This document describes experiments performed to sequence the human Apolipoprotein B (ApoB) gene. A portion of the ApoB gene was amplified via PCR and subcloned into E. coli plasmid vectors. The plasmid vectors containing the inserted ApoB fragment were then purified and sequenced. Sequence analysis revealed that human ApoB is highly similar to Canis lupus familiaris (dog) ApoB, indicating evolutionary conservation. The experiments aimed to accurately insert, track, and sequence the ApoB gene to better understand its structure, function, and evolutionary relationships.

1. Leone 1
PCR and Sequencing of human Apolipoprotein B by subcloning into
Escherichia coli
Michael Leone, Daniel Schreiner4, Harold Smith5, and Max A. Cheng2
1,2,3,4,5Department of Biochemistry, University of Rochester School of Medicine and Dentistry,
1,2,3,4,5University of Rochester, Rochester, NY 14627
2Eastman School of Music, University of Rochester, Rochester, NY 14627
Current Address: 500 Joseph C. Wilson Blvd, Rochester, NY 14627
Running Title: Sequencing of Human Apolipoprotein B
* To whom correspondence should be addressed: Tel.: +1 201 419-4279; E-mail:
Mleone8@u.rochester.edu
Keywords: Apolipoprotein, ApoB, Sequencing, Subcloning, E. coli
CAPSULE
Background: Human Apolipoprotein B is a
crucial protein to human metabolism with
highly unknown function. Sequencing is
necessary to determine composition,
structure, and function of this important
lipoprotein.
Results: Sequence was obtained through
subcloning and mid-scale plasmids.
Sequence was subjected to multiple sequence
alignment to determine possible relatives
with similar protein function.
Conclusion: ApoB is a highly conserved
protein among multiple organism families.
Further analysis could lead to easier protein
studies done on organisms with
evolutionarily similar ApoB.
Significance: The results from this
experiment signify that mammalian
lipoproteins are highly conserved. To study
human ApoB in more detail, it may be
feasible to obtain a close mammalian relative
and conduct studies on that ApoB to elucidate
the exact purpose of the protein in the body.
SUMMARY
Human Apolipoprotein B is a protein
found in chylomicrons in the body. A portion
of the protein was amplified by PCR,
subcloned into vectors and expressed,
analyzed, and sent out to an analytical facility
for sequencing. After the sequence results
returned, Human ApoB was found to be very
closely related to Canis lupus familiaris
ApoB. The experiments performed in the
following procedures were done to track and
ensure that the ApoB gene was being
correctly inserted into vectors without
complication and with minimal
contamination. Efficiency of PCR was
observed with a 1.0% agarose gel and the
product was digested with KpnI and XbaI
followed by ligation into pGEM3zf plasmid
vectors. The ligation effectiveness was
examined using a blue/white transformation
screening assay along with an EcoRI
restriction mapping procedure using small
scale plasmids. Finally, after following that
the insert had been successfully ligated into a
vector, mid-scale plasmids were prepared
and sent for sequencing, after which
sequence alignments and analyses allowed
for the identification of human ApoB and its
evolutionary divergences through 5 families
of organisms.
INTRODUCTION

2. Leone 2
Apolipoprotein B is the primary
apolipoprotein of chylomicrons, very low
density lipoproteins, intermediate density
lipoproteins, and low density lipoproteins
(VLDL, IDL, and LDL, respectively). LDL,
known commonly by the misnomer "bad
cholesterol" when in reference to both heart
disease and vascular disease, is responsible
for carrying lipids, including cholesterol,
around the body to essentially all cells in the
body. ApoB is the primary organizing protein
of the entire complex shell that is responsible
for enclosing and carrying fat molecules
within chylomicrons.9 It is an essential
component of the particles and is necessary
to the formation of fat carrying particles.
ApoB on the LDL particle acts as a ligand for
LDL receptors in various cells throughout the
body; that is, ApoB indicates fat carrying
particles are ready to enter any cells with
ApoB receptors and deliver fats carried
within into the cells.10 Human apolipoprotein
B is an essential protein in the process of
cholesterol and fat transport in the Homo
sapiens.9,10
Because the exact methods of
function of human ApoB are largely
unknown, sequencing of the molecule is a
required process to determine the exact
function and purpose of the protein itself, due
to the nature of proteins and the effect that
structure has on function. To accomplish the
goal of sequencing the human ApoB protein,
standard PCR, electrophoresis, sub cloning
and restriction digestion procedures were
followed to track the progress of the gene
carrying ApoB on its journey from PCR
product to sequenced genome. Cloning is
utilized to ensure that the plasmid vector used
for amplification and sequencing was
correctly ligated into a viable insert. The
resulting sequence was compared to a variety
of organisms, and a reasonably simple
evolutionary tree of the protein was compiled
and assessed to suggest the ancestral origins
and divergences of human ApoB.
EXPERIMENTAL PROCEDURES
Polymerase Chain Reaction3,5 -- To conduct
the polymerase chain reaction necessary to
amplify the human ApoB gene, two
oligonucleotide primers of the sequences 5’
GATTTAGGTGACACTATAG 3’ and
5’TAATACGACTCACTATAGGG 3’ were
placed into 8 150 µl PCR tubes. Each of the
reaction tubes contained 20 µl of 5X Taq
polymerase buffer, 1 µl of 25 mM dNTP
oligonucleotide mix, 1 µl of 0.5 µM primer 1,
1 µl of 0.5 µM primer 2, 56.5 µl of deionized
water, 10 µl of 0.01ng template DNA, and 0.5
µl of 2.5U Taq polymerase. In addition to the
reaction mix, each of the tubes past the first
contained 10 µl of 5-50 mM concentrations
of MgCl2 were added to increase Taq
polymerase activity (aliquots were added
linearly in increments of 5, doubling at
50mM, and going back down to 25mM. The
50mM and 25mM MgCl2 concentrations
were used for the negative and positive
control solutions, respectively. An additional
PCR tube was prepared, containing a DNA
ladder with which to determine the success of
the PCR. The cycling conditions were set to
denaturation at 94 °C for 45 seconds,
annealing for 45 seconds at 50 °C, and
extension for 30 seconds at 72 °C. These
parameters were determined based on the
melting points of the two primers, which
were estimated to be 56 °C and 62 °C for the
primer 1 and primer 2, respectively. The
cycler was run for 35 cycles, with a hold
temperature of 4 °C, and a post step of 72 °C
for 5 minutes.
Agarose Gel Electrophoresis and Elution3,5 -
- Following the PCR, the completed reaction
tubes were placed into wells in a 1.0%
agarose gel in aliquots of 8 µl mixed with 2
µl of gel buffer with EtBr staining. Samples
were electrophoresed at constant voltage and
results recorded for later analysis. After
analysis of the electrophoresis results, the
most effective product of the PCR reactions
was chosen for purification. To begin

3. Leone 3
purification of the product, 50 µl of the PCR
reaction was selected and 50 µl of membrane
binding solution was added to the sample.
The mixture was placed in a SV minicolumn
and centrifuged for 30 seconds to collect the
DNA product. After flowthrough was
discarded, 0.7 ml of membrane wash solution
was added to the tube, which was centrifuged
a second time for 45 seconds to ensure
purification of DNA product. The
flowthrough was again discarded and the
sample was washed a second time with 500
µl of membrane wash solution. After
centrifuging the sample for 1 minute at high
speed. Care was taken to remove residual
wash solution to avoid contamination of
future experiments. The minicolumn
containing the DNA was placed in a new 1.5
ml microfuge tube. H2O (50 µl) was added to
the center of the minicolumn, which was
centrifuged at high speed for another minute
to elute the PCR product. Elution buffer was
added to the DNA to prevent autocatalytic
degradation.
Restriction Digest using KpnI and
XbaI, Analysis, and Purification1,3,5 --
Restriction digestion of the product was
conducted after product purification. Two
reactions were prepared. One reaction was a
vector digestion containing 3 µl of 3 µg
plasmid vector pGEM3zf, 5 µl 10X reaction
buffer, 2.5 µl each of enzymes KpnI and
XbaI, and 37 µl of H2O. The second reaction
tube was a PCR product digestion, and
contained 25 µl of PCR product, 5 µl of 10X
reaction buffer, 2.5 µl of each of the same
enzymes, and 15 µl of H2O. Vast excess of
enzyme was used to ensure complete and
rapid digestion of the product and vector.
Both reaction mixtures were incubated at 37
°C for 1 hour. After the incubation period, the
samples were treated with 5 µl of cow
intestine alkaline phosphatase to prevent re-
ligation. After phosphatase treatment,
another incubation at 37 °C for 30 minutes
was performed to allow for complete
procession of the enzyme. Following the
phosphatase incubation, the samples were
treated with 10 µl of 5X gel loading buffer
and loaded onto a 1% agarose gel for
electrophoretic analysis of the digestion. 1 µl
of uncut vector and 5 µl of uncut PCR
product were also loaded in the gel, along
with 4 µl of DNA mass ladder size standards
for analysis. Extraction of the DNA from
agarose was performed by excision of a
sample of both vector and PCR product with
a clean razor blade. The PCR segment
selected had a weight of 0.68g and the vector
segment had a weight of 0.35g. Both samples
were placed in two separate 1.5 ml microfuge
tubes. Membrane binding solution was added
at a ratio of 10 µl per 10 mg of agarose gel
slice. These mixtures were vortexed and
incubated at 65 °C so that they could melt.
After the agarose gel samples had been
introduced to the liquid phase, SV
minicolumns were placed in collection tubes
(one for the vector and one for the PCR
product), at which point the corresponding
gel mixtures were transferred to the
respective columns and incubated for 1
minute at room temperature. These samples
were then centrifuged at 10,000 x g for 1
minute, then liquid was discarded from the
minicolumn. The columns were subjected to
a wash with 700 µl of membrane wash
solution and centrifuged at the same speed for
1 minute. The wash was then repeated with
500 µl and columns were centrifuged for 5
minutes at the same speed. The contents of
the minicolumns were transferred to clean 1.5
ml microfuge tubes. 50 µl of nuclease free
water was added to each, and the samples
were incubated at room temperature for 1
minute, followed by centrifugation at the
same speed as above. Eluted DNA was stored
at low temperature to protect from
autocatalytic degradation.
Ligation of PCR Product into
Plasmid Vector pGEM3zf 3,5 -- In order to
insert the PCR products into transformation

4. Leone 4
vectors, a ligation reaction was conducted
using the following procedure. A vector +
ligase reaction was prepared, with 2 µl of
vector DNA, 2 µl of 10X ligation buffer, 1 µl
T4 DNA Ligase, and 15 µl of water. A vector
– ligase reaction was set up, containing 2 µl
of vector DNA, 2 µl of 10X ligation buffer,
and 16 µl of water. Finally, a vector + ligase
+ insert reaction was prepared, containing 2
µl of 10X ligation buffer, 2 µl of vector DNA,
5 µl of water 1 µl of T4 DNA ligase, and 10
µl of PCR product. The reactions were
incubated overnight at 15 °C and kept at -20
°C after the incubation was complete.
Transformation into Escherichia coli
Cell Cultures3,5 -- E. coli cells eligible for
blue/white screening were made competent
by allowing growth to mid-log phase and
harvesting by centrifugation at 4 °C. The
cells were resuspended on ice-cold calcium
chloride and allowed to incubate for 30
minutes. After re-centrifugation and
suspension, cells were competent for DNA
uptake. Competent DH5 alpha cells were
transformed with the ligation reaction
products. Cells were suspended in Luria
broth, mixed gently, and had DNA ligation
reactions pipetted into them. As a positive
control, 5 µl of control DNA was added to
one tube containing 100 µl competent cells.
A negative control plate contained nothing
but cells and was created for the purpose of
contamination identification. Cells were
incubated on ice for 30 minutes and heat
shocked for 45 seconds. 0.9 ml L-broth was
added to each cell culture aseptically and
cells were shaken and heated at 37 °C for 1
hour so that beta-lactamase could be
expressed and thus ampicillin resistance
could be identified. 6 ampicillin agar plates
containing chromogenic X-Gal substrate
were prepared. X-Gal (30 µl) was spread onto
each plate and glass beads were used to
ensure total plate coverage. The six plates
were incubated for an hour at 37 °C and 100
µl of each culture was pipetted onto each
plate. There were 6 plates prepared in total: a
vector+ligase plate, vector-ligase plate, two
vector+insert plates (0.05 ml and 0.2 ml), a
positive control plate, and a negative control
plate. The colonies were counted to
determine transformation efficiency and
consequently ligation effectiveness.
Purification of DNA from Agarose
and Restriction Mapping of the Vector using
a Miniprep Plasmid1,5 -- To restriction map
the plasmid insert, a small scale plasmid
preparation for restriction mapping was
prepared using the Promega SV Miniprep kit.
Four Eppendorf tubes were labeled (vector +
ligase, vector – ligase, vector+insert, and
positive control), and 1.5ml of each
respective culture was poured into the
corresponding tube. The cultures were
centrifuged for 2 minutes and supernatants
were discarded. Cell resuspension solution
(250 µl) and 250 µl of cell lysis solution were
added and followed by a vortex step and
addition of 350 µl of neutralization solution.
After centrifugation for 10 minutes at high
speed (10,000 x g), supernatants were
collected in separate SV columns and
centrifuged again for 60 seconds, after which
the flowthroughs were discarded. The SV
columns were then washed with 0.75 ml of
column wash buffer and centrifuged again for
30 seconds, and then washed with 0.25 ml of
column wash buffer and centrifuged for 30
seconds again. Flowthroughs were discarded
and another centrifugation step for 1 minute
was performed to remove residual wash
buffer. To elute the DNA, 50 µl of water was
added to the center of each SV column and
each column was centrifuged for 1 minute.
To actually digest the products of the
small scale plasmid preparation, 4 tubes were
prepared with the following: 5 µl DNA, 1 µl
10X buffer, 1 µl EcoRI, and 3 µl H2O. The
DNA products from the plasmid preparation
were added to 4 different tubes and left to
incubate overnight to allow digestion. Excess
EcoRI was used to ensure rapid and maximal

5. Leone 5
digestion. After digestion, the contents of
each tube were loaded with 2 µl of 5X
loading buffer to an agarose gel for
electrophoretic analysis.
Mid-Scale Plasmid Preparation1,5 --Finally,
after restriction digestion analysis, a mid-
scale plasmid was prepared so that the
sequence of the human apolipoprotein B
could be obtained and analyzed. To create the
plasmid, the protocol Promega A7640 was
followed. Cleared lysate was prepared by
pelleting cells at 10,000 x g for 10 minutes.
Supernatant was discarded and the remaining
pellet was suspended in 3 ml of cell
resuspension solution. Cell lysis solution (3
ml) was added and the sample was mixed
carefully. Neutralization solution was added
at a volume of 3 ml and the sample was
centrifuged at 14,000 x g for 15 minutes.
Supernatant was discarded and resin was
resuspended. The resuspended resin was
added to the DNA from the previous step.
The entire solution was transferred to a
midicolumn and a vacuum filtration system
was used to pass all the liquid through the
column. 15 ml of column wash solution was
pulled through the column by the vacuum
twice. The midicolumn and reservoir were
then separated and the midicolumn was
centrifuged in a 1.5 ml centrifuge tube at
10,000 x g for 2 minutes. To elute the DNA
midiplasmid, the midicolumn was transferred
to a new 1.5 ml tube. 300 µl of preheated
water was added, and the sample was
centrifuged at 10,000g for 20 seconds to elute
DNA. Another round of centrifugation was
performed for 5 minutes to ensure full elution
of DNA. Supernatant was kept and
transferred to a new centrifuge tube.
Determining of DNA Concentration
in Solution and Preparing for Sequencing1,5 -
- To determine the concentration of the DNA
in the sample, a UV spectrophotometer was
set to 260 nm and blanked. DNA plasmid (5
µl) was pipetted into a clean microfuge tube
with 500 µl H2O. The absorbance of the
diluted solution was read at 260 and 280 nm
and Beer-Lambert’s Law was applied to
determine the concentration of DNA in the
sample. Dividing the absorbance at 260 by
that of 280nm determined the purity of the
sample. DNA was diluted to 0.5 µg in a 15 µl
solution with 5 µl 1 µM T7 primer and water
and sent out for sequencing. The cycling
conditions were set to 96 °C for 120 seconds,
followed by 25 cycles of annealing for 10
seconds at 96 °C, 50 °C for 5 seconds, 60 °C
for 4 minutes, followed by a cool and hold
step at 4 °C. These parameters are standard
for T7 primer and were used to conduct
sequencing procedures on the prepared
midiplasmids.
(Note: All samples were sent to GENEWIZ,
Inc. for Sanger Sequencing.)
Sequence Analysis1,4,5,6,7,8 -- After
sequences were obtained, using the RSCB
protein database and the NCBI database,
different sequences for ApoB from species
other than H. sapiens were compared and a
basic phylogenetic tree was assembled. The
sequence was translated to amino acid
composition and used in a BLASTP search to
observe conservation among members of
different species. One fish (Pundamilia
nyererei), One amphibian (Xenopus clavii),
one reptile (Alligator mississippiensis), two
birds (Gallus gallus, Struthio camelis
australis), and two mammals (Homo sapiens,
Canis lupus familiaris) were all observed and
compared to find a conserved polypeptide
sequence. A TBLASTN alignment was
performed to observe nucleic acid
conservation using the same sequence.
RESULTS
Polymerase Chain Reaction Analysis
-- The electrophoresis 1.0% agarose gel plate
with the PCR reactions (Figure 1) showed
that all of the PCR reactions were successful
in amplifying DNA, and that there was no
contamination or self-dimerization in the
negative control lane based on analysis of the
lack of band presence in the agarose gel

6. Leone 6
(Figure 1). The most effective MgCl2
concentration was determined to be 1.0mM.
The product from the PCR reaction
containing 1.0mM MgCl2 was used for the
rest of the procedures. PCR product
containing human ApoB size is estimated to
be ~500 bp according the DNA size standard
(Figure 1b).
Restriction Digestion and
Purification – Electrophoretic analysis of
restriction digestion of purified plasmid
product with KpnI and XbaI (Figure 2)
indicates successful digestion with little to no
contamination. Interpretation of this gel plate
showed that the PCRproduct and vector were
successfully digested based on the presence
of two bands at ~3,000 and two bands at ~
500 bp. The presence of a second faint band
in the digestion lanes suggests that there may
have been some minor byproduct formation,
however, the size of the PCR product and
vector were not affected. Both DNA samples
were digested without complication.
Ligation of PCR Product into
pGEM3zf Plasmid Vector and
Transformation into E. coli – The ligation
efficiency was determined using a
transformation blue/white assay. The
transformation efficiency was calculated to
be 2.4 x 107 colony forming units/µg (Figure
3). The electrophoresis plate of the restriction
digest (Figure 4) showed successful
restriction digestion of all 4 samples. Two
bands of ~2,700 and ~500 bp were observed.
Restriction digest showed no signs of
complication or contamination, and thus was
successful. Furthermore, there was a known
EcoRI cut site in both the pGEM3zf plasmid
and the PCR product; the digest shows this in
the form of the two bands. In corroboration
with the transformation assay, ligation was
shown to be efficient and effective.
Mid-scale Plasmid Preparation and
Sequencing – The concentration of plasmid
product in solution was determined
spectrophotometrically to be 67.7 ng/µl, and
the sample prepared for sequencing
contained 7.4µl DNA, 5.0µl T7 primer, and
2.6µl H2O to achieve a final concentration of
0.5µg/µl of DNA sample. Sequencing results
of the gene were returned (Figure 5) and the
sequence corresponded to that of human
ApoB. Genetic sequence translation into
amino acid sequence allowed for comparison
of human ApoB to ApoB of other species. A
simple tree was designed4 (Figure 6) to
examine the evolutionary origins of
apolipoprotein B.
DISCUSSION
In this study, the sequence and
evolutionary origin of human apolipoprotein
B was determined through downstream
applications of PCR. Taq polymerase was
used because it is a thermostable polymerase
– that is, heating of solution will not denature
the protein and remove catalytic activity. In
an agarose gel electrophoresis, 1.0% of
agarose is mixed into water and heated in a
microwave to a boil. After being left to cool
until it is “hand ready”, the agarose gel is
poured into a mold that sets up wells for
electrophoresis. DNA samples are poured
into the wells, which have a current passed
through them at the rate of 5V per centimeter
of distance between the electrodes. The
negative electrode is near the top of the gel,
and the positive electrode is near the bottom
of the gel. Because DNA is negatively
charged, it flows from the negative electrode
to the positive electrode, and smaller
fragments move further through the gel than
others do. The agarose gel analysis of the
PCR reaction was very indicative of two key
conclusions; first, the PCR was run without
complication. This is shown by the
consistency of the PCR bands – there is no
evident contamination or error in the gel. If
examined closely, the products in each lane
darken as the reactions move from left to
right. This is due to the increasing presence
of MgCl2 in each reaction. MgCl2 is necessary
for the polymerase chain reaction because of

7. Leone 7
the usage of Taq thermostable polymerase.
Taq polymerase requires the presence of
magnesium to act as a cofactor during the
reaction process it uses to synthesize new
DNA. The magnesium is not actually
consumed in the reaction, but the reaction
cannot proceed without the presence of the
magnesium.3,5 As the MgCl2 concentration
reached 5.0mM, no prominent product was
observed. This is due to the high
concentration of MgCl2 (5.0mM) in the
reaction, which lowers the specificity and
integrity of product observed. There does not
seem to be any undesired product in lane 7,
which suggests that there was likely not a
high enough concentration of magnesium to
promote incorrect annealing, only enough to
cause misincorporation and increase the error
rate of the polymerase. Thus, the second
conclusion that can be drawn from the
electrophoresis is the optimal concentration
of MgCl2 for Taq polymerase was
determined. Analysis of the electrophoretic
PCR gel shows the clearest ~500 bp band
contained in the PCR reaction with 1.0mM of
MgCl2. Thus, it can be determined that for
every 0.5 µl of 2.5U Taq polymerase in
solution, the optimal amount of MgCl2 to be
added is 10 µl of 1.0 mM concentration.
PCR products require extraction from
the agarose gel and purification since
detection of the product is not the primary
objective of the procedure3,5. The primary
objective of the procedure was cloning,
expression of the PCR product into
Escherichia coli to determine ligation
efficiency, and midiprep preparation to allow
for sequencing of human ApoB to further
research its function in the human body. In
the case of this gel extraction, DNA being
purified is separated from residual primers,
dNTPs, and primer dimers that are present in
the gel during electrophoresis. The product
extracted was that from the PCR reaction
containing 10 µl of 1.0 mM MgCl2, (Figure
1) due to its MgCl2 concentration being at an
optimal level.
Restriction digests are a necessary
step in cloning DNA products into bacterial
vectors. In this procedure, the PCR product
with 1.0mM MgCl2 was purified was treated
with 2 restriction enzymes, KpnI and XbaI,
which cut at palindromic sequences and
produce “sticky ends” that are useful for
ligation and annealing during the process of
getting the PCR product into the vector. The
vector used in this case was plasmid vector
pGEM3zf, and the restriction enzymes were
used to digest the DNA and the plasmid
vector. KpnI cuts at GGTAC|C and XbaI cuts
at T|CTAGA; each of these enzymes left the
same sticky ends in both the plasmid vector
and the PCR product, which allowed for
ligation later in the procedure.
Restriction digest success was shown
by analyzing another gel plate, one with two
bands for both the plasmid and PCR product
samples (Figure 2). It is very important that
there is digestion of both the plasmid vector
and the PCR product, so that ligation can
occur at the desired sequences. The positive
control lanes for both the vector and DNA,
contained in lanes D and E, respectively, are
a method of measuring the maintenance of
the PCR produced DNA. The indecipherable
bands present in Figure 2 are a result of small
products produced by digestion of the
plasmid DNA and PCR DNA with KpnI and
XbaI. The reason these appear in the
digestion is because restriction enzymes cut
at specific base sequences, which can appear
in multiple places on the DNA being
digested. The DNA multiplied with the PCR
was approximately 500 bp in length, and the
products after digestion were estimated to be
450 bp and 30-50bp. The 30-50 bp fragments
were the minor product, and thus are the
obscured bands in the electrophoresis gel.
Treatment with calf intestine alkaline
phosphatase removes the 5’ phosphate
groups present on digested DNA, which are

8. Leone 8
necessary for ligation. This treatment
prevents re-ligation of undesired products
and maximizes the chance for successful
integration of a PCR product into a cloning
vector.
Extraction of the digested products is
necessary to get the products purified in the
previous procedures into the E.coli cells. The
amount of membrane binding solution added
was dependent on the size of the gel
fragments that were being used in the
extraction. The PCR fragment used was
treated with binding solution and heated to
melt the gel fragment, and the same
procedure was applied to the vector. This step
was followed by introduction of the samples
to T4 DNA ligase, the primary purpose of
which is to seal the DNA sticky ends created
with KpnI and XbaI. This procedure creates
an intact plasmid that can be used for
transformation into competent E. coli
cultures to examine ligation efficacy. The
logic behind the transformation efficiency is
based on plating the cultures on ampicillin
containing media. For this reason, the
negative control plate (without
contamination) should show no growth, as
the insert contains an ampicillin resistance
gene that encodes for the formation of beta-
lactamase, the enzyme required to inactivate
penicillin based antibiotics. The negative
control plate showed minimal growth, which
shows low contamination. The vector +
ligase plate and vector – ligase plates both
showed no growth, which was to be expected.
The positive control plate was designed to
show only colonies that could not create blue
product from cleavage of X-Gal. From the
blue/white assay, results of the
transformation (Figure 3) were analyzed and
the calculated transformation efficiency was
2.4 x 107 colony forming units/µg2. This is a
low transformation efficiency, but it is still
within an acceptable range and indicates
mildly successful ligation of the PCRproduct
into the vector.
To further examine the effectiveness
of the ligation, another restriction digest
analysis was performed (Figure 4). The
digest was performed this time with EcoRI,
which has a known cut site in both pGEM3zf
and the PCR product ligated into it. Thus,
because it cuts the circular plasmid twice,
there was expected to be two bands in the
restriction digestion gel. There are two bands
of approximately 2,700 bp and 500 bp
present in the gel that correspond to the
vector and the PCR product, which indicates
that there was successful ligation of the PCR
product into the vector. The other small
bands seen are simply byproducts of the
reaction and did not interfere with the results.
There was one lane that did not show a
second band, which indicates that the ligation
was not perfect, and therefore not every
plasmid vector had a PCR product in it.
Following the EcoRI digestion, a
mid-scale plasmid preparation was
performed so that the sequence of the PCR
product containing human ApoB could be
obtained and analyzed. The sequence came
back with minimal “N” results, indicative of
a very sound sequence with little ambiguity.
After running the sequence through a
BLASTP and TBLASTN search6,7,8, there
was significant evidence (Figure 6) to
suggest evolutionary relationships between
the 8 closest matches. The tree suggests that
there is a common ApoB ancestor, and that
further studies on the structure and function
of ApoB performed in mammals (not
necessarily humans) may be helpful in
elucidating the exact function of the protein.
Acknowledgements – We wish to thank Harold Smith, Ph. D. of the University of Rochester for
guidance through this undertaking in the sequencing of ApoB. We also thank Dr. Michael
Bulger, Dr. Peter Gibbs, and Dr. Yi-Tao Yu for their contributions to the project and their

9. Leone 9
suggestions and input on experimental procedures and theory. Finally, I would like to extend my
thanks to Daniel Schreiner, without whom this work would have not been completed. This work
is supported by the University of Rochester School of Medicine and Dentistry, Rochester, NY
14627.
REFERENCES
1. Gibbs, P. (2015) Restriction
Endonuclease Mapping. Techniques
in Biochemistry and Molecular
Biology. 57-60. Mid-Scale Plasmid
Preparation. Techniques in
Biochemistry and Molecular
Biology. 62-63. Sequence Analysis.
Techniques in Biochemistry and
Molecular Biology. 71-72.
University of Rochester School of
Medicine and Dentistry, Rochester,
NY 14627.
2. Cheng, Max A. (2015)
Transformation Efficiency of
pGEM3zf in E. coli. Eastman School
of Music, Rochester, NY 14627.
3. Bulger, M., Ph.D., Yu, Y., Ph.D.
(2015) An Introduction to DNA
Manipulation and Analysis.
Techniques in Biochemistry and
Molecular Biology. 19-41.
University of Rochester School of
Medicine and Dentistry, Rochester,
NY 14627.
4. Schreiner, D. (2015) Sequence
Alignment and Phylogeny
Generation of Human ApoB.
University of Rochester School of
Medicine and Dentistry, Rochester,
NY 14627.
5. Smith, Harold, Ph. D. (2015)
Techniques in Biochemistry and
Molecular Biology. 19-73.
University of Rochester School of
Medicine and Dentistry, Rochester,
NY 14627.
6. Altschul, S.F., Gish, W., Miller, W.,
Myers, E.W. & Lipman, D.J. (1990)
"Basic local alignment search tool."
J. Mol. Biol. 215:403-410.
7. Madden, T.L., Tatusov, R.L. &
Zhang, J. (1996) "Applications of
network BLAST server" Meth.
Enzymol. 266:131-141.
8. Schaffer AA, Aravind L, Madden
TL, Shavirin S, Spouge JL, Wolf YI,
Koonin EV, Altschul SF. (2001)
"Improving the accuracy of PSI-
BLAST protein database searches
with composition-based statistics and
other refinements." Nucleic Acids
Res. 2001 Jul 15;29(14):2994-3005
9. Lim JS, Lee DH, Park JY, Jin SH,
Jacobs DR (2011). "Reliability of
low-density lipoprotein cholesterol,
non-high-density lipoprotein
cholesterol, and apolipoprotein B
measurement". Journal of Clinical
Lipidology 5 (4): 264–272.
10. McQueen MJ, Hawken S, Wang X,
Ounpuu S, Sniderman A, Probstfield
J et al. (July 2008). "Lipids,
lipoproteins, and apolipoproteins as
risk markers of myocardial infarction
in 52 countries (the INTERHEART
study): a case-control
study". Lancet 372 (9634): 224–33.

10. Leone 10
FIGURE LEGENDS
FIG. 1a. PCR results on a 1.0% agarose
electrophoretic plate. Lanes 1-6 contain (in
addition to the PCR reactions containing 20
µl of 5X Taq polymerase buffer, 1 µl of 25
mM dNTP oligonucleotide mix, 1 µl of 0.5
µM primer 1, 1 µl of 0.5 µM primer 2, 56.5
µl of deionized water, 10 µl of 0.01ng
template DNA, and 0.5 µl of 2.5U Taq
polymerase)10 µl each of 0-2.5 mM MgCl2
to test for optimal concentration of
magnesium cation in Taq polymerase
activity. Lane 7 contains 10µl of 5.0mM
MgCl2 in addition to the PCR reaction mix
to observe the effects of excessive cation
activity during Taq polymerization. Lane 3
shows clear, concise band in comparison to
the others and thus was determined to have
optimal MgCl2 concentration. PCR product
size was estimated at approx. 500 bp.
FIG. 1b. DNA standard size ladder used to
approximate sizes of bands in FIG. 1a, FIG.
2, and FIG. 4.
FIG. 2a. Restriction digest results from
KpnI and XbaI digestion with positive vector
and PCR product control groups in lanes C
and D, respectively. Lanes A1 and A2
contained 3 µl of 3 µg plasmid vector
pGEM3zf, 5 µl 10X reaction buffer, 2.5 µl
each of enzymes KpnI and XbaI, and 37 µl
of H2O. Lanes B1 and B2 contained 25 µl of
PCR product, 5 µl of 10X reaction buffer,
2.5 µl of each of the same enzymes, and 15
µl of H2O. Lanes A1 and A2 show digested
pGEM3zf plasmid vector and lanes B1 and
B2 show digested PCR product. Lane E
contains the DNA size ladder used to
estimate sizes. From this electrophoresis and
using the DNA size standard from FIG. 1b,
the size of the plasmid was estimated at
~2,700 bp and the size of the digested PCR
product was again estimated at ~500 bp. The
small, faint bands present in lanes A1, A2,
B1, and B2 are undesired byproducts, likely
formed by self-dimerization and specificity
inconsistency by Taq polymerase. These
small bands did not affect the outcomes or
conclusiveness of the experimental
procedure, and may have been caused by
excess enzyme in solution.
FIG. 2b. Lane identities for FIG. 2a.
FIG. 3. Transformation efficiency assay and
accompanying equation used to calculate
effectiveness of ligation of PCR product into
pGEM3zf vector. Transformation results
show slight contamination in the form of
negative control plate having colonies, as
well as the positive control plate having blue
colonies. A negative control plate contains
no insert, and therefore should contain no
ampicillin resistant E. coli. The plate
showed colonies, which indicated that there
may have been contamination present in the
sample or that the ampicillin agar plates
were incorrectly made. Blue colonies on the
positive control plate are a good sign,
however, the presence of white colonies
indicates that there may also have been
contamination on the plates as a whole. The
vector + insert plates all showed white
colonies, which indicates successful
transformation of the competent E. coli cells
and meant that the insert had been
successfully ligated. Equation 1 was used to
calculate the transformation efficiency in the
units of colony forming units/µg of DNA.
FIG. 4. Restriction digest electrophoretic
gel showing digestion of ¾ of the restriction
mapping reactions. In each lane was placed
a sample from a reaction of 5 µl DNA, 1 µl
10X buffer, 1 µl EcoRI, and 3 µl H2O. The
gel shows that ¾ of the sample ligations
were successful, as a cut site in the vector
and in the insert was identified. The bands in
lanes 2,3, and 5 are of sizes approx. 2700
bp and 500 bp, consistent with earlier
results. The ladder placed in lane 1 was used
to estimate the sizes of the bands.
FIG. 5. Sequence of PCR product
containing human ApoB gene. The PCR
product was sequenced by creating mid-

11. Leone 11
scale plasmids that were sent out to an
analytical lab for sequencing procedures.
This was done because the University of
Rochester does not possess the required
equipment for such sequencing. Note the
lack of ambiguous “N” residues, as the
sequence obtained was very precise.
FIG. 6. Phylogenetic tree compiled after the
sequence of the PCR product was obtained.
Using the RSCB protein database and the
NCBI database, different sequences for
ApoB from species other than H. sapiens
were compared and a basic phylogenetic tree
was assembled. The sequence was translated
to amino acid composition and used in a
BLASTP search to observe conservation
among members of different species. The
species used are the best matches from each
major family of highly developed organisms
to identify possible divergences in
evolutionary development of ApoB.

12. Leone 12
Figure 1 – a) PCR Gel Analysis b) DNA Ladder for Size Analysis
a) b)
Figure 2 – a) Restriction Digest Results with KpnI and XbaI b) Lane Identities

13. Leone 13
Figure 3 – Transformation Efficiency Using Blue/White Assay
Figure 4 – Restriction Digest of Ligation Products with EcoRI

14. Leone 14
Figure 5 – Sequence of PCR Product
Figure 6 – Phylogenetic Analysis of Human ApoB