc.).
This includes tasks like:
Monitoring vital signs and physical condition.
Administering medications and treatments.
Performing procedures as directed by doctors.
Assisting with daily living activities (bathing, feeding).
Providing emotional support and pain management.
2. Health Promotion and Education:
Objective: Promote healthy behaviors and educate children, families, and communities about preventive healthcare.
This includes tasks like:
Administering vaccinations.
Providing education on nutrition, hygiene, and development.
Offering breastfeeding and childbirth support.
Counseling families on safety and injury prevention.
3. Collaboration and Advocacy:
Objective: Collaborate effectively with doctors, social workers, therapists, and other healthcare professionals to ensure coordinated care for children.
Objective: Advocate for the rights and best interests of their patients, especially when children cannot speak for themselves.
This includes tasks like:
Communicating effectively with healthcare teams.
Identifying and addressing potential risks to child welfare.
Educating families about their child's condition and treatment options.
4. Professional Development and Research:
Objective: Stay up-to-date on the latest advancements in pediatric healthcare through continuing education and research.
Objective: Contribute to improving the quality of care for children by participating in research initiatives.
This includes tasks like:
Attending workshops and conferences on pediatric nursing.
Participating in clinical trials related to child health.
Implementing evidence-based practices into their daily routines.
By fulfilling these objectives, pediatric nurses play a crucial role in ensuring the optimal health and well-being of children throughout all stages of their development.
Leading the Way in Nephrology: Dr. David Greene's Work with Stem Cells for Ki...Dr. David Greene Arizona
As we watch Dr. Greene's continued efforts and research in Arizona, it's clear that stem cell therapy holds a promising key to unlocking new doors in the treatment of kidney disease. With each study and trial, we step closer to a world where kidney disease is no longer a life sentence but a treatable condition, thanks to pioneers like Dr. David Greene.
Leading the Way in Nephrology: Dr. David Greene's Work with Stem Cells for Ki...
Bioremediation and information technologies for sustainable management.pdf
1. BioMedSciDirect
Publications
Int J Biol Med Res.2023 ;14(4):7702-7711
Contents lists available at BioMedSciDirect Publications
Journal homepage: www.biomedscidirect.com
International Journal of Biological & Medical Research
International Journal of
BIOLOGICAL AND MEDICAL RESEARCH
www.biomedscidirect.com
Int J Biol Med Res
Volume 14, Issue 4, Oct 2023
Copyright 2023 BioMedSciDirect Publications IJBMR - ISSN: 0976:6685. All rights reserved.
c
ARTICLE INFO ABSTRACT
Keywords:
Biodegradation
Bioremediation
Environmental Sciences
Phytoremediation
Pollutants
1. Introduction
2. Concept of Sustainable Management
Withtheriseofnewchemicalbeingsynthesizedeveryyear,the
need to dispose them carefully while keeping in mind
environment's safety is also rising continuously along with the
development of the society every day. There are about 3,50,000
chemicals used commercially a crosse the globe while this number
wasjust60,000in2010[1].Thesechemicalsincludeheavymetals,
toxins, harsh chemicals, and non-degradable particles. These
chemicals are synthesised by utilizing resources from earth which
is draining humans towards depletions of these resources [2].
Therefore, we can observe a rise in chemicals turned into
environmental pollutants disturbing the normal balance of the
ecosystem.
Microbiologists, biotechnologists, and environmentalists are
trying to figure out new bioremediation techniques to dispose of
these environmental pollutants. We not only need to find methods
to dispose of these pollutants but also replenish these resources
back to the mother nature. Disposing of these chemicals by
traditional methods i.e., burning, giving simple physical or
chemical treatments, can cost government and private agencies
fortunes so we need cheap disposable methods too. These goals
couldbeachievedbybioremediation[3].
Bioremediation is a process (natural yet humans can replicate it to
useitfortheseownadvantages)bywhichmicroscopicorganisms'
decay, attenuate, transform, eliminate, or neutralise chemicals
from soil and water [4]. Advantages of bioremediation techniques
include lowcost, easy implementation, safe by-products, pollution
free procedure, versatility of remediating multiple chemicals and
its ability to be carried on site of dumping. In this research paper
we will try to see some of the current techniques of the
bioremediation, latest findings in this field and future aspects of
these techniques [5]. The approach of scientist recently has been
to retore pollutants without harming the environment at a cheap
cost.
We all know that the wastes or pollutants are generated in the
process or in the name of development of society or production of
goods that would get consumed by its population. we can say that
the waste is the undesired product of the development itself. Many
developed countries became developed by burning lots of fossil
fuel; therefore, it will be hypocritical of them to call out
underdeveloped countries trying to grow now. Even the
underdeveloped countries are now utilising the cleanest way
possible to a surplus production of goods. Still, they need to use
somenon-eco-friendlymethods[6].
Sustainable development is the concept of developing society
for more comfort and providing better living conditions to the
population without hurting the environment in the process.
Management of society and country as whole without producing
wastes is the goal of many countries’ latest policies [7].
Bioremediation is one such process where the waste or pollutant
produced by a country could be denatured, altered, or made
harmless. Apart from the bioremediation processes,
physiochemicaltreatmentcouldalsohelpinmanagingwastes.
Abstract. Bioremediation is a process by which microscopic organisms' decay, attenuate,
transform, eliminate, or neutralise chemicals from soil and water. Microbiologists,
biotechnologists, and environmentalists are trying to figure out new bioremediation
techniques to dispose of these environmental pollutants. We not only need to find methods to
dispose of these pollutants but also replenish these resources back to the mother nature. In
bioremediation a biological agent, usually a microbe, is utilized to mend or degrade a toxic
waste or pollutant from our natural environment, usually from soil. This review paper focuses
upon the current bioremediation techniques, its advantages, drawbacks, and prospects.
Considering all the possible ways to deal with pollutants and recover contaminated soil,
bioremediation is found to be the most effective, clean, and affordable management tool. In
recent years, in situ, ex-situ and permeable reactive barrier techniques have seen strong
scientific growth, especially due to the rise of bioinformatics. Not only microbes, including
aerobes, anaerobes, and fungi, but plants also are observed to be very good in remediation of
thepollutantsintheenvironment.
Review article
Bioremediation and Information Technologies for Sustainable Management
Jyoti Prakash, Aryan Shukla and Ruchi Yadav*
Amity Institute of Biotechnology, Amity University Uttar Pradesh, Lucknow Campus, India
* Corresponding Author :
Assistant Professor
Amity Institute of Biotechnology
Amity University Uttar Pradesh, Lucknow Campus
Malhaur, Near Railway Station,Gomti Nagar Extension,
Lucknow, Uttar Pradesh 226028 (INDIA)
Dr.Ruchi Yadav, M.Sc, M.Tech, Ph.D
Copyright 2023 BioMedSciDirect Publications IJBMR - All rights reserved.
c
2. 3. Physio-chemical treatments of pollutants
4. Bioremediation as green tool
Table 1 Optimum factors required during physio chemical
treatmentofpollutants(nameofpollutants)
3.1 Coagulation–flocculation treatments: Flocculation &
Coagulation are the physio-chemical processes utilized to remove
colloidal particles and finely suspended solid. Alum, lime, ferrous
sulphate, ferric sulphate, and ferric chloride are used as coagulating
agents as they form flocks which are larger in size so that they can
precipitate easily in the chambers or containers. The process of
sedimentation can only clear 50 to 70% of the total suspended
matter as 30 to 40% of the organic matter settles [8]. Whereas, in
coagulation and flocculation 80 to 90% of the suspended matter and
bacteria can be eliminated including effectively cleaning insoluble
dyes. However, the cost value of the process is doubtful taking cost of
treating the sludge into account. There are increasing number of
restrictionsonaccountofthedisposalofsludge[9].
3.2 Membrane separation processes: these physio-chemical
processes,isprovingtobepromisingfortextileeffluenttreatmentas
effluent quality is found to be improving. Common biologically
treated water was found to have good BOD (Biochemical Oxygen
Demand) and COD (Chemical Oxygen Demand) removal efficiency.
However, mineral parameters were not found to be in healthy limits
[10]. Henceforth, a viable alternative in this concern is membrane
separation. To decrease the fouling problems, different pre-
treatment is being considered. Filtration with normal filter paper
was used before microfiltration to reduce fouling problem, which
alsoincreasesthemembranelife.
Physicochemicalpre-treatmentlikeflocculationandcoagulation
were used before Nano filtration and reverse osmosis. Combination
of these processes are considered too according to the need.
Ultrafiltration is best suited for secondary textile wastewater [11].
Nanofiltration works best for low molecular weight species
separation. Nanofiltration sometimes produces reusable permeate.
Still, in nanofiltration treatment procedure, membrane fouling
occurs and therefore to prevent this problem ultrafiltration is taken
as pre-treatment. Even when direct ultrafiltration and ultrafiltration
(after microfiltration) were compared the latter gave better result
[12].
Bacteriaaregreatfriendswhocanhelptakecareofpollutantsfor
us humans. They form a complex symbiotic and synergistic zone
called rhizosphere zone where bioremediation takes place. But this
complex does not always work in the interest of humans which is
why scientists step in and try to alter rhizosphere zone [15]. The
recent developments are done utilizing proteomics
rhizoremediation, metabolic engineering, protein engineering, and
whole-transcriptome profiling when dealing pollutants like
chlorinated aliphatic and polychlorinated biphenyl and binding
heavy metals. Cell surface expression of specific proteins helped
creating microorganisms to transport, bioaccumulate and/or
detoxifyheavymetalsanddegradexenobiotics[16].
Degrading heavy metals is a difficult task since heavy metals
formscomplexesandstrongerbondswiththepollutants.Regardless
of this, they have, crucial functions in the environment like they are
micronutrients organisms needs to survive (chromium, nickel, zinc
etc) while some are useless (lead and mercury) [17]. An unseen
struggle between metal and microbes takes place as metal ions
become bactericidal at higher concentrations by inhibiting cell
metabolic reactions of microbes but after many generations bacteria
can develop resistance for that metal. At higher concentration they
decrease specific bacteria's population affecting their colony’s
diversity and lead to loss of biomass. Specifically speaking,
rhizobacteria has mutated resistance against heavy metals high
concentrations.Ithas5mechanisms[18]
1. Exclusion- where bacteria keep metal ions away from its target
siteandseparatespollutantsintheprocess.
2. Extrusion- where it digests pollutants and pushes the metals out
ofthecellwiththehelpofchromosomalorplasmidmediatedevents.
3. Accommodation- where it uses metal binding proteins (e.g.,
metallothienins) or other cell components to form complexes which
areharmlessinnature.
4. Bio-transformation- toxic metal is reduced to less toxic forms
usingchemicalsorproteinsproducedbyit.
5. Methylation & Demethylation- adding or subtracting of methyl
grouptothepollutant.
Bioremediation can be run with the help of microorganisms and
wastes or pollutants either in presence of oxygen (aerobic) or in
absence of oxygen (anaerobic). Mostly aerobic bioremediation is
carried out cause anaerobic bioremediation can lead to microbes
dying and formation of undesirable products. Then the process is
furtherdependentonfivemorefactorsi.e.,soil,redoxpotential,food,
pollutants,andtemperature[13].Thesoil’shydrology(thescienceof
the occurrence, distribution, and movement of water below the
Earth's surface) is considered before carrying out the process. The
soil’s pH, moisture content, structure and type affect the process too.
Redoxpotentialcanbedefinedasmeasureoftheabilityofachemical
species to acquire electrons from or lose electrons to an electrode
and can be reduced or oxidised, respectively. Food for microbes is
usually the pollutants we are trying to get rid of. They use it as source
of their energy. The food can be categorised as supplements
(electron acceptors like nitrogen and phosphorus etc.) and
substrates (methane, phenol, toluene etc.). other than these factors
some microbes can be used as catalysts in this process, for example
mixture of fungus cultures are used to bioremediate crude oil [14].
Table 1 shows environmental factors and optimum conditions that
arerequiredbyamicrobetocarryoutbioremediationprocess.
7703
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711
3. Many algae strains are tested out in labs to prove that it is possible to
remove heavy metals like chromium, zinc, and copper etc from
[19].
pollutedsoilorwatercompletely
5. Categoriesofbioremediation
It includes different techniques [20] like- a) Ex situ (Land
farming, Bioreactor- 1) Slurry reactors and 2) Aqueous reactors,
Windrow, Biopoile, Biostimulation, Composting, and Fungal
biodegradation); b) In situ 1) Natural attenuation and 2) Enhanced
(Bioslurping, Bioventing, Biosparging, Phytoremediation, and
Bioaugmentation); andc)Permeablereactivebarrierasexplainedin
Fig.1.
Fig. 2 Different types of ex situ bioremediation techniques
In situ as the name suggest is treatment of pollutants in its
original place or in the ground waters of that place. While ex situ
techniques include excavation of soil and laying it out on other
suitable places for the process to occur. The selection of the
technique is done based on 3 factors: - biochemistry of pollutants
and microbes, availability of nutrients to microbes and bioactivity of
microbes.
pollutants and microbes, availability of nutrients to microbes and
bioactivityofmicrobes.
5.1.1Landfarming
Biological processes are made to occur by humans. It is of
multiple types-base it is the simplest bioremediation technique, yet
itisdifficulttoclassifyitasinsituorexsitu.Usuallydecidedbasedon
the depth of pollutant whether soil will be tiled (in situ) or excavated
(ex situ). It is mostly ex situ (when pollutant is above 1 m of ground
surface, otherwise in situ) technique and has a lot common with
other ex situ techniques [25]. It is then spread on ground with
somethingtosupportit(andstopthepollutantsfromspreading)and
degrade by autochthonous microorganisms. Mostly it is done
without adding any nutrient with the help of air and water only
microbes degrade the waste, especially diesel and other
polyaromatichydrocarbons.
It is extremely cheap, simplest of all, and quite effective
technique. But it also has many limitations i.e., it is not so versatile as
it cannot treat volatile chemicals, it requires substantial amount of
land,andmicrobialactivityisleastinthistechnique[26].
5.1.2Composting
It takes place at higher temperatures (55-60 degrees Celsius)
produced by microbes when they degrade organic matter to make
compost. It turns biodegradable solid waste into humus like
substance. Compost is further used as fertilisers for soil therefore
this process is not only cheap but also commercially beneficial.
Contaminated soil is excavated, filtered to take out big rocks and
debris and transferred to a container. To supplement carbon source
agricultural wastes such as straw, alfalfa, manure, and wood chips
(called amendments) are used. This helps in reduction of pollution
as these agriculture wastes otherwise would have been dumped on
landorworsecouldhavebeenburneduptopollutetheair[27].
Amendments and soil are layered into long piles termed as
windrowswhicharemixedthoroughlywiththehelpofcommercially
available windrow turning machine. Multiple factors like
temperature, pH, and moisture are maintained. Upon completion of
composting period, these windrows are opened to take compost out
and used in fields. Its disadvantage is that it requires months and, in
somecases,cantakeayeartocomplete.Toboostuptheprocessnous
aswellastransienthydrocarbonoclasticbacteria [29].
Advantages of ex situ techniques includes: - is simplicity, lesser
timetaken,andversatilitytotreatawiderrangeofcontaminantsand
work on different soil types compared to in situ techniques. It
requires lesser to preliminary examination of polluted site before
bioremediation [21]. The continuous mixing the soil ensures
homogenized (when soil is excavated the big chunks gets broken
down in smaller pieces and microbes can easily communicate and
transport in soil), easy to observe and uniform degradation of
pollutant. It is usually done in closed controlled areas and i.e., labs,
buildings,workingsites,innercities,orsocietiesetc[22].
While its disadvantages are: -they always require excavation of
soil, large are to decompose pollutants and it requires treatment pre
and post process which leads to increase costs. Excavation also
disturbs the natural soil and can cause pollution while excavation or
transportation of soil [23]. More capital is also utilised in making
new supporters for the excavated soil. Ex situ techniques are of 2
types: - solid-phase soil treatment processes (e.g., landfarming, soil
biopiles,andcomposting)andslurry-phasesoiltreatmentprocesses
(slurry phase bioreactor). Types of ex situ bioremediation
techniques[24]includeareshowninFig.2.
Fig. 1 Cladogram depicting evolution and branching of several
typesofbioremediationtechniques
5.1Offsite (Ex situ)
7704
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711
4. 5.1.4Biopiling
In Biopiling excavated soil is taken to desired site, called
treatment area, and mixed with amendments and air is pumped like
bioventing. Soil piles can at max go up to 6 meters high. The products
formed at the end are carbon dioxide and water [30]. This process
usually requires a treatment bed, an aeration system to pump air, a
source of water and nutrient along with leachate (it is a liquid made
from rainfall and decomposed waste) collection system. Factors like
nutrients, oxygen, moisture, pH, and heat are maintained at
optimum levels to optimize biodegradation. The irrigation/nutrient
system is buried below the soil to pump mixture of air and nutrients
in it. It is suggested to cover soil piles with plastic sheets to decrease
evaporation,runoff,andvolatilization,anditalsohelpsincontrolling
temperature by solar heating [31]. Its best used to treat agricultural
and municipal wastes. Its limitation includes management of loss of
abioticandlowbioavailabilityanditcantakeup3to6months[32].
5.1.5Biostimulation
The original microbes are encouraged to breakdown the
pollutant in this manner. It usually entails adding nutrients (e.g.,
carbonandnitrogensources,O2),acidorbasestoadjustpH,orwater
or specified substrates to induce precise enzymes. It is a useful
bioremediation policy, albeit it has limited reproducibility and is
dependent on microbial population features. To encourage the
unique microbial communities, nitrogen and phosphorus-
containing substrates have been supplied [33]. During a 72-day bio
stimulation management with a mineral nutrient and surfactant
solution, a 39.5 percent decline in total hydrocarbon content of an
aged contamination of crude oil contaminated soil was reported
while studying the hydrocarbon-degrading bacterial population in
laboratory soil columns. The problem of nutrient scarcity has been
solvedbyusingfertilisers[34].
5.1.6BioreactorsTechniqueforbioremediation
Bioreactors are instruments in which biological processes are
made to occur by humans. It is of multiple types-based on how we
transfer nutrients in it and take out products from it: - batch
(simplest), fed-batch, sequencing batch, continuous and multistage.
Among these types, people choose one over another based on their
profitandtimeallotment[35].Inthebioreactor,nutrients,substrate,
or pollutant are added and optimum conditions for the growth of
microbesisprovided.Thecellsgrowin4phases:-lag,log,stationary,
and death. There are 2 different types of reactors based on the water
contentinreactor[36].
Slurryreactors
Stones and rubble are separated from the excavated soil
physically. It is also pre-washed in some circumstances to
concentrate pollutants into a smaller amount of soil. An aqueous
slurryismadebymixingcontaminatedsoil,silt,orsludgewithwater
and nutrients. The varying amounts of nutrients depending on the
concentration required for proper biodegradation (Typically, the
slurry includes between 10% and 30% solids by weight) [37]. To
keep solids floating and microorganisms in touch with soil
pollutants, the slurry is mixed. The slurry is dewatered at the end of
the operation, and the treated soil can be returned to its original
location. Only the polluted fines and the collected wastewater need
tobetreatedfurther[38].
Aqueousreactors
Here, bioreactors have copious amounts of water, hence the
name aqueous. It enhances mass transfer due to liquidity in the
reactor. It also ensures effective use of inoculants and surfactant. But
omatichydrocarbons[43]asexplainedinTable2.
it is not used commonly due to relatively high-cost capital. Toxin
concentrations and chances of contamination increases as microbes
cangrowinthehypertonicmedia[39]
5.1.7Fungalbiodegradation(Mycoremediation)
Fungal species can be also utilised to decolorize dyes. In most
cases, enzymatic degradation is the most common mechanism as
enzymes like laccase (Laccase’s activity is found in T. versicolor),
manganese peroxidase, and lignin peroxidase (Penicillium
chrysosporium’s lignin peroxidase decolourises dyes) degrades
dyes [40]. Aspergillus terreus SA3, a fungal isolated from textile
industry, is used for the removal of dye such as Sulfur black from
textileeffluent.Othercasesofsuccessfulbioremediationbyfungiare
combination of Doratomyces nanus, Doratomyces purpureofuscus,
Doratomyces verrucisporus, Myceliophthora thermophila, Phoma
eupyrena, and Thermoascus crustaceus degrading >70 % of
polychlorinated biphenyl [41]. Mycelium sterila 3 and R. stolonifer
working together to degrade 10% & 40% of metalaxyl and folpet in
vineyards soils respectively [42]. Alternaria alternata (AA-
1), Aspergillus flavus (AF-3), Aspergillus terreus (AT-7),
and Trichoderma harzianum (TH-5) working on crude oil to remove
73.6% of it. Alternaria alternata (AA-1), Aspergillus flavus (AF-
3), Aspergillus terreus (AT-7), and Trichoderma harzianum (TH-5)
degrading67.1%ofpolycyclicar
5.2Onsitetechniques(Insitu)
In situ bioremediation techniques are a lot cheaper when
compared alongside ex situ by saving cost of excavation of soil and
large amount of soil sample can be treated at once [44]. Types of in
situbioremediationtechniquesinclude:-
5.2.1Naturalattenuation
Itisthesimplestinsitubiologicalremediationbecausenutrients,
moisture content, temperature and oxygen can all occur naturally
within the ground. so, no action implies zero cost along with no
addition of harmful chemicals causing zero pollution and requiring
zero machinery [45]. Contaminant concentrations would be
monitored until they were lowered to acceptable levels. The
contaminants are being bio-degraded if there is no contaminant
movement (zero plume growth despite diffusion, dilution, or
dispersion)[46].
Table 2 Some fungus with remediation potent
7705
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711
5. It is commonly used for VOCs, SVOCs and fuel hydrocarbons are
commonly evaluated for natural attenuation. Some pesticides also
can be allowed to naturally attenuate (generally less effective). Only
if natural attenuation processes results in a change in the valence
state of the metal would it results in immobilisation of a metal
contaminant(e.g.,chromium)(noactualtreatment)[47].
Waste generation and transfer are reduced. Less bothersome
(only ground monitoring wells required). Can be used in conjunction
with or as a 'polish' treatment following other (active) remedial
procedures (depending on site conditions, cleanup aims, and
permissible treatment time), for example. Modeling (if possible) and
performance monitoring are generally less expensive than active
remediation (until sufficient contaminant levels have been reached)
[48].
Disadvantage of the process being too slow (if require rapid
remediation or have fast groundwater flow). More education &
communication efforts are required to gain public acceptance of
MNA (Monitored Natural Attenuation). Toxicity and/or mobility of
contaminant may be too great. Long-term, more extensive
performance monitoring reqd. longer time to achieve clean-up
objectives. Typically requires several years. Site characterisation
(modelling/evaluation)maybemorecomplexandcostly[49].
5.2.2Enhanced
Enhanced bioremediation is type of bioremediation where some
factors are altered off natural attenuation [50]. It is of multiple
differenttypesasexplainedinFig.3.
Biosparging
This approach is pumping air under pressure into the
groundwater to increase oxygen levels and slowthe rate of biological
deteriorationofthecontaminatedareabynaturallypresentbacteria.
The installation of small-diameter air inoculation points is
straightforward and inexpensive, allowing for significant flexibility
inthearrangement'sformandstructure[51].Itisresponsibleforthe
expansion of the saturated region and, as a result, the interaction
between soil and groundwater. This is the most well-organized and
non-invasive technology with native microorganisms'
biodegradative abilities and the presence of metals and inorganic
chemicals[52].
Fig. 3 Different types of enhanced in situ bioremediation
techniques
Bioventing
It is an improved biological version of remediation techniques
known as soil vapor vacuum extraction where a vacuum pump is
used to push air in wells. These air bubbles collect pollutants from
groundwater and raise it to the ground level where it is collected and
discarded. On the other hand, in bioventing we supply oxygen
containing air directly to residual contaminants, mostly petroleum-
oil lubricants, at a low rate enough to keep microbes alive and
functioning [53]. This helps in movement of biodegraded wastes as
vapours in biologically active soil while avoiding volatility of
chemicalstointerferewiththeprocess.Itisfeasibleandlowcostasit
onlyrequiresablowerandwell.
In latest findings, it is seen that bioventing can be done by
pumping air along with nutrients directly on the pollutant soil to
biodegrade simple hydrocarbons [54]. Limitation of bioventing is
rare cases when we are unable to deliver oxygen to the polluted soil
or there is insufficient aeration in shallow contamination. It is also
quiteslowerprocesscomparedtoothers.
Bioaugmentation
This occurs when a collection of pre-selected organisms, typical
microbial strains, or a genetically modified alternative is used to
treat contaminated soil or water, increasing the rate or amount of
bioremediation, or both. It is commonly utilised in the treatment of
municipal wastewater. Bioremediation is mostly dependent on the
importedspecies'competitivepotentialandthebioavailabilityofthe
xenobiotic chemicals in this process. Bioavailability refers to the
compound's attainment and subsequent transformation and is
linked to its chemical characteristics as well as a variety of soil
physical and chemical conditions [55]. The microorganisms used
must be perfectly suited to the waste pollution and metabolites
produced. Bio augmentation is utilised on chlorinated ethenes (e.g.,
tetrachloroethylene and trichloroethylene) contaminated soil and
groundwater. In situ microorganisms can break these contaminants
into ethylene and chloride which are not toxic. Petroleum-
hydrocarbons have been reported to be degraded by various
commercialmicroorganisms[56].
When a hydrocarbon-polluted Antarctic soil was bioaugmented
with a psychrotolerant strain, 75 percent of the hydrocarbon was
removed (B-2-2). After a 10-week management, the two fungal
species were able to remove PAHs from the polluted soil, with
concentrations of phenanthrene, anthracene, fluoranthene, and
pyrene dropping by up to 66 percent. Irpex lacteus and Pleurotus
ostreatus, two white rot fungus species, were employed as
inoculums in the bioremediation of petroleum hydrocarbon-
contaminated soil from a manufactured-gas-plant-area [57]. The
capacity to degrade most petroleum components, feasibility during
storage, genetic strength, and rapid growth in successive storage, a
high stage of enzymatic activity and development in the
surroundings, competence to resist native microorganisms, no
pathogenicity, and inability to create lethal metabolites are the most
well-known qualities of valuable seed organisms. Some members of
the group were able to digest 70% of the crude oil enzymatically,
while others destroyed crude oil through the production of bio
surfactantandrhamnolipid[58].
Different microbes for different wastes can be broken down by
different bacteria like Baikal EM1, a microbiological compound, can
degrade up to 96.7% of benzo(a)pyrene in contaminated soils. A
psychrotolerant strain can degrade up to 75% of hydrocarbon while
Irpex lacteus and Pleurotus ostreatus can degrade up to 70% of
crudeoil[59]asexplainedinTable3.
7706
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711
6. Table 3 Percentage pollutants removed via bioaugmentation Table 4 types of plants with remediation ability
5.3 Permeable reactive barrier technique
Table 5: Combined techniques clearing pollutants.
Phytoremediation
Green plants have been proposed to be used for in situ soil
phytoremediation, which has become a popular research and
development topic. Plant-assisted bioremediation, also known as
phytoremediation, is the use of green or higher terrestrial plants to
treat chemically or radioactively polluted soils. In a laboratory trial,
some researchers quantified and compared the responses of soil
microbial communities to polycyclic aromatic hydrocarbons (PAHs).
Researchers discovered that bacterial 1-aminocyclopropane-1-
carboxylate (ACC) deaminase regulates ethylene levels in plants by
converting ACC into -ketobutyric acid and ammonia. A recent paper
describes the development of transgenic poplars (Populus)
overexpressing a mammalian cytochrome P450, a family of enzymes
involved in the metabolism of toxic compounds [60]. The engineered
plants demonstrated improved performance in the metabolism of
trichloroethylene as well as the removal of a variety of toxic volatile
organic pollutants such as vinyl chloride, carbon tetrachloride,
chloroform, and benzene. Some researchers suggested that
transgenic plants could help to expand and improve the safety of
phytoremediation. Herbicides are economically important, but the
non-point pollution they cause can have a negative impact on the
environment. Herbicide phytoremediation has been extensively
researchedusingconventionalplants[61].
Both in-situ and ex-situ, the cost of phytoremediation is lower
than that of previous procedures. It is simple to keep track of the
plants. The potential for valuable products to be recovered and
reused. It makes use of naturally occurring organisms and keeps the
environment in its natural state. The fundamental advantage of
phytoremediation is its low cost (up to 1000 times less expensive
thanexcavationandreburial)[62].
The surface area and depth occupied by the roots are limited in
phytoremediation;slowdevelopmentandlowbiomassnecessitatea
long-term commitment. It is impossible to totally avoid the leaching
of pollutants into groundwater using plant-based remediation
techniques (without the complete removal of the contaminated
ground, which does not resolve the problem of contamination) [63].
The toxicity of polluted land, the general health of the soil, and the
bioaccumulation of contaminants, which then transfer into the food
chain from primary level consumers upwards, have an impact on
plant survival. Because of the limitations of phytoremediation,
researchers devised the innovative concept of bioremediation in
tandemwithrhizoremediation[64].
Mostly plants take up heavy metal pollutants from the polluted
soil via roots’ absorption like Salvinia natans takes up 7.40 mg/g of
Cr [18]. Elodea densa takes up 177 µg/g of Hg [19]. Oryza sativa L.
takes up 77-162 mg/kg, 77-162 mg/kg, and 49-199 mg/kg of Fe, Cd,
and As respectively . Raphanus sativus L. takes up 40.2 mg/kg, 49.3
mg/kg, 43.8 mg/kg, and 1.1 mg/kg of Pb, Cu, Zn and Ni respectively
[65]asgiveninTable4.
This is newer physical technique for remediation of
contaminated groundwater. Biological reactions like degradation,
precipitation, and sorption are one of several pollutant removal
mechanisms in PRB (Permeable Reactive Barrier) approach. PRB is
an in-situ bioremediation technique for cleaning groundwater
heavily contaminated with pollutants (usually heavy metals and
chlorinatedchemicals)[66].
Here, we take semi-permanent or permanent reactive barrier
(medium usually constituting of a 0 valent iron) is dipped in the way
of movement of polluted groundwater. The polluted water flows
through this barrier with its natural gradient and simultaneously
pollutants get trapped in barrier. These pollutants undergo series of
reactions leaving water clean. Ideally speaking, these barriers
should be reactive enough to trap pollutants as well as permeable
enough to let water flow but not pollutants [67]. They should also be
less expensive, accessible, and passive with little energy input. This
technique’s effectiveness depends on the type of media used more
than any other factor. The type of media used is of course based on
environmentalandhealthinfluence,pollutanttype,cost,mechanical
stability,biogeochemicalandhydrogeologicalconditions[68].
Lately, researchers tried combining PRB with other methods
such as electrokinetics and it resulted in 90 % nitrate degradation
from spiked clay soil in just 1 week. While combining electrokinetic
soilflushingwith biological-PRBresultedin 30%dieseldegradation
from clay soil and again Bio-PRB technique with electrokinetic
resulted in 39 % diesel degradation from diesel-polluted soils both
injust2weeksasshowninTable5[69].
7707
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711
7. By combing different methods factors (nutrients, pH,
temperature) affecting microbial growth in polluted soil were
maintained at suitable environmental conditions and it results in
distributionofsurfactantbiomassthroughoutthepollutedsoil.Inan
artificial laboratory-scale aquifer, Trametes versicolor (a white-rot
fungus) when used as bio-barrier carried out 97 % degradation of
Orange G dye. It opened gates for the potential of different fungus in
naturalaquiferstobeusedasafilteringbarrier(PRB)[70].
Many physical or mechanical uncertainties can significantly
affectthegeneralizationofPBRtechnique‘sperformance.Intheiron
PRBs, these uncertainties could be reduced in future by
amalgamation of independent experiments and many more field
observations directed towards increasing our understanding its
surfacedeactivationmechanism[71].
6.InformaticsinBioremediation
Information technology (IT) have lots of impact on
bioremediation research. Bioinformatics and computational biology
playkeyroleinidentificationofgenesdegradingpollutantsandhave
higher impact on genomics based research [72]. Number of genes
have been identified from different microbes, fungus that plays
critical role in bioremediation and biodegradation process. With the
advent of bioinformatics gene prediction tools, ORF prediction tools
etc. have been used to predict genes in bacteria, algae, fungus, plants
thathavebiodegradingpotential[73].
Genomics, Metagenomics, Metabolomics, proteomics,
Metaproteomics research have been used in identification and
prediction of genes/ proteins that have function in biodegradation
process. This information of biodegrading genes and proteins can be
used to enhance gene/ protein expression and can be used for
bioremediation tool [74]. Table 6 enlist the different bioinformatics
databasesthatareusedinbioremediationresearch.
Table 6 List of databases used for bioremediation research
alongwithinformationavailableandURL
7. DisadvantagesofBioremediation
When we compare bioremediation to physical or chemical
treatments, we find that it is extremely slow. Bioremediation is not
versatile enough. It cannot be used to treat inorganic chemicals and
few organic chemicals too, but it is newer method therefore it is not
tested out for many chemicals. In lab experiments while developing
these techniques it is tough to examine the end products of the
reaction. Many pollutants have low (high chlorine containing
compounds) to no (polyethene) biodegradability. While some
pollutants break down to become even more harmful to society (e.g.,
TCE to vinyl chloride). There are multiple factors affecting the
processofbioremediationanditgetsdifficulttocontrolallthese.
8.Conclusion
Analogy of bioreactors (with wastes being the waste in reactors)
works best to explain our current standing in the field of
bioremediation. Just like the bacteria in new media we scientific
minds are also in lag phase in process of producing solution to
increasing waste problem. We are trying out different possible
methods to consume the waste and turn it into useful product. With
the development of biotechnology and our understanding of
microbes we surely get new and newer number of methods along
with newly developed genetically modified bacterial species are
coming into light, the field of bioremediation becomes inevitable
solution for waste management. With new research fungus, plants,
and even membranes of microbes are being utilized to clear
contaminates. Many combinations of different techniques have also
shown in labs significant conversion of wastes into harmless
products. Heavy metals which were considered impossible to be
treated by microorganisms once. Now a Strain of CW-96-1 was able
to remove 99% of cadmium from industry discharged water in
just140 hr period [13]. Hence, we are getting closer to log phase
when we will be able to bioremediate waste faster than waste is
generated and once we eliminate significant waste, industries and
societies will also take note of it and might produce more
environmental pollutants. Resulting in us being in stationary phase.
People need to be educated about environmental issues and need to
implement waste management in their daily life. With these
implementation waste can be reduced at significant scale so that
scientist might even stop researching new techniques as the already
developed ones are enough to sustain good, hygienic, and proper life
onearth.
9.Discussion
In this paper, recent advancements, and follow-ups of the
techniques available to mankind for biologically treating the wastes
and pollutants are enlisted and described in logical order. The types,
subtypes, definitions, integration with different techniques,
pollutants it degrades (in percentage), mode of action, advantages,
and disadvantages etc of bioremediation are mentioned along with
diagrams and tables. This paper mostly focuses on very recent
advancements in bioremediation, i.e., permeable membrane
technology, fungal bioremediation, phytoremediation, and role of
informaticsinthisfield.Theamalgamationofcomputationalbiology,
informatics or bioinformatics with environmental technology has
led to development of new field of study called ecoinformatics or
ecologicalinformatics.
Without a doubt, advancements in computational biology,
informatics or bioinformatics have significantly made theorising,
researching, testing, and implementing different techniques,
7708
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711
8. microbes, enzymes, and tools for bioremediation easier for the
scientists. Different ecoinformatics’ tools are described in this paper
helps in coming up with new proteins, enzymes, combination of
microbes, combination of different techniques or even novel
microbes which can better remediate wastes and further help clean
our planet. Even gathering intel about the techniques and microbes
available currently to scientists for bioremediation is made easier
with the different ecoinformatics databases. And then testing out
these novel genes, proteins, processes, or microbes is made easier
with the dry lab stimulation software which further helps cutting
downthecost,effort,andtimeofresearchers.
Acknowledgments
We would like to acknowledge Amity Institute of biotechnology,
Amity University Uttar Pradesh, Lucknow campus for providing us
facilitiestoconductingthisstudy.
Ethicalissue
Noethicalissuesinvolved.
Competinginterests
Authordeclaresnoconflictofinterest
7709
1. Wang Z, Walker GW, Muir DC, Nagatani-Yoshida K. Toward a global
understanding of chemical pollution: a first comprehensive analysis of
national and regional chemical inventories. Environmental science &
technology.2020Jan22;54(5):2575-84.
2. Pande V, Pandey SC, Sati D, Pande V, Samant M. Bioremediation: an emerging
effective approach towards environment restoration. Environmental
Sustainability.2020Mar;3(1):91-103.
3. Parween T, Bhandari P, Sharma R, Jan S, Siddiqui ZH, Patanjali PK.
Bioremediation: a sustainable tool to prevent pesticide pollution. InModern
age environmental problems and their remediation 2018 (pp. 215-227).
Springer,Cham.
4. Sharma I. Bioremediation techniques for polluted environment: concept,
advantages, limitations, and prospects. InTrace Metals in the Environment-
NewApproachesandRecentAdvances2020Dec7.IntechOpen.
5. Shukla KP, Singh NK, Sharma S. Bioremediation: developments, current
practicesandperspectives.GenetEngBiotechnolJ.2010Jan1;3:1-20.
6. YadavAN,SuyalDC,KourD,RajputVD,RastegariAA,SinghJ.Bioremediation
andWasteManagementforEnvironmentalSustainability.JournalofApplied
Biology&Biotechnology.2022;10(2):1-5.
7. Singh P, Singh VK, Singh R, Borthakur A, Madhav S, Ahamad A, Kumar A, Pal
DB, Tiwary D, Mishra PK. Bioremediation: a sustainable approach for
management of environmental contaminants. InAbatement of
environmentalpollutants2020Jan1(pp.1-23).Elsevier.
8. Ajaz M, Shakeel S, Rehman A. Microbial use for azo dye degradation—a
strategy for dye bioremediation. International Microbiology. 2020
May;23(2):149-59.
9. Saxena G, Kishor R, Zainith S, Bharagava RN. Environmental contamination,
toxicity profile and bioremediation technologies for treatment and
detoxification of textile effluent. InBioremediation for Environmental
Sustainability2021Jan1(pp.415-434).Elsevier.
10. Lee DJ, Hsieh MH. Forward osmosis membrane processes for wastewater
bioremediation: Research needs. Bioresource technology. 2019 Oct
1;290:121795.
11. Srivastava A, Rani RM, Patle DS, Kumar S. Emerging bioremediation
technologies for the treatment of textile wastewater containing synthetic
dyes: a comprehensive review. Journal of Chemical Technology &
Biotechnology.2022Jan;97(1):26-41.
12. Puggioni G, Milia S, Dessì E, Unali V, Pous N, Balaguer MD, Puig S, Carucci A.
Combining electro-bioremediation of nitrate in saline groundwater with
concomitantchlorineproduction.WaterResearch.2021Nov1;206:117736.
13. Garg S, Rumjit NP, Thomas P, Lai CW. Bioremediation of Agricultural
Wastewater. Applied Water Science: Remediation Technologies. 2021 Jun
22;2:565-79.
14. SaeedMU,HussainN,SumrinA,ShahbazA,NoorS,BilalM,AleyaL,IqbalHM.
Microbial bioremediation strategies with wastewater treatment
potentialities–A review. Science of The Total Environment. 2021 Nov
17:151754.
15. Al-Zaban MI, Mahmoud MA, AlHarbi MA, Bahatheq AM. Bioremediation of
crude oil by rhizosphere fungal isolates in the presence of silver
nanoparticles. International journal of environmental research and public
health.2020Sep;17(18):6564.
16. Li L, Zhou T, Zhong L, Zhou Q, Gu G, Hu M, Chen F, Lin S. Bioremediation of
quinclorac injury on tobacco by a rhizosphere bacterium. World Journal of
MicrobiologyandBiotechnology.2022Sep;38(9):1-4.
17. Awasthi G, Prakash J. Biodegradation of textile waste by bacterial strains.
JournalofGlobalBioscience.2014;3(1):379-84.
18. Dua M, Singh A, Sethunathan N, Johri A. Biotechnology and bioremediation:
successes and limitations. Applied microbiology and biotechnology. 2002
Jul;59(2):143-52.
19. Chitara MK, Chauhan S, Singh RP. Bioremediation of Polluted Soil by Using
Plant Growth–Promoting Rhizobacteria. InMicrobial Rejuvenation of
PollutedEnvironment2021(pp.203-226).Springer,Singapore.
20. KumarV,ShahiSK,SinghS.Bioremediation:aneco-sustainableapproachfor
restoration of contaminated sites. InMicrobial bioprospecting for
sustainabledevelopment2018(pp.115-136).Springer,Singapore.
21. Maitra S. Ex situ bioremediation–an overview. Res J Life Sci Bioinformatics
PharmChemSciSciBioinformaticsPharmChemSci.2018;4(6):422-37.
22. Zheng C. The Application of Carbon Nanotubes in Permeable Reactive
Barriers (PRBs) for Groundwater Remediation. In2022 International
Conference on Social Sciences and Humanities and Arts (SSHA 2022) 2022
Apr8(pp.920-923).AtlantisPress.
23. Zhang Y, Labianca C, Chen L, De Gisi S, Notarnicola M, Guo B, Sun J, Ding S,
Wang L. Sustainable ex-situ remediation of contaminated sediment: a
review.EnvironmentalPollution.2021Oct15;287:117333.
24. Sayqal A, Ahmed OB. Advances in heavy metal bioremediation: an overview.
AppliedBionicsandBiomechanics.2021Nov11;2021.
25. EnglertCJ,KenzieEJ,DragunJ.Bioremediationofpetroleumproductsinsoil.
InPrinciplesandpracticesforpetroleumcontaminatedsoils2019Jul16(pp.
111-130).Routledge.
26. Hazen TC. Bioremediation. InThe microbiology of the terrestrial deep
subsurface2018Jan10(pp.247-266).CRCPress.
27. Leech C, Tighe MK, Pereg L, Winter G, McMillan M, Esmaeili A, Wilson SC.
Bioaccessibility constrains the co-composting bioremediation of field aged
PAH contaminated soils. International Biodeterioration & Biodegradation.
2020Apr1;149:104922.
28. Lin C, Cheruiyot NK, Bui XT, Ngo HH. Composting and its application in
bioremediation of organic contaminants. Bioengineered. 2022 Jan
1;13(1):1073-89.
29. Patel AK, Singhania RR, Albarico FP, Pandey A, Chen CW, Dong CD. Organic
wastes bioremediation and its changing prospects. Science of The Total
Environment.2022Feb15:153889.
30. BenyahiaF,AbdulkarimM,ZekriA,ChaalalO,HasanainH.Bioremediationof
crude oil contaminated soils: A black art or an engineering challenge?.
ProcessSafetyandEnvironmentalProtection.2005Jul1;83(4):364-70.
31. Jabbar NM, Kadhim EH, Mohammed AK. Bioremediation of soil
contaminated with diesel using biopile system. Al-Khwarizmi Engineering
Journal.2018Aug15;14(3):48-56.
32. Nayak A, Bhushan B, Wilson I. Current Soil Bioremediation Technologies: An
Assessment. InAdvances in Bioremediation and Phytoremediation for
SustainableSoilManagement2022(pp.17-29).Springer,Cham.
REFERENCES
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711
9. 7710
53. Shivalkar S, Singh V, Sahoo AK, Samanta SK, Gautam PK. Bioremediation: a
potential ecological tool for waste management. InBioremediation for
EnvironmentalSustainability2021Jan1(pp.1-21).Elsevier.
54. Sales da Silva IG, Gomes de Almeida FC, Padilha da Rocha e Silva NM, Casazza
AA, Converti A, Asfora Sarubbo L. Soil bioremediation: Overview of
technologiesandtrends.Energies.2020Sep8;13(18):4664.
55. Medaura MC, Guivernau M, Moreno-Ventas X, Prenafeta-Boldú FX, Viñas M.
Bioaugmentation of native fungi, an efficient strategy for the bioremediation
of an aged industrially polluted soil with heavy hydrocarbons. Frontiers in
microbiology.2021Mar31;12:626436.
56. Płaza GR, Ulfig K, Hazen TC, Brigmon RL. Use of molecular techniques in
bioremediation.ActaMicrobiolPol.2001Jan1;50(3-4):205-18.
57. Lara-Moreno A, Morillo E, Merchán F, Madrid F, Villaverde J. Bioremediation
of a trifluralin contaminated soil using bioaugmentation with novel isolated
bacterial strains and cyclodextrin. Science of The Total Environment. 2022
Sep20;840:156695.
58. Wood TK. Molecular approaches in bioremediation. Current Opinion in
Biotechnology.2008Dec1;19(6):572-8.
59. de Souza Vandenberghe LP, Junior NL, Valladares-Diestra KK, Karp SG,
Siqueira JG, Rodrigues C, Soccol CR. Enzymatic bioremediation: current
status, challenges, future prospects, and applications. InDevelopment in
Wastewater Treatment Research and Processes 2022 Jan 1 (pp. 355-381).
Elsevier.
60. Yan A, Wang Y, Tan SN, Mohd Yusof ML, Ghosh S, Chen Z. Phytoremediation: a
promisingapproachforrevegetationofheavymetal-pollutedland.Frontiers
inPlantScience.2020Apr30;11:359.
61. Shah V, Daverey A. Phytoremediation: A multidisciplinary approach to clean
up heavy metal contaminated soil. Environmental Technology & Innovation.
2020May1;18:100774.
62. Sharma P. Efficiency of bacteria and bacterial assisted phytoremediation of
heavymetals:anupdate.BioresourceTechnology.2021May1;328:124835.
63. Muthusaravanan S, Sivarajasekar N, Vivek JS, Paramasivan T, Naushad M,
Prakashmaran J, Gayathri V, Al-Duaij OK. Phytoremediation of heavy metals:
mechanisms,methodsandenhancements.Environmentalchemistryletters.
2018Dec;16(4):1339-59.
64. Arshad M, Saleem M, Hussain S. Perspectives of bacterial ACC deaminase in
phytoremediation.TRENDSinBiotechnology.2007Aug1;25(8):356-62.
65. FaisalAA,SulaymonAH,KhaliefaQM.Areviewofpermeablereactivebarrier
as passive sustainable technology for groundwater remediation.
International Journal of Environmental Science and Technology. 2018
May;15(5):1123-38.
66. Maamoun I, Eljamal O, Falyouna O, Eljamal R, Sugihara Y. Multi-objective
optimization of permeable reactive barrier design for Cr (VI) removal from
groundwater. Ecotoxicology and Environmental Safety. 2020 Sep
1;200:110773.
67. Upadhyay S, Sinha A. Role of microorganisms in Permeable Reactive Bio-
Barriers (PRBBs) for environmental clean-up: A review. Global Nest J. 2018
Jul1;20(2):269-80.
68. Han X, Wong YS, Tam NF. Surface complexation mechanism and modeling in
Cr (III) biosorption by a microalgal isolate, Chlorella miniata. Journal of
ColloidandInterfaceScience.2006Nov15;303(2):365-71.
69. Chaturvedi R, Prakash J, Awasthi G. Microbial bioremediation: an advanced
approach for waste management. Int J Eng Technol Sci Res. 2016 May;3:50-
62.
70. Azubuike CC, Chikere CB, Okpokwasili GC. Bioremediation
techniques–classification based on site of application: principles,
advantages, limitations and prospects. World Journal of Microbiology and
Biotechnology.2016Nov;32(11):1-8.
71. Pandey B, Fulekar MH. Bioremediation technology: a new horizon for
environmentalclean-up.BiologyandMedicine.2012;4(1):51.
72. Kumari P, Kumar Y. Bioinformatics and computational tools in
bioremediation and biodegradation of environmental pollutants.
InBioremediation for environmental sustainability 2021 Jan 1 (pp. 421-
444).Elsevier.
33. Raimondo EE, Saez JM, Aparicio JD, Fuentes MS, Benimeli CS.
Bioremediation of lindane-contaminated soils by combining of
bioaugmentation and biostimulation: Effective scaling-up from microcosms
to mesocosms. Journal of Environmental Management. 2020 Dec
15;276:111309.
34. Bai Y, Liang B, Yun H, Zhao Y, Li Z, Qi M, Ma X, Huang C, Wang A. Combined
bioaugmentation with electro-biostimulation for improved bioremediation
of antimicrobial triclocarban and PAHs complexly contaminated sediments.
JournalofHazardousMaterials.2021Feb5;403:123937.
35. Tekere M, Jacob-Lopes E, Zepka LQ. Microbial bioremediation and different
bioreactorsdesignsapplied.London,UK:IntechOpen;2019Oct11.
36. Sayed K, Baloo L, Sharma NK. Bioremediation of total petroleum
hydrocarbons (TPH) by bioaugmentation and biostimulation in water with
floating oil spill containment booms as bioreactor basin. International
Journal of Environmental Research and Public Health. 2021
Mar;18(5):2226.
37. Babalola R, Efeovbokhan VE, Atiku YO, Usoro UE, Ibeh MA, Alagbe EE,
Omoleye JA, Abatan OG. Slurry-Phase Bioremediation of Ogoni Land Crude
Oil Contaminated Soil. InIOP Conference Series: Materials Science and
Engineering2021Apr1(Vol.1107,No.1,p.012167).IOPPublishing.
38. Celin SM, Sahai S, Kalsi A, Bhanot P. Environmental monitoring approaches
used during bioremediation of soils contaminated with hazardous explosive
chemicals. Trends in Environmental Analytical Chemistry. 2020 Jun
1;26:e00088.
39. Bhaskaran K, Russel JG. A Low-Cost In-Situ Bioremediation Process for
PerchlorateContaminatedAqueousPhase.AvailableatSSRN4147156.
40. Akhtar N, Mannan MA. Mycoremediation: expunging environmental
pollutants.Biotechnologyreports.2020Jun1;26:e00452.
41. Horel A, Schiewer S. Microbial degradation of different hydrocarbon fuels
withmycoremediationofvolatiles.Microorganisms.2020Jan23;8(2):163.
42. Bosco F, Mollea C. Mycoremediation in soil. Environmental chemistry and
recentpollutioncontrolapproaches.2019Feb25:173.
43. Gupta S, Pathak B. Mycoremediation of polycyclic aromatic hydrocarbons.
InAbatement of environmental pollutants 2020 Jan 1 (pp. 127-149).
Elsevier.
44. MaitraS.Insitubioremediation—anoverview.ResponsibilityofLifeScience
InformaticsPublications.2018.
45. Varjani S, Upasani VN. Influence of abiotic factors, natural attenuation,
bioaugmentation and nutrient supplementation on bioremediation of
petroleum crude contaminated agricultural soil. Journal of environmental
management.2019Sep1;245:358-66.
46. Cabrera S, Zubillaga M, Montserrat JM. Natural attenuation and
bioremediation of chlorpyrifos and endosulfan in periurban horticultural
soils of Buenos Aires (Argentina) using microcosms assays. Applied Soil
Ecology.2022Jan1;169:104192.
47. Kreling NE, Simon V, Fagundes VD, Thomé A, Colla LM. Simultaneous
production of lipases and biosurfactants in solid-state fermentation and use
in bioremediation. Journal of Environmental Engineering. 2020 Sep
1;146(9):04020105.
48. Gomez F, Sartaj M. Field scale ex-situ bioremediation of petroleum
contaminated soil under cold climate conditions. International
Biodeterioration&Biodegradation.2013Nov1;85:375-82.
49. El-Aziz AR, Al-Othman MR, Hisham SM, Shehata SM. Evaluation of crude oil
biodegradation using mixed fungal cultures. PloS one. 2021 Aug
26;16(8):e0256376.
50. Pete AJ, Bharti B, Benton MG. Nano-enhanced bioremediation for oil spills: a
review.ACSES&TEngineering.2021Apr29;1(6):928-46.
51. Tyagi B, Kumar N. Bioremediation: principles and applications in
environmental management. InBioremediation for environmental
sustainability2021Jan1(pp.3-28).Elsevier.
52. Barik P, Biswal T, Malik JA. Assessment of Current Soil Bioremediation
Technologies. InBioremediation and Phytoremediation Technologies in
Sustainable Soil Management 2022 Jun 30 (pp. 147-184). Apple Academic
Press.
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711
10. 7711
74. Patil A, Yesankar P, Bhanse P, Maitreya A, Kapley A, Qureshi A. Omics
Perspective: Molecular Blueprint for Agrochemical Bioremediation Process
in the Environment. InAgrochemicals in Soil and Environment 2022 (pp.
585-608).Springer,Singapore.
73. Slama HB, Cherif-Silini H, Bouket AC, Silini A, Alenezi FN, Luptakova L, Vallat
A,BelbahriL.Biotechnologyandbioinformaticsofendophytesinbiocontrol,
bioremediation, and plant growth promotion. InEndophytes: Mineral
NutrientManagement,Volume32021(pp.181-205).Springer,Cham.
All rights reserved.
Copyright 2023 BioMedSciDirect Publications IJBMR - ISSN: 0976:6685.
c
Jyoti Prakash et al./Int J Biol Med Res.14(4):7702-7711