Adapting to adversity: insights from a stand-alone human immunodeficiency virus testing centre in india during the covid-19 pandemic
Authors:Sumathi Muralidhar*, Abhishek Lachyan
Int J Biol Med Res. 2024; 15(1): 7750-7755
https://www.biomedscidirect.com/2857/adapting-to-adversity-insights-from-a-stand-alone-human-immunodeficiency-virus-testing-centre-in-india-during-the-covid-19-pandemic
A Study to Assess the Post Covid Home Quarantine Stress Level in Second Wave ...ijtsrd
AIM The present study aims to assess the post covid home quarantine stress level in second wave among general population in selected community at SMCH. METHODS AND MATERIALS A descriptive research design was used for the present study. A total 50 samples were collected using non probability purposive sampling technique. The demographic variable and level of stress was assessed using structured questioner, followed by that data was gathered and analyzed. RESULTS the results the study revealed that there is a significant association between level of stress and demographic variable among the general population at the level of p 0.01 conclusion Thus, the present despites that factors associated with level of stress and demographic variable among general population. Dayana. B. A. A | Nagalakshmi. H "A Study to Assess the Post Covid Home Quarantine Stress Level in Second Wave among General Population in a Selected Community" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-7 | Issue-5 , October 2023, URL: https://www.ijtsrd.com/papers/ijtsrd59990.pdf Paper Url: https://www.ijtsrd.com/medicine/other/59990/a-study-to-assess-the-post-covid-home-quarantine-stress-level-in-second-wave-among-general-population-in-a-selected-community/dayana-b-a-a
Current Status and Future Perspective of Rapid Diagnostic Kits Vaccine agains...ijtsrd
Coronavirus disease 2019 COVID 19 , which causes serious respiratory illness such as pneumonia and lung failure, was first reported in Wuhan, the capital of Hubei, China. The etiological agent of COVID 19 has been confirmed as a novel coronavirus, now known as severe acute respiratory syndrome coronavirus 2 SARS CoV 2 , which is most likely originated from zoonotic coronaviruses, like SARS CoV, which emerged in 2002. Rapid diagnostics, vaccines and therapeutics are important interventions for the management of the 2019 novel coronavirus 2019 nCoV outbreak. Currently, various diagnostic kits to test for COVID 19 are available and several repurposing therapeutics for COVID 19 have shown to be clinically effective. In addition, global institutions and companies have begun to develop vaccines for the prevention of COVID 19. Here, we review the current status of, diagnosis, and vaccine development for COVID 19. M A Nandedkar | R A Shinde | S S Bansode "Current Status and Future Perspective of Rapid Diagnostic Kits / Vaccine against COVID-19" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-4 | Issue-4 , June 2020, URL: https://www.ijtsrd.com/papers/ijtsrd30977.pdf Paper Url :https://www.ijtsrd.com/pharmacy/analytical-chemistry/30977/current-status-and-future-perspective-of-rapid-diagnostic-kits--vaccine-against-covid19/m-a-nandedkar
ASSESSMENT OF KNOWLEDGE REGARDING HOSPITAL ACQUIRED INFECTIONS (NOSOCOMIAL INFECTION) AMONG HEALTH CARE WORKERS IN A TERTIARY CARE HOSPITAL OF WAH CANTT
The Study to a Assess the Effectiveness of Tailored Program on Preventive Mea...ijtsrd
AIM the present study aims to assess the effectiveness of tailored program on preventive measures of covid 19 infections among mother having kids below 2 years of age at Smch. METHODS AND MATERIALS A quantitative research design was used for the present study. A total 100 samples were collected using quota sampling technique. The demographic variable and pretest posttest level of preventive measures of covid 19 among mothers having kids below 2 years was assessed using structured questioner, and the mothers were exposed to tailored programme on preventive measures of covid, followed by that data was gathered and analyzed. RESULTS the results the study revealed that there is a significant association between posttest of selected demographic at the level of p 0.01 conclusion Thus, the present despites that factors associated with posttest level of selected demographic. Dayana. B. A. A | Devabharathi M "The Study to a Assess the Effectiveness of Tailored Program on Preventive Measures of Covid 19 Infections among Mother Having Kids Below 2 Years of Age" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-7 | Issue-5 , October 2023, URL: https://www.ijtsrd.com/papers/ijtsrd60021.pdf Paper Url: https://www.ijtsrd.com/medicine/other/60021/the-study-to-a-assess-the-effectiveness-of-tailored-program-on-preventive-measures-of-covid-19-infections-among-mother-having-kids-below-2-years-of-age/dayana-b-a-a
A Study to Assess the Post Covid Home Quarantine Stress Level in Second Wave ...ijtsrd
AIM The present study aims to assess the post covid home quarantine stress level in second wave among general population in selected community at SMCH. METHODS AND MATERIALS A descriptive research design was used for the present study. A total 50 samples were collected using non probability purposive sampling technique. The demographic variable and level of stress was assessed using structured questioner, followed by that data was gathered and analyzed. RESULTS the results the study revealed that there is a significant association between level of stress and demographic variable among the general population at the level of p 0.01 conclusion Thus, the present despites that factors associated with level of stress and demographic variable among general population. Dayana. B. A. A | Nagalakshmi. H "A Study to Assess the Post Covid Home Quarantine Stress Level in Second Wave among General Population in a Selected Community" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-7 | Issue-5 , October 2023, URL: https://www.ijtsrd.com/papers/ijtsrd59990.pdf Paper Url: https://www.ijtsrd.com/medicine/other/59990/a-study-to-assess-the-post-covid-home-quarantine-stress-level-in-second-wave-among-general-population-in-a-selected-community/dayana-b-a-a
Current Status and Future Perspective of Rapid Diagnostic Kits Vaccine agains...ijtsrd
Coronavirus disease 2019 COVID 19 , which causes serious respiratory illness such as pneumonia and lung failure, was first reported in Wuhan, the capital of Hubei, China. The etiological agent of COVID 19 has been confirmed as a novel coronavirus, now known as severe acute respiratory syndrome coronavirus 2 SARS CoV 2 , which is most likely originated from zoonotic coronaviruses, like SARS CoV, which emerged in 2002. Rapid diagnostics, vaccines and therapeutics are important interventions for the management of the 2019 novel coronavirus 2019 nCoV outbreak. Currently, various diagnostic kits to test for COVID 19 are available and several repurposing therapeutics for COVID 19 have shown to be clinically effective. In addition, global institutions and companies have begun to develop vaccines for the prevention of COVID 19. Here, we review the current status of, diagnosis, and vaccine development for COVID 19. M A Nandedkar | R A Shinde | S S Bansode "Current Status and Future Perspective of Rapid Diagnostic Kits / Vaccine against COVID-19" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-4 | Issue-4 , June 2020, URL: https://www.ijtsrd.com/papers/ijtsrd30977.pdf Paper Url :https://www.ijtsrd.com/pharmacy/analytical-chemistry/30977/current-status-and-future-perspective-of-rapid-diagnostic-kits--vaccine-against-covid19/m-a-nandedkar
ASSESSMENT OF KNOWLEDGE REGARDING HOSPITAL ACQUIRED INFECTIONS (NOSOCOMIAL INFECTION) AMONG HEALTH CARE WORKERS IN A TERTIARY CARE HOSPITAL OF WAH CANTT
The Study to a Assess the Effectiveness of Tailored Program on Preventive Mea...ijtsrd
AIM the present study aims to assess the effectiveness of tailored program on preventive measures of covid 19 infections among mother having kids below 2 years of age at Smch. METHODS AND MATERIALS A quantitative research design was used for the present study. A total 100 samples were collected using quota sampling technique. The demographic variable and pretest posttest level of preventive measures of covid 19 among mothers having kids below 2 years was assessed using structured questioner, and the mothers were exposed to tailored programme on preventive measures of covid, followed by that data was gathered and analyzed. RESULTS the results the study revealed that there is a significant association between posttest of selected demographic at the level of p 0.01 conclusion Thus, the present despites that factors associated with posttest level of selected demographic. Dayana. B. A. A | Devabharathi M "The Study to a Assess the Effectiveness of Tailored Program on Preventive Measures of Covid 19 Infections among Mother Having Kids Below 2 Years of Age" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-7 | Issue-5 , October 2023, URL: https://www.ijtsrd.com/papers/ijtsrd60021.pdf Paper Url: https://www.ijtsrd.com/medicine/other/60021/the-study-to-a-assess-the-effectiveness-of-tailored-program-on-preventive-measures-of-covid-19-infections-among-mother-having-kids-below-2-years-of-age/dayana-b-a-a
Proposed Protocol for Improving Staff Nurses` Awareness and Self – Efficacy w...ijtsrd
The awareness and preparedness in managing Novel Coronavirus SARS CoV 2 Outbreak infection are most important to prevent the further spread. Aim This study aimed to propose a protocol for improving staff nurses` awareness and self – efficacy with Novel Coronavirus SARS CoV 2 Outbreak. Subjects and Method A descriptive design was utilized in this study that was conducted in the units of Critical Care and Emergency for adults surgery, medicine and pediatrics at El Sayed Galal and Ain Shams University Hospitals. A random sample was composed of 180 nurses with different ages, gender, education and experiences were recruited from the above mentioned settings. The study tools were 1 Self administered questionnaire sheet to assess nurses awareness about Novel Coronavirus SARS CoV 2 Outbreak. 2 General self efficacy scale. 3 Ways of Coping Questionnaire for Staff Nurses. 4 Competency obstacles assessment sheet. Results Mean age of studied nurses was 33.4±27.2 added to their awareness and self efficacy need for improvement. Moreover, there were many obstacles affecting their competency. Conclusion Overall, the current study concluded that nearly half of studied nurses had satisfactory awareness about Novel Coronavirus SARS CoV 2 and their role during the outbreak. Meanwhile, less than half of them had high self – efficacy and positive coping. In addition, majority of them had competency obstacles during their work on outbreak time. Recommendations Further research study should be done to implement and nvestigate the effect of this proposed protocol for such group of nurses. Lamiaa A. Elsayed | Soad M. Hegazy | Rania M. Abueldahab | Manal A. Ahmed | Salwa O. Elkhattab "Proposed Protocol for Improving Staff Nurses` Awareness and Self – Efficacy with Novel Coronavirus SARS-Cov-2 Outbreak" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-4 | Issue-5 , August 2020, URL: https://www.ijtsrd.com/papers/ijtsrd31871.pdf Paper Url :https://www.ijtsrd.com/medicine/other/31871/proposed-protocol-for-improving-staff-nurses`-awareness-and-self-–-efficacy-with-novel-coronavirus-sarscov2-outbreak/lamiaa-a-elsayed
The COVID-19 global pandemic has caused huge disruption to health system. These findings aim to highlight the immediate and long-term impact of the COVID-19 breakdown on palliative care services at the national level and the institutional level, and suggest lessons for future outbreaks.
SYSTEMS-LEVEL QUALITY IMPROVEMENTFrom Cues to Nudge A Knolisandrai1k
SYSTEMS-LEVEL QUALITY IMPROVEMENT
From Cues to Nudge: A Knowledge-Based Framework
for Surveillance of Healthcare-Associated Infections
Arash Shaban-Nejad1,2 & Hiroshi Mamiya2 & Alexandre Riazanov3 & Alan J. Forster4 &
Christopher J. O. Baker2,5 & Robyn Tamblyn2 & David L. Buckeridge2
Received: 3 June 2015 /Accepted: 30 September 2015 /Published online: 4 November 2015
# Springer Science+Business Media New York 2015
Abstract We propose an integrated semantic web framework
consisting of formal ontologies, web services, a reasoner and a
rule engine that together recommend appropriate level of
patient-care based on the defined semantic rules and guide-
lines. The classification of healthcare-associated infections
within the HAIKU (Hospital Acquired Infections – Knowl-
edge in Use) framework enables hospitals to consistently fol-
low the standards along with their routine clinical practice and
diagnosis coding to improve quality of care and patient safety.
The HAI ontology (HAIO) groups over thousands of codes
into a consistent hierarchy of concepts, along with relation-
ships and axioms to capture knowledge on hospital-associated
infections and complications with focus on the big four types,
surgical site infections (SSIs), catheter-associated urinary tract
infection (CAUTI); hospital-acquired pneumonia, and blood
stream infection. By employing statistical inferencing in our
study we use a set of heuristics to define the rule axioms to
improve the SSI case detection. We also demonstrate how the
occurrence of an SSI is identified using semantic e-triggers.
The e-triggers will be used to improve our risk assessment of
post-operative surgical site infections (SSIs) for patients un-
dergoing certain type of surgeries (e.g., coronary artery bypass
graft surgery (CABG)).
Keywords Ontologies . Knowledge modeling .
Healthcare-associated infections . Surveillance . Semantic
framework . Surgical site infections
Introduction
Healthcare-associated Infections (HAIs) affect millions of
patients around the world, killing hundreds of thousands
and imposing, directly or indirectly, a significant socio-
economic burden on healthcare systems [1]. According
to the Centers for Disease Control (CDC) [2], hospital-
acquired infections in the U.S., where the point preva-
lence of HAIs among hospitalized patients is 4 %, result
in an estimated 1.7 million infections, which lead to as
many as 99,000 deaths and cost up to $45 billion annually
[3, 4]. Similar or higher rates of HAI occur in other coun-
tries as well with an estimated 10.5 % of patients in Ca-
nadian hospitals having an HAI [5]. Clinical assessment
and laboratory testing are generally used to detect and
confirm an infection, identify its origin, and determine
appropriate infection control methods to stop the infection
from spreading within a healthcare institution. Failure to
monitor, and detect HAI in timely manner can delay di-
agnosis, leading to complications (e.g., sepsis), and
allowing an epid ...
SYSTEMS-LEVEL QUALITY IMPROVEMENTFrom Cues to Nudge A Kno.docxdeanmtaylor1545
SYSTEMS-LEVEL QUALITY IMPROVEMENT
From Cues to Nudge: A Knowledge-Based Framework
for Surveillance of Healthcare-Associated Infections
Arash Shaban-Nejad1,2 & Hiroshi Mamiya2 & Alexandre Riazanov3 & Alan J. Forster4 &
Christopher J. O. Baker2,5 & Robyn Tamblyn2 & David L. Buckeridge2
Received: 3 June 2015 /Accepted: 30 September 2015 /Published online: 4 November 2015
# Springer Science+Business Media New York 2015
Abstract We propose an integrated semantic web framework
consisting of formal ontologies, web services, a reasoner and a
rule engine that together recommend appropriate level of
patient-care based on the defined semantic rules and guide-
lines. The classification of healthcare-associated infections
within the HAIKU (Hospital Acquired Infections – Knowl-
edge in Use) framework enables hospitals to consistently fol-
low the standards along with their routine clinical practice and
diagnosis coding to improve quality of care and patient safety.
The HAI ontology (HAIO) groups over thousands of codes
into a consistent hierarchy of concepts, along with relation-
ships and axioms to capture knowledge on hospital-associated
infections and complications with focus on the big four types,
surgical site infections (SSIs), catheter-associated urinary tract
infection (CAUTI); hospital-acquired pneumonia, and blood
stream infection. By employing statistical inferencing in our
study we use a set of heuristics to define the rule axioms to
improve the SSI case detection. We also demonstrate how the
occurrence of an SSI is identified using semantic e-triggers.
The e-triggers will be used to improve our risk assessment of
post-operative surgical site infections (SSIs) for patients un-
dergoing certain type of surgeries (e.g., coronary artery bypass
graft surgery (CABG)).
Keywords Ontologies . Knowledge modeling .
Healthcare-associated infections . Surveillance . Semantic
framework . Surgical site infections
Introduction
Healthcare-associated Infections (HAIs) affect millions of
patients around the world, killing hundreds of thousands
and imposing, directly or indirectly, a significant socio-
economic burden on healthcare systems [1]. According
to the Centers for Disease Control (CDC) [2], hospital-
acquired infections in the U.S., where the point preva-
lence of HAIs among hospitalized patients is 4 %, result
in an estimated 1.7 million infections, which lead to as
many as 99,000 deaths and cost up to $45 billion annually
[3, 4]. Similar or higher rates of HAI occur in other coun-
tries as well with an estimated 10.5 % of patients in Ca-
nadian hospitals having an HAI [5]. Clinical assessment
and laboratory testing are generally used to detect and
confirm an infection, identify its origin, and determine
appropriate infection control methods to stop the infection
from spreading within a healthcare institution. Failure to
monitor, and detect HAI in timely manner can delay di-
agnosis, leading to complications (e.g., sepsis), and
allowing an epid.
Repurposed existing drugs and updated global health policy and clinical guidelines will be essential for limiting the social and economic devastation caused by this virus. So, we are leading a three-phase multinational Network Medicine clinical study (MNM COVID-19 study). The study will apply Network Medicine methodologies to repurpose existing drugs for SARS-CoV-2 infected patients and update global health policy and clinical guidelines.
The number of article submissions to CMI in 2020 was 4315
(Fig. 1), almost twice the number of submissions in 2019. In 2020
we accepted 9% of the original submissions. A large percentage of
submissions were on COVID-19. We have tried to maintain the
usual quality of our editorial process, and at the same time shorten
the time to publication for relevant studies [1].
The CMI Clarivate impact factor (IF) for 2020 is an impressive
8.067, an increase of 13% compared with the 2019 figure, and of
76% compared with 2015 (Fig. 2). CMI is now fifth on the list of infectious disease journals ranked by IF. The impact factor is certainly
not the most important indicator of quality for journals. However, it
does convey a progressive improvement of the journal and a
growing interest from CMI readers.
In 2020 we reduced the mean time to first decision to 21.5 days
for articles that were sent for revision after peer-review; and to
16.5 days for article rejected after peer-review (Fig. 3). The spread
around this figure is still large. Some of our authors have experienced delays in the editorial process, accentuated by the fatigue
of the Corona year. We are making an effort to improve the time
Socio-demographic Characteristics of Clients Visiting Integrated Counseling and Testing Centre (ICTC) at SMS Medical College, Jaipur (Rajasthan) India-Human immunodeficiency virus (HIV) infection is a global pandemic and India counts for 10% of the global HIV burden and 65% of that in the South and South-East Asia. This study of clients of ICTC was carried out to know the association of HIV positivity with socio-demographic variables. Total 2412 clients have visited at ICTC of SMS Medical College, Jaipur, either voluntarily or referred by various department of this institute in ICTC in 1st quarter of 2009. They Overall HIV positivity was found 12.35% with a significant difference in voluntary and referred clients i.e. 83.59% v/s 8.36%. It was also found that HIV positivity is more in reproductive age group than extremes of ages, more in females than males, more in person who were married but presently single because of separation of spouse, divorce form spouse or death of spouse than the unmarried or married living with their spouses.
Clinical Research Centre (CRC) Perak (Hospital Ipoh, Hospital Taiping, Hospital Seri Manjung) has just released their new Network Bulletin. This edition focused on COVID-19 Vaccine Trial and COVID-19 Research Priorities.
5 Direct Practice Improvement Project ProspectusAntim.docxtarifarmarie
5
Direct Practice Improvement Project Prospectus
Antimicrobial Stewardship program (ASP): An evidence based quality assurance measure in combating Healthcare Associated Clostridium Difficile Infection in an acute care facility and the role of the Staff Nurse.
Submitted by
Date
Insert Chairperson Name
Prospectus Instructions:
1. Read the entire Prospectus Template to understand the requirements for writing your Prospectus. Each section contains a narrative overview of what should be included in the section and a table with criteria required for each section. These criteria will be used to assess the prospectus for overall quality and feasibility of the proposed research study.
2. As you draft each section, delete the narrative instructions and insert your work related to that section. Use the criteria table for each section to ensure that you address the requirements for that particular section. Do not delete/remove the criteria table as this is used by you and your Committee to evaluate your prospectus.
3. Prior to submitting your prospectus for review by your Chair or Methodologist, use the criteria table for each section to complete a self-evaluation, inserting what you believe is your score for each listed criteria into the Learner Self-Evaluation column.
4. The scoring for the criteria ranges from a 0-3 as defined below. Complete a realistic and thoughtful evaluation of your work. Your Chair and Methodologist will also use the criteria tables to evaluate your work.
5. Your Prospectus should be between 6-10 pages when the tables are deleted.
Score
Assessment
0
Item Not Present
1
Item is Present, But Does Not Meet Expectations: Not all components are present. Large gaps are present in the components that leave the reader with significant questions. All items scored at 1 must be addressed by learner per reviewer comments.
2
Item Approaches Meeting Expectations, But Needs Revision: Component is present and adequate. Small gaps are present that leave the reader with questions. Any item scored at 2 must be addressed by the learner per the reviewer comments.
3
Item Meets Expectations: Component is addressed clearly and comprehensively. No gaps are present that leave the reader with questions. No changes required.
2
Introduction
The world today is faced with very dangerous infectious diseases due to antibiotic resistance and in the United States, the Centers for Disease Control and Prevention (CDC), has named this escalating antibiotic resistance as one of the top five threats in the country (CDC, 2017). According to statistics from the CDC, drug-resistant bacteria cause more than 20, 000 deaths annually and result to 2 million cases of disease recurrence annually (Lagier et al., 2015). For this reason, there is an increased need to make changes to the clinical practice to encourage appropriate use of antibiotics. In late 2014, the President’s Council of Advisors on Science and Technology (PCAST) published a report on how to combat.
Population-scale and rapid testing for SARS-CoV-2 continues to be a priority for several parts of the world. We revisit the in vitro technology platforms for COVID-19 testing and diagnostics—molecular tests and rapid antigen tests, serology or antibody tests, and tests for the management of COVID-19 patients. Within each category of tests, we review the commercialized testing platforms, their analyzing systems, specimen collection protocols, testing methodologies, supply chain logistics, and related attributes. Our discussion is essentially focused on test products that have been granted emergency use authorization by the FDA to detect and diagnose COVID-19 infections. Different strategies for scaled-up and faster screening are covered here, such as pooled testing, screening programs, and surveillance testing. The near-term challenges lie in detecting subtle infectivity profiles, mapping the transmission dynamics of new variants, lowering the cost for testing, training a large healthcare workforce, and providing test kits for the masses. Through this review, we try to understand the feasibility of universal access to COVID-19 testing and diagnostics in the near future while being cognizant of the implicit tradeoffs during the development and distribution cycles of new testing platforms.
Assignment on Covid 19 | Tutors India.pptxTutors India
Tutors india thesis and dissertation writing help guarantees that your dissertation is confidential, and so you do not have to worry about it.
For #Enquiry:
World: https://www.tutorsindia.com
UK: https://www.tutorsindia.com/uk
UAE: https://tutorsindia.com/ae/
Australia:https://www.tutorsindia.com/au/
Newzealand: https://www.tutorsindia.com/nz/
(UK): +44-1143520021
Mail: info@tutorsindia.com
Mail: info@tutorsuk.co.uk
(Whatsapp): +91-8754446690
Porocarcinoma of the nose- reconstructed with seagull flap
Authors:Balasubramaniam, Ramanandham, Pradeep, Sivakumar, Kalpa Pandya
Int J Biol Med Res. 2024; 15(1): 7760-7763
https://www.biomedscidirect.com/2847/porocarcinoma-of-the-nose-reconstructed-with-seagull-flap
Surgical excision of infiltrative mammary lipoma in a twelve-year old local breed of bitch through modified radical mastectomy
Authors:Melkamu Birhanu Meharu & Jiregna Dugassa Kittesa
Int J Biol Med Res. 2024; 15(1): 7756-7759
https://www.biomedscidirect.com/2848/surgical-excision-of-infiltrative-mammary-lipoma-in-a-twelve-year-old-local-breed-of-bitch-through-modified-radical-mastectomy
Assessment of trend of mortality due to poisoning in the northern zone of india and comparison with other international & national researches
Authors:Naveen Sharma, Kunal Khanna, Kuldeep Kumar, Tarun Dagar, Sandeep Kumar Giri, Vijay Pal Khanagwal
Int J Biol Med Res. 2024; 15(1): 7741-7745
https://www.biomedscidirect.com/2824/assessment-of-trend-of-mortality-due-to-poisoning-in-the-northern-zone-of-india-and-comparison-with-other-international-national-researches
More Related Content
Similar to Adapting to adversity insights from a stand-alone human immunodeficiency virus testing centre in india during the covid-19 pandemic.pdf
Proposed Protocol for Improving Staff Nurses` Awareness and Self – Efficacy w...ijtsrd
The awareness and preparedness in managing Novel Coronavirus SARS CoV 2 Outbreak infection are most important to prevent the further spread. Aim This study aimed to propose a protocol for improving staff nurses` awareness and self – efficacy with Novel Coronavirus SARS CoV 2 Outbreak. Subjects and Method A descriptive design was utilized in this study that was conducted in the units of Critical Care and Emergency for adults surgery, medicine and pediatrics at El Sayed Galal and Ain Shams University Hospitals. A random sample was composed of 180 nurses with different ages, gender, education and experiences were recruited from the above mentioned settings. The study tools were 1 Self administered questionnaire sheet to assess nurses awareness about Novel Coronavirus SARS CoV 2 Outbreak. 2 General self efficacy scale. 3 Ways of Coping Questionnaire for Staff Nurses. 4 Competency obstacles assessment sheet. Results Mean age of studied nurses was 33.4±27.2 added to their awareness and self efficacy need for improvement. Moreover, there were many obstacles affecting their competency. Conclusion Overall, the current study concluded that nearly half of studied nurses had satisfactory awareness about Novel Coronavirus SARS CoV 2 and their role during the outbreak. Meanwhile, less than half of them had high self – efficacy and positive coping. In addition, majority of them had competency obstacles during their work on outbreak time. Recommendations Further research study should be done to implement and nvestigate the effect of this proposed protocol for such group of nurses. Lamiaa A. Elsayed | Soad M. Hegazy | Rania M. Abueldahab | Manal A. Ahmed | Salwa O. Elkhattab "Proposed Protocol for Improving Staff Nurses` Awareness and Self – Efficacy with Novel Coronavirus SARS-Cov-2 Outbreak" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-4 | Issue-5 , August 2020, URL: https://www.ijtsrd.com/papers/ijtsrd31871.pdf Paper Url :https://www.ijtsrd.com/medicine/other/31871/proposed-protocol-for-improving-staff-nurses`-awareness-and-self-–-efficacy-with-novel-coronavirus-sarscov2-outbreak/lamiaa-a-elsayed
The COVID-19 global pandemic has caused huge disruption to health system. These findings aim to highlight the immediate and long-term impact of the COVID-19 breakdown on palliative care services at the national level and the institutional level, and suggest lessons for future outbreaks.
SYSTEMS-LEVEL QUALITY IMPROVEMENTFrom Cues to Nudge A Knolisandrai1k
SYSTEMS-LEVEL QUALITY IMPROVEMENT
From Cues to Nudge: A Knowledge-Based Framework
for Surveillance of Healthcare-Associated Infections
Arash Shaban-Nejad1,2 & Hiroshi Mamiya2 & Alexandre Riazanov3 & Alan J. Forster4 &
Christopher J. O. Baker2,5 & Robyn Tamblyn2 & David L. Buckeridge2
Received: 3 June 2015 /Accepted: 30 September 2015 /Published online: 4 November 2015
# Springer Science+Business Media New York 2015
Abstract We propose an integrated semantic web framework
consisting of formal ontologies, web services, a reasoner and a
rule engine that together recommend appropriate level of
patient-care based on the defined semantic rules and guide-
lines. The classification of healthcare-associated infections
within the HAIKU (Hospital Acquired Infections – Knowl-
edge in Use) framework enables hospitals to consistently fol-
low the standards along with their routine clinical practice and
diagnosis coding to improve quality of care and patient safety.
The HAI ontology (HAIO) groups over thousands of codes
into a consistent hierarchy of concepts, along with relation-
ships and axioms to capture knowledge on hospital-associated
infections and complications with focus on the big four types,
surgical site infections (SSIs), catheter-associated urinary tract
infection (CAUTI); hospital-acquired pneumonia, and blood
stream infection. By employing statistical inferencing in our
study we use a set of heuristics to define the rule axioms to
improve the SSI case detection. We also demonstrate how the
occurrence of an SSI is identified using semantic e-triggers.
The e-triggers will be used to improve our risk assessment of
post-operative surgical site infections (SSIs) for patients un-
dergoing certain type of surgeries (e.g., coronary artery bypass
graft surgery (CABG)).
Keywords Ontologies . Knowledge modeling .
Healthcare-associated infections . Surveillance . Semantic
framework . Surgical site infections
Introduction
Healthcare-associated Infections (HAIs) affect millions of
patients around the world, killing hundreds of thousands
and imposing, directly or indirectly, a significant socio-
economic burden on healthcare systems [1]. According
to the Centers for Disease Control (CDC) [2], hospital-
acquired infections in the U.S., where the point preva-
lence of HAIs among hospitalized patients is 4 %, result
in an estimated 1.7 million infections, which lead to as
many as 99,000 deaths and cost up to $45 billion annually
[3, 4]. Similar or higher rates of HAI occur in other coun-
tries as well with an estimated 10.5 % of patients in Ca-
nadian hospitals having an HAI [5]. Clinical assessment
and laboratory testing are generally used to detect and
confirm an infection, identify its origin, and determine
appropriate infection control methods to stop the infection
from spreading within a healthcare institution. Failure to
monitor, and detect HAI in timely manner can delay di-
agnosis, leading to complications (e.g., sepsis), and
allowing an epid ...
SYSTEMS-LEVEL QUALITY IMPROVEMENTFrom Cues to Nudge A Kno.docxdeanmtaylor1545
SYSTEMS-LEVEL QUALITY IMPROVEMENT
From Cues to Nudge: A Knowledge-Based Framework
for Surveillance of Healthcare-Associated Infections
Arash Shaban-Nejad1,2 & Hiroshi Mamiya2 & Alexandre Riazanov3 & Alan J. Forster4 &
Christopher J. O. Baker2,5 & Robyn Tamblyn2 & David L. Buckeridge2
Received: 3 June 2015 /Accepted: 30 September 2015 /Published online: 4 November 2015
# Springer Science+Business Media New York 2015
Abstract We propose an integrated semantic web framework
consisting of formal ontologies, web services, a reasoner and a
rule engine that together recommend appropriate level of
patient-care based on the defined semantic rules and guide-
lines. The classification of healthcare-associated infections
within the HAIKU (Hospital Acquired Infections – Knowl-
edge in Use) framework enables hospitals to consistently fol-
low the standards along with their routine clinical practice and
diagnosis coding to improve quality of care and patient safety.
The HAI ontology (HAIO) groups over thousands of codes
into a consistent hierarchy of concepts, along with relation-
ships and axioms to capture knowledge on hospital-associated
infections and complications with focus on the big four types,
surgical site infections (SSIs), catheter-associated urinary tract
infection (CAUTI); hospital-acquired pneumonia, and blood
stream infection. By employing statistical inferencing in our
study we use a set of heuristics to define the rule axioms to
improve the SSI case detection. We also demonstrate how the
occurrence of an SSI is identified using semantic e-triggers.
The e-triggers will be used to improve our risk assessment of
post-operative surgical site infections (SSIs) for patients un-
dergoing certain type of surgeries (e.g., coronary artery bypass
graft surgery (CABG)).
Keywords Ontologies . Knowledge modeling .
Healthcare-associated infections . Surveillance . Semantic
framework . Surgical site infections
Introduction
Healthcare-associated Infections (HAIs) affect millions of
patients around the world, killing hundreds of thousands
and imposing, directly or indirectly, a significant socio-
economic burden on healthcare systems [1]. According
to the Centers for Disease Control (CDC) [2], hospital-
acquired infections in the U.S., where the point preva-
lence of HAIs among hospitalized patients is 4 %, result
in an estimated 1.7 million infections, which lead to as
many as 99,000 deaths and cost up to $45 billion annually
[3, 4]. Similar or higher rates of HAI occur in other coun-
tries as well with an estimated 10.5 % of patients in Ca-
nadian hospitals having an HAI [5]. Clinical assessment
and laboratory testing are generally used to detect and
confirm an infection, identify its origin, and determine
appropriate infection control methods to stop the infection
from spreading within a healthcare institution. Failure to
monitor, and detect HAI in timely manner can delay di-
agnosis, leading to complications (e.g., sepsis), and
allowing an epid.
Repurposed existing drugs and updated global health policy and clinical guidelines will be essential for limiting the social and economic devastation caused by this virus. So, we are leading a three-phase multinational Network Medicine clinical study (MNM COVID-19 study). The study will apply Network Medicine methodologies to repurpose existing drugs for SARS-CoV-2 infected patients and update global health policy and clinical guidelines.
The number of article submissions to CMI in 2020 was 4315
(Fig. 1), almost twice the number of submissions in 2019. In 2020
we accepted 9% of the original submissions. A large percentage of
submissions were on COVID-19. We have tried to maintain the
usual quality of our editorial process, and at the same time shorten
the time to publication for relevant studies [1].
The CMI Clarivate impact factor (IF) for 2020 is an impressive
8.067, an increase of 13% compared with the 2019 figure, and of
76% compared with 2015 (Fig. 2). CMI is now fifth on the list of infectious disease journals ranked by IF. The impact factor is certainly
not the most important indicator of quality for journals. However, it
does convey a progressive improvement of the journal and a
growing interest from CMI readers.
In 2020 we reduced the mean time to first decision to 21.5 days
for articles that were sent for revision after peer-review; and to
16.5 days for article rejected after peer-review (Fig. 3). The spread
around this figure is still large. Some of our authors have experienced delays in the editorial process, accentuated by the fatigue
of the Corona year. We are making an effort to improve the time
Socio-demographic Characteristics of Clients Visiting Integrated Counseling and Testing Centre (ICTC) at SMS Medical College, Jaipur (Rajasthan) India-Human immunodeficiency virus (HIV) infection is a global pandemic and India counts for 10% of the global HIV burden and 65% of that in the South and South-East Asia. This study of clients of ICTC was carried out to know the association of HIV positivity with socio-demographic variables. Total 2412 clients have visited at ICTC of SMS Medical College, Jaipur, either voluntarily or referred by various department of this institute in ICTC in 1st quarter of 2009. They Overall HIV positivity was found 12.35% with a significant difference in voluntary and referred clients i.e. 83.59% v/s 8.36%. It was also found that HIV positivity is more in reproductive age group than extremes of ages, more in females than males, more in person who were married but presently single because of separation of spouse, divorce form spouse or death of spouse than the unmarried or married living with their spouses.
Clinical Research Centre (CRC) Perak (Hospital Ipoh, Hospital Taiping, Hospital Seri Manjung) has just released their new Network Bulletin. This edition focused on COVID-19 Vaccine Trial and COVID-19 Research Priorities.
5 Direct Practice Improvement Project ProspectusAntim.docxtarifarmarie
5
Direct Practice Improvement Project Prospectus
Antimicrobial Stewardship program (ASP): An evidence based quality assurance measure in combating Healthcare Associated Clostridium Difficile Infection in an acute care facility and the role of the Staff Nurse.
Submitted by
Date
Insert Chairperson Name
Prospectus Instructions:
1. Read the entire Prospectus Template to understand the requirements for writing your Prospectus. Each section contains a narrative overview of what should be included in the section and a table with criteria required for each section. These criteria will be used to assess the prospectus for overall quality and feasibility of the proposed research study.
2. As you draft each section, delete the narrative instructions and insert your work related to that section. Use the criteria table for each section to ensure that you address the requirements for that particular section. Do not delete/remove the criteria table as this is used by you and your Committee to evaluate your prospectus.
3. Prior to submitting your prospectus for review by your Chair or Methodologist, use the criteria table for each section to complete a self-evaluation, inserting what you believe is your score for each listed criteria into the Learner Self-Evaluation column.
4. The scoring for the criteria ranges from a 0-3 as defined below. Complete a realistic and thoughtful evaluation of your work. Your Chair and Methodologist will also use the criteria tables to evaluate your work.
5. Your Prospectus should be between 6-10 pages when the tables are deleted.
Score
Assessment
0
Item Not Present
1
Item is Present, But Does Not Meet Expectations: Not all components are present. Large gaps are present in the components that leave the reader with significant questions. All items scored at 1 must be addressed by learner per reviewer comments.
2
Item Approaches Meeting Expectations, But Needs Revision: Component is present and adequate. Small gaps are present that leave the reader with questions. Any item scored at 2 must be addressed by the learner per the reviewer comments.
3
Item Meets Expectations: Component is addressed clearly and comprehensively. No gaps are present that leave the reader with questions. No changes required.
2
Introduction
The world today is faced with very dangerous infectious diseases due to antibiotic resistance and in the United States, the Centers for Disease Control and Prevention (CDC), has named this escalating antibiotic resistance as one of the top five threats in the country (CDC, 2017). According to statistics from the CDC, drug-resistant bacteria cause more than 20, 000 deaths annually and result to 2 million cases of disease recurrence annually (Lagier et al., 2015). For this reason, there is an increased need to make changes to the clinical practice to encourage appropriate use of antibiotics. In late 2014, the President’s Council of Advisors on Science and Technology (PCAST) published a report on how to combat.
Population-scale and rapid testing for SARS-CoV-2 continues to be a priority for several parts of the world. We revisit the in vitro technology platforms for COVID-19 testing and diagnostics—molecular tests and rapid antigen tests, serology or antibody tests, and tests for the management of COVID-19 patients. Within each category of tests, we review the commercialized testing platforms, their analyzing systems, specimen collection protocols, testing methodologies, supply chain logistics, and related attributes. Our discussion is essentially focused on test products that have been granted emergency use authorization by the FDA to detect and diagnose COVID-19 infections. Different strategies for scaled-up and faster screening are covered here, such as pooled testing, screening programs, and surveillance testing. The near-term challenges lie in detecting subtle infectivity profiles, mapping the transmission dynamics of new variants, lowering the cost for testing, training a large healthcare workforce, and providing test kits for the masses. Through this review, we try to understand the feasibility of universal access to COVID-19 testing and diagnostics in the near future while being cognizant of the implicit tradeoffs during the development and distribution cycles of new testing platforms.
Assignment on Covid 19 | Tutors India.pptxTutors India
Tutors india thesis and dissertation writing help guarantees that your dissertation is confidential, and so you do not have to worry about it.
For #Enquiry:
World: https://www.tutorsindia.com
UK: https://www.tutorsindia.com/uk
UAE: https://tutorsindia.com/ae/
Australia:https://www.tutorsindia.com/au/
Newzealand: https://www.tutorsindia.com/nz/
(UK): +44-1143520021
Mail: info@tutorsindia.com
Mail: info@tutorsuk.co.uk
(Whatsapp): +91-8754446690
Similar to Adapting to adversity insights from a stand-alone human immunodeficiency virus testing centre in india during the covid-19 pandemic.pdf (19)
Porocarcinoma of the nose- reconstructed with seagull flap
Authors:Balasubramaniam, Ramanandham, Pradeep, Sivakumar, Kalpa Pandya
Int J Biol Med Res. 2024; 15(1): 7760-7763
https://www.biomedscidirect.com/2847/porocarcinoma-of-the-nose-reconstructed-with-seagull-flap
Surgical excision of infiltrative mammary lipoma in a twelve-year old local breed of bitch through modified radical mastectomy
Authors:Melkamu Birhanu Meharu & Jiregna Dugassa Kittesa
Int J Biol Med Res. 2024; 15(1): 7756-7759
https://www.biomedscidirect.com/2848/surgical-excision-of-infiltrative-mammary-lipoma-in-a-twelve-year-old-local-breed-of-bitch-through-modified-radical-mastectomy
Assessment of trend of mortality due to poisoning in the northern zone of india and comparison with other international & national researches
Authors:Naveen Sharma, Kunal Khanna, Kuldeep Kumar, Tarun Dagar, Sandeep Kumar Giri, Vijay Pal Khanagwal
Int J Biol Med Res. 2024; 15(1): 7741-7745
https://www.biomedscidirect.com/2824/assessment-of-trend-of-mortality-due-to-poisoning-in-the-northern-zone-of-india-and-comparison-with-other-international-national-researches
Pulmonary function and respiratory symptoms among petrol station workers in debre tabor town, northwest ethiopia, 2023
Authors:Deribew Abebaw Abuhay
Int J Biol Med Res. 2024; 15(1): 7724-7730
https://www.biomedscidirect.com/2853/pulmonary-function-and-respiratory-symptoms-among-petrol-station-workers-in-debre-tabor-town-northwest-ethiopia-2023
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
https://www.biomedscidirect.com/2835/bioremediation-and-information-technologies-for-sustainable-management?utm=articles
Bioremediation and information technologies for sustainable management
Authors:Jyoti Prakash, Aryan Shukla , Ruchi Yadav
Int J Biol Med Res. 2023; 14(4): 7702-7711 | Abstract | PDF File
Medical segregation cohort study of bio – medical waste management
Authors:Naval Kishor Lodha, Krishna Murari, Biramchand Mewara, Gopal Sharma, Mahendra varma
Int J Biol Med Res. 2023; 14(4): 7699-7701 | Abstract | PDF File
https://www.biomedscidirect.com/2829/an-overview-of-coronavirus-disease-covid-19?utm=articles
An overview of coronavirus disease (covid-19)
Authors:Emy Jancy Rani J.
Int J Biol Med Res. 2023; 14(4): 7687-7691 | Abstract | PDF File
Prevalence and associated risk factor of bovine calves coccidiosis in nekemt city, oromia, western ethiopia
Authors:Walkite Furgasa , Sosina Dawit , Shibiru Wako and Adisu Dube
Int J Biol Med Res. 2023; 14(4): 7660-7664 | Abstract | PDF File
Serum interleukin - 6 level among sudanese patients with chronic kidney disease
Authors:Safaa I.A Nasr , Rbab A.M Adam , Hala M.M Ibrahim , Afra S.A Abdelgadir , Ibrahim Alkider , Solomon M. Gamde , Simon P. Abriba
Int J Biol Med Res. 2023; 14(4): 7652-7654 | Abstract | PDF File
Assessment of cardiac histology and hematological parameters in adult male wistar rats exposed to exhaust emissions from gasoline generators
Authors:Akinpelu MORONKEJI, Frederick O AKINBO
Int J Biol Med Res. 2023; 14(4): 7638-7642 | Abstract | PDF File
Defecation
Normal defecation begins with movement in the left colon, moving stool toward the anus. When stool reaches the rectum, the distention causes relaxation of the internal sphincter and an awareness of the need to defecate. At the time of defecation, the external sphincter relaxes, and abdominal muscles contract, increasing intrarectal pressure and forcing the stool out
The Valsalva maneuver exerts pressure to expel faeces through a voluntary contraction of the abdominal muscles while maintaining forced expiration against a closed airway. Patients with cardiovascular disease, glaucoma, increased intracranial pressure, or a new surgical wound are at greater risk for cardiac dysrhythmias and elevated blood pressure with the Valsalva maneuver and need to avoid straining to pass the stool.
Normal defecation is painless, resulting in passage of soft, formed stool
CONSTIPATION
Constipation is a symptom, not a disease. Improper diet, reduced fluid intake, lack of exercise, and certain medications can cause constipation. For example, patients receiving opiates for pain after surgery often require a stool softener or laxative to prevent constipation. The signs of constipation include infrequent bowel movements (less than every 3 days), difficulty passing stools, excessive straining, inability to defecate at will, and hard feaces
IMPACTION
Fecal impaction results from unrelieved constipation. It is a collection of hardened feces wedged in the rectum that a person cannot expel. In cases of severe impaction the mass extends up into the sigmoid colon.
DIARRHEA
Diarrhea is an increase in the number of stools and the passage of liquid, unformed feces. It is associated with disorders affecting digestion, absorption, and secretion in the GI tract. Intestinal contents pass through the small and large intestine too quickly to allow for the usual absorption of fluid and nutrients. Irritation within the colon results in increased mucus secretion. As a result, feces become watery, and the patient is unable to control the urge to defecate. Normally an anal bag is safe and effective in long-term treatment of patients with fecal incontinence at home, in hospice, or in the hospital. Fecal incontinence is expensive and a potentially dangerous condition in terms of contamination and risk of skin ulceration
HEMORRHOIDS
Hemorrhoids are dilated, engorged veins in the lining of the rectum. They are either external or internal.
FLATULENCE
As gas accumulates in the lumen of the intestines, the bowel wall stretches and distends (flatulence). It is a common cause of abdominal fullness, pain, and cramping. Normally intestinal gas escapes through the mouth (belching) or the anus (passing of flatus)
FECAL INCONTINENCE
Fecal incontinence is the inability to control passage of feces and gas from the anus. Incontinence harms a patient’s body image
PREPARATION AND GIVING OF LAXATIVESACCORDING TO POTTER AND PERRY,
An enema is the instillation of a solution into the rectum and sig
R3 Stem Cells and Kidney Repair A New Horizon in Nephrology.pptxR3 Stem Cell
R3 Stem Cells and Kidney Repair: A New Horizon in Nephrology" explores groundbreaking advancements in the use of R3 stem cells for kidney disease treatment. This insightful piece delves into the potential of these cells to regenerate damaged kidney tissue, offering new hope for patients and reshaping the future of nephrology.
One of the most developed cities of India, the city of Chennai is the capital of Tamilnadu and many people from different parts of India come here to earn their bread and butter. Being a metropolitan, the city is filled with towering building and beaches but the sad part as with almost every Indian city
QA Paediatric dentistry department, Hospital Melaka 2020Azreen Aj
QA study - To improve the 6th monthly recall rate post-comprehensive dental treatment under general anaesthesia in paediatric dentistry department, Hospital Melaka
Struggling with intense fears that disrupt your life? At Renew Life Hypnosis, we offer specialized hypnosis to overcome fear. Phobias are exaggerated fears, often stemming from past traumas or learned behaviors. Hypnotherapy addresses these deep-seated fears by accessing the subconscious mind, helping you change your reactions to phobic triggers. Our expert therapists guide you into a state of deep relaxation, allowing you to transform your responses and reduce anxiety. Experience increased confidence and freedom from phobias with our personalized approach. Ready to live a fear-free life? Visit us at Renew Life Hypnosis..
Welcome to Secret Tantric, London’s finest VIP Massage agency. Since we first opened our doors, we have provided the ultimate erotic massage experience to innumerable clients, each one searching for the very best sensual massage in London. We come by this reputation honestly with a dynamic team of the city’s most beautiful masseuses.
CHAPTER 1 SEMESTER V - ROLE OF PEADIATRIC NURSE.pdfSachin Sharma
Pediatric nurses play a vital role in the health and well-being of children. Their responsibilities are wide-ranging, and their objectives can be categorized into several key areas:
1. Direct Patient Care:
Objective: Provide comprehensive and compassionate care to infants, children, and adolescents in various healthcare settings (hospitals, clinics, etc.).
This includes tasks like:
Monitoring vital signs and physical condition.
Administering medications and treatments.
Performing procedures as directed by doctors.
Assisting with daily living activities (bathing, feeding).
Providing emotional support and pain management.
2. Health Promotion and Education:
Objective: Promote healthy behaviors and educate children, families, and communities about preventive healthcare.
This includes tasks like:
Administering vaccinations.
Providing education on nutrition, hygiene, and development.
Offering breastfeeding and childbirth support.
Counseling families on safety and injury prevention.
3. Collaboration and Advocacy:
Objective: Collaborate effectively with doctors, social workers, therapists, and other healthcare professionals to ensure coordinated care for children.
Objective: Advocate for the rights and best interests of their patients, especially when children cannot speak for themselves.
This includes tasks like:
Communicating effectively with healthcare teams.
Identifying and addressing potential risks to child welfare.
Educating families about their child's condition and treatment options.
4. Professional Development and Research:
Objective: Stay up-to-date on the latest advancements in pediatric healthcare through continuing education and research.
Objective: Contribute to improving the quality of care for children by participating in research initiatives.
This includes tasks like:
Attending workshops and conferences on pediatric nursing.
Participating in clinical trials related to child health.
Implementing evidence-based practices into their daily routines.
By fulfilling these objectives, pediatric nurses play a crucial role in ensuring the optimal health and well-being of children throughout all stages of their development.
The dimensions of healthcare quality refer to various attributes or aspects that define the standard of healthcare services. These dimensions are used to evaluate, measure, and improve the quality of care provided to patients. A comprehensive understanding of these dimensions ensures that healthcare systems can address various aspects of patient care effectively and holistically. Dimensions of Healthcare Quality and Performance of care include the following; Appropriateness, Availability, Competence, Continuity, Effectiveness, Efficiency, Efficacy, Prevention, Respect and Care, Safety as well as Timeliness.
Medical Technology Tackles New Health Care Demand - Research Report - March 2...pchutichetpong
M Capital Group (“MCG”) predicts that with, against, despite, and even without the global pandemic, the medical technology (MedTech) industry shows signs of continuous healthy growth, driven by smaller, faster, and cheaper devices, growing demand for home-based applications, technological innovation, strategic acquisitions, investments, and SPAC listings. MCG predicts that this should reflects itself in annual growth of over 6%, well beyond 2028.
According to Chris Mouchabhani, Managing Partner at M Capital Group, “Despite all economic scenarios that one may consider, beyond overall economic shocks, medical technology should remain one of the most promising and robust sectors over the short to medium term and well beyond 2028.”
There is a movement towards home-based care for the elderly, next generation scanning and MRI devices, wearable technology, artificial intelligence incorporation, and online connectivity. Experts also see a focus on predictive, preventive, personalized, participatory, and precision medicine, with rising levels of integration of home care and technological innovation.
The average cost of treatment has been rising across the board, creating additional financial burdens to governments, healthcare providers and insurance companies. According to MCG, cost-per-inpatient-stay in the United States alone rose on average annually by over 13% between 2014 to 2021, leading MedTech to focus research efforts on optimized medical equipment at lower price points, whilst emphasizing portability and ease of use. Namely, 46% of the 1,008 medical technology companies in the 2021 MedTech Innovator (“MTI”) database are focusing on prevention, wellness, detection, or diagnosis, signaling a clear push for preventive care to also tackle costs.
In addition, there has also been a lasting impact on consumer and medical demand for home care, supported by the pandemic. Lockdowns, closure of care facilities, and healthcare systems subjected to capacity pressure, accelerated demand away from traditional inpatient care. Now, outpatient care solutions are driving industry production, with nearly 70% of recent diagnostics start-up companies producing products in areas such as ambulatory clinics, at-home care, and self-administered diagnostics.
Navigating Challenges: Mental Health, Legislation, and the Prison System in B...Guillermo Rivera
This conference will delve into the intricate intersections between mental health, legal frameworks, and the prison system in Bolivia. It aims to provide a comprehensive overview of the current challenges faced by mental health professionals working within the legislative and correctional landscapes. Topics of discussion will include the prevalence and impact of mental health issues among the incarcerated population, the effectiveness of existing mental health policies and legislation, and potential reforms to enhance the mental health support system within prisons.
Telehealth Psychology Building Trust with Clients.pptxThe Harvest Clinic
Telehealth psychology is a digital approach that offers psychological services and mental health care to clients remotely, using technologies like video conferencing, phone calls, text messaging, and mobile apps for communication.
Adapting to adversity insights from a stand-alone human immunodeficiency virus testing centre in india during the covid-19 pandemic.pdf
1. Contents lists available at BioMedSciDirect Publications
Journal homepage: www.biomedscidirect.com
International Journal of Biological & Medical Research
Int J Biol Med Res. 2024; 15(1): 7750-7755
Adapting to Adversity: Insights from a Stand-alone Human Immunodeficiency Virus
Testing Centre in India During the COVID-19 Pandemic
a b
Sumathi Muralidhar *, Abhishek Lachyan
Apex Regional STD Centre & SRL-HIV, VMMC & Safdarjung Hospital, New Delhi, India
A R T I C L E I N F O A B S T R A C T
Keywords:
COVID-19
HIV Testing
Healthcare Adaptation
Staff Efficiency
Pandemic Impact.
Original Article
Background: The global healthcare landscape confronted unprecedented challenges during
the COVID-19 pandemic in 2020. Materials and Methods: This study explores how the COVID-
19 pandemic impacted healthcare services in India, with a focus on the Stand-alone HIV
Testing Centre (SA-ICTC) at Safdarjung Hospital, New Delhi, during the period from April 1,
2020, to March 31, 2021. Amid the pandemic, specialized clinics for Sexually Transmitted
Infections (STI) and Reproductive Tract Infections (RTI) saw a decline in outpatient
attendance, while the SA-ICTC faced unique challenges. Results: To address these challenges,
innovative solutions were implemented including alternate-day duty rosters, leading to
increased staff efficiency and reduced errors. The study noted a 47.9% reduction in the total
number of HIV tests conducted, although the proportion of HIV-positive clients accessing
services remained stable. Referrals from STI clinics and Targeted Intervention sites decreased,
while referrals from the Tuberculosis (TB) center remained consistent. Client categories
accessingICTCservicesdecreased,exceptforreferralsfromFacilityIntegratedCounselingand
Testing Centres (F-ICTC). Conclusions: This research underscores the intricate interplay
between COVID-19 and HIV, prompting positive changes in healthcare work ethics,
documentation practices, and service delivery. It emphasizes the significance of strategic
supply chain management, recommending a 1-2-month buffer of testing kits and consumables
in HIV testing facilities to ensure uninterrupted service delivery during crises, thus
safeguardingthehealthcareneedsofvulnerablepopulations.
BioMedSciDirect
Publications
International Journal of
BIOLOGICAL AND MEDICAL RESEARCH
www.biomedscidirect.com
Int J Biol Med Res
1. Introduction
Copyright 2023 BioMedSciDirect Publications IJBMR - All rights reserved.
ISSN: 0976:6685.
c
TheCOVID-19pandemic,whichsentshockwavesacrosstheglobe
in 2020, serves as the backdrop for this discussion. It is marked by its
sudden emergence and the far-reaching consequences it brought to
every corner of the world [1]. As the pandemic continued to evolve,
India, like many other nations, faced its own unique set of challenges
indealingwiththeoutbreak[1].
In January 2020, the pandemic officially reached Indian shores,
initiating a seriesofeventsthat wouldprofoundlyimpact thenation's
healthcare infrastructure. By March of the same year, the number of
COVID-19 cases began to surge at an alarming rate. To mitigate the
rapid spread of the virus and protect the public, the Indian
government made the historic decision to enforce a nationwide
lockdown on March 22, 2020. This significant measure aimed to curb
thetransmissionofthevirus,albeitwithsignificantconsequencesfor
variousaspectsofdailylife,includinghealthcare[1].
One of the most conspicuous effects of the pandemic was the
transformation it brought to the healthcare landscape. Hospitals
faced an unprecedented influx of COVID-19 patients, resulting in a
strain on medical resources, particularly hospital beds. This
sudden and overwhelming demand for healthcare services
necessitated a swift adaptation to ensure that all patients received
thecaretheyrequired[1].
As the pandemic unfolded, a notable trend emerged - a decline
in the number of out-patient attendees at clinics specializing in
Sexually Transmitted Infections (STI) and Reproductive Tract
Infections (RTI). This drop in foot traffic signaled that individuals
were increasingly avoiding non-essential medical visits during
these uncertain times, potentially leading to concerns about
undiagnosedanduntreatedconditions[1].
Amid these challenges, the Stand-alone Integrated Counseling
& Testing Centre, HIV laboratory (SA-ICTC), serving not only the
capital city of New Delhi but also its neighboring provinces,
encountered its own set of hurdles during the pandemic. These
* Corresponding Author : Dr. Sumathi Muralidhar
Professor and Consultant Microbiologist,
Apex Regional STD Centre, Safdarjung Hospital, New Delhi, India.
sumu3579@yahoo.com
E-mail : sumu3579@yahoo.com
drabhilachyan@gmail.com
Copyright 2023 BioMedSciDirect Publications. All rights reserved.
c
2. Sumathi Muralidhar and Abhishek Lachyan Int J Biol Med Res. 2024; 15(1): 7750-7755
7751
sought to comprehensively understand, address, and shed light
on the experiences and adaptations of healthcare facilities dealing
withHIVtestingandcareduringthisexceptionalperiod[1].
This study provides an introduction to the multifaceted impact
of the COVID-19 pandemic on healthcare services in India,
underscoring its influence on STI and RTI clinics, ICTC laboratories,
and the SA-ICTC HIV testing laboratory. The subsequent study,
detailed within this narrative, was initiated with the primary
objectives of examining functional changes within the SA-ICTC
laboratory, evaluating shifts in staff efficiency, and exploring
potential correlations between the pandemic and HIV positivity
rates among COVID-19 patients. This study aims to offer valuable
insights into the evolving healthcare landscape during this
unparalleledglobalhealthcrisis.
The provided section outlines the methods and data collection
process used in a study conducted within the SA-ICTC HIV Lab,
located at Safdarjung Hospital in New Delhi, India. The study
spanned from April 1, 2020, to March 31, 2021, coinciding with a
full year of the COVID-19 crisis. The study design is described as a
retrospective observational study, meaning that researchers
examined past data to draw conclusions. Here is a detailed
breakdownofeachelement:
StudyVenue:
The study was conducted at the SA-ICTC HIV Lab, situated
within Safdarjung Hospital, which is identified as one of the largest
tertiary care hospitals in New Delhi, the capital city of India. The
ICTC(IntegratedCounsellingand TestingCentre)ispart oftheApex
Regional STD Centre and State Reference Laboratory for HIV. This
department caters exclusively to the diagnosis and management of
Sexually Transmitted Infections (STIs), Reproductive Tract
Infections(RTIs),andHIV/AIDS.
StudyPeriod:
The study covered the timeframe from April 1, 2020, to March
31, 2021. This period corresponds to the entire year during which
theCOVID-19crisiswasprevalent.
StudyDesign:
The chosen study design is described as a retrospective
observational study. In such a study, researchers analyze existing
data from past records to draw conclusions. In this case,
researchers examined data related to the operation of the SA-ICTC
HIVLabanditschangesduringtheCOVID-19pandemic.
StudyProcess:
The study process involved investigating various aspects of
changes within the HIV testing facility during the COVID-19
lockdown.
Researchers compared these changes with data from the
previous two years, specifically 2018-19 and 2019-20, to
understand how the pandemic affected the facility's operations and
Data Collected: The following data points were collected and
analyzedduringthestudy.
· Total number of ICTC attendees during the study period: This
data likely provides insights into how the overall attendance at the
Integrated Counselling and Testing Centre was affected during the
COVID-19crisis.
· The categories of the ICTC attendees: This information
includes demographic details or reasons for seeking services at the
ICTC,helpingtounderstandthecompositionofattendees.
· The number of HIV tests performed and their positivity:
Tracking the number of HIV tests conducted and the positivity rate
during the pandemic can reveal changes in HIV testing patterns and
outcomes.
· Staff details - Changes in staff strength, availability, and work
efficiency: This data helps assess how the SA-ICTC's workforce was
affected by the pandemic, including any changes in staffing levels
andstaffefficiency.
· Availability of supplies and consumables: Information on the
availability of essential supplies and consumables is crucial for
understandingresourcechallengesfacedbythefacility.
· Behavioral changes among faculty, staff, and nursing
orderlies/attendants: Examining behavioral changes among
healthcare providers can provide insights into the impact of the
pandemiconthefacility'spersonnel.
· Details of COVID-19 patients getting tested for HIV: This data
includesinformationaboutCOVID-19patientswhoalsounderwent
HIVtesting,whichcanshedlightonpotentialintersectionsbetween
thesehealthissues.
RESULTS: Table 1 Provides a structured overview of staff
attendanceduringthepandemic.
Table 1 Staff attendance of SA-ICTC during the COVID-19
pandemicyear.
From Table 1, it is evident that the staffing levels at the SA-ICTC
experienced a significant reduction, declining to 50% of their pre-
3. 7752
Table 2 SA-ICTC Staff efficiency during the three-year
period.
Table 3 COVID-19 patients tested for HIV
Figure 1 Comparison of HIV testing data over 3 years
Figure 2 Data on ART referrals and Spouse testing of
HIV-positive cases.
Figure 3 Testing for Syphilis at ICTC during Covid-19
pandemic
Table 3 presents data on the HIV testing outcomes among
COVID-19 patients. A total of 55 COVID-19 patients, comprising 38
males and 17 females, underwent HIV testing. Among them, one
individual tested positive for HIV, representing a prevalence rate of
1.82%.
Figure 3 presents a significant reduction (51.12%) in the
number of ICTC clients tested for Syphilis by RPR during the
pandemic.
Sumathi Muralidhar and Abhishek Lachyan Int J Biol Med Res. 2024; 15(1): 7750-7755
4. 7753
Figure 4 Various referrals for HIV Testing during COVID-19
pandemic
Figure 5 Break-up of client categories at SA-ICTC
Figure 4 illustrates a substantial decline in referrals from STI
clinics and Targeted Intervention sites to ICTC (58.29% and 50%,
respectively), whereas referrals from the Tuberculosis (TB) center
remainedrelativelyconsistent.4
The onset of the COVID-19 pandemic in 2020 caught the world
off guard, unleashing widespread havoc across nations. India, too,
grappled with the profound effects of this global crisis. Lockdowns
were imposed to restrict the movement of people and suspend
many public services and activities [2]. The aim was to minimize
physical interactions between individuals, reduce the spread of the
virus,andalleviatethestrainonhealthcarefacilities.
Our study focused on the Stand-alone HIV testing center (SA-
ICTC) within our healthcare system, which serves not only the
populous capital city of New Delhi but also the neighbouring states
of Haryana, Punjab, and Uttar Pradesh. Prior to the pandemic, the
SA-ICTC typically received an average of over 28,000 clients
annually. However, during the pandemic year of 2020-21, there was
a sharp decline in ICTC client attendance by 47.9%, a clear
consequenceoftheCOVID-19pandemic[3].
During the pandemic and lockdown, public transport services
were significantly disrupted or even temporarily halted in various
regions of India. This disruption made it challenging for employees
to travel to their workplaces, including healthcare facilities, like our
SA-ICTC. The attendance of staff and faculty in our department
plummeted to 50% of its usual strength due to this nationwide
lockdown and severe restrictions on public transport. Many staff
members faced considerable difficulty in commuting to their
workplace. Simultaneously, client footfall decreased significantly in
both our ICTC and STI clinics. In response to these challenges, we
devised a duty roster for our staff and faculty, requiring them to
alternatetheirdaysofduty(asindicatedinTable1).
AnalysisofTable2revealsthatthereducedworkloadduringthe
pandemic led to an enhancement in the work efficiency and
competence of ICTC staff. Instances of errors in tasks such as
registration, labelling, sampling, and HIV testing noticeably
decreased. Staff attendance improved, both in online classes
organized during the pandemic and in onsite training for those
Figure 6 Changes in ICTC client categories during the
COVID-19pandemic(2019-20vs.2020-21)
DISCUSSION
Sumathi Muralidhar and Abhishek Lachyan Int J Biol Med Res. 2024; 15(1): 7750-7755
5. present on alternate duty days. These improvements translated
into enhanced performance during the annual competency
assessmentsforstaffmembers[3].
Regarding the availability of testing kits and consumables, our
ICTC adopts a proactive approach by procuring stocks well in
advance (over a 3-month period). Additionally, the overall number
of cases decreased during 2020-21, ensuring that no shortages of
kits or consumables were encountered during the study period.
This stability in the supply of testing kits highlights the SA-ICTC's
resilience and capacity to maintain essential resources required for
HIVandRPRtestingduringachallengingpublichealthcrisis[3].
An important aspect of our study was the HIV testing among
COVID-19-positive patients, which involved pre and post-test
counseling by ICTC counselors. As indicated in Table 3, of the 55
COVID-19-positive patients tested for HIV, only 1 individual
(1.82%)testedpositive.
Figures1and2depictthetrendsinHIVtesting.Figure1showsa
significant 47.9% reduction in the total number of HIV tests
conducted in 2020-21 compared to the previous year, reflecting the
considerable impact of the COVID-19 pandemic. Figure 2 reveals
that the percentages of HIV-positive clients registering at the ART
center and HIV testing among the spouses of HIV-positive clients
remainedrelativelystable[4].
In summary, our study provides a comprehensive overview of
theimpactoftheCOVID-19pandemiconHIVtestingandhealthcare
services. The data highlight the challenges faced, including reduced
staff attendance, decrease in patient footfall, and alterations in
testing and referral patterns. These findings emphasize the
importance of flexibility and adaptability within healthcare
systemsduringcrisissituationstoensurethecontinuityofessential
services[5]
CONCLUSIONS
InterconnectedImpactofCOVID-19onHIVPatientsandTesting
Facilities: This study underscores the intricate interplay between
COVID-19 and HIV, illustrating the adverse effects that one has on
the other, and vice versa. It becomes evident that these two global
health challenges share a complex relationship, extending beyond
the immediate health of affected individuals to healthcare facilities
andtestingservices.
Turning Adversities into Opportunities: A key takeaway from
this study is the ability to turn adversities into opportunities. The
COVID-19 pandemic, a formidable challenge for healthcare systems
worldwide, has provided a unique platform for growth and
improvement. We have observed tangible enhancements in work
ethics, documentation practices, service provision skills, and the
diligent practice of Standard or Universal Precautions. These
lessons can be harnessed to fortify healthcare delivery in the face of
futurecrises.
Strategic Supply Chain Management: A critical lesson
highlighted in this study pertains to the maintenance of supply
chain management. The importance of maintaining a strategic
buffer of 1-2 months' worth of testing kits and consumables in
HIV testing facilities cannot be overstated, especially during
challenging times such as the COVID-19 pandemic. This foresight
ensures continuity in essential services even when confronted with
circumstances like lockdowns or disruptions in supply chains,
thereby safeguarding the healthcare requirements of vulnerable
populations.
Finally, the profound impact of COVID-19 on both HIV patients
and testing facilities has shed light on the intricate relationship
between infectious diseases. The study exemplifies how adversity
can be a catalyst for positive change, leading to improvements in
various facets of healthcare provision. Moreover, prudent supply
chain management practices, as highlighted here, are essential for
maintaining seamless healthcare services, even in the face of
unforeseenchallenges.Theselessonsserveasvaluableguidancefor
the future preparedness in delivery of healthcare systems
worldwide.
ACKNOWLEDGEMENTS
We wish to express our sincere gratitude to the ICTC
Counsellors, namely Ms. Neelu Singh, Ms. Harsh Madhavi, and Mr.
SanjayKumar,fortheirexpertiseandunwaveringcommitment.Our
sincere thanks to the ICTC Laboratory technicians, including Mr.
Vijay Kumar, Mr. Brejesh Kumar, and Mr. Dushyant Sharma, for their
exceptional efficiency and cooperation, particularly during the
challenging times of the pandemic. We acknowledge the crucial
support of the National AIDS Control Organization (NACO) and the
Delhi State AIDS Control Society (DSACS) for their significant
contributions in the supply of kits, consumables, and manpower.
These contributions have been instrumental in our research efforts
andhavegreatlyfacilitatedourstudy.
AUTHORS'CONTRIBUTIONS
SM designed and conceptualized the study. SM collected the
data and analyzed the data. SM and AL wrote the entire manuscript
together.SMreviewedthemanuscript.
FUNDING
Nil
COMPETINGINTERESTS
Theauthorsstatethattheyhavenoconflictsofinterest.
AUTHORDETAILS
Apex Regional STD Centre & SRL-HIV, VMMC & Safdarjung
Hospital,NewDelhi,India.
References
1. Couronne I. Coronavirus lockdowns could spark rise in HIV infections,
experts warn. [Internet]. 2020 May 11 [cited 2021 Sep 30]. Available
from: https://www.barrons.com/news/coronavirus-lockdowns-could-
spark-rise-in-hiv-infections-experts-warn-01589247309
2. Braun MM, Heyward WL, Curran JW. The global epidemiology of HIV
infection and AIDS. Annu Rev Microbiol. 1990;44:555-77. doi:
10.1146/annurev.mi.44.100190.003011.PMID:2252394.
Sumathi Muralidhar and Abhishek Lachyan Int J Biol Med Res. 2024; 15(1): 7750-7755
7754
6. 3. Soriano V, Barreiro P. Impact of New Coronavirus Epidemics on HIV-
Infected Patients. AIDS Rev. 2020;22(1):57-58. doi:
10.24875/AIDSRev.M20000031.PMID:32167508.
4. Times of India.Marginal drop in HIV/AIDS cases as virus on decline in
Te l a n ga n a . [ c i te d 2 0 2 3 O c to b e r 5 ] . Ava i l a b l e f ro m :
.
http://timesofindia.indiatimes.com/articleshow/95898704.cms?utm_s
ource=contentofinterest&utm_medium=text&utm_campaign=cppst
5. Kroese K, Porter K, Surridge H, Tembo D. Challenges and solutions:
surveying researchers on what type of community engagement and
involvement activities are feasible in low- and middle-income countries
duringtheCOVID-19pandemic.BMJOpen.2021Oct27;11(10):e052135.
doi: 10.1136/bmjopen-2021-052135. PMID: 34706957; PMCID:
PMC8551745.
Copyright 2023 BioMedSciDirect Publications IJBMR -
All rights reserved.
ISSN: 0976:6685.
c
Sumathi Muralidhar and Abhishek Lachyan Int J Biol Med Res. 2024; 15(1): 7750-7755
7755